Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
RERE	473	broad.mit.edu	37	1	8418644	8418644	+	Silent	SNP	C	A	A	rs11121172	byFrequency	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8418644C>A	uc001ape.2	-	21	4761	c.3951G>T	c.(3949-3951)CGG>CGT	p.R1317R	RERE_uc001apf.2_Silent_p.R1317R|RERE_uc001apd.2_Silent_p.R763R	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	1317	Arg/Glu-rich (mixed charge).				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CCCGCAGCTCCCGCTCTCGGA	0.682													3	39	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22200485	22200485	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22200485G>C	uc001bfj.2	-	29	3716	c.3676C>G	c.(3676-3678)CTG>GTG	p.L1226V	HSPG2_uc009vqd.2_Missense_Mutation_p.L1227V	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	1226	Laminin EGF-like 7.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TCTGTGTCCAGAAAACAAGTG	0.637													3	16	---	---	---	---	PASS
LUZP1	7798	broad.mit.edu	37	1	23419764	23419764	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23419764T>G	uc001bgk.2	-	4	1375	c.991A>C	c.(991-993)AAT>CAT	p.N331H	LUZP1_uc010odv.1_Missense_Mutation_p.N331H|LUZP1_uc001bgl.2_Missense_Mutation_p.N331H|LUZP1_uc001bgm.1_Missense_Mutation_p.N331H	NM_033631	NP_361013	Q86V48	LUZP1_HUMAN	leucine zipper protein 1	331	Potential.					nucleus					0		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TTGTTTTTATTTTGTTCACTT	0.343													38	259	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34190152	34190152	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34190152T>C	uc001bxn.1	-	18	2758	c.2729A>G	c.(2728-2730)AAC>AGC	p.N910S	CSMD2_uc001bxm.1_Missense_Mutation_p.N950S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	910	Sushi 5.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCACTGGAAGTTGGGCTCACA	0.597													3	71	---	---	---	---	PASS
ZMYM6	9204	broad.mit.edu	37	1	35480744	35480744	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35480744C>G	uc001byh.2	-	5	676	c.448G>C	c.(448-450)GAT>CAT	p.D150H	ZMYM6_uc001byf.1_Missense_Mutation_p.D150H|ZMYM6_uc010oht.1_Missense_Mutation_p.D53H|ZMYM6_uc009vup.2_5'UTR|ZMYM6_uc009vuq.1_Missense_Mutation_p.D150H|ZMYM6_uc009vur.1_5'UTR	NM_007167	NP_009098	O95789	ZMYM6_HUMAN	zinc finger protein 258	150	MYM-type 1.				multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				GTGATCACATCCTTAGGATTT	0.338													3	73	---	---	---	---	PASS
CC2D1B	200014	broad.mit.edu	37	1	52825395	52825395	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52825395C>A	uc001ctq.1	-	8	1062	c.924G>T	c.(922-924)GAG>GAT	p.E308D	CC2D1B_uc001ctr.2_5'Flank|CC2D1B_uc001cts.2_5'UTR	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	308										ovary(2)	2						TCCTCATGAGCTCTCGGGCAC	0.423													4	14	---	---	---	---	PASS
TYW3	127253	broad.mit.edu	37	1	75204423	75204423	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75204423C>T	uc001dgn.2	+	3	394	c.305C>T	c.(304-306)CCA>CTA	p.P102L	TYW3_uc010oqw.1_Intron|TYW3_uc010oqx.1_Intron|TYW3_uc010oqy.1_RNA	NM_138467	NP_612476	Q6IPR3	TYW3_HUMAN	tRNA-yW synthesizing protein 3 homolog isoform	102					tRNA processing		methyltransferase activity	p.P102R(1)		ovary(2)	2						AAATTTGAACCATTTGTTCTT	0.363													29	75	---	---	---	---	PASS
EPHX4	253152	broad.mit.edu	37	1	92511107	92511107	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92511107T>C	uc001don.2	+	4	598	c.494T>C	c.(493-495)CTT>CCT	p.L165P		NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7	165						integral to membrane	hydrolase activity			central_nervous_system(1)	1						AAATGTGTTCTTATTGGCCAT	0.373													24	276	---	---	---	---	PASS
BCAR3	8412	broad.mit.edu	37	1	94027879	94027879	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94027879C>G	uc001dpz.2	-	12	2672	c.2397G>C	c.(2395-2397)GAG>GAC	p.E799D	BCAR3_uc001dqa.2_Missense_Mutation_p.E799D|BCAR3_uc001dqb.2_Missense_Mutation_p.E799D|BCAR3_uc001dpx.3_Missense_Mutation_p.E475D|BCAR3_uc001dpy.2_Missense_Mutation_p.E708D	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	799	Ras-GEF.				response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		TCTCATATCTCTCTGTCTGAT	0.418													63	207	---	---	---	---	PASS
LPPR4	9890	broad.mit.edu	37	1	99772302	99772302	+	Silent	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99772302G>C	uc001dse.2	+	7	2134	c.2028G>C	c.(2026-2028)CTG>CTC	p.L676L	LPPR4_uc010oue.1_Silent_p.L618L	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN	plasticity related gene 1	676							phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GTGAGTCTCTGAAAGACAGCT	0.522													13	41	---	---	---	---	PASS
PHTF1	10745	broad.mit.edu	37	1	114254741	114254741	+	Intron	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114254741A>G	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc001edm.2_Intron|PHTF1_uc001edo.1_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCTCCTACAAAGAGAACAGC	0.408													33	79	---	---	---	---	PASS
WDR3	10885	broad.mit.edu	37	1	118491082	118491082	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118491082G>T	uc010oxe.1	+	13	1543	c.1477G>T	c.(1477-1479)GAT>TAT	p.D493Y	WDR3_uc001ehi.2_Intron	NM_006784	NP_006775	Q9UNX4	WDR3_HUMAN	WD repeat-containing protein 3	493	WD 8.					nuclear membrane|nucleolus				upper_aerodigestive_tract(1)	1	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		GGAGACAATAGATGCACATGA	0.478													12	89	---	---	---	---	PASS
TRIM46	80128	broad.mit.edu	37	1	155148067	155148067	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155148067G>A	uc001fhs.1	+	2	352	c.269G>A	c.(268-270)CGC>CAC	p.R90H	RAG1AP1_uc010pey.1_Intron|KRTCAP2_uc001fho.2_5'Flank|KRTCAP2_uc001fhp.1_5'Flank|TRIM46_uc009wpe.1_RNA|TRIM46_uc010pez.1_Missense_Mutation_p.R77H|TRIM46_uc001fhq.2_RNA|TRIM46_uc001fhr.2_Missense_Mutation_p.R90H|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Intron|TRIM46_uc001fhu.1_Missense_Mutation_p.R67H|TRIM46_uc009wpg.1_Missense_Mutation_p.R77H|TRIM46_uc009wpf.2_Missense_Mutation_p.R77H|TRIM46_uc001fhv.3_Missense_Mutation_p.R77H|TRIM46_uc001fhw.1_RNA	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46	90						intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGCAGCCCCCGCCTCTCCCGC	0.672													13	54	---	---	---	---	PASS
CADM3	57863	broad.mit.edu	37	1	159163779	159163779	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159163779G>C	uc001ftl.2	+	5	782	c.640G>C	c.(640-642)GAA>CAA	p.E214Q	CADM3_uc009wsy.1_Intron|CADM3_uc001ftk.2_Missense_Mutation_p.E248Q	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	214	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)					TGTGAACCATGAATCTCTAAA	0.498													20	69	---	---	---	---	PASS
DARS2	55157	broad.mit.edu	37	1	173802512	173802512	+	Splice_Site	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173802512A>G	uc001gjh.1	+	6	903	c.493_splice	c.e6-2	p.K165_splice		NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	CAATTTCTTTAGAAAACAGAG	0.313													6	18	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175046622	175046622	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046622C>T	uc001gkl.1	+	2	181	c.68C>T	c.(67-69)TCG>TTG	p.S23L	TNN_uc010pmx.1_Missense_Mutation_p.S23L	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	23					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CTGGTGGCTTCGGCCCCAGCC	0.592													15	62	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186072603	186072603	+	Splice_Site	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186072603G>A	uc001grq.1	+	69	10803	c.10574_splice	c.e69-1	p.E3525_splice		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CCTTTAAATAGAACCACCTCA	0.338													37	113	---	---	---	---	PASS
EXOC8	149371	broad.mit.edu	37	1	231473325	231473325	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231473325G>C	uc001huq.2	-	1	254	c.167C>G	c.(166-168)GCG>GGG	p.A56G	C1orf124_uc001hur.2_5'Flank|C1orf124_uc001hus.2_5'Flank|C1orf124_uc001hut.2_5'Flank	NM_175876	NP_787072	Q8IYI6	EXOC8_HUMAN	exocyst complex 84-kDa subunit	56					exocytosis|protein transport	growth cone|nucleus	protein binding			skin(1)	1	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				CAGGTTCTGCGCCGTCTCCTC	0.642													3	81	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237494252	237494252	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237494252G>T	uc001hyl.1	+	3	363	c.243G>T	c.(241-243)ATG>ATT	p.M81I		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	81	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCAGGAGATGCTGGCTAACA	0.488													29	78	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237819249	237819249	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237819249A>G	uc001hyl.1	+	53	8214	c.8094A>G	c.(8092-8094)GAA>GAG	p.E2698E		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2698	Modulator (Potential).|Cytoplasmic (By similarity).|3.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGATTCTGAAGGGAACTTTA	0.403													18	45	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248487030	248487030	+	Missense_Mutation	SNP	C	T	T	rs143090101	byFrequency	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487030C>T	uc010pzk.1	-	1	841	c.841G>A	c.(841-843)GTC>ATC	p.V281I		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	281	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGGGAGTGACGATGGTGTAG	0.453													42	103	---	---	---	---	PASS
RNF144A	9781	broad.mit.edu	37	2	7154628	7154628	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7154628A>T	uc002qys.2	+	4	621	c.179A>T	c.(178-180)GAA>GTA	p.E60V	RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144	60	RING-type 1; atypical.					Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		GAAGGATTAGAAACTGCAATT	0.443													54	131	---	---	---	---	PASS
NTSR2	23620	broad.mit.edu	37	2	11802132	11802132	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11802132G>A	uc002rbq.3	-	2	933	c.859C>T	c.(859-861)CGC>TGC	p.R287C		NM_012344	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	287	Cytoplasmic (Potential).				sensory perception	integral to plasma membrane					0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	CGGATCCGGCGCACGTCTTTA	0.493													68	160	---	---	---	---	PASS
NCOA1	8648	broad.mit.edu	37	2	24929797	24929797	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24929797C>T	uc002rfk.2	+	11	1716	c.1458C>T	c.(1456-1458)TTC>TTT	p.F486F	NCOA1_uc010eye.2_Silent_p.F486F|NCOA1_uc002rfi.2_Silent_p.F335F|NCOA1_uc002rfj.2_Silent_p.F486F|NCOA1_uc002rfl.2_Silent_p.F486F	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	486	Interaction with STAT3.|Ser-rich.								PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAGCACAGTTCATGTCTCCAA	0.448			T	PAX3	alveolar rhadomyosarcoma								46	118	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50765611	50765611	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50765611C>A	uc010fbq.2	-	10	3520	c.2043G>T	c.(2041-2043)GTG>GTT	p.V681V	NRXN1_uc002rxb.3_Silent_p.V313V|NRXN1_uc002rxe.3_Silent_p.V641V|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGATGCAGCCCACGTAGCCAT	0.522													36	171	---	---	---	---	PASS
ASB3	51130	broad.mit.edu	37	2	54041673	54041673	+	Intron	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54041673G>C	uc002rxi.3	-						ERLEC1_uc002rxl.2_Intron|ERLEC1_uc002rxm.2_Intron|ERLEC1_uc002rxn.2_Intron	NM_001164165	NP_001157637	Q9Y575	ASB3_HUMAN	hypothetical protein LOC100302652						intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTGTTTCTCTGATTCAGGATG	0.333													12	43	---	---	---	---	PASS
MEIS1	4211	broad.mit.edu	37	2	66668595	66668595	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66668595A>C	uc002sdu.2	+	5	939	c.482A>C	c.(481-483)AAG>ACG	p.K161T	MEIS1_uc002sdt.2_Missense_Mutation_p.K161T|MEIS1_uc002sdv.2_Missense_Mutation_p.K159T|MEIS1_uc010yqh.1_RNA|MEIS1_uc010yqi.1_Missense_Mutation_p.K96T|MEIS1_uc002sdw.1_Missense_Mutation_p.K17T	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1	161							sequence-specific DNA binding transcription factor activity				0						GAATTAGAGAAGGTAATTTCT	0.413													4	9	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	79971593	79971593	+	Silent	SNP	T	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79971593T>G	uc010ysh.1	+	2	188	c.183T>G	c.(181-183)GCT>GCG	p.A61A	CTNNA2_uc010yse.1_Silent_p.A61A|CTNNA2_uc010ysf.1_Silent_p.A61A|CTNNA2_uc010ysg.1_Silent_p.A61A	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	61					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ATGTACTAGCTGCCTCTGTAG	0.443													17	39	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80782969	80782969	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80782969G>A	uc010ysh.1	+	11	1697	c.1692G>A	c.(1690-1692)GGG>GGA	p.G564G	CTNNA2_uc010yse.1_Silent_p.G564G|CTNNA2_uc010ysf.1_Silent_p.G564G|CTNNA2_uc010ysg.1_Silent_p.G564G|CTNNA2_uc010ysi.1_Silent_p.G196G	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	564					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ATGAAGCTGGGGTTTATACTG	0.488													12	218	---	---	---	---	PASS
TGFBRAP1	9392	broad.mit.edu	37	2	105889313	105889313	+	Silent	SNP	G	A	A	rs61738978		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105889313G>A	uc002tcq.2	-	10	2055	c.1971C>T	c.(1969-1971)CTC>CTT	p.L657L	TGFBRAP1_uc010fjc.2_Silent_p.L426L|TGFBRAP1_uc002tcr.3_Silent_p.L657L	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	657					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						CATCCTCACCGAGAAGAAAGT	0.552													20	47	---	---	---	---	PASS
TFCP2L1	29842	broad.mit.edu	37	2	122007221	122007221	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122007221G>C	uc002tmx.2	-	3	310	c.217C>G	c.(217-219)CAG>GAG	p.Q73E	TFCP2L1_uc010flr.2_Missense_Mutation_p.Q73E	NM_014553	NP_055368	Q9NZI6	TF2L1_HUMAN	LBP-9	73					female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)					TCATAAGACTGACCTGGATGG	0.443													21	132	---	---	---	---	PASS
RAB3GAP1	22930	broad.mit.edu	37	2	135920135	135920135	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135920135A>T	uc002tuj.2	+	20	2325	c.2300A>T	c.(2299-2301)TAT>TTT	p.Y767F	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.Y767F|RAB3GAP1_uc010fng.2_Missense_Mutation_p.Y592F|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	767						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		GTGCTGCACTATCTGGCAATC	0.483													6	72	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152427027	152427027	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152427027C>A	uc010fnx.2	-	80	12190	c.11999G>T	c.(11998-12000)AGG>ATG	p.R4000M	NEB_uc002txr.2_Missense_Mutation_p.R423M	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	4000	Nebulin 109.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGCAATCTCCCTGGAGGCCTT	0.522													4	15	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159537068	159537068	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159537068C>G	uc002tzv.2	+	22	3718	c.3458C>G	c.(3457-3459)TCT>TGT	p.S1153C	PKP4_uc002tzw.2_Missense_Mutation_p.S1110C|PKP4_uc002tzx.2_Missense_Mutation_p.S810C|PKP4_uc002uaa.2_Missense_Mutation_p.S962C|uc002uab.1_Intron|PKP4_uc002uac.2_Missense_Mutation_p.S334C|PKP4_uc002uad.2_RNA	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	1153					cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						TTTCCAGCTTCTACTGATTAC	0.393										HNSCC(62;0.18)			26	272	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165984340	165984340	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165984340C>G	uc002ucx.2	-	18	3686	c.3194G>C	c.(3193-3195)AGA>ACA	p.R1065T	SCN3A_uc002ucy.2_Missense_Mutation_p.R1016T|SCN3A_uc002ucz.2_Missense_Mutation_p.R1016T|SCN3A_uc002uda.1_Missense_Mutation_p.R885T|SCN3A_uc002udb.1_Missense_Mutation_p.R885T	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1065						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	ATTCCCATCTCTAAGATAATT	0.363													19	181	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170103423	170103423	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170103423G>A	uc002ues.2	-	21	3195	c.2982C>T	c.(2980-2982)TTC>TTT	p.F994F	LRP2_uc010zdf.1_Silent_p.F857F	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	994	EGF-like 4.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACACTCGCTGGAAATTTGGCA	0.557													26	67	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179411914	179411914	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179411914C>G	uc010zfg.1	-	289	86858	c.86634G>C	c.(86632-86634)GAG>GAC	p.E28878D	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E22573D|TTN_uc010zfi.1_Missense_Mutation_p.E22506D|TTN_uc010zfj.1_Missense_Mutation_p.E22381D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29805							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTCTTTCTTCTCAACCCAGT	0.433													96	228	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179449653	179449653	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179449653A>G	uc010zfg.1	-	259	57235	c.57011T>C	c.(57010-57012)ATA>ACA	p.I19004T	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I12699T|TTN_uc010zfi.1_Missense_Mutation_p.I12632T|TTN_uc010zfj.1_Missense_Mutation_p.I12507T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19931							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCAGCGTCTATATCAGAAAT	0.458													47	145	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179497054	179497054	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179497054C>T	uc010zfg.1	-	185	36087	c.35863G>A	c.(35863-35865)GAT>AAT	p.D11955N	TTN_uc010zfh.1_Missense_Mutation_p.D5650N|TTN_uc010zfi.1_Missense_Mutation_p.D5583N|TTN_uc010zfj.1_Missense_Mutation_p.D5458N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12882							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGATGTTATCATGAGATAAC	0.428													8	27	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179588880	179588880	+	Intron	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179588880G>A	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGTGTGAGGAAAGGTAAGA	0.418													13	40	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179605601	179605601	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179605601T>C	uc010zfh.1	-	46	12070	c.11846A>G	c.(11845-11847)CAA>CGA	p.Q3949R	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.Q3882R|TTN_uc010zfj.1_Missense_Mutation_p.Q3757R|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGCTTGTCTTGCTCCAAAAT	0.448													76	192	---	---	---	---	PASS
SLC39A10	57181	broad.mit.edu	37	2	196548476	196548476	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196548476C>T	uc002utg.3	+	3	1276	c.1062C>T	c.(1060-1062)CCC>CCT	p.P354P	SLC39A10_uc002uth.3_Silent_p.P354P|SLC39A10_uc010zgp.1_5'UTR	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),	354					zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			CCAACTCTCCCATCTCAACTG	0.338													45	186	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210893702	210893702	+	Intron	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210893702C>T	uc002vds.2	-						C2orf67_uc002vdt.2_Intron	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		TTCTGCAAAACAGGATTACAG	0.363													27	93	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211515145	211515145	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211515145G>T	uc002vee.3	+	28	3595	c.3463G>T	c.(3463-3465)GCG>TCG	p.A1155S	CPS1_uc010fur.2_Missense_Mutation_p.A1161S|CPS1_uc010fus.2_Missense_Mutation_p.A704S	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	1155	ATP-grasp 2.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CCTAGAAGAGGCGACTAGAGT	0.368													11	145	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211542608	211542608	+	Intron	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211542608C>G	uc002vee.3	+						CPS1_uc010fur.2_Intron|CPS1_uc010fus.2_Intron	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b						carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		ATTATATTTTCAGGTGACCAA	0.418													121	411	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211542649	211542649	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211542649C>T	uc002vee.3	+	38	4575	c.4443C>T	c.(4441-4443)CGC>CGT	p.R1481R	CPS1_uc010fur.2_Silent_p.R1487R|CPS1_uc010fus.2_Silent_p.R1030R	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	1481					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		AGAAATCTCGCAAGGTGGACT	0.428													133	406	---	---	---	---	PASS
ACCN4	55515	broad.mit.edu	37	2	220401788	220401788	+	Silent	SNP	G	A	A	rs142124538	byFrequency	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220401788G>A	uc002vma.2	+	6	1568	c.1554G>A	c.(1552-1554)CGG>CGA	p.R518R	ACCN4_uc002vlz.2_Silent_p.R537R|ACCN4_uc002vmb.2_Silent_p.R191R	NM_182847	NP_878267	Q96FT7	ACCN4_HUMAN	amiloride-sensitive cation channel 4 isoform 2	518	Extracellular (Potential).					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity			ovary(2)	2		Renal(207;0.0183)		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)		GTCTCCACAGGGAGAACTTCC	0.577													32	91	---	---	---	---	PASS
STK11IP	114790	broad.mit.edu	37	2	220471540	220471540	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220471540C>T	uc002vml.2	+	12	1170	c.1127C>T	c.(1126-1128)TCA>TTA	p.S376L	STK11IP_uc010zll.1_Missense_Mutation_p.S333L|STK11IP_uc002vmm.1_Missense_Mutation_p.S365L	NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN	LKB1 interacting protein	376					protein localization	cytoplasm	protein kinase binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCCTCTCCTCAGGGGGTGTT	0.627													24	44	---	---	---	---	PASS
ACSL3	2181	broad.mit.edu	37	2	223773836	223773836	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223773836G>C	uc002vni.2	+	4	797	c.346G>C	c.(346-348)GAA>CAA	p.E116Q	ACSL3_uc002vnj.2_Missense_Mutation_p.E116Q	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	116	Cytoplasmic (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TGAGGAAGATGAAGTACAACC	0.299			T	ETV1	prostate								28	70	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230678586	230678586	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230678586C>G	uc002vpw.1	-	12	1951	c.1842G>C	c.(1840-1842)CAG>CAC	p.Q614H	TRIP12_uc002vpx.1_Missense_Mutation_p.Q662H|TRIP12_uc002vpy.1_Missense_Mutation_p.Q317H|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Missense_Mutation_p.Q620H	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	614					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CATATTTTACCTGATGTGTTA	0.274													20	74	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242432343	242432343	+	Splice_Site	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242432343G>A	uc002wbi.1	+	25	2905	c.2788_splice	c.e25-1	p.N930_splice		NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TTTATTGACAGAACCAGCTTT	0.463													14	127	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1363395	1363395	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1363395T>C	uc003boz.2	+	8	1090	c.823T>C	c.(823-825)TAC>CAC	p.Y275H	CNTN6_uc011asj.1_Missense_Mutation_p.Y203H|CNTN6_uc003bpa.2_Missense_Mutation_p.Y275H	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	275	Ig-like C2-type 3.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GAAAGTCAAGTACAGCAAATC	0.453													84	137	---	---	---	---	PASS
FBXL2	25827	broad.mit.edu	37	3	33400471	33400471	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33400471C>G	uc003cfp.2	+	3	149	c.78C>G	c.(76-78)TTC>TTG	p.F26L	FBXL2_uc011axm.1_RNA|FBXL2_uc011axn.1_RNA|FBXL2_uc011axo.1_5'UTR|FBXL2_uc011axp.1_Intron|FBXL2_uc011axq.1_Intron|FBXL2_uc011axr.1_Intron|FBXL2_uc011axs.1_RNA	NM_012157	NP_036289	Q9UKC9	FBXL2_HUMAN	F-box and leucine-rich repeat protein 2	26	F-box.				interspecies interaction between organisms|proteolysis	cytoplasm|membrane	protein binding|ubiquitin-protein ligase activity			large_intestine(1)	1						TATTTTCCTTCTTGGATATAG	0.313													13	28	---	---	---	---	PASS
CX3CR1	1524	broad.mit.edu	37	3	39307160	39307160	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39307160C>A	uc003cjl.2	-	2	933	c.841G>T	c.(841-843)GTT>TTT	p.V281F		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	281	Helical; Name=7; (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		CTAAATGCAACCGTCTCAGTC	0.473													33	86	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47129614	47129614	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47129614C>A	uc003cqs.2	-	10	5319	c.5266G>T	c.(5266-5268)GAA>TAA	p.E1756*	SETD2_uc003cqv.2_Nonsense_Mutation_p.E1823*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1756					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGTATGAGTTCCAGACAGGTA	0.378			N|F|S|Mis		clear cell renal carcinoma								64	100	---	---	---	---	PASS
KLHL18	23276	broad.mit.edu	37	3	47382151	47382151	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47382151C>T	uc003crd.2	+	8	1337	c.1211C>T	c.(1210-1212)TCA>TTA	p.S404L	KLHL18_uc011bav.1_Missense_Mutation_p.S292L	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	404	Kelch 3.										0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GAGACCTACTCACCTGAGACG	0.483													6	144	---	---	---	---	PASS
SCAP	22937	broad.mit.edu	37	3	47455557	47455557	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47455557G>C	uc003crh.1	-	23	3882	c.3627C>G	c.(3625-3627)ATC>ATG	p.I1209M	SCAP_uc011baz.1_Missense_Mutation_p.I953M|SCAP_uc003crg.2_Missense_Mutation_p.I816M|uc003cri.2_5'Flank	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	1209	Interaction with SREBF2 (By similarity).|Cytoplasmic (By similarity).|WD 7.				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GGTTGTCTGAGATGACACCCA	0.547													30	51	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107492023	107492023	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107492023C>T	uc010hpr.2	+	11	1782	c.1455C>T	c.(1453-1455)AGC>AGT	p.S485S	BBX_uc003dwk.3_Silent_p.S485S|BBX_uc003dwl.3_Intron|BBX_uc010hps.1_Silent_p.S506S|BBX_uc003dwm.3_Silent_p.S485S|BBX_uc003dwo.3_5'Flank	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	485	Lys-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			ACATTGAGAGCGTCATATATA	0.453													13	162	---	---	---	---	PASS
CD200R1L	344807	broad.mit.edu	37	3	112546226	112546226	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112546226G>A	uc003dzi.1	-	3	644	c.418C>T	c.(418-420)CTC>TTC	p.L140F	CD200R1L_uc011bhw.1_Missense_Mutation_p.L119F|CD200R1L_uc010hqf.1_Missense_Mutation_p.L119F	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2	140	Extracellular (Potential).|Ig-like C2-type.					integral to membrane	receptor activity			ovary(1)	1						AACACTTGGAGGTGATATCCA	0.438													21	288	---	---	---	---	PASS
DIRC2	84925	broad.mit.edu	37	3	122525698	122525698	+	Intron	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122525698T>C	uc003efw.3	+						DIRC2_uc010hrl.2_Intron|DIRC2_uc010hrm.2_Intron	NM_032839	NP_116228	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2						transport	integral to membrane					0				GBM - Glioblastoma multiforme(114;0.0614)		CTTTGTTTCATTTTAGGTCTC	0.318													4	176	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122629801	122629801	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122629801G>A	uc003efz.1	-	22	3487	c.3183C>T	c.(3181-3183)CAC>CAT	p.H1061H	SEMA5B_uc011bju.1_Silent_p.H967H|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Silent_p.H1061H|SEMA5B_uc003efy.1_Silent_p.H39H	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	1061	Cytoplasmic (Potential).				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		GACGCTGGCAGTGCTGGCAAG	0.582													33	78	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130289871	130289871	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130289871G>T	uc010htl.2	+	6	2642	c.2611G>T	c.(2611-2613)GAG>TAG	p.E871*		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	871	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						CACAAAACTGGAGGTAATTTC	0.507													13	62	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133472451	133472451	+	Missense_Mutation	SNP	G	A	A	rs121918681		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133472451G>A	uc003epu.1	+	8	1957	c.229G>A	c.(229-231)GAT>AAT	p.D77N	TF_uc011bls.1_Missense_Mutation_p.D77N|TF_uc011blt.1_5'UTR|TF_uc003epw.1_Intron|TF_uc003epv.1_Missense_Mutation_p.D77N	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	77	Transferrin-like 1.		D -> N (in ATRAF).		cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	AAACGAAGCGGATGCTGTGAC	0.522													19	80	---	---	---	---	PASS
PPP2R3A	5523	broad.mit.edu	37	3	135759780	135759780	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135759780A>T	uc003eqv.1	+	4	2907	c.2342A>T	c.(2341-2343)CAG>CTG	p.Q781L	PPP2R3A_uc011blz.1_Missense_Mutation_p.Q45L|PPP2R3A_uc003eqw.1_Missense_Mutation_p.Q160L|PPP2R3A_uc011bma.1_RNA	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	781	EF-hand 1.				protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						GTGACAGCACAGTCATTCATT	0.478													13	44	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140123518	140123518	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140123518G>T	uc003etn.2	+	4	737	c.547G>T	c.(547-549)GCC>TCC	p.A183S	CLSTN2_uc003etm.2_Missense_Mutation_p.A183S	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	183	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GCAGGTGGAGGCCATTGACGA	0.522										HNSCC(16;0.037)			19	178	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140123519	140123519	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140123519C>T	uc003etn.2	+	4	738	c.548C>T	c.(547-549)GCC>GTC	p.A183V	CLSTN2_uc003etm.2_Missense_Mutation_p.A183V	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	183	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						CAGGTGGAGGCCATTGACGAG	0.517										HNSCC(16;0.037)			20	173	---	---	---	---	PASS
SR140	23350	broad.mit.edu	37	3	142735709	142735709	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142735709A>T	uc003evh.1	+	6	561	c.462A>T	c.(460-462)AGA>AGT	p.R154S	SR140_uc003evi.1_5'UTR|SR140_uc011bnj.1_Missense_Mutation_p.R154S|SR140_uc003evj.1_RNA|SR140_uc003evk.1_Missense_Mutation_p.R154S	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein	154					RNA processing	nucleus	nucleotide binding|RNA binding				0						ATGAAAAAAGAGGTAAAATCT	0.284													6	58	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148759977	148759977	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148759977C>A	uc003ewq.1	-	19	2391	c.2173G>T	c.(2173-2175)GCA>TCA	p.A725S	HLTF_uc003ewr.1_Missense_Mutation_p.A725S|HLTF_uc003ews.1_Missense_Mutation_p.A724S|HLTF_uc010hve.1_Missense_Mutation_p.A724S	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	725					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GAAGACACTGCATTTGTAAGA	0.368													39	119	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164905718	164905718	+	Silent	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164905718G>C	uc003fej.3	-	2	3345	c.2901C>G	c.(2899-2901)CTC>CTG	p.L967L	SLITRK3_uc003fek.2_Silent_p.L967L	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	967	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						CCAGGACTTCGAGGTAATCCG	0.388										HNSCC(40;0.11)			94	356	---	---	---	---	PASS
MFN1	55669	broad.mit.edu	37	3	179085308	179085308	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179085308C>A	uc003fjs.2	+	8	961	c.835C>A	c.(835-837)CGT>AGT	p.R279S	MFN1_uc010hxb.2_RNA|MFN1_uc003fjt.2_Missense_Mutation_p.R307S|MFN1_uc010hxc.2_Missense_Mutation_p.R132S	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	279	Cytoplasmic (Potential).				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			AGCACAGAATCGTATCTTCTT	0.413													24	79	---	---	---	---	PASS
DVL3	1857	broad.mit.edu	37	3	183887879	183887879	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183887879G>A	uc003fms.2	+	14	1724	c.1584G>A	c.(1582-1584)GGG>GGA	p.G528G	DVL3_uc011bqw.1_Silent_p.G511G|DVL3_uc003fmt.2_Silent_p.G199G|DVL3_uc003fmu.2_Silent_p.G360G	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3	528					canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CGCACCCGGGGGCCGCCCCTT	0.682													24	79	---	---	---	---	PASS
SENP2	59343	broad.mit.edu	37	3	185316794	185316794	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185316794A>G	uc003fpn.2	+	4	511	c.340A>G	c.(340-342)AAC>GAC	p.N114D	SENP2_uc011brv.1_Missense_Mutation_p.N104D|SENP2_uc011brw.1_Intron	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2	114					mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			TGGATCCTGGAACAACATGCT	0.368													40	150	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186450324	186450324	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186450324G>T	uc011bsa.1	+	7	1003	c.791G>T	c.(790-792)TGC>TTC	p.C264F	KNG1_uc003fqr.2_Missense_Mutation_p.C264F	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	264	Cystatin 3.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	ACCAAGATTTGCGTGGGCTGC	0.493													50	158	---	---	---	---	PASS
MAN2B2	23324	broad.mit.edu	37	4	6611581	6611581	+	Missense_Mutation	SNP	C	T	T	rs140604370	byFrequency	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6611581C>T	uc003gjf.1	+	13	2099	c.2063C>T	c.(2062-2064)CCG>CTG	p.P688L	MAN2B2_uc003gje.1_Missense_Mutation_p.P688L|MAN2B2_uc011bwf.1_Missense_Mutation_p.P637L	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	688					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						ACCCATGTGCCGCAGGGCCAT	0.602													12	61	---	---	---	---	PASS
RASL11B	65997	broad.mit.edu	37	4	53728716	53728716	+	Silent	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53728716C>G	uc003gzt.2	+	1	222	c.42C>G	c.(40-42)CCC>CCG	p.P14P		NM_023940	NP_076429	Q9BPW5	RSLBB_HUMAN	RAS-like family 11 member B	14					small GTPase mediated signal transduction	membrane	GTP binding|GTPase activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(32;0.0302)			CCGAGTACCCCGCGCCGGGCA	0.721													9	36	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90170193	90170193	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170193G>T	uc003hsm.1	-	2	1588	c.1069C>A	c.(1069-1071)CAG>AAG	p.Q357K		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	357										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		ACACGCAGCTGCTCTTGTTCA	0.592													53	57	---	---	---	---	PASS
QRFPR	84109	broad.mit.edu	37	4	122301659	122301659	+	Silent	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122301659G>C	uc010inj.1	-	1	523	c.144C>G	c.(142-144)CTC>CTG	p.L48L	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_Silent_p.L48L|QRFPR_uc010inl.1_Silent_p.L48L	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	48	Helical; Name=1; (Potential).					plasma membrane	neuropeptide Y receptor activity				0						CGGTGAGCACGAGGGCCAGCT	0.652													4	21	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126412763	126412763	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126412763A>G	uc003ifj.3	+	17	14786	c.14786A>G	c.(14785-14787)AAC>AGC	p.N4929S	FAT4_uc011cgp.1_Missense_Mutation_p.N3170S|FAT4_uc003ifi.1_Missense_Mutation_p.N2406S	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4929	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GGGACTTTCAACTGGGACAAC	0.532													21	46	---	---	---	---	PASS
SH3RF1	57630	broad.mit.edu	37	4	170038713	170038713	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170038713G>T	uc003isa.1	-	9	2073	c.1738C>A	c.(1738-1740)CAA>AAA	p.Q580K	SH3RF1_uc010irc.1_Missense_Mutation_p.Q280K	NM_020870	NP_065921	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	580						Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding			breast(2)|lung(1)	3		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		ACTGTCATTTGCCCCGTCATG	0.542													66	112	---	---	---	---	PASS
MORF4	10934	broad.mit.edu	37	4	174537102	174537102	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174537102A>T	uc011cke.1	-	1	693	c.693T>A	c.(691-693)CAT>CAA	p.H231Q		NM_006792	NP_006783			mortality factor 4												0		Prostate(90;0.00201)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0765)|all_hematologic(60;0.107)		all cancers(43;1.88e-18)|Epithelial(43;1.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CAGCTTTCCGATGGTACTCAG	0.398													58	56	---	---	---	---	PASS
SLC6A18	348932	broad.mit.edu	37	5	1242883	1242883	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1242883T>C	uc003jby.1	+	8	1159	c.1036T>C	c.(1036-1038)TAC>CAC	p.Y346H		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	346	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CAGGGACGACTACCCAGCCGT	0.602													35	186	---	---	---	---	PASS
NDUFS6	4726	broad.mit.edu	37	5	1816017	1816017	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1816017A>G	uc003jcy.2	+	4	385	c.362A>G	c.(361-363)CAG>CGG	p.Q121R		NM_004553	NP_004544	O75380	NDUS6_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 6,	121					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1					NADH(DB00157)	CAGTTCAGACAGCACCACCAC	0.517													23	234	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13845038	13845038	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13845038C>G	uc003jfd.2	-	32	5221	c.5179G>C	c.(5179-5181)GAG>CAG	p.E1727Q		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1727	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CCCAGAATCTCTAGAAGGGCA	0.448									Kartagener_syndrome				7	333	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16754955	16754955	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16754955G>C	uc003jft.3	-	19	2379	c.1911C>G	c.(1909-1911)ATC>ATG	p.I637M	MYO10_uc010itx.2_Missense_Mutation_p.I260M	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	637	Myosin head-like.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						TGTTTGGCTTGATACAGCGAA	0.428													10	47	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21752226	21752226	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21752226C>G	uc010iuc.2	-	12	2463	c.2005G>C	c.(2005-2007)GAT>CAT	p.D669H	CDH12_uc011cno.1_Missense_Mutation_p.D629H|CDH12_uc003jgk.2_Missense_Mutation_p.D669H|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	669	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						GCCTGGGTATCTTCCTCCCCA	0.468										HNSCC(59;0.17)			19	306	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24488152	24488152	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24488152C>A	uc003jgr.1	-	12	2319	c.1987G>T	c.(1987-1989)GGA>TGA	p.G663*	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	663	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		TCCTCCTCTCCACCACCCTCA	0.453										HNSCC(23;0.051)			51	242	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24535363	24535363	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24535363G>C	uc003jgr.1	-	5	1004	c.672C>G	c.(670-672)AAC>AAG	p.N224K	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	224	Cadherin 2.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		CTCTGTTCATGTTCGGTAAAG	0.408										HNSCC(23;0.051)			66	178	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33527326	33527326	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33527326C>A	uc003jia.1	-	24	4915	c.4752G>T	c.(4750-4752)AGG>AGT	p.R1584S	ADAMTS12_uc010iuq.1_Missense_Mutation_p.R1499S	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1584					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						GCAACCGTTGCCTTCTTTGCC	0.527										HNSCC(64;0.19)			62	523	---	---	---	---	PASS
PTGER4	5734	broad.mit.edu	37	5	40681532	40681532	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40681532C>A	uc003jlz.2	+	2	1029	c.437C>A	c.(436-438)TCC>TAC	p.S146Y		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	146	Helical; Name=4; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						GTCTATGCGTCCAACGTGCTC	0.582											OREG0016588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	285	---	---	---	---	PASS
FBXO4	26272	broad.mit.edu	37	5	41927307	41927307	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41927307A>G	uc003jmq.2	+	2	438	c.382A>G	c.(382-384)ATA>GTA	p.I128V	FBXO4_uc003jmp.2_Missense_Mutation_p.I128V|FBXO4_uc003jmr.2_Missense_Mutation_p.I128V	NM_012176	NP_036308	Q9UKT5	FBX4_HUMAN	F-box only protein 4 isoform 1	128					positive regulation of protein ubiquitination|protein polyubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|telomere maintenance|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	protein binding|protein homodimerization activity|ubiquitin-protein ligase activity			liver(1)	1		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				AAAAAAGCCTATATCTGAGGT	0.343													116	310	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70844517	70844517	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70844517A>G	uc003kbp.1	+	33	7016	c.6753A>G	c.(6751-6753)CCA>CCG	p.P2251P	BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2251					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AGTATACACCAACAAGTATTC	0.313													24	208	---	---	---	---	PASS
ARSB	411	broad.mit.edu	37	5	78181606	78181606	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78181606G>A	uc003kfq.2	-	5	2229	c.943C>T	c.(943-945)CGA>TGA	p.R315*	ARSB_uc003kfr.3_Nonsense_Mutation_p.R315*	NM_000046	NP_000037	P15848	ARSB_HUMAN	arylsulfatase B isoform 1 precursor	315			R -> Q (in MPS6; intermediate form).		lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		TTTCTTCCTCGAAGGGGCCAG	0.517													75	128	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176673711	176673711	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176673711C>T	uc003mfr.3	+	10	4549	c.4411C>T	c.(4411-4413)CGA>TGA	p.R1471*	NSD1_uc003mft.3_Nonsense_Mutation_p.R1202*|NSD1_uc003mfs.1_Nonsense_Mutation_p.R1368*|NSD1_uc011dfx.1_Nonsense_Mutation_p.R1119*	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1471					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GCCAAGGAAGCGAAAACGACA	0.413			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			5	67	---	---	---	---	PASS
ZNF354C	30832	broad.mit.edu	37	5	178489082	178489082	+	Silent	SNP	C	T	T	rs149113509		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178489082C>T	uc003mju.2	+	2	128	c.13C>T	c.(13-15)CTG>TTG	p.L5L		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	5					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		GGCTGTGGATCTGCTGTCTGC	0.512													25	150	---	---	---	---	PASS
RUFY1	80230	broad.mit.edu	37	5	179007956	179007956	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179007956G>C	uc003mka.1	+	7	899	c.899G>C	c.(898-900)AGA>ACA	p.R300T	RUFY1_uc003mkb.1_Missense_Mutation_p.R192T|RUFY1_uc003mkc.1_Missense_Mutation_p.R192T	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a	300					endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGCATGAAAGAATTACTGAT	0.333										HNSCC(44;0.11)			25	44	---	---	---	---	PASS
TUBB2A	7280	broad.mit.edu	37	6	3154115	3154115	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3154115C>G	uc003mvc.2	-	4	1406	c.1320G>C	c.(1318-1320)GAG>GAC	p.E440D	TUBB2A_uc003mvb.2_Missense_Mutation_p.E433D|TUBB2A_uc003mvd.2_Missense_Mutation_p.E403D	NM_001069	NP_001060	Q13885	TBB2A_HUMAN	tubulin, beta 2	440					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			skin(1)	1	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CGTCCTCGCCCTCCTCCTCCT	0.527													4	102	---	---	---	---	PASS
BTN1A1	696	broad.mit.edu	37	6	26509079	26509079	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26509079C>T	uc003nif.3	+	7	1278	c.1258C>T	c.(1258-1260)CGC>TGC	p.R420C		NM_001732	NP_001723	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1 precursor	420	B30.2/SPRY.|Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2						AGGGCCCCCACGCCGGGTTGG	0.502													13	80	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29911963	29911963	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911963G>A	uc003nol.2	+	4	684	c.684G>A	c.(682-684)TGG>TGA	p.W228*	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Nonsense_Mutation_p.W107*|HLA-A_uc003nok.2_Nonsense_Mutation_p.W107*|HLA-A_uc003non.2_Nonsense_Mutation_p.W228*|HLA-A_uc003noo.2_Nonsense_Mutation_p.W228*|HLA-A_uc010jrr.2_Nonsense_Mutation_p.W228*|HLA-A_uc003nom.2_Nonsense_Mutation_p.W107*|HLA-A_uc010klp.2_Nonsense_Mutation_p.W200*|HLA-A_uc011dmc.1_Nonsense_Mutation_p.W107*|HLA-A_uc011dmd.1_Nonsense_Mutation_p.W107*	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	228	Extracellular (Potential).|Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						TGAGGTGCTGGGCCCTGGGCT	0.617									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			8	216	---	---	---	---	PASS
SLC26A8	116369	broad.mit.edu	37	6	35949981	35949981	+	Splice_Site	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35949981C>G	uc003olm.2	-	8	1054	c.943_splice	c.e8-1	p.I315_splice	SLC26A8_uc003oln.2_Splice_Site_p.I315_splice|SLC26A8_uc003oll.2_Splice_Site_p.I210_splice	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						AGCCAATAATCTGTAGGGGGT	0.433													52	58	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43410821	43410821	+	Silent	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43410821C>G	uc003ouy.1	+	10	2555	c.2340C>G	c.(2338-2340)CTC>CTG	p.L780L	ABCC10_uc003ouz.1_Silent_p.L752L|ABCC10_uc010jyo.1_5'UTR	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	780	ABC transporter 1.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CACGGCTGCTCTGCACCCACC	0.652													8	59	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52993048	52993048	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52993048G>T	uc003pbp.2	-	6	1476	c.1267C>A	c.(1267-1269)CAC>AAC	p.H423N		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	423						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					TTGTTGCAGTGATCCAAACCC	0.458													121	672	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52993120	52993120	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52993120G>A	uc003pbp.2	-	6	1404	c.1195C>T	c.(1195-1197)CAG>TAG	p.Q399*		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	399						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					GAATATTGCTGATGAGGATGA	0.438													103	723	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52993134	52993134	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52993134G>T	uc003pbp.2	-	6	1390	c.1181C>A	c.(1180-1182)GCC>GAC	p.A394D		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	394						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					AGGATGAGAGGCGTAGGTGAA	0.428													100	701	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52993228	52993228	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52993228G>C	uc003pbp.2	-	6	1296	c.1087C>G	c.(1087-1089)CTT>GTT	p.L363V		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	363						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					TCTTCATAAAGATTACCCGCT	0.478													46	264	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52993240	52993240	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52993240G>A	uc003pbp.2	-	6	1284	c.1075C>T	c.(1075-1077)CCA>TCA	p.P359S		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	359						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					TTACCCGCTGGATTTGGCCAT	0.478													40	238	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56473173	56473173	+	Intron	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56473173A>G	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.S1548P	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGCAAGGAAGATGATGTGGGA	0.408													62	180	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70993461	70993461	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70993461A>G	uc003pfg.3	-	6	918	c.759T>C	c.(757-759)CAT>CAC	p.H253H	COL9A1_uc003pff.3_5'Flank	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	253	Nonhelical region (NC4).	Zinc.			axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						CTGGCAGCTCATGGCAAGTTT	0.522													12	26	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76582983	76582983	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76582983A>G	uc003pih.1	+	20	2322	c.2043A>G	c.(2041-2043)GAA>GAG	p.E681E	MYO6_uc003pig.1_Silent_p.E681E|MYO6_uc003pii.1_Silent_p.E681E	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	681	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		ACCACTTTGAAGGTGCTCAAA	0.358													8	131	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123377156	123377156	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123377156C>G	uc003pzi.1	+	5	1750	c.881C>G	c.(880-882)CCA>CGA	p.P294R		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	294					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GAACTCTCCCCAAAGTCCATG	0.507													23	36	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127771330	127771330	+	3'UTR	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127771330C>G	uc003qbd.2	-	9					C6orf174_uc003qbc.2_Silent_p.L101L|C6orf174_uc003qbb.2_5'UTR|KIAA0408_uc011ebs.1_Silent_p.L101L	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		TTTCTTTTCTCAGACCATCTT	0.363													46	319	---	---	---	---	PASS
LTV1	84946	broad.mit.edu	37	6	144165676	144165676	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144165676C>G	uc003qjs.2	+	2	164	c.57C>G	c.(55-57)CAC>CAG	p.H19Q		NM_032860	NP_116249	Q96GA3	LTV1_HUMAN	LTV1 homolog	19										ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TGTCTTTTCACTTGGTCCACC	0.428													25	277	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146216035	146216035	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146216035G>C	uc003qlf.2	-	26	4993	c.4594C>G	c.(4594-4596)CTC>GTC	p.L1532V	SHPRH_uc003qld.2_Missense_Mutation_p.L1536V|SHPRH_uc003qle.2_Missense_Mutation_p.L1536V	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	1532	Helicase C-terminal.				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GAGAAAACGAGTGCTTTGGCC	0.383													39	472	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152576119	152576119	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152576119C>A	uc010kiw.2	-	104	19968	c.19366G>T	c.(19366-19368)GAT>TAT	p.D6456Y	SYNE1_uc010kiv.2_Missense_Mutation_p.D980Y|SYNE1_uc003qos.3_Missense_Mutation_p.D980Y|SYNE1_uc003qot.3_Missense_Mutation_p.D6385Y|SYNE1_uc003qou.3_Missense_Mutation_p.D6456Y	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6456	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCCAAAGTATCTTCAATAACA	0.358										HNSCC(10;0.0054)			49	67	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152576120	152576120	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152576120T>A	uc010kiw.2	-	104	19967	c.19365A>T	c.(19363-19365)GAA>GAT	p.E6455D	SYNE1_uc010kiv.2_Missense_Mutation_p.E979D|SYNE1_uc003qos.3_Missense_Mutation_p.E979D|SYNE1_uc003qot.3_Missense_Mutation_p.E6384D|SYNE1_uc003qou.3_Missense_Mutation_p.E6455D	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6455	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAAAGTATCTTCAATAACAT	0.358										HNSCC(10;0.0054)			47	68	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152763201	152763201	+	Intron	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152763201G>C	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qow.2_Intron|SYNE1_uc003qox.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTAACTTCCGGCTCCTACCT	0.532										HNSCC(10;0.0054)			46	169	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152763202	152763202	+	Intron	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152763202G>T	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qow.2_Intron|SYNE1_uc003qox.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTAACTTCCGGCTCCTACCTG	0.537										HNSCC(10;0.0054)			46	168	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14378241	14378241	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14378241C>A	uc003ssz.2	-	22	2211	c.2024G>T	c.(2023-2025)GGA>GTA	p.G675V	DGKB_uc011jxt.1_Missense_Mutation_p.G656V|DGKB_uc003sta.2_Missense_Mutation_p.G675V|DGKB_uc011jxu.1_Missense_Mutation_p.G674V	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	675					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	CTTAGACTCTCCCCAAAGATT	0.408													59	146	---	---	---	---	PASS
TNS3	64759	broad.mit.edu	37	7	47409020	47409020	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47409020C>A	uc003tnv.2	-	17	1590	c.1223G>T	c.(1222-1224)CGC>CTC	p.R408L	TNS3_uc003tnw.2_Missense_Mutation_p.R408L	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	408						focal adhesion	protein binding			ovary(4)	4						TGGGGCCAGGCGCTCTTCCGT	0.627													33	71	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92985380	92985380	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92985380C>T	uc003umo.2	+	27	2891	c.2763C>T	c.(2761-2763)ATC>ATT	p.I921I	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Silent_p.I891I|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Silent_p.I641I	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	921											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AACGGTGGATCAAAGAGCACA	0.318													19	65	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113518175	113518175	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113518175C>T	uc010ljy.1	-	4	3003	c.2972G>A	c.(2971-2973)AGA>AAA	p.R991K		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	991					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						GCCTATGCATCTTTCTTTTCT	0.388													74	179	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122261657	122261657	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122261657C>A	uc010lkp.2	-	5	1145	c.982G>T	c.(982-984)GGT>TGT	p.G328C	CADPS2_uc003vkg.3_Missense_Mutation_p.G28C|CADPS2_uc010lkq.2_Missense_Mutation_p.G328C	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	328					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TCCGGACCACCTTTCGAAACT	0.363													25	174	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142606734	142606734	+	Missense_Mutation	SNP	C	T	T	rs143560130		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142606734C>T	uc003wby.1	-	14	2081	c.1817G>A	c.(1816-1818)CGG>CAG	p.R606Q		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	606	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					AGGCAGCTTCCGCTCCAGCAT	0.612													15	52	---	---	---	---	PASS
OR2A12	346525	broad.mit.edu	37	7	143792604	143792604	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143792604T>A	uc011kty.1	+	1	404	c.404T>A	c.(403-405)ATG>AAG	p.M135K		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					ACCCTCATTATGAACTGGAGA	0.438													9	316	---	---	---	---	PASS
ZNF425	155054	broad.mit.edu	37	7	148801578	148801578	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148801578C>A	uc003wfj.2	-	4	1458	c.1385G>T	c.(1384-1386)CGC>CTC	p.R462L		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	462	C2H2-type 9.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GCTGTGCAGGCGCTGGTGGGC	0.672													5	78	---	---	---	---	PASS
SLC4A2	6522	broad.mit.edu	37	7	150761614	150761614	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150761614C>A	uc003wit.3	+	4	475	c.219C>A	c.(217-219)TAC>TAA	p.Y73*	SLC4A2_uc011kve.1_Nonsense_Mutation_p.Y64*|SLC4A2_uc003wiu.3_Nonsense_Mutation_p.Y59*	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	73	Cytoplasmic (Potential).|Pro-rich.				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCCTGCAGACCACCGCCAGT	0.682													13	44	---	---	---	---	PASS
SLC18A1	6570	broad.mit.edu	37	8	20031880	20031880	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20031880G>C	uc011kyq.1	-	6	1094	c.623C>G	c.(622-624)TCT>TGT	p.S208C	SLC18A1_uc003wzl.2_5'Flank|SLC18A1_uc003wzm.2_Missense_Mutation_p.S208C|SLC18A1_uc011kyr.1_Missense_Mutation_p.S208C|SLC18A1_uc003wzn.2_Missense_Mutation_p.S208C|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Missense_Mutation_p.S208C	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	208	Helical; (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		ACCTGCAACAGATGAAAATGA	0.438													19	59	---	---	---	---	PASS
FAM160B2	64760	broad.mit.edu	37	8	21960417	21960417	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21960417C>A	uc011kyx.1	+	17	2258	c.2207C>A	c.(2206-2208)TCC>TAC	p.S736Y	FAM160B2_uc011kyy.1_RNA	NM_022749	NP_073586	Q86V87	F16B2_HUMAN	retinoic acid induced 16	736											0						CAGAACGTCTCCCCAGCCCCG	0.657													13	31	---	---	---	---	PASS
ADAM32	203102	broad.mit.edu	37	8	39068795	39068795	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39068795C>A	uc003xmt.3	+	12	1430	c.1185C>A	c.(1183-1185)GGC>GGA	p.G395G	ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32	395	Disintegrin.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CAGTCTGTGGCAATGGCAGAT	0.338													10	26	---	---	---	---	PASS
IDO2	169355	broad.mit.edu	37	8	39840260	39840260	+	Silent	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39840260G>T	uc010lwy.1	+	5	686	c.444G>T	c.(442-444)CTG>CTT	p.L148L	IDO2_uc003xno.1_RNA|IDO2_uc010lwz.1_Intron	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1	135					tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						ACTTGGTGCTGACGAACTGGA	0.468													9	25	---	---	---	---	PASS
GDAP1	54332	broad.mit.edu	37	8	75275219	75275219	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75275219C>G	uc003yah.2	+	5	704	c.625C>G	c.(625-627)CTT>GTT	p.L209V	GDAP1_uc011lfj.1_Missense_Mutation_p.L94V|GDAP1_uc003yai.2_Missense_Mutation_p.L141V	NM_018972	NP_061845	Q8TB36	GDAP1_HUMAN	ganglioside-induced differentiation-associated	209	GST C-terminal.					cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			GAAGAAAATTCTTGATGAGTT	0.318													27	217	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110417312	110417312	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110417312C>T	uc003yne.2	+	16	1726	c.1622C>T	c.(1621-1623)TCA>TTA	p.S541L		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	541	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAAGCTAATTCATGTTCACTT	0.313										HNSCC(38;0.096)			4	12	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113418818	113418818	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113418818G>A	uc003ynu.2	-	35	5903	c.5744C>T	c.(5743-5745)GCA>GTA	p.A1915V	CSMD3_uc003yns.2_Missense_Mutation_p.A1117V|CSMD3_uc003ynt.2_Missense_Mutation_p.A1875V|CSMD3_uc011lhx.1_Missense_Mutation_p.A1811V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1915	Sushi 10.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ACACCTAATTGCTATGGATCC	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			13	172	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139706804	139706804	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139706804C>A	uc003yvd.2	-	34	3094	c.2647G>T	c.(2647-2649)GGA>TGA	p.G883*	COL22A1_uc011ljo.1_Nonsense_Mutation_p.G183*	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	883	Pro-rich.|Gly-rich.|Collagen-like 7.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCTGCAGTCCCTGTAAGCAC	0.572										HNSCC(7;0.00092)			25	74	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144993708	144993708	+	Silent	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144993708C>G	uc003zaf.1	-	32	10862	c.10692G>C	c.(10690-10692)CTG>CTC	p.L3564L	PLEC_uc003zab.1_Silent_p.L3427L|PLEC_uc003zac.1_Silent_p.L3431L|PLEC_uc003zad.2_Silent_p.L3427L|PLEC_uc003zae.1_Silent_p.L3395L|PLEC_uc003zag.1_Silent_p.L3405L|PLEC_uc003zah.2_Silent_p.L3413L|PLEC_uc003zaj.2_Silent_p.L3454L	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3564	Plectin 14.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						TCTCGGCAGACAGCAGCTGCT	0.672													7	25	---	---	---	---	PASS
MPDZ	8777	broad.mit.edu	37	9	13138074	13138074	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13138074C>A	uc010mia.1	-	28	4139	c.4082G>T	c.(4081-4083)GGC>GTC	p.G1361V	MPDZ_uc003zky.3_5'Flank|MPDZ_uc010mib.2_Missense_Mutation_p.G66V|MPDZ_uc010mhx.2_Missense_Mutation_p.G183V|MPDZ_uc011lmm.1_Missense_Mutation_p.G220V|MPDZ_uc003zkz.3_Missense_Mutation_p.G54V|MPDZ_uc010mhy.2_Missense_Mutation_p.G1361V|MPDZ_uc010mhz.2_Missense_Mutation_p.G1328V|MPDZ_uc011lmn.1_Missense_Mutation_p.G1328V|MPDZ_uc003zlb.3_Missense_Mutation_p.G1361V	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1361	PDZ 8.				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		AAGACTTAGGCCCAAACCACT	0.438													20	33	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21974748	21974748	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21974748C>A	uc003zpk.2	-	1	291	c.79G>T	c.(79-81)GAG>TAG	p.E27*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_Nonsense_Mutation_p.E27*|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Intron	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	27	ANK 1.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(23)|p.E27*(1)|p.R22fs*14(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCCCGCACCTCCTCTACCCGA	0.741		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			5	6	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79954514	79954514	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79954514A>G	uc004akr.2	+	48	6721	c.6461A>G	c.(6460-6462)CAT>CGT	p.H2154R	VPS13A_uc004akp.3_Missense_Mutation_p.H2154R|VPS13A_uc004akq.3_Missense_Mutation_p.H2154R|VPS13A_uc004aks.2_Missense_Mutation_p.H2115R	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	2154					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						GCCAGGCTACATTTAAAATTA	0.333													14	36	---	---	---	---	PASS
ZCCHC6	79670	broad.mit.edu	37	9	88943339	88943339	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88943339G>C	uc004aoq.2	-	11	1739	c.1524C>G	c.(1522-1524)ATC>ATG	p.I508M	ZCCHC6_uc011ltf.1_RNA|ZCCHC6_uc004aor.2_RNA|ZCCHC6_uc004aos.2_RNA|ZCCHC6_uc004aot.2_Missense_Mutation_p.I385M|ZCCHC6_uc004aou.2_Missense_Mutation_p.I508M	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	508					RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2						TATGTTCCCAGATCACAACAT	0.398													104	281	---	---	---	---	PASS
FAM22F	54754	broad.mit.edu	37	9	97081890	97081890	+	Intron	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97081890T>C	uc004aup.1	-							NM_017561	NP_060031	A1L443	FA22F_HUMAN	hypothetical protein LOC54754												0		Acute lymphoblastic leukemia(62;0.136)				CCTCCGCTGCTCTACCTGGGC	0.607													5	270	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98244316	98244316	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98244316C>T	uc004avk.3	-	5	849	c.661G>A	c.(661-663)GAA>AAA	p.E221K	PTCH1_uc010mro.2_Missense_Mutation_p.E70K|PTCH1_uc010mrp.2_Missense_Mutation_p.E70K|PTCH1_uc010mrq.2_Missense_Mutation_p.E70K|PTCH1_uc004avl.3_Missense_Mutation_p.E70K|PTCH1_uc010mrr.2_Missense_Mutation_p.E155K|PTCH1_uc004avm.3_Missense_Mutation_p.E220K|PTCH1_uc010mrs.1_5'Flank|PTCH1_uc010mrt.1_RNA|PTCH1_uc010mru.1_Intron|PTCH1_uc004avo.2_Missense_Mutation_p.E155K|PTCH1_uc010mrv.1_RNA	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	221	Extracellular (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TAAAGATATTCTATTATCTGT	0.408									Basal_Cell_Nevus_syndrome				4	88	---	---	---	---	PASS
ABL1	25	broad.mit.edu	37	9	133753888	133753888	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133753888G>C	uc004bzw.2	+	8	1360	c.1357G>C	c.(1357-1359)GAG>CAG	p.E453Q	ABL1_uc004bzv.2_Missense_Mutation_p.E472Q	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	453	Protein kinase.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding	p.E453K(2)|p.E453D(1)|p.E453L(1)		haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	TGAGCTGCTAGAGAAGGACTA	0.507			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								28	410	---	---	---	---	PASS
ARRDC1	92714	broad.mit.edu	37	9	140509521	140509521	+	Intron	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140509521C>T	uc004cns.2	+						ARRDC1_uc004cnt.2_Intron|ARRDC1_uc004cnu.2_Intron|ARRDC1_uc004cnv.2_Intron|ARRDC1_uc004cnw.2_Intron|ARRDC1_uc004cnp.1_Missense_Mutation_p.R436C|ARRDC1_uc004cnq.1_Missense_Mutation_p.R418C|ARRDC1_uc011mfb.1_Missense_Mutation_p.R311C|ARRDC1_uc004cnx.1_Missense_Mutation_p.R311C|ARRDC1_uc004cny.2_Intron	NM_152285	NP_689498	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1												0	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		GCTTTCTTCCCGCAGAGGCCC	0.657													19	40	---	---	---	---	PASS
CXCL12	6387	broad.mit.edu	37	10	44866810	44866810	+	3'UTR	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44866810A>G	uc001jbf.2	-	4						NM_000609	NP_000600	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12 (stromal						blood circulation|cell adhesion|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|negative regulation of leukocyte apoptosis|positive regulation of monocyte chemotaxis|regulation of actin polymerization or depolymerization|response to virus	extracellular space	chemokine activity|growth factor activity|signal transducer activity				0					Dexamethasone(DB01234)	AGGTACATCCAAGTTCTACGT	0.383													5	7	---	---	---	---	PASS
C10orf71	118461	broad.mit.edu	37	10	50531322	50531322	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50531322C>T	uc010qgp.1	+	3	1071	c.732C>T	c.(730-732)ACC>ACT	p.T244T		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	244											0						ACACGGCCACCTTATGTGAGT	0.552													11	7	---	---	---	---	PASS
NCOA4	8031	broad.mit.edu	37	10	51582221	51582221	+	Silent	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51582221A>T	uc001jis.3	+	6	722	c.519A>T	c.(517-519)GCA>GCT	p.A173A	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|NCOA4_uc009xon.2_Silent_p.A189A|NCOA4_uc010qhd.1_Silent_p.A189A|NCOA4_uc010qhe.1_Silent_p.A73A|NCOA4_uc010qhf.1_Silent_p.A7A|NCOA4_uc001jit.2_Silent_p.A173A|NCOA4_uc009xoo.2_Silent_p.A173A	NM_001145263	NP_001138735	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4 isoform 3	173					androgen receptor signaling pathway|male gonad development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	androgen receptor binding|transcription coactivator activity			central_nervous_system(1)|kidney(1)	2						CTAGTTCAGCAAATATTGGGC	0.363			T	RET	papillary thyroid 								38	92	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	54032153	54032153	+	Missense_Mutation	SNP	C	A	A	rs142314590	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54032153C>A	uc001jjm.2	+	12	1464	c.1270C>A	c.(1270-1272)CTG>ATG	p.L424M	PRKG1_uc001jjo.2_Missense_Mutation_p.L439M|PRKG1_uc009xow.1_Missense_Mutation_p.L142M|uc001jjq.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	424	Protein kinase.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		AATTTACAGACTGTACAGAAC	0.373													17	108	---	---	---	---	PASS
C10orf28	27291	broad.mit.edu	37	10	99994210	99994210	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99994210G>T	uc001kow.3	+	6	2264	c.1969G>T	c.(1969-1971)GGA>TGA	p.G657*	C10orf28_uc001kox.3_Nonsense_Mutation_p.G671*|C10orf28_uc001koy.3_Nonsense_Mutation_p.G657*|C10orf28_uc009xvx.2_Nonsense_Mutation_p.G657*|C10orf28_uc009xvy.2_Nonsense_Mutation_p.G63*|C10orf28_uc001koz.3_RNA	NM_014472	NP_055287	Q4KMY3	Q4KMY3_HUMAN	growth inhibition and differentiation related	657							nucleotide binding			large_intestine(1)|skin(1)	2		Colorectal(252;0.234)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)		CAGAAAGAAAGGATTTGATAT	0.313													5	180	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120802129	120802129	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120802129G>C	uc001ldu.2	-	19	3049	c.2903C>G	c.(2902-2904)CCT>CGT	p.P968R	EIF3A_uc010qsu.1_Missense_Mutation_p.P934R|EIF3A_uc009xzg.1_Missense_Mutation_p.P7R	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	968	Asp-rich.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].|5.				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ACCACGTCTAGGGCCTCTGTC	0.592													8	228	---	---	---	---	PASS
ZNF215	7762	broad.mit.edu	37	11	6953621	6953621	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6953621G>C	uc001mey.2	+	3	706	c.118G>C	c.(118-120)GAG>CAG	p.E40Q	ZNF215_uc010raw.1_Missense_Mutation_p.E40Q|ZNF215_uc010rax.1_5'UTR|ZNF215_uc001mez.1_Missense_Mutation_p.E40Q	NM_013250	NP_037382	Q9UL58	ZN215_HUMAN	zinc finger protein 215	40					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CCCCGTCGTGGAGACACATGA	0.498													4	143	---	---	---	---	PASS
PPFIBP2	8495	broad.mit.edu	37	11	7670765	7670765	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7670765C>T	uc001mfj.3	+	21	2389	c.2001C>T	c.(1999-2001)AAC>AAT	p.N667N	PPFIBP2_uc010rbb.1_Silent_p.N590N|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Silent_p.N601N|PPFIBP2_uc010rbe.1_Silent_p.N555N|PPFIBP2_uc001mfl.3_Silent_p.N524N|PPFIBP2_uc009yfj.1_Silent_p.N311N	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2	667	SAM 2.				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TCTTTCAGAACGATTTACTCT	0.443													109	294	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	20940796	20940796	+	Splice_Site	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20940796A>T	uc001mqe.2	+	7	830	c.677_splice	c.e7-2	p.T226_splice	NELL1_uc001mqf.2_Splice_Site_p.T226_splice|NELL1_uc009yid.2_Splice_Site_p.T254_splice|NELL1_uc010rdo.1_Splice_Site_p.T169_splice|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						ttCTTTATTGAGCTTGCCCAA	0.289													25	83	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22242675	22242675	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22242675C>A	uc001mqi.2	+	5	530	c.213C>A	c.(211-213)ATC>ATA	p.I71I	ANO5_uc001mqj.2_Silent_p.I70I	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	71	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						AAGATTCTATCTTCTTCCGAG	0.348													23	80	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22291937	22291937	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22291937G>T	uc001mqi.2	+	18	2295	c.1978G>T	c.(1978-1980)GAC>TAC	p.D660Y	ANO5_uc001mqj.2_Missense_Mutation_p.D659Y	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	660	Extracellular (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						GCAGGATCATGACCTTGAAAG	0.423													74	185	---	---	---	---	PASS
PAX6	5080	broad.mit.edu	37	11	31824246	31824246	+	Intron	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31824246G>T	uc001mtd.3	-						PAX6_uc001mte.3_Intron|PAX6_uc001mtg.3_Intron|PAX6_uc001mtf.3_Intron|PAX6_uc001mth.3_Intron|PAX6_uc009yjr.2_Intron	NM_001127612	NP_001121084	P26367	PAX6_HUMAN	paired box gene 6 isoform a						blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity			lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9	Lung SC(675;0.225)					GCGCCGGGAGGATCACCTGCA	0.592									Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				5	12	---	---	---	---	PASS
MAPK8IP1	9479	broad.mit.edu	37	11	45923588	45923588	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45923588C>A	uc001nbr.2	+	4	750	c.580C>A	c.(580-582)CGA>AGA	p.R194R		NM_005456	NP_005447	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting	194	JNK-binding domain (JBD).				vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity			ovary(2)|breast(1)|skin(1)	4				GBM - Glioblastoma multiforme(35;0.231)		TCGGGTGTCTCGATCATCCTC	0.527													9	362	---	---	---	---	PASS
NDUFS3	4722	broad.mit.edu	37	11	47602541	47602541	+	Intron	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602541G>T	uc001nga.2	+						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_Missense_Mutation_p.S129I	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	TTTGAGGTCAGTTGGGAGATC	0.398													45	142	---	---	---	---	PASS
OR4C46	119749	broad.mit.edu	37	11	51515930	51515930	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51515930G>A	uc010ric.1	+	1	649	c.649G>A	c.(649-651)GTG>ATG	p.V217M		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GGTCTCCTATGTGGTCATCTT	0.502													26	136	---	---	---	---	PASS
APLNR	187	broad.mit.edu	37	11	57003581	57003581	+	Missense_Mutation	SNP	C	A	A	rs7943508	byFrequency	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57003581C>A	uc001njo.2	-	1	1347	c.898G>T	c.(898-900)GTC>TTC	p.V300F	APLNR_uc001njn.3_RNA	NM_005161	NP_005152	P35414	APJ_HUMAN	apelin receptor	300	Helical; Name=7; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			lung(5)|ovary(1)	6						CAGCTGTTGACGTAGCTGATG	0.597													5	50	---	---	---	---	PASS
ZDHHC5	25921	broad.mit.edu	37	11	57467477	57467477	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57467477G>A	uc001nkx.1	+	12	3378	c.2122G>A	c.(2122-2124)GGT>AGT	p.G708S	ZDHHC5_uc001nky.1_Missense_Mutation_p.G655S|ZDHHC5_uc001nkz.1_Missense_Mutation_p.G522S	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC domain containing 5	708						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1						AGGGGTTGGTGGTACCACCTA	0.647													24	71	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62761028	62761028	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62761028G>T	uc001nwo.2	-	10	1533	c.1397C>A	c.(1396-1398)ACG>AAG	p.T466K	SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Missense_Mutation_p.T466K|SLC22A8_uc009yom.2_Missense_Mutation_p.T343K|SLC22A8_uc010rmm.1_Missense_Mutation_p.T375K|SLC22A8_uc009yon.2_Missense_Mutation_p.T466K	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8	466	Cytoplasmic (Potential).				response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						TACCTCACCCGTGATTTTCAC	0.592													12	169	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64525904	64525904	+	Intron	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64525904C>T	uc001oax.3	-						PYGM_uc001oay.3_Intron	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1						glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	GCCCTGTCTTCTTACCTGCCA	0.662													47	123	---	---	---	---	PASS
GPR152	390212	broad.mit.edu	37	11	67219032	67219032	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67219032G>A	uc001olm.2	-	1	1169	c.1164C>T	c.(1162-1164)GCC>GCT	p.A388A	uc009yrw.1_5'Flank|CABP4_uc001oln.2_5'Flank	NM_206997	NP_996880	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	388	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GCTGTGGCTGGGCTGTGGGAT	0.632													6	35	---	---	---	---	PASS
POLD3	10714	broad.mit.edu	37	11	74331143	74331143	+	Intron	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74331143G>C	uc001ovf.1	+						POLD3_uc009yua.1_Intron	NM_006591	NP_006582	Q15054	DPOD3_HUMAN	DNA-directed DNA polymerase delta 3						base-excision repair|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|mismatch repair|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm	DNA-directed DNA polymerase activity|protein binding			kidney(2)|ovary(1)	3	Breast(11;3.21e-06)					GAGTAAGCATGTTCTTACCTC	0.398													63	206	---	---	---	---	PASS
UVRAG	7405	broad.mit.edu	37	11	75776843	75776843	+	Intron	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75776843G>C	uc001oxc.2	+						UVRAG_uc010rrw.1_Intron|UVRAG_uc001oxd.2_Intron|UVRAG_uc010rrx.1_Intron	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated						DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						GTAAGTCTCTGTTCTTCACTT	0.408													4	200	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76256898	76256898	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76256898C>T	uc001oxl.2	+	20	3474	c.3331C>T	c.(3331-3333)CGC>TGC	p.R1111C	C11orf30_uc001oxm.2_Missense_Mutation_p.R1013C|C11orf30_uc010rsb.1_Missense_Mutation_p.R1126C|C11orf30_uc010rsc.1_Missense_Mutation_p.R1112C|C11orf30_uc001oxn.2_Missense_Mutation_p.R1112C|C11orf30_uc010rsd.1_Missense_Mutation_p.R1020C|C11orf30_uc010rse.1_Missense_Mutation_p.R358C|C11orf30_uc001oxp.2_Intron	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	1111					chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						TTTTGAGGGGCGCCAGCCTCC	0.453													19	174	---	---	---	---	PASS
CHORDC1	26973	broad.mit.edu	37	11	89939369	89939369	+	Splice_Site	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89939369C>A	uc001pdg.2	-	7	973	c.563_splice	c.e7+1	p.G188_splice	CHORDC1_uc009yvz.2_Splice_Site_p.G169_splice	NM_012124	NP_036256	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain-containing						chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				GCATAAGTTACCCCTCATGGA	0.269													57	154	---	---	---	---	PASS
PGR	5241	broad.mit.edu	37	11	100999559	100999559	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100999559C>A	uc001pgh.2	-	1	986	c.243G>T	c.(241-243)TCG>TCT	p.S81S	PGR_uc001pgi.2_Silent_p.S81S|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA|uc010rum.1_5'Flank	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	81	Modulating, Pro-Rich.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	CCTCCACGTCCGACAGCGACT	0.607													3	69	---	---	---	---	PASS
SIK2	23235	broad.mit.edu	37	11	111558844	111558844	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111558844G>C	uc001plt.2	+	4	554	c.436G>C	c.(436-438)GAA>CAA	p.E146Q		NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2	146	Protein kinase.				intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						CCTCAAAGCTGAAAATCTCCT	0.453													52	80	---	---	---	---	PASS
HTR3A	3359	broad.mit.edu	37	11	113856854	113856854	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113856854T>C	uc010rxb.1	+	6	913	c.680T>C	c.(679-681)TTC>TCC	p.F227S	HTR3A_uc010rxa.1_Missense_Mutation_p.F227S|HTR3A_uc009yyx.2_Intron|HTR3A_uc010rxc.1_Missense_Mutation_p.F206S	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	221	Extracellular (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	TTTCGGGAGTTCAGCATGGAA	0.478													11	410	---	---	---	---	PASS
APOC3	345	broad.mit.edu	37	11	116701317	116701317	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116701317C>G	uc001ppt.1	+	2	65	c.19C>G	c.(19-21)CTT>GTT	p.L7V		NM_000040	NP_000031	P02656	APOC3_HUMAN	apolipoprotein C-III precursor	7					Cdc42 protein signal transduction|cholesterol efflux|cholesterol homeostasis|chylomicron remnant clearance|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle remodeling|lipoprotein metabolic process|negative regulation of cholesterol import|negative regulation of fatty acid biosynthetic process|negative regulation of high-density lipoprotein particle clearance|negative regulation of lipoprotein lipase activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor-mediated endocytosis|negative regulation of triglyceride catabolic process|negative regulation of very-low-density lipoprotein particle clearance|negative regulation of very-low-density lipoprotein particle remodeling|phospholipid efflux|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle assembly	chylomicron|intermediate-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	high-density lipoprotein particle receptor binding|lipase inhibitor activity|phospholipid binding				0	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CCGGGTACTCCTTGTTGTTGC	0.657													11	64	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118376731	118376731	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118376731C>G	uc001pta.2	+	27	10138	c.10115C>G	c.(10114-10116)ACC>AGC	p.T3372S	MLL_uc001ptb.2_Missense_Mutation_p.T3375S	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3372					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TTGCTTGGTACCCCAGATATT	0.483			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								42	470	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	121028662	121028662	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121028662G>A	uc010rzo.1	+	13	4418	c.4418G>A	c.(4417-4419)CGC>CAC	p.R1473H		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1473					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGTGCGCTGCGCAACGGGGTG	0.667													15	78	---	---	---	---	PASS
CLEC9A	283420	broad.mit.edu	37	12	10215734	10215734	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10215734T>A	uc001qxa.2	+	7	1013	c.400T>A	c.(400-402)TGG>AGG	p.W134R		NM_207345	NP_997228	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	134	Extracellular (Potential).|C-type lectin.				positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1						TTGGAGCATTTGGCACACCAG	0.368													23	233	---	---	---	---	PASS
PRB4	5545	broad.mit.edu	37	12	11461259	11461259	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11461259G>T	uc001qzf.1	-	3	692	c.658C>A	c.(658-660)CCT>ACT	p.P220T	PRB4_uc001qzt.2_Missense_Mutation_p.P220T	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	283						extracellular region				ovary(1)	1						TTTCCAGCAGGAGGTGCCTGA	0.632										HNSCC(22;0.051)			82	201	---	---	---	---	PASS
PRB4	5545	broad.mit.edu	37	12	11461447	11461447	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11461447G>A	uc001qzf.1	-	3	504	c.470C>T	c.(469-471)CCT>CTT	p.P157L	PRB4_uc001qzt.2_Missense_Mutation_p.P157L	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	220	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.|9.					extracellular region				ovary(1)	1						TCCTGGATGAGGTGGGGGACC	0.602										HNSCC(22;0.051)			167	501	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20893186	20893186	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20893186A>G	uc001rej.3	+	13	1972	c.1617A>G	c.(1615-1617)GGA>GGG	p.G539G	SLCO1C1_uc010sii.1_Silent_p.G539G|SLCO1C1_uc010sij.1_Silent_p.G490G|SLCO1C1_uc009zip.2_Silent_p.G373G|SLCO1C1_uc001rei.2_Silent_p.G539G|SLCO1C1_uc010sik.1_Silent_p.G421G	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	539	Extracellular (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					GCATAGTGGGAAGATGTCAGA	0.393													72	186	---	---	---	---	PASS
TM7SF3	51768	broad.mit.edu	37	12	27143425	27143425	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27143425C>T	uc010sjl.1	-	6	1064	c.826G>A	c.(826-828)GCT>ACT	p.A276T		NM_016551	NP_057635	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3 precursor	276						integral to membrane|plasma membrane				upper_aerodigestive_tract(2)	2	Colorectal(261;0.0847)					AAGCTGCAAGCGTATGTGTGA	0.458													50	116	---	---	---	---	PASS
C12orf41	54934	broad.mit.edu	37	12	49075195	49075195	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49075195T>C	uc001rrx.2	-	2	296	c.221A>G	c.(220-222)AAT>AGT	p.N74S	C12orf41_uc001rrw.2_5'Flank|C12orf41_uc001rrz.2_Missense_Mutation_p.N257S|C12orf41_uc001rry.2_RNA	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934	74										ovary(2)	2						TGGGGCAGCATTGGGACATCT	0.418													27	74	---	---	---	---	PASS
KRT8	3856	broad.mit.edu	37	12	53298547	53298547	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53298547C>T	uc001sbd.2	-	1	322	c.219G>A	c.(217-219)CTG>CTA	p.L73L	KRT8_uc009zmj.2_Silent_p.L73L|KRT8_uc009zmk.1_Silent_p.L101L|KRT8_uc009zml.1_Silent_p.L73L|KRT8_uc009zmm.1_Silent_p.L73L	NM_002273	NP_002264	P05787	K2C8_HUMAN	keratin 8	73	Head.				cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAAGGGGGCTCAGCAGGCTCT	0.627													10	91	---	---	---	---	PASS
EIF4B	1975	broad.mit.edu	37	12	53431196	53431196	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53431196C>T	uc001sbh.3	+	11	1516	c.1310C>T	c.(1309-1311)GCA>GTA	p.A437V	EIF4B_uc010snu.1_Missense_Mutation_p.A442V|EIF4B_uc010snv.1_Missense_Mutation_p.A398V|EIF4B_uc001sbi.2_Missense_Mutation_p.A189V	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	437					insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2						TTCACAGATGCACGAAGGAGA	0.448													7	33	---	---	---	---	PASS
HOXC10	3226	broad.mit.edu	37	12	54379069	54379069	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54379069C>T	uc001sen.2	+	1	124	c.26C>T	c.(25-27)CCG>CTG	p.P9L		NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10	9					positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1						AATGTAACTCCGAACTCGTAC	0.532													41	209	---	---	---	---	PASS
SMARCC2	6601	broad.mit.edu	37	12	56563645	56563645	+	Silent	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56563645G>C	uc001skb.2	-	23	2476	c.2370C>G	c.(2368-2370)ACC>ACG	p.T790T	SMARCC2_uc001skd.2_Silent_p.T821T|SMARCC2_uc001ska.2_Silent_p.T821T|SMARCC2_uc001skc.2_Silent_p.T820T|SMARCC2_uc010sqf.1_Silent_p.T710T	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated	790	Glu-rich.				chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GAGCCTCGCTGGTTTTCTCTT	0.498													47	130	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78510549	78510549	+	Intron	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78510549T>C	uc001syp.2	+						NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_5'Flank	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GTCTTGCCTTTAGCTGGGATG	0.433										HNSCC(70;0.22)			8	97	---	---	---	---	PASS
MYF5	4617	broad.mit.edu	37	12	81111152	81111152	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81111152G>A	uc001szg.2	+	1	445	c.310G>A	c.(310-312)GAA>AAA	p.E104K		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	104	Helix-loop-helix motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						CCAGGCTTTCGAAACCCTCAA	0.597													8	107	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81688753	81688753	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81688753G>A	uc001szo.1	-	24	2947	c.2786C>T	c.(2785-2787)GCC>GTC	p.A929V	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	855										ovary(3)|lung(2)|pancreas(1)	6						AGACATGATGGCACCACTCTT	0.438													15	26	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99145241	99145241	+	Silent	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99145241T>A	uc001tge.1	-	25	3981	c.3564A>T	c.(3562-3564)CTA>CTT	p.L1188L	ANKS1B_uc001tgf.1_Silent_p.L704L|ANKS1B_uc001tgk.2_Silent_p.L485L|ANKS1B_uc010svd.1_Silent_p.L194L|ANKS1B_uc001tgd.1_Silent_p.L354L|ANKS1B_uc009ztq.2_Silent_p.L90L|ANKS1B_uc010sve.1_Silent_p.L218L|ANKS1B_uc001tgh.3_Silent_p.L194L|ANKS1B_uc001tgi.2_Silent_p.L438L|ANKS1B_uc009ztr.2_Silent_p.L378L|ANKS1B_uc001tgj.2_Silent_p.L354L|ANKS1B_uc009ztp.2_Silent_p.L219L|ANKS1B_uc010svf.1_Silent_p.L218L|ANKS1B_uc001tgg.3_Silent_p.L286L|ANKS1B_uc010svg.1_Silent_p.L323L|ANKS1B_uc009zts.1_Silent_p.L414L	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	1188	PID.					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CTTGTAGTGCTAGCTGGTAAG	0.483													61	179	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104077060	104077060	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104077060C>A	uc001tjw.2	+	26	3069	c.2883C>A	c.(2881-2883)ACC>ACA	p.T961T		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	961	Extracellular (Potential).|EGF-like 10.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TGGAACAAACCGGGAAATGTC	0.333													31	108	---	---	---	---	PASS
WSCD2	9671	broad.mit.edu	37	12	108642091	108642091	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108642091G>C	uc001tms.2	+	9	2413	c.1669G>C	c.(1669-1671)GGT>CGT	p.G557R	WSCD2_uc001tmt.2_Missense_Mutation_p.G557R|WSCD2_uc001tmu.2_Missense_Mutation_p.G325R	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	557						integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						GAACCTAACGGGTGTCCCCGA	0.587													20	51	---	---	---	---	PASS
WSB2	55884	broad.mit.edu	37	12	118490293	118490293	+	Intron	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118490293G>C	uc001twr.2	-						WSB2_uc010sza.1_5'Flank|WSB2_uc010szb.1_Intron|WSB2_uc009zws.1_Intron	NM_018639	NP_061109	Q9NYS7	WSB2_HUMAN	WD SOCS-box protein 2						intracellular signal transduction					ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTGGGGCAGGAGACAACATG	0.592													45	131	---	---	---	---	PASS
TMEM132B	114795	broad.mit.edu	37	12	126128791	126128791	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126128791T>C	uc001uhe.1	+	6	1600	c.1592T>C	c.(1591-1593)ATC>ACC	p.I531T	TMEM132B_uc001uhf.1_Missense_Mutation_p.I43T	NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	531	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CTGAGCCAGATCAAGGGCTGG	0.567													20	60	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130840130	130840130	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130840130G>A	uc001uik.2	+	12	1412	c.1322G>A	c.(1321-1323)TGG>TAG	p.W441*	PIWIL1_uc001uij.1_Nonsense_Mutation_p.W441*	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	441					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTTCGAGACTGGGGTTTGAGC	0.378													34	385	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133393317	133393317	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133393317G>A	uc001ukz.1	-	3	774	c.215C>T	c.(214-216)ACG>ATG	p.T72M	GOLGA3_uc001ula.1_Missense_Mutation_p.T72M|GOLGA3_uc001ulb.2_Missense_Mutation_p.T72M	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	72	Pro-rich.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GAAGGGTGGCGTTGGCCCGTT	0.622													36	73	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101753188	101753188	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101753188G>A	uc001vox.1	-	27	3298	c.3109C>T	c.(3109-3111)CAG>TAG	p.Q1037*		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1037	Extracellular (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCAAAAAGCTGAACTCCAAAG	0.308													4	63	---	---	---	---	PASS
EFNB2	1948	broad.mit.edu	37	13	107148093	107148093	+	Intron	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107148093T>C	uc001vqi.2	-							NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor						cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AGATGGTCTTTACCTTGTCCA	0.512													221	244	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21868389	21868389	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21868389C>T	uc001was.1	-	24	3905	c.3811G>A	c.(3811-3813)GAT>AAT	p.D1271N	CHD8_uc001war.1_Missense_Mutation_p.D1167N|SNORD8_uc001wau.1_5'Flank	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1550					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CGGATCCAATCTGCCTTATGG	0.403													59	121	---	---	---	---	PASS
RBM23	55147	broad.mit.edu	37	14	23371603	23371603	+	Intron	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23371603C>A	uc001whg.2	-						RBM23_uc001whh.2_Intron|RBM23_uc001whi.2_Intron|RBM23_uc010tne.1_Intron|RBM23_uc001whj.2_Intron	NM_001077351	NP_001070819	Q86U06	RBM23_HUMAN	RNA binding motif protein 23 isoform 1						mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		TATGAGAAACCCAGGCCATGT	0.507													9	14	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39772705	39772705	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39772705A>T	uc001wvg.3	+	11	1276	c.940A>T	c.(940-942)AAG>TAG	p.K314*	CTAGE5_uc010tqe.1_Nonsense_Mutation_p.K276*|CTAGE5_uc001wuz.3_Nonsense_Mutation_p.K302*|CTAGE5_uc001wuy.3_Nonsense_Mutation_p.K234*|CTAGE5_uc001wvb.3_Nonsense_Mutation_p.K285*|CTAGE5_uc001wvc.3_Nonsense_Mutation_p.K259*|CTAGE5_uc001wva.3_Nonsense_Mutation_p.K285*|CTAGE5_uc001wve.1_Nonsense_Mutation_p.K290*|CTAGE5_uc001wvh.3_Nonsense_Mutation_p.K314*|CTAGE5_uc001wvf.3_Nonsense_Mutation_p.K239*|CTAGE5_uc001wvi.3_Nonsense_Mutation_p.K319*|CTAGE5_uc010amz.2_5'UTR|CTAGE5_uc001wvj.3_Nonsense_Mutation_p.K285*	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	314							enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		AGGAGCTTTGAAGAAACTGAT	0.328													53	87	---	---	---	---	PASS
EXD2	55218	broad.mit.edu	37	14	69704332	69704332	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69704332A>T	uc001xkt.2	+	10	1617	c.958A>T	c.(958-960)ATC>TTC	p.I320F	EXD2_uc001xku.2_Missense_Mutation_p.I190F|EXD2_uc001xkv.2_Missense_Mutation_p.I445F|EXD2_uc001xkw.2_Missense_Mutation_p.I320F|EXD2_uc010aqt.2_Missense_Mutation_p.I445F|EXD2_uc010tte.1_Missense_Mutation_p.I445F|EXD2_uc001xky.2_Missense_Mutation_p.I320F	NM_018199	NP_060669	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	320					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						GCACTTCCCCATCGAGATGAA	0.532													24	36	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106320570	106320570	+	RNA	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106320570C>T	uc010tyt.1	-	3601		c.56404G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						TGGGCCACCACGCAGGTGTAG	0.642													34	39	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34064318	34064318	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34064318T>C	uc001zhi.2	+	63	9084	c.9014T>C	c.(9013-9015)TTT>TCT	p.F3005S	RYR3_uc010bar.2_Missense_Mutation_p.F3005S	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3005	Helical; Name=M'; (Potential).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACGTCCATCTTTGAGCACGTC	0.478													8	44	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41853468	41853468	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41853468T>C	uc001zof.1	+	2	492	c.268T>C	c.(268-270)TAC>CAC	p.Y90H	TYRO3_uc001zoe.2_Missense_Mutation_p.Y90H	NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	90	Extracellular (Potential).|Ig-like C2-type 1.					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGACCAGTTGTACATCCCAGT	0.622													10	77	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43822398	43822398	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43822398C>T	uc001zrt.2	+	6	8855	c.8388C>T	c.(8386-8388)TTC>TTT	p.F2796F		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2796						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	ATGAGTCCTTCCCTGCCTGCA	0.552													12	149	---	---	---	---	PASS
GALK2	2585	broad.mit.edu	37	15	49493405	49493405	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49493405C>A	uc001zxj.1	+	2	198	c.100C>A	c.(100-102)CCC>ACC	p.P34T	GALK2_uc001zxi.1_Missense_Mutation_p.P23T|GALK2_uc010ufb.1_Missense_Mutation_p.P10T|GALK2_uc001zxk.2_RNA|GALK2_uc010ufc.1_Missense_Mutation_p.P10T	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1	34					galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		TGGATCTATTCCCAAGTTTTA	0.303													24	75	---	---	---	---	PASS
ONECUT1	3175	broad.mit.edu	37	15	53081523	53081523	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53081523G>A	uc002aci.1	-	1	687	c.559C>T	c.(559-561)CTG>TTG	p.L187L		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	187					endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		ATGCTGCCCAGACCGGAGCTG	0.662													25	71	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	54007474	54007474	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54007474A>T	uc002acj.2	-	5	472	c.430T>A	c.(430-432)TTG>ATG	p.L144M	WDR72_uc010bfi.1_Missense_Mutation_p.L144M	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	144										lung(1)|skin(1)	2				all cancers(107;0.0511)		ACAACAGCCAAAGTTTTGGCA	0.398													18	104	---	---	---	---	PASS
NEDD4	4734	broad.mit.edu	37	15	56144621	56144621	+	Splice_Site	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56144621C>T	uc002adj.2	-	9	2703	c.2403_splice	c.e9+1	p.Q801_splice	NEDD4_uc002adl.2_Splice_Site_p.Q382_splice|NEDD4_uc002adi.2_Splice_Site_p.Q729_splice|NEDD4_uc010ugj.1_Splice_Site_p.Q785_splice|NEDD4_uc010bfm.2_Splice_Site_p.Q784_splice|NEDD4_uc002adk.2_Splice_Site	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally						development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TTACAGGATACCTGTACAGTG	0.373													40	128	---	---	---	---	PASS
LDHAL6B	92483	broad.mit.edu	37	15	59499577	59499577	+	Silent	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59499577T>A	uc002agb.2	+	1	536	c.438T>A	c.(436-438)GGT>GGA	p.G146G	MYO1E_uc002aga.2_Intron	NM_033195	NP_149972	Q9BYZ2	LDH6B_HUMAN	lactate dehydrogenase A-like 6B	146					glycolysis	cytoplasm	L-lactate dehydrogenase activity|protein binding				0					NADH(DB00157)	TCACAGCAGGTGCACGCCAAG	0.433													93	223	---	---	---	---	PASS
BNIP2	663	broad.mit.edu	37	15	59964827	59964827	+	Intron	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59964827T>C	uc010uhc.1	-						BNIP2_uc010uhb.1_Intron	NM_004330	NP_004321	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 2						anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1						TTGTTTAATATATACTTACTT	0.279													38	64	---	---	---	---	PASS
TPM1	7168	broad.mit.edu	37	15	63353941	63353941	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63353941A>G	uc002alg.2	+	6	784	c.593A>G	c.(592-594)AAA>AGA	p.K198R	TPM1_uc002alh.2_Intron|TPM1_uc010bgn.2_Intron|TPM1_uc002ali.2_Missense_Mutation_p.K198R|TPM1_uc002alj.2_Missense_Mutation_p.K198R|TPM1_uc002alk.2_Intron|TPM1_uc002all.2_Intron|TPM1_uc002alm.2_Missense_Mutation_p.K240R|TPM1_uc010uie.1_Missense_Mutation_p.K198R|TPM1_uc002alp.2_Missense_Mutation_p.K198R|TPM1_uc010uif.1_Intron|TPM1_uc002alr.2_Intron|TPM1_uc002als.2_Missense_Mutation_p.K162R|TPM1_uc010uig.1_Missense_Mutation_p.K162R|TPM1_uc002alt.2_Intron|TPM1_uc010bgp.2_Intron	NM_001018005	NP_001018005	P09493	TPM1_HUMAN	tropomyosin 1 alpha chain isoform 1	198	By similarity.				cardiac muscle contraction|cellular component movement|cellular response to reactive oxygen species|muscle filament sliding|negative regulation of cell migration|positive regulation of ATPase activity|positive regulation of cell adhesion|positive regulation of heart rate by epinephrine|positive regulation of stress fiber assembly|regulation of muscle contraction|ruffle organization|sarcomere organization|ventricular cardiac muscle tissue morphogenesis|wound healing	bleb|cytosol|muscle thin filament tropomyosin|ruffle membrane|stress fiber	actin binding|structural constituent of cytoskeleton|structural constituent of muscle				0						GAAGAATTGAAAACTGTGACG	0.488													8	99	---	---	---	---	PASS
TLE3	7090	broad.mit.edu	37	15	70342518	70342518	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70342518C>G	uc002asm.2	-	20	3356	c.2237G>C	c.(2236-2238)AGT>ACT	p.S746T	TLE3_uc002ask.2_Missense_Mutation_p.S673T|TLE3_uc002asl.2_Missense_Mutation_p.S746T|TLE3_uc010ukd.1_Missense_Mutation_p.S736T|TLE3_uc010bik.1_Missense_Mutation_p.S327T|TLE3_uc010bil.1_Missense_Mutation_p.S743T|TLE3_uc002asn.2_Missense_Mutation_p.S734T|TLE3_uc002asp.2_Missense_Mutation_p.S738T|TLE3_uc002aso.2_Missense_Mutation_p.S741T	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a	746	WD 7.				organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						AATGTCACAACTCAAGACAGA	0.473													5	263	---	---	---	---	PASS
PKM2	5315	broad.mit.edu	37	15	72509778	72509778	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72509778C>T	uc002atx.1	-	3	459	c.218G>A	c.(217-219)CGT>CAT	p.R73H	PKM2_uc010bit.1_Missense_Mutation_p.R78H|PKM2_uc010uki.1_Missense_Mutation_p.R147H|PKM2_uc002atv.1_Missense_Mutation_p.R108H|PKM2_uc002atw.1_Missense_Mutation_p.R73H|PKM2_uc002aty.1_Missense_Mutation_p.R73H|PKM2_uc010ukj.1_Intron|PKM2_uc010ukk.1_Intron|PKM2_uc010biu.1_Missense_Mutation_p.R94H|PKM2_uc002atz.1_RNA	NM_182471	NP_872271	P14618	KPYM_HUMAN	pyruvate kinase, muscle isoform M1	73		Substrate (By similarity).			glycolysis|programmed cell death	cytosol|nucleus|plasma membrane	ATP binding|magnesium ion binding|potassium ion binding|protein binding|pyruvate kinase activity			breast(1)	1					Pyruvic acid(DB00119)	GAAGTTCAGACGAGCCACATT	0.473													20	56	---	---	---	---	PASS
CHRNB4	1143	broad.mit.edu	37	15	78922133	78922133	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78922133G>A	uc002bed.1	-	5	626	c.514C>T	c.(514-516)CGC>TGC	p.R172C	CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_5'UTR	NM_000750	NP_000741	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4	172	Extracellular (Potential).				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0						GTCCAGGAGCGGAACTTGAGG	0.572													31	89	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	86838602	86838602	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86838602G>T	uc002blz.1	+	16	2279	c.2199G>T	c.(2197-2199)ATG>ATT	p.M733I	AGBL1_uc002bma.1_Missense_Mutation_p.M464I|AGBL1_uc002bmb.1_Missense_Mutation_p.M427I	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	733					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						TCACGGCCATGCCTGAGTCCA	0.493													51	128	---	---	---	---	PASS
NTRK3	4916	broad.mit.edu	37	15	88679149	88679149	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88679149A>C	uc002bme.1	-	8	1050	c.888T>G	c.(886-888)AGT>AGG	p.S296R	NTRK3_uc002bmh.2_Missense_Mutation_p.S296R|NTRK3_uc002bmf.1_Missense_Mutation_p.S296R|NTRK3_uc010upl.1_Missense_Mutation_p.S198R|NTRK3_uc010bnh.1_Missense_Mutation_p.S296R|NTRK3_uc002bmg.2_Missense_Mutation_p.S296R	NM_001012338	NP_001012338	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	296	Ig-like C2-type 1.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGAGGGCAACACTGGCATTGC	0.542			T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			30	66	---	---	---	---	PASS
C15orf42	90381	broad.mit.edu	37	15	90145164	90145164	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90145164G>A	uc002boe.2	+	12	2524	c.2524G>A	c.(2524-2526)GAT>AAT	p.D842N		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	842					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CCCTGAATCTGATGAACTGCA	0.408													52	96	---	---	---	---	PASS
SOLH	6650	broad.mit.edu	37	16	603040	603040	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:603040A>T	uc002chi.2	+	13	3445	c.3082A>T	c.(3082-3084)AGG>TGG	p.R1028W	SOLH_uc002chj.2_Missense_Mutation_p.R88W	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	1028					proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				ACCCCTGCACAGGTGcgcccc	0.333													4	15	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9927957	9927957	+	Intron	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9927957C>A	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TGAAGGTACCCTTACCTTTCC	0.328													44	283	---	---	---	---	PASS
HS3ST4	9951	broad.mit.edu	37	16	26147055	26147055	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26147055T>C	uc002dof.2	+	2	1249	c.857T>C	c.(856-858)GTG>GCG	p.V286A		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	286	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		CTGATTGTGGTGGTGAGAAAC	0.512													34	120	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48172191	48172191	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48172191G>C	uc002efc.1	-	6	1273	c.927C>G	c.(925-927)ATC>ATG	p.I309M	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA|ABCC12_uc002efe.1_Missense_Mutation_p.I309M|ABCC12_uc010vgj.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	309	ABC transmembrane type-1 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				TGATCAGCCTGATGCAGGTCA	0.418													68	139	---	---	---	---	PASS
CTCF	10664	broad.mit.edu	37	16	67662443	67662443	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67662443A>G	uc002etl.2	+	9	1979	c.1689A>G	c.(1687-1689)ACA>ACG	p.T563T	CTCF_uc010cek.2_Silent_p.T235T|CTCF_uc002etm.1_Silent_p.T52T	NM_006565	NP_006556	P49711	CTCF_HUMAN	CCCTC-binding factor	563	C2H2-type 11; atypical.				chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GTGGGAAAACATTTACACGTC	0.463													79	186	---	---	---	---	PASS
DUS2L	54920	broad.mit.edu	37	16	68112719	68112719	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68112719G>C	uc002evi.2	+	17	1461	c.1312G>C	c.(1312-1314)GAG>CAG	p.E438Q	DUS2L_uc002evj.2_Missense_Mutation_p.E438Q|DUS2L_uc010vkk.1_Missense_Mutation_p.E403Q|DUS2L_uc010cez.2_Missense_Mutation_p.E351Q	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2-like, SMM1 homolog	438					tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)		GGGCCTCCCTGAGGGTCGGCT	0.632													16	47	---	---	---	---	PASS
FTSJD1	55783	broad.mit.edu	37	16	71319141	71319141	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71319141G>C	uc010cga.2	-	3	1089	c.683C>G	c.(682-684)ACT>AGT	p.T228S	FTSJD1_uc002ezy.3_Missense_Mutation_p.T228S|FTSJD1_uc002ezz.3_Missense_Mutation_p.T228S	NM_001099642	NP_001093112	Q8IYT2	FTSJ1_HUMAN	FtsJ methyltransferase domain containing 1	228						integral to membrane	methyltransferase activity|nucleic acid binding			skin(1)	1						CAAGTGAACAGTAGCCATGCT	0.423													10	133	---	---	---	---	PASS
TAF1C	9013	broad.mit.edu	37	16	84217394	84217394	+	Intron	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84217394G>C	uc002fhn.2	-						TAF1C_uc002fhm.2_Intron|TAF1C_uc010vnx.1_Intron|TAF1C_uc010vny.1_Intron|TAF1C_uc010vnz.1_Intron|TAF1C_uc002fho.2_Intron|TAF1C_uc010voa.1_Intron|TAF1C_uc002fhp.1_Intron|TAF1C_uc010vob.1_Intron	NM_005679	NP_005670	Q15572	TAF1C_HUMAN	TBP-associated factor 1C isoform 1						regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding			ovary(1)	1						TCTGAAGGGAGGACAATCGCA	0.378													20	41	---	---	---	---	PASS
KIAA0182	23199	broad.mit.edu	37	16	85694958	85694958	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85694958G>A	uc002fix.2	+	9	1921	c.1847G>A	c.(1846-1848)CGC>CAC	p.R616H	KIAA0182_uc002fiw.2_Missense_Mutation_p.R512H|KIAA0182_uc002fiy.2_Missense_Mutation_p.R543H|KIAA0182_uc002fiz.2_5'Flank|KIAA0182_uc010cho.2_5'Flank	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1	616	Pro-rich.						protein binding			large_intestine(3)|ovary(1)|skin(1)	5						GAGCCCAGCCGCCAGGCAGCC	0.667													13	38	---	---	---	---	PASS
GEMIN4	50628	broad.mit.edu	37	17	649357	649357	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:649357C>T	uc002frs.1	-	2	2045	c.1926G>A	c.(1924-1926)GTG>GTA	p.V642V		NM_015721	NP_056536	P57678	GEMI4_HUMAN	gemin 4	642					rRNA processing|spliceosomal snRNP assembly	Cajal body|cytosol|nucleolus|small nuclear ribonucleoprotein complex|spliceosomal complex	protein binding			ovary(2)|kidney(1)|skin(1)	4		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GAAGAGCAGCCACTGGAATCC	0.483													4	117	---	---	---	---	PASS
C17orf85	55421	broad.mit.edu	37	17	3717728	3717728	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3717728A>G	uc010ckl.1	-	12	1538	c.1515T>C	c.(1513-1515)TTT>TTC	p.F505F	C17orf85_uc002fwr.2_Silent_p.F215F|C17orf85_uc002fwq.2_Silent_p.F225F	NM_001114118	NP_001107590	Q53F19	CQ085_HUMAN	ELG protein isoform a	505							nucleotide binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		GGTTACTACTAAAAGCCTTTT	0.498													45	66	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7411633	7411633	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7411633A>G	uc002ghf.3	+	20	3538	c.3304A>G	c.(3304-3306)ATG>GTG	p.M1102V		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	1102					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				TGCCACCCAGATGACCTTGAA	0.542													25	39	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578458	7578458	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578458G>C	uc002gim.2	-	5	666	c.472C>G	c.(472-474)CGC>GGC	p.R158G	TP53_uc002gig.1_Missense_Mutation_p.R158G|TP53_uc002gih.2_Missense_Mutation_p.R158G|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R26G|TP53_uc010cng.1_Missense_Mutation_p.R26G|TP53_uc002gii.1_Missense_Mutation_p.R26G|TP53_uc010cnh.1_Missense_Mutation_p.R158G|TP53_uc010cni.1_Missense_Mutation_p.R158G|TP53_uc002gij.2_Missense_Mutation_p.R158G|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R65G|TP53_uc002gio.2_Missense_Mutation_p.R26G|TP53_uc010vug.1_Missense_Mutation_p.R119G	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	158	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R158H(58)|p.R158L(53)|p.R158C(17)|p.R158G(10)|p.R158P(9)|p.0?(7)|p.R158R(6)|p.R158fs*12(5)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R158fs*11(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.V157_R158delVR(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.R156fs*12(1)|p.R158F(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)|p.R158fs*8(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCCATGGCGCGGACGCGGGTG	0.622		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			25	40	---	---	---	---	PASS
PER1	5187	broad.mit.edu	37	17	8046002	8046002	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8046002G>C	uc002gkd.2	-	20	3462	c.3224C>G	c.(3223-3225)TCC>TGC	p.S1075C	PER1_uc010cns.2_5'Flank|PER1_uc010vuq.1_RNA	NM_002616	NP_002607	O15534	PER1_HUMAN	period 1	1075	Ser-rich.				circadian rhythm|entrainment of circadian clock|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			lung(2)|breast(2)|skin(2)|large_intestine(1)|ovary(1)|kidney(1)	9						CCCTTCATGGGAGCCTGAACC	0.667			T	ETV6	AML|CMML			Other_conserved_DNA_damage_response_genes					31	45	---	---	---	---	PASS
PER1	5187	broad.mit.edu	37	17	8051538	8051538	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8051538C>G	uc002gkd.2	-	9	1326	c.1088G>C	c.(1087-1089)CGG>CCG	p.R363P	PER1_uc010vuq.1_RNA|PER1_uc010vur.1_Missense_Mutation_p.R347P	NM_002616	NP_002607	O15534	PER1_HUMAN	period 1	363	PAS 2.				circadian rhythm|entrainment of circadian clock|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			lung(2)|breast(2)|skin(2)|large_intestine(1)|ovary(1)|kidney(1)	9						GGGTGTGTGCCGCGTAGTGAA	0.597			T	ETV6	AML|CMML			Other_conserved_DNA_damage_response_genes					33	66	---	---	---	---	PASS
SMCR8	140775	broad.mit.edu	37	17	18219655	18219655	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18219655G>C	uc002gsy.3	+	1	1062	c.552G>C	c.(550-552)AAG>AAC	p.K184N		NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	184										central_nervous_system(1)	1						AGTGCTTGAAGACTGGCAACA	0.468													6	84	---	---	---	---	PASS
TUBG1	7283	broad.mit.edu	37	17	40767067	40767067	+	3'UTR	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40767067A>T	uc002ian.2	+	11						NM_001070	NP_001061	P23258	TBG1_HUMAN	tubulin, gamma 1						G2/M transition of mitotic cell cycle|meiotic spindle organization|protein polymerization	condensed nuclear chromosome|cytosol|gamma-tubulin complex|polar microtubule	GTP binding|GTPase activity|protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)		TGAGTCCCCCAGGACAGGGAC	0.597													33	49	---	---	---	---	PASS
MYCBPAP	84073	broad.mit.edu	37	17	48602368	48602368	+	Missense_Mutation	SNP	G	A	A	rs149888826		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48602368G>A	uc010wmr.1	+	13	2057	c.1895G>A	c.(1894-1896)CGG>CAG	p.R632Q	MYCBPAP_uc002iqz.2_RNA	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein	595					cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GACTTGTTCCGGCACAGAAAT	0.572													4	95	---	---	---	---	PASS
PRKCA	5578	broad.mit.edu	37	17	64637581	64637581	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64637581G>A	uc002jfp.1	+	4	441	c.397G>A	c.(397-399)GAC>AAC	p.D133N	PRKCA_uc002jfo.1_Missense_Mutation_p.D4N	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	133	Phorbol-ester/DAG-type 2.				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	GATGAAATGTGACAGTAAGTA	0.463													6	120	---	---	---	---	PASS
CTAGE1	64693	broad.mit.edu	37	18	19997382	19997382	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19997382T>G	uc002ktv.1	-	1	497	c.393A>C	c.(391-393)GAA>GAC	p.E131D		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	131	Potential.					integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					ATTCATTTTGTTCAGAATGTT	0.373													11	323	---	---	---	---	PASS
MEP1B	4225	broad.mit.edu	37	18	29800198	29800198	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29800198A>G	uc002kxj.3	+	15	2143	c.2096A>G	c.(2095-2097)CAT>CGT	p.H699R		NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor	699	Cytoplasmic (Potential).				digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						TTTTAGCAGCATGCTTTTTGA	0.303													9	19	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54398814	54398814	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54398814G>C	uc002lgk.1	+	14	2186	c.1975G>C	c.(1975-1977)GAG>CAG	p.E659Q	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.E659Q	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	659										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		CTTGGCTTCTGAGGCATCTGA	0.398													14	181	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59941201	59941201	+	Intron	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59941201T>C	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				TATCAGTATTTTTCCTCTGTA	0.338													31	143	---	---	---	---	PASS
TMX3	54495	broad.mit.edu	37	18	66367644	66367644	+	Silent	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66367644A>G	uc002lkf.2	-	6	525	c.390T>C	c.(388-390)TCT>TCC	p.S130S	TMX3_uc010xez.1_5'UTR|TMX3_uc010xfa.1_Intron|TMX3_uc002lkg.3_Silent_p.S130S	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor	130	Lumenal (Potential).				cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						TAACTTACCCAGATACTCTGT	0.244													20	211	---	---	---	---	PASS
NETO1	81832	broad.mit.edu	37	18	70417473	70417473	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70417473C>A	uc002lkw.2	-	9	1649	c.1365G>T	c.(1363-1365)TTG>TTT	p.L455F	NETO1_uc002lkx.1_Missense_Mutation_p.L454F|NETO1_uc002lky.1_Missense_Mutation_p.L455F	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3	455	Cytoplasmic (Potential).				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		GCATCTCTGTCAAGATAGAAG	0.488													24	87	---	---	---	---	PASS
FBXO15	201456	broad.mit.edu	37	18	71797764	71797764	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71797764C>A	uc002lle.2	-	4	570	c.234G>T	c.(232-234)TGG>TGT	p.W78C	FBXO15_uc002llf.2_Missense_Mutation_p.W154C	NM_152676	NP_689889	Q8NCQ5	FBX15_HUMAN	F-box protein 15 isoform 1	78										ovary(2)|pancreas(1)	3		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		ATTCTTTCTTCCAATAACCAG	0.378													5	126	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72345581	72345581	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72345581T>G	uc002llw.2	+	1	2663	c.2606T>G	c.(2605-2607)ATT>AGT	p.I869S	ZNF407_uc010xfc.1_Missense_Mutation_p.I869S|ZNF407_uc010dqu.1_Missense_Mutation_p.I869S|ZNF407_uc002llu.2_Missense_Mutation_p.I868S	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	869	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACTGTTCACATTAGACGAAAA	0.413													39	121	---	---	---	---	PASS
ZBTB7A	51341	broad.mit.edu	37	19	4054023	4054023	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4054023G>T	uc002lzh.2	-	2	1283	c.1208C>A	c.(1207-1209)ACC>AAC	p.T403N	ZBTB7A_uc002lzi.2_Missense_Mutation_p.T403N	NM_015898	NP_056982	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	403	C2H2-type 1.				cell differentiation|multicellular organismal development|transcription, DNA-dependent	nucleus	DNA binding|histone acetyltransferase binding|zinc ion binding			pancreas(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGTGTGGGTGCGGATGTG	0.657													7	35	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9027580	9027580	+	Intron	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9027580A>G	uc002mkp.2	-							NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGAAACCTGCACAGAGAAGGA	0.532													18	29	---	---	---	---	PASS
HOOK2	29911	broad.mit.edu	37	19	12881986	12881986	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12881986C>A	uc002muy.2	-	9	919	c.748G>T	c.(748-750)GAG>TAG	p.E250*	HOOK2_uc002muz.2_Nonsense_Mutation_p.E250*	NM_013312	NP_037444	Q96ED9	HOOK2_HUMAN	hook homolog 2 isoform 1	250	Sufficient for interaction with microtubules.|Potential.				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding			ovary(1)|breast(1)|skin(1)	3						AAGTTCTCCTCCTGCAACTGC	0.672													9	11	---	---	---	---	PASS
TMEM161A	54929	broad.mit.edu	37	19	19231853	19231853	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19231853T>A	uc002nlg.2	-	10	1067	c.1037A>T	c.(1036-1038)GAG>GTG	p.E346V	TMEM161A_uc010eca.2_RNA|TMEM161A_uc002nlh.2_Missense_Mutation_p.E321V|TMEM161A_uc002nli.2_Missense_Mutation_p.E243V|TMEM161A_uc002nlj.2_Missense_Mutation_p.E221V	NM_017814	NP_060284	Q9NX61	T161A_HUMAN	transmembrane protein 161A precursor	346	Extracellular (Potential).				cellular response to oxidative stress|cellular response to UV|negative regulation of apoptosis|positive regulation of DNA repair|response to retinoic acid	integral to membrane				breast(2)	2			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			TCGCAGCTGCTCCACCCGGGC	0.692													14	23	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21605734	21605734	+	5'UTR	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21605734T>A	uc002npx.2	+	2					ZNF493_uc002npw.2_Silent_p.A91A|ZNF493_uc002npy.2_5'UTR	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTCATTTTGCTGAAGACTTTT	0.284													42	84	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37903707	37903707	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37903707C>T	uc002ogi.2	-	6	2411	c.1853G>A	c.(1852-1854)AGC>AAC	p.S618N	ZNF569_uc002ogh.2_Missense_Mutation_p.S459N|ZNF569_uc002ogj.2_Missense_Mutation_p.S642N	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	618	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGGGATGAGCTTTGGGAGAA	0.408													91	227	---	---	---	---	PASS
ZNF540	163255	broad.mit.edu	37	19	38102891	38102891	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38102891A>G	uc002ogq.2	+	5	1042	c.710A>G	c.(709-711)CAT>CGT	p.H237R	ZNF540_uc002ogu.2_Missense_Mutation_p.H237R|ZNF540_uc010efq.2_Missense_Mutation_p.H205R	NM_152606	NP_689819	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	237	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGAGATTTCATACTGGTGAG	0.368													6	122	---	---	---	---	PASS
CEACAM21	90273	broad.mit.edu	37	19	42083652	42083652	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083652G>A	uc002ore.3	+	2	261	c.165G>A	c.(163-165)GTG>GTA	p.V55V	CEACAM21_uc002orc.1_RNA|CEACAM21_uc002ord.1_RNA|CEACAM21_uc002orf.2_RNA|CEACAM21_uc002org.3_Silent_p.V55V	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion	55	Extracellular (Potential).					integral to membrane				ovary(1)	1						ATCTCTCTGTGGTTTATCTGC	0.478													30	70	---	---	---	---	PASS
ATP1A3	478	broad.mit.edu	37	19	42480657	42480657	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42480657C>T	uc002osg.2	-	15	2159	c.2005G>A	c.(2005-2007)GAC>AAC	p.D669N	ATP1A3_uc010xwf.1_Missense_Mutation_p.D680N|ATP1A3_uc010xwg.1_Missense_Mutation_p.D639N|ATP1A3_uc010xwh.1_Missense_Mutation_p.D682N|ATP1A3_uc002osh.2_Missense_Mutation_p.D669N	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	669	Cytoplasmic (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						AGGATCTCGTCGATTTGCTCG	0.607													37	93	---	---	---	---	PASS
CCDC61	729440	broad.mit.edu	37	19	46498682	46498682	+	Splice_Site	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46498682G>A	uc002pdw.2	+	2	81	c.81_splice	c.e2-1	p.R27_splice		NM_001080402	NP_001073871			coiled-coil domain containing 61											ovary(1)	1		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		TGACCAATCAGAAGCGAGAAC	0.602													3	12	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47193887	47193887	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47193887G>T	uc002pfh.2	-	14	2121	c.1779C>A	c.(1777-1779)AGC>AGA	p.S593R	PRKD2_uc002pfd.2_5'Flank|PRKD2_uc010eks.2_5'UTR|PRKD2_uc010ekt.2_5'UTR|PRKD2_uc002pfe.2_Missense_Mutation_p.S113R|PRKD2_uc002pff.2_Missense_Mutation_p.S113R|PRKD2_uc002pfg.2_Missense_Mutation_p.S436R|PRKD2_uc002pfi.2_Missense_Mutation_p.S593R|PRKD2_uc002pfj.2_Missense_Mutation_p.S593R|PRKD2_uc010xye.1_Missense_Mutation_p.S593R|PRKD2_uc002pfk.2_Missense_Mutation_p.S436R	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	593	Protein kinase.				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TCCGGAGCTGGCTCTCCTGCT	0.502													30	88	---	---	---	---	PASS
TMEM143	55260	broad.mit.edu	37	19	48866798	48866798	+	Intron	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48866798G>A	uc002pix.1	-						TMEM143_uc002piw.1_Intron|TMEM143_uc002piy.1_Intron|TMEM143_uc010xzn.1_Intron|TMEM143_uc010elw.1_Intron|TMEM143_uc010xzo.1_Intron|TMEM143_uc010xzp.1_Intron|TMEM143_uc010xzq.1_Intron|SYNGR4_uc002piz.2_5'Flank	NM_018273	NP_060743	Q96AN5	TM143_HUMAN	transmembrane protein 143							integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		CCTAAACAGAGGAAAATGGGC	0.637													12	35	---	---	---	---	PASS
PPFIA3	8541	broad.mit.edu	37	19	49652839	49652839	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49652839G>T	uc002pmr.2	+	28	3722	c.3390G>T	c.(3388-3390)TGG>TGT	p.W1130C	PPFIA3_uc010yai.1_RNA|PPFIA3_uc002pms.2_Missense_Mutation_p.W989C|PPFIA3_uc002pmt.2_Missense_Mutation_p.W269C|PPFIA3_uc002pmu.1_Missense_Mutation_p.W179C	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3	1130						cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CCCCATCCTGGCGGAAGATGT	0.627													3	38	---	---	---	---	PASS
SIGLEC7	27036	broad.mit.edu	37	19	51647820	51647820	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51647820C>A	uc002pvv.1	+	2	660	c.591C>A	c.(589-591)ACC>ACA	p.T197T	SIGLEC7_uc002pvw.1_Intron|SIGLEC7_uc010eoq.1_Intron|SIGLEC7_uc010eor.1_Intron	NM_014385	NP_055200	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7 isoform 1	197	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		CCTCCACCACCCGCTCCTCAG	0.662													22	132	---	---	---	---	PASS
HAS1	3036	broad.mit.edu	37	19	52222524	52222524	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52222524C>G	uc002pxo.1	-	2	672	c.637G>C	c.(637-639)GGC>CGC	p.G213R	HAS1_uc010epc.1_5'Flank|HAS1_uc010epd.1_Missense_Mutation_p.G178R|HAS1_uc002pxn.1_Missense_Mutation_p.G220R|HAS1_uc002pxp.1_Missense_Mutation_p.G212R	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1	213	Cytoplasmic (Potential).				cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CGCTTGCCGCCCCAGCGCTGC	0.652													7	48	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328242	57328242	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328242T>A	uc002qnu.2	-	7	1919	c.1568A>T	c.(1567-1569)CAT>CTT	p.H523L	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.H494L|PEG3_uc002qnv.2_Missense_Mutation_p.H523L|PEG3_uc002qnw.2_Missense_Mutation_p.H399L|PEG3_uc002qnx.2_Missense_Mutation_p.H397L|PEG3_uc010etr.2_Missense_Mutation_p.H523L	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	523	C2H2-type 2.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AATCTTCCGATGTTCAGCCAA	0.453													25	294	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57669846	57669846	+	Intron	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57669846G>A	uc002qoa.1	-							NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		CTCTACCTAGGGAAGGCATGG	0.473													31	89	---	---	---	---	PASS
ZNF586	54807	broad.mit.edu	37	19	58290764	58290764	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58290764C>T	uc002qqd.2	+	3	995	c.809C>T	c.(808-810)TCA>TTA	p.S270L	ZNF587_uc002qqb.2_Intron|ZNF586_uc002qqe.2_3'UTR|ZNF586_uc010euh.2_Missense_Mutation_p.S227L|ZNF586_uc002qqf.1_Intron	NM_017652	NP_060122	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	270	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGTGGAAAATCATTTCGCCGA	0.428													24	81	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3674246	3674246	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3674246T>C	uc002wja.2	-	13	3356	c.3356A>G	c.(3355-3357)TAC>TGC	p.Y1119C	SIGLEC1_uc002wjb.1_5'Flank|SIGLEC1_uc002wiz.3_Missense_Mutation_p.Y1119C	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1119	Ig-like C2-type 11.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						GTACCATGTGTAGGTGAGCTG	0.662													10	27	---	---	---	---	PASS
PROKR2	128674	broad.mit.edu	37	20	5283025	5283025	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5283025C>T	uc010zqw.1	-	2	816	c.816G>A	c.(814-816)AAG>AAA	p.K272K	PROKR2_uc010zqx.1_Silent_p.K272K|PROKR2_uc010zqy.1_Silent_p.K272K	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	272	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CCAGGACCGTCTTCCTGCGGC	0.597										HNSCC(71;0.22)			15	38	---	---	---	---	PASS
PLK1S1	55857	broad.mit.edu	37	20	21143633	21143633	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21143633G>A	uc002wsb.2	+	6	1318	c.1185G>A	c.(1183-1185)CAG>CAA	p.Q395Q	PLK1S1_uc010zsh.1_Silent_p.Q292Q|PLK1S1_uc010zsi.1_Silent_p.Q262Q|PLK1S1_uc010zsj.1_RNA|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_RNA	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1	395					spindle organization	centrosome	protein kinase binding				0						CAGAACCACAGCCAAATCCAG	0.433													19	57	---	---	---	---	PASS
NKX2-2	4821	broad.mit.edu	37	20	21494122	21494122	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21494122C>T	uc002wsi.2	-	1	543	c.186G>A	c.(184-186)AAG>AAA	p.K62K		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	62					brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						AGAAGGGGTTCTTCAGGGGCA	0.677													11	28	---	---	---	---	PASS
REM1	28954	broad.mit.edu	37	20	30070090	30070090	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30070090G>A	uc002wwa.2	+	4	708	c.424G>A	c.(424-426)GAT>AAT	p.D142N		NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM	142					small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TCTCCTGCAGGATAAAAGCTG	0.582													32	72	---	---	---	---	PASS
C20orf185	359710	broad.mit.edu	37	20	31656643	31656643	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31656643T>C	uc002wym.1	+	10	1013	c.1013T>C	c.(1012-1014)CTA>CCA	p.L338P		NM_182658	NP_872599	P59826	LPLC3_HUMAN	antimicrobial peptide RYA3 precursor	338					innate immune response	cytoplasm|extracellular region	lipid binding|protein binding			ovary(4)	4						CAGCAACTCCTACTGTTCCTG	0.522													4	96	---	---	---	---	PASS
SAMHD1	25939	broad.mit.edu	37	20	35526237	35526237	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35526237G>A	uc002xgh.1	-	15	1864	c.1734C>T	c.(1732-1734)TTC>TTT	p.F578F	SAMHD1_uc010gft.1_RNA	NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	578					defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				GCGGCTTGGTGAAATTTCTGT	0.388													5	111	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37169683	37169683	+	Splice_Site	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37169683G>C	uc002xiw.2	+	18	2820	c.2563_splice	c.e18-1	p.D855_splice	RALGAPB_uc002xix.2_Splice_Site_p.D851_splice|RALGAPB_uc002xiy.1_Splice_Site_p.D855_splice|RALGAPB_uc002xiz.2_Splice_Site_p.D633_splice|RALGAPB_uc002xja.1_Splice_Site_p.D582_splice	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						CCTGCTTTTAGGACTGCCTTA	0.318													44	133	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40045305	40045305	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40045305G>A	uc002xka.1	-	33	6587	c.6409C>T	c.(6409-6411)CGA>TGA	p.R2137*	CHD6_uc002xjz.1_5'Flank	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2137					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				AGGCTGGTTCGAGAACCAGCA	0.587													36	81	---	---	---	---	PASS
C20orf106	200232	broad.mit.edu	37	20	55100911	55100911	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55100911A>T	uc002xxx.2	+	2	381	c.301A>T	c.(301-303)AAA>TAA	p.K101*	GCNT7_uc010zzg.1_5'UTR|C20orf107_uc010zzh.1_Intron	NM_001012971	NP_001012989	Q5JX71	CT106_HUMAN	hypothetical protein LOC200232 precursor	101	Cytoplasmic (Potential).					integral to membrane					0			Colorectal(105;0.202)			TCCATTAAAGAAAAAAAGAAA	0.428													74	226	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38573770	38573770	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38573770C>T	uc002yvz.2	+	46	6078	c.5973C>T	c.(5971-5973)AGC>AGT	p.S1991S	TTC3_uc002ywa.2_Silent_p.S1991S|TTC3_uc002ywb.2_Silent_p.S1991S|TTC3_uc010gnf.2_Silent_p.S1756S|TTC3_uc002ywc.2_Silent_p.S1681S	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1991	RING-type.				protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				AAGGGCAGAGCGCTTGCCCGG	0.537													4	128	---	---	---	---	PASS
GGT5	2687	broad.mit.edu	37	22	24615949	24615949	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24615949C>A	uc002zzo.3	-	12	2167	c.1750G>T	c.(1750-1752)GCA>TCA	p.A584S	GGT5_uc002zzp.3_Missense_Mutation_p.A585S|GGT5_uc002zzr.3_Missense_Mutation_p.A552S|GGT5_uc002zzq.3_3'UTR|GGT5_uc011ajm.1_Missense_Mutation_p.A508S	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b	584	Extracellular (Potential).				glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						TAGTAGCCTGCGGCCTCCCCA	0.637													19	52	---	---	---	---	PASS
ENTHD1	150350	broad.mit.edu	37	22	40139799	40139799	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40139799A>G	uc003ayg.2	-	7	1960	c.1709T>C	c.(1708-1710)ATC>ACC	p.I570T		NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	570	Potential.									ovary(2)|skin(1)	3	Melanoma(58;0.0749)					AAGTTCTTGGATCACTGTGCT	0.443													37	127	---	---	---	---	PASS
GYG2	8908	broad.mit.edu	37	X	2773121	2773121	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2773121G>T	uc004cqs.1	+	6	787	c.505G>T	c.(505-507)GTG>TTG	p.V169L	GYG2_uc004cqt.1_Missense_Mutation_p.V138L|GYG2_uc004cqu.1_Missense_Mutation_p.V138L|GYG2_uc004cqv.1_5'UTR|GYG2_uc004cqw.1_Missense_Mutation_p.V129L|GYG2_uc004cqx.1_Missense_Mutation_p.V138L|GYG2_uc010ndc.1_5'UTR	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	169					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAATAGCGGGGTGTTTGTCTT	0.572													58	127	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11312966	11312966	+	Intron	SNP	A	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11312966A>C	uc004cup.1	-						ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_Intron|AMELX_uc004cut.2_Intron|AMELX_uc004cuu.2_Intron	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						CATGCCTGTGAGTAAAACACC	0.403													100	209	---	---	---	---	PASS
CA5B	11238	broad.mit.edu	37	X	15793398	15793398	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15793398A>T	uc004cxe.2	+	6	702	c.585A>T	c.(583-585)AAA>AAT	p.K195N		NM_007220	NP_009151	Q9Y2D0	CAH5B_HUMAN	carbonic anhydrase VB, mitochondrial precursor	195					one-carbon metabolic process	mitochondrion	carbonate dehydratase activity|zinc ion binding				0	Hepatocellular(33;0.183)					AGCTACAGAAATTAGTGGATA	0.323													15	162	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17750110	17750110	+	Silent	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17750110C>A	uc004cxx.2	+	8	4757	c.4419C>A	c.(4417-4419)CCC>CCA	p.P1473P	NHS_uc011mix.1_Silent_p.P1494P|NHS_uc004cxy.2_Silent_p.P1317P|NHS_uc004cxz.2_Silent_p.P1296P|NHS_uc004cya.2_Silent_p.P1196P	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1473						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					TGACAACCCCCAACAGCCAGA	0.512													76	238	---	---	---	---	PASS
GPR64	10149	broad.mit.edu	37	X	19028829	19028829	+	Silent	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19028829G>T	uc004cyx.2	-	17	1331	c.1167C>A	c.(1165-1167)TCC>TCA	p.S389S	GPR64_uc004cyy.2_Silent_p.S386S|GPR64_uc004cyz.2_Silent_p.S375S|GPR64_uc004czb.2_Silent_p.S389S|GPR64_uc004czc.2_Silent_p.S373S|GPR64_uc004czd.2_Silent_p.S365S|GPR64_uc004cze.2_Silent_p.S359S|GPR64_uc004czf.2_Silent_p.S351S|GPR64_uc004cza.2_Silent_p.S367S|GPR64_uc004cyw.2_Silent_p.S373S|GPR64_uc010nfj.2_Silent_p.S359S	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	389	Extracellular (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					GGCTGCCCAAGGACAGAGCCT	0.502													91	256	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26179876	26179876	+	IGR	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26179876T>C								MAGEB18 (21024 upstream) : MAGEB6 (30681 downstream)																							TCCCGGTTTATACCCACATCT	0.522													79	223	---	---	---	---	PASS
MAGEB10	139422	broad.mit.edu	37	X	27839977	27839977	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27839977A>G	uc004dbw.2	+	3	781	c.554A>G	c.(553-555)GAT>GGT	p.D185G		NM_182506	NP_872312	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	185	MAGE.									lung(1)|breast(1)|central_nervous_system(1)	3						AACAAACTAGATCTAGGCTGT	0.478													11	161	---	---	---	---	PASS
BCOR	54880	broad.mit.edu	37	X	39934138	39934138	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39934138C>G	uc004den.3	-	4	753	c.461G>C	c.(460-462)GGA>GCA	p.G154A	BCOR_uc004dep.3_Missense_Mutation_p.G154A|BCOR_uc004deo.3_Missense_Mutation_p.G154A|BCOR_uc004dem.3_Missense_Mutation_p.G154A|BCOR_uc004deq.3_Missense_Mutation_p.G154A	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	154					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						TTTTTGTATTCCAGGCGGTGT	0.512													25	82	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41075775	41075775	+	Silent	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41075775A>T	uc004dfb.2	+	35	6588	c.5955A>T	c.(5953-5955)TCA>TCT	p.S1985S	USP9X_uc004dfc.2_Silent_p.S1985S	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	1985					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						TTATGCCATCAGCCATTGAGA	0.368													85	166	---	---	---	---	PASS
TBC1D25	4943	broad.mit.edu	37	X	48418240	48418240	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48418240A>G	uc004dka.1	+	6	1055	c.944A>G	c.(943-945)CAC>CGC	p.H315R	TBC1D25_uc011mly.1_Missense_Mutation_p.H257R|TBC1D25_uc004dkb.1_Missense_Mutation_p.H61R|TBC1D25_uc011mlz.1_Missense_Mutation_p.H61R|TBC1D25_uc011mma.1_Missense_Mutation_p.H61R|TBC1D25_uc004dkc.1_Missense_Mutation_p.H61R|TBC1D25_uc011mmb.1_Missense_Mutation_p.H319R|TBC1D25_uc011mmc.1_Missense_Mutation_p.H61R|TBC1D25_uc011mmd.1_Missense_Mutation_p.H61R	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	315	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			ovary(1)	1						CGGGCGCTGCACGACCTGCTC	0.617													16	51	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50094351	50094351	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50094351T>C	uc004dox.3	+	12	4370	c.4072T>C	c.(4072-4074)TAT>CAT	p.Y1358H	CCNB3_uc004doy.2_Missense_Mutation_p.Y1358H|CCNB3_uc004doz.2_Missense_Mutation_p.Y254H|CCNB3_uc010njq.2_Missense_Mutation_p.Y250H|CCNB3_uc004dpa.2_Missense_Mutation_p.Y197H	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	1358					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					CAAGGCTGTGTATTACAAGTA	0.453													146	321	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	51149908	51149908	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51149908C>T	uc004dpj.2	+	1	142	c.40C>T	c.(40-42)CAG>TAG	p.Q14*		NM_203407	NP_981952			hypothetical protein LOC340602																		GCAGAAGCACCAGCAGGACGA	0.627													9	36	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67936270	67936270	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67936270G>T	uc004dxa.2	+	4	426	c.54G>T	c.(52-54)AAG>AAT	p.K18N	STARD8_uc004dxb.2_Missense_Mutation_p.K98N|STARD8_uc004dxc.3_Missense_Mutation_p.K18N	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	18					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						TTCAAAGCAAGCAGGTGAGTC	0.478													18	61	---	---	---	---	PASS
OTUD6A	139562	broad.mit.edu	37	X	69283241	69283241	+	Nonstop_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69283241G>T	uc004dxu.1	+	1	901	c.867G>T	c.(865-867)TAG>TAT	p.*289Y		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	289										lung(1)|skin(1)	2						GTCTCCTGTAGGCCCCAAGGC	0.567													4	12	---	---	---	---	PASS
NLGN3	54413	broad.mit.edu	37	X	70389799	70389799	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70389799C>A	uc004dzb.2	+	7	2643	c.2339C>A	c.(2338-2340)CCG>CAG	p.P780Q	NLGN3_uc004dzc.2_Missense_Mutation_p.P663Q|NLGN3_uc011mps.1_Missense_Mutation_p.P760Q|NLGN3_uc004dze.2_Missense_Mutation_p.P598Q	NM_018977	NP_061850	Q9NZ94	NLGN3_HUMAN	neuroligin 3	800	Cytoplasmic (Potential).				neuron cell-cell adhesion|positive regulation of synaptogenesis|receptor-mediated endocytosis|social behavior|synapse assembly	cell surface|endocytic vesicle|integral to plasma membrane|synapse	neurexin binding|receptor activity			ovary(1)	1	Renal(35;0.156)					CGGCGCTCCCCGGATGACATC	0.632													9	13	---	---	---	---	PASS
ATRX	546	broad.mit.edu	37	X	76938248	76938248	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76938248C>T	uc004ecp.3	-	9	2732	c.2500G>A	c.(2500-2502)GCC>ACC	p.A834T	ATRX_uc004ecq.3_Missense_Mutation_p.A796T|ATRX_uc004eco.3_Missense_Mutation_p.A619T|ATRX_uc004ecr.2_Missense_Mutation_p.A766T|ATRX_uc010nlx.1_Missense_Mutation_p.A805T|ATRX_uc010nly.1_Missense_Mutation_p.A779T	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	834					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	GTGGTTCTGGcagcaccaatt	0.219			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						24	566	---	---	---	---	PASS
CSTF2	1478	broad.mit.edu	37	X	100087736	100087736	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100087736C>A	uc004egh.2	+	10	1103	c.1045C>A	c.(1045-1047)CCA>ACA	p.P349T	CSTF2_uc010nnd.2_Missense_Mutation_p.P369T|CSTF2_uc004egi.2_Missense_Mutation_p.P332T	NM_001325	NP_001316	P33240	CSTF2_HUMAN	cleavage stimulation factor subunit 2	349	Gly/Pro-rich.				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cleavage body|mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding			skin(1)	1						TTACTTGGGACCACCTCATCA	0.493													11	52	---	---	---	---	PASS
MUM1L1	139221	broad.mit.edu	37	X	105451326	105451326	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105451326A>G	uc004emf.1	+	4	2550	c.1901A>G	c.(1900-1902)AAA>AGA	p.K634R	MUM1L1_uc004emg.1_Missense_Mutation_p.K634R	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	634										ovary(2)|pancreas(1)|skin(1)	4						GATAAAATTAAATTTATCCTA	0.338													5	20	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123199799	123199799	+	Intron	SNP	A	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123199799A>C	uc004etz.3	+						STAG2_uc004eua.2_Intron|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Intron|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TTTCATAAGTAAGTTGAATTT	0.299													59	116	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123680714	123680714	+	Intron	SNP	A	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123680714A>T	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TAAAATAAATACATATGTACC	0.368													41	111	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125299528	125299528	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299528G>A	uc004euk.1	-	1	407	c.380C>T	c.(379-381)TCA>TTA	p.S127L		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	127										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						GATGTGGCCTGACTGCACGTC	0.642													48	139	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129189940	129189940	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129189940G>T	uc004evb.1	+	13	5079	c.4965G>T	c.(4963-4965)GAG>GAT	p.E1655D	BCORL1_uc004evc.1_Missense_Mutation_p.E491D	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1655					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						CCAAGGCCGAGTTCTACAGGC	0.597													63	198	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142718090	142718090	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142718090G>A	uc004fbx.2	-	2	1211	c.835C>T	c.(835-837)CAG>TAG	p.Q279*	SLITRK4_uc004fby.2_Nonsense_Mutation_p.Q279*	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	279	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TTTTCCAGCTGAGATGGAGGC	0.438													82	181	---	---	---	---	PASS
FMR1	2332	broad.mit.edu	37	X	147024736	147024736	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147024736G>C	uc010nst.2	+	14	1550	c.1361G>C	c.(1360-1362)CGT>CCT	p.R454P	FMR1_uc004fcj.2_Missense_Mutation_p.R431P|FMR1_uc004fck.3_Missense_Mutation_p.R433P|FMR1_uc004fcl.3_Missense_Mutation_p.R294P|FMR1_uc011mxa.1_Missense_Mutation_p.R101P	NM_002024	NP_002015	Q06787	FMR1_HUMAN	fragile X mental retardation 1	454	Interaction with RANBP9.				mRNA transport|negative regulation of translational initiation	cytoplasm|mRNA cap binding complex|nucleolus|nucleoplasm|soluble fraction	mRNA binding|protein binding			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CCACCAAATCGTACAGATAAG	0.448									Fragile_X_syndrome				73	252	---	---	---	---	PASS
TMEM185A	84548	broad.mit.edu	37	X	148685678	148685678	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148685678T>C	uc011mxq.1	-	5	793	c.482A>G	c.(481-483)GAC>GGC	p.D161G	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|TMEM185A_uc011mxp.1_Missense_Mutation_p.D102G|TMEM185A_uc004fdo.2_Intron|TMEM185A_uc004fdp.3_Missense_Mutation_p.D78G	NM_032508	NP_115897	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	161	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GATGATCTTGTCCAGTCTTAA	0.254													5	143	---	---	---	---	PASS
PRRG3	79057	broad.mit.edu	37	X	150869314	150869314	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150869314G>C	uc004few.1	+	4	895	c.505G>C	c.(505-507)GTC>CTC	p.V169L		NM_024082	NP_076987	Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3	169	Cytoplasmic (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGACCACAGTCCGGCTAGA	0.672													19	61	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152818658	152818658	+	Silent	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152818658C>T	uc004fht.1	+	11	2115	c.1989C>T	c.(1987-1989)AAC>AAT	p.N663N	ATP2B3_uc004fhs.1_Silent_p.N663N	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	663	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACTGGGACAACGAGAATGAGG	0.622													24	132	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152821585	152821585	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152821585C>T	uc004fht.1	+	12	2263	c.2137C>T	c.(2137-2139)CGG>TGG	p.R713W	ATP2B3_uc004fhs.1_Missense_Mutation_p.R713W	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	713	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAACACGGCCCGGGCCATCGC	0.587													49	120	---	---	---	---	PASS
PNCK	139728	broad.mit.edu	37	X	152937050	152937050	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152937050C>A	uc011myu.1	-	6	927	c.741G>T	c.(739-741)CAG>CAT	p.Q247H	PNCK_uc011myt.1_Missense_Mutation_p.Q181H|PNCK_uc004fia.2_Missense_Mutation_p.Q176H|PNCK_uc004fhz.3_Missense_Mutation_p.Q62H|PNCK_uc010nuh.2_3'UTR|PNCK_uc011myv.1_Missense_Mutation_p.Q191H|PNCK_uc011myw.1_Missense_Mutation_p.Q191H	NM_001039582	NP_001034671	Q6P2M8	KCC1B_HUMAN	pregnancy upregulated non-ubiquitously expressed	164	Protein kinase.					cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGTTCCCAGCCTGGATTTTGG	0.597													74	206	---	---	---	---	PASS
PDZD4	57595	broad.mit.edu	37	X	153070266	153070266	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153070266G>T	uc004fiz.1	-	8	1102	c.852C>A	c.(850-852)GAC>GAA	p.D284E	PDZD4_uc004fiy.1_Missense_Mutation_p.D209E|PDZD4_uc004fix.2_Missense_Mutation_p.D188E|PDZD4_uc004fja.1_Missense_Mutation_p.D290E|PDZD4_uc011mze.1_Missense_Mutation_p.D175E	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	284						cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGTGCTCTCGTCAGTCCGGC	0.667													10	85	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153585881	153585881	+	Silent	SNP	G	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153585881G>A	uc004fkk.2	-	29	5115	c.4866C>T	c.(4864-4866)TAC>TAT	p.Y1622Y	FLNA_uc011mzn.1_Translation_Start_Site|FLNA_uc010nuu.1_Silent_p.Y1622Y	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1622	Filamin 14.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGTCACCACCGTACTTGATGA	0.617													19	38	---	---	---	---	PASS
CLIC2	1193	broad.mit.edu	37	X	154507354	154507354	+	Intron	SNP	C	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154507354C>T	uc004fnf.2	-							NM_001289	NP_001280	O15247	CLIC2_HUMAN	chloride intracellular channel 2						signal transduction	chloride channel complex|cytoplasm|nucleus	voltage-gated chloride channel activity			large_intestine(1)|ovary(1)|skin(1)	3	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGGCAGCAACCTAGAATTTTG	0.388													33	114	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11585503	11585504	+	Intron	INS	-	C	C	rs139641245	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11585503_11585504insC	uc001ash.3	+						PTCHD2_uc001asi.1_Intron	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2						cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCTCCCCTAAACCAGCCATGTC	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18427841	18427848	+	IGR	DEL	CTTCCTTT	-	-	rs72072517		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18427841_18427848delCTTCCTTT								ACTL8 (274285 upstream) : IGSF21 (6392 downstream)																							tctttccttccttcctttcttcctttct	0.168													4	2	---	---	---	---	
BMP8A	353500	broad.mit.edu	37	1	39988318	39988319	+	Intron	INS	-	TTG	TTG	rs139401553	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39988318_39988319insTTG	uc001cdi.2	+						PPIEL_uc001cdj.1_Intron|PPIEL_uc001cdk.2_Intron	NM_181809	NP_861525	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8A precursor						cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGAAAGGGTTTTGTTGTTGTT	0.356													4	3	---	---	---	---	
PRKACB	5567	broad.mit.edu	37	1	84640700	84640701	+	Intron	INS	-	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84640700_84640701insT	uc001djj.2	+						PRKACB_uc001djl.2_Intron|PRKACB_uc010ort.1_Intron|PRKACB_uc001djn.2_Intron|PRKACB_uc010oru.1_Intron|PRKACB_uc001djp.2_Intron|PRKACB_uc001djq.2_Intron|PRKACB_uc001dji.2_Intron|PRKACB_uc001djk.2_Intron|PRKACB_uc001djo.1_Intron|PRKACB_uc009wcf.1_Intron	NM_002731	NP_002722	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		TTTCTAATTTATTTTTTGGACA	0.218													4	2	---	---	---	---	
SYDE2	84144	broad.mit.edu	37	1	85665735	85665735	+	Intron	DEL	A	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85665735delA	uc009wcm.2	-						SYDE2_uc001dku.3_Intron	NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2						activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		GATTAAAAAGAAAAAAAAAAG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156606225	156606235	+	IGR	DEL	TTTCTTTCTTT	-	-	rs57630481	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156606225_156606235delTTTCTTTCTTT								HAPLN2 (10708 upstream) : BCAN (5505 downstream)																							tctttctttctttctttctttctttctttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12607546	12607549	+	Intron	DEL	CTAT	-	-	rs7568368		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12607546_12607549delCTAT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		tccttccttcctatcttccttcct	0.093													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91766815	91766816	+	IGR	INS	-	T	T	rs148718335		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91766815_91766816insT								None (None upstream) : LOC654342 (38376 downstream)																							AGATAGACTCCttttttttgag	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103992	113103992	+	IGR	DEL	C	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103992delC								ZC3H6 (6352 upstream) : RGPD8 (21974 downstream)																							tcaccaccatcaccactgcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129393430	129393437	+	IGR	DEL	CCTTCCTT	-	-	rs72091728		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129393430_129393437delCCTTCCTT								HS6ST1 (317259 upstream) : None (None downstream)																							tccctccctcccttccttccttccttcc	0.192													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156126552	156126552	+	IGR	DEL	A	-	-	rs77418096		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156126552delA								KCNJ3 (413538 upstream) : None (None downstream)																							ccataatggcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NSUN3	63899	broad.mit.edu	37	3	93844904	93844904	+	Intron	DEL	A	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93844904delA	uc003drl.1	+							NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3								methyltransferase activity			skin(1)	1						actctgtctcaaaaaaaaaaa	0.169													5	4	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191888074	191888074	+	Intron	DEL	A	-	-	rs11293703		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191888074delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		gcctcaaaagaaaaaaaaaaa	0.159													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7725875	7725877	+	Intron	DEL	GTG	-	-	rs150201814	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7725875_7725877delGTG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ggtgatggtcgtggtggtggtgg	0.099													4	2	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39851220	39851220	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39851220delG	uc003guv.3	-	27	3679	c.3139delC	c.(3139-3141)CATfs	p.H1047fs	PDS5A_uc010ifo.2_Frame_Shift_Del_p.H1007fs	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	1047					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ATAAAGGCATGGCTATTGTTT	0.378													48	28	---	---	---	---	
EXOC1	55763	broad.mit.edu	37	4	56726892	56726895	+	Intron	DEL	TGAC	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56726892_56726895delTGAC	uc003hbe.1	+						EXOC1_uc003hbf.1_Intron|EXOC1_uc003hbg.1_Intron	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1						exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					AAAATTACTTTGACTGTATACATT	0.211													5	5	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79205383	79205384	+	Intron	INS	-	T	T	rs75951231		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79205383_79205384insT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc003hky.1_Intron|FRAS1_uc003hkz.2_Intron|FRAS1_uc003hla.1_5'Flank	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ATTGGAATGTAttttttttttt	0.347													10	5	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	164449736	164449737	+	3'UTR	INS	-	TGTT	TGTT	rs144407064	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164449736_164449737insTGTT	uc003iqs.1	-	8					MARCH1_uc003iqr.1_3'UTR	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GGCATTTGGTCTGTTTGTTTTT	0.371													5	3	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1093609	1093610	+	Intron	INS	-	GGGCGGGGACT	GGGCGGGGACT	rs138268307	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1093609_1093610insGGGCGGGGACT	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGGGACACACGGGGCGGGGACT	0.668													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14044833	14044834	+	IGR	INS	-	AA	AA			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14044833_14044834insAA								DNAH5 (100244 upstream) : TRIO (98995 downstream)																							aggaaggaaggaaggaaggaaa	0.000													6	5	---	---	---	---	
FAM105B	90268	broad.mit.edu	37	5	14681342	14681343	+	Intron	INS	-	T	T	rs71603726		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14681342_14681343insT	uc003jfk.2	+							NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)					TTTTTCTTGCCTTTTTTTTTTT	0.337													8	6	---	---	---	---	
PBX2	5089	broad.mit.edu	37	6	32157697	32157697	+	5'UTR	DEL	G	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32157697delG	uc003oav.1	-	1					PBX2_uc003oaw.2_5'UTR	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2								transcription factor binding			ovary(1)	1						GTCCATAGCTGGGGGGGGGCC	0.602													6	4	---	---	---	---	
SLC26A8	116369	broad.mit.edu	37	6	35927057	35927057	+	Intron	DEL	T	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35927057delT	uc003olm.2	-						SLC26A8_uc010jwa.2_Intron|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						ATCTTGTGCCTTTTTTTTTTC	0.413													4	2	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40489061	40489061	+	Intron	DEL	A	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40489061delA	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						GTTAGCAACTAAAAGTATAGG	0.383													8	5	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99040865	99040872	+	Intron	DEL	CCACTTTC	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99040865_99040872delCCACTTTC	uc011kiw.1	-						CPSF4_uc003uqi.2_Intron|CPSF4_uc003uqj.2_Intron|CPSF4_uc003uqk.2_Intron|CPSF4_uc011kix.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GTAATTTTCACCACTTTCTTCTCTGCTG	0.428													8	5	---	---	---	---	
STRA8	346673	broad.mit.edu	37	7	134936765	134936766	+	Intron	INS	-	GT	GT	rs142941773	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134936765_134936766insGT	uc011kpx.1	+							NM_182489	NP_872295	Q7Z7C7	STRA8_HUMAN	STRA8						DNA replication|regulation of transcription, DNA-dependent	cytoplasm|nucleus					0						agagagagagagtgtgtgtgtg	0.183													4	3	---	---	---	---	
CREB3L2	64764	broad.mit.edu	37	7	137583787	137583788	+	Intron	INS	-	AAAAAGAAAGAAAG	AAAAAGAAAGAAAG	rs113900167		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137583787_137583788insAAAAAGAAAGAAAG	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vtv.2_Intron	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						agaaaggaagaaaaaagaaaga	0.000			T	FUS	fibromyxoid sarcoma								7	4	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12397630	12397631	+	Intron	INS	-	A	A	rs144512072	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12397630_12397631insA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						ATACTATTATTAATTTTGGGGG	0.208													9	4	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110460747	110460747	+	Intron	DEL	T	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110460747delT	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			gtttgtttggttttttttttt	0.090										HNSCC(38;0.096)			5	4	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126202595	126202595	+	Intron	DEL	A	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126202595delA	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron|DENND1A_uc010mwh.1_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						aaacaaaaataaaaaaaaaac	0.458													20	14	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32307648	32307649	+	Intron	INS	-	A	A	rs144717631	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32307648_32307649insA	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				TGCTGTCTTTCaaaaaaaaaat	0.178													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112210759	112210760	+	IGR	DEL	AA	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112210759_112210760delAA								SMNDC1 (146052 upstream) : DUSP5 (46865 downstream)																							GATGCAGaagaaaaaaaaaaaa	0.406													4	2	---	---	---	---	
MRVI1	10335	broad.mit.edu	37	11	10653738	10653738	+	Intron	DEL	T	-	-	rs72349102		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10653738delT	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron|MRVI1_uc010rce.1_Intron	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		tctttctttcttttttttttt	0.070													4	2	---	---	---	---	
PARVA	55742	broad.mit.edu	37	11	12499254	12499255	+	Intron	INS	-	C	C	rs148790777	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12499254_12499255insC	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		acatagtgagaccccatctcaa	0.109													6	6	---	---	---	---	
LRTOMT	220074	broad.mit.edu	37	11	71806723	71806723	+	3'UTR	DEL	T	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71806723delT	uc001orr.2	+	6					LRTOMT_uc009ysz.2_RNA|LRTOMT_uc010rqt.1_3'UTR|LRTOMT_uc010rqu.1_3'UTR|LRTOMT_uc009yta.2_RNA|LRTOMT_uc010rqv.1_Intron|LRTOMT_uc010rqw.1_Intron|LRTOMT_uc001ors.3_Intron|LRTOMT_uc010rqs.1_Intron	NM_145309	NP_660352	Q96E66	LRC51_HUMAN	leucine rich transmembrane and							cytoplasm					0						ttttcttttcttttttttttt	0.184													2	4	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892814	76892820	+	Intron	DEL	TTTTTTT	-	-	rs10522799		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892814_76892820delTTTTTTT	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CCTTCTCAAGtttttttttttgttttt	0.295													4	4	---	---	---	---	
KRT75	9119	broad.mit.edu	37	12	52827176	52827176	+	Intron	DEL	A	-	-	rs113631887		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52827176delA	uc001saj.2	-							NM_004693	NP_004684	O95678	K2C75_HUMAN	keratin 75							keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.192)		ACTCCAACCCAAAAGGAGGCA	0.478													7	4	---	---	---	---	
IRAK3	11213	broad.mit.edu	37	12	66629084	66629085	+	Intron	INS	-	GCGGGC	GCGGGC	rs139344896	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66629084_66629085insGCGGGC	uc001sth.2	+						IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3						interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		gggccgcggcggcgggcgcggg	0.431													4	2	---	---	---	---	
VEZT	55591	broad.mit.edu	37	12	95676570	95676571	+	Intron	DEL	AA	-	-	rs113129038		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95676570_95676571delAA	uc001tdz.2	+						VEZT_uc009ztb.1_Intron|VEZT_uc009ztc.1_Intron|VEZT_uc001tdy.2_Intron	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane							acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						TAAATATAGCaaaaaaaaaaaa	0.302													5	4	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118517627	118517630	+	Intron	DEL	TTTC	-	-	rs66686401		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118517627_118517630delTTTC	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						CACCTTTGCAtttctttctttctt	0.221													4	2	---	---	---	---	
HNF1A	6927	broad.mit.edu	37	12	121437471	121437471	+	Intron	DEL	C	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121437471delC	uc001tzg.2	+						HNF1A_uc010szn.1_Intron	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha						glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACTGTCCCTGCCCCCTTCCAT	0.672									Hepatic_Adenoma_Familial_Clustering_of				17	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480461	98480462	+	IGR	INS	-	CTTT	CTTT	rs149441117	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480461_98480462insCTTT								C14orf64 (36000 upstream) : C14orf177 (697488 downstream)																							ttccttccttcctttctttctc	0.000													5	4	---	---	---	---	
BRF1	2972	broad.mit.edu	37	14	105686239	105686239	+	Intron	DEL	G	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105686239delG	uc001yqp.2	-						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yqk.2_Intron|BRF1_uc001yql.2_Intron|BRF1_uc001yqo.2_Intron|BRF1_uc010axg.1_Intron|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axi.1_Intron	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		AAGAGAGTGTGGGGGGGGGTC	0.711													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106573051	106573052	+	Intron	INS	-	C	C			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106573051_106573052insC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						CTGGAGAAGTTCCTGGGGAAAT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28948128	28948129	+	5'Flank	INS	-	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28948128_28948129insA	uc001zcc.2	+						uc001zcd.2_5'Flank					DQ578707																		GCGCTGGCAGCCACCCTCTGCT	0.649													4	2	---	---	---	---	
ATPBD4	89978	broad.mit.edu	37	15	35834917	35834918	+	Intron	INS	-	TA	TA	rs148757442	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35834917_35834918insTA	uc001zja.2	-						ATPBD4_uc001ziz.2_5'Flank|ATPBD4_uc001zjb.2_Intron	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1												0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		GCTTAAGAAACTATATATATAT	0.272													3	3	---	---	---	---	
ONECUT1	3175	broad.mit.edu	37	15	53082264	53082265	+	5'Flank	DEL	GT	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53082264_53082265delGT	uc002aci.1	-							NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1						endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		gtgcgtgtgcgtgtgtgtgtgt	0.337													3	3	---	---	---	---	
SLCO3A1	28232	broad.mit.edu	37	15	92694019	92694020	+	Intron	INS	-	A	A			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92694019_92694020insA	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			ACTTTAGGCAGAAAAAAAAAAA	0.337													6	3	---	---	---	---	
NAE1	8883	broad.mit.edu	37	16	66839541	66839541	+	Intron	DEL	A	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66839541delA	uc002eqf.2	-						NAE1_uc002eqe.2_Intron|NAE1_uc002eqg.2_Intron|NAE1_uc010cdv.2_Intron	NM_003905	NP_003896	Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1 isoform a						apoptosis|cell cycle|DNA replication|mitotic cell cycle DNA replication checkpoint|protein neddylation|signal transduction	cytoplasm|insoluble fraction|plasma membrane	catalytic activity|protein heterodimerization activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	actgcgtctcaaaaaaaaaaa	0.124													2	4	---	---	---	---	
TMCO7	79613	broad.mit.edu	37	16	69059905	69059906	+	Intron	INS	-	T	T			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69059905_69059906insT	uc002ewi.3	+							NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		CAAACtttttcttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74645594	74645595	+	IGR	INS	-	CTCT	CTCT	rs145363335	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74645594_74645595insCTCT								ST6GALNAC1 (5700 upstream) : MXRA7 (26214 downstream)																							tccttccttccctctctctctc	0.000													3	3	---	---	---	---	
COLEC12	81035	broad.mit.edu	37	18	334892	334904	+	Frame_Shift_Del	DEL	GCTCCCCAACGGT	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:334892_334904delGCTCCCCAACGGT	uc002kkm.2	-	6	1869_1881	c.1654_1666delACCGTTGGGGAGC	c.(1654-1668)ACCGTTGGGGAGCCTfs	p.T552fs		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	552_556	Collagen-like 3.|Extracellular (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GGCACCCCAGGCTCCCCAACGGTGCCCTGAAGT	0.737													3	5	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14779833	14779834	+	Intron	INS	-	CCA	CCA			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14779833_14779834insCCA	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						GTGGTTGTTATTCAATAGAATA	0.257													3	3	---	---	---	---	
HDHD2	84064	broad.mit.edu	37	18	44656853	44656854	+	Intron	DEL	AA	-	-	rs76655632		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44656853_44656854delAA	uc002lcs.2	-						HDHD2_uc002lct.2_Intron	NM_032124	NP_115500	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain								hydrolase activity				0						TTGGAAGTATAAGAGAGTACAC	0.238													5	8	---	---	---	---	
ZNF516	9658	broad.mit.edu	37	18	74153304	74153308	+	Frame_Shift_Del	DEL	GCTGG	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74153304_74153308delGCTGG	uc010dqx.1	-	2	1938_1942	c.1703_1707delCCAGC	c.(1702-1707)CCCAGCfs	p.P568fs	ZNF516_uc002lme.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	568_569					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		AGCCAGGGCTGCTGGGCTGGGAGGC	0.741													20	10	---	---	---	---	
RYR1	6261	broad.mit.edu	37	19	39018582	39018583	+	Intron	INS	-	A	A	rs142679376	by1000genomes	TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39018582_39018583insA	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron|RYR1_uc010xuf.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TAGAATGGATCGGGGGAGGGGT	0.569													4	4	---	---	---	---	
APOC2	344	broad.mit.edu	37	19	45452308	45452309	+	Intron	INS	-	TCT	TCT			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45452308_45452309insTCT	uc002pah.2	+							NM_000483	NP_000474	P02655	APOC2_HUMAN	apolipoprotein C-II precursor						cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle clearance|lipid catabolic process|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of lipid metabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of phospholipase activity|positive regulation of phospholipid catabolic process|positive regulation of triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	chylomicron|intermediate-density lipoprotein particle|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	lipase inhibitor activity|lipid binding|lipoprotein lipase activator activity|phospholipase activator activity|phospholipase binding|protein homodimerization activity			kidney(1)	1	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		cccccagcccctcctccctcag	0.025													9	4	---	---	---	---	
TCFL5	10732	broad.mit.edu	37	20	61473633	61473633	+	Intron	DEL	T	-	-	rs11475897		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61473633delT	uc002ydp.2	-						TCFL5_uc002ydo.2_Intron|DPH3B_uc011aan.1_5'Flank	NM_006602	NP_006593	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 protein						cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)	1	Breast(26;5.68e-08)					AGATTTTAACTTTTTTTTTTT	0.303													4	4	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10996309	10996310	+	Intron	INS	-	A	A	rs114636497		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10996309_10996310insA	uc002yis.1	-									P56180	TPTE_HUMAN	Homo sapiens putative tyrosine phosphatase mRNA, complete cds.						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAAACAACCAAAAAAAAAAA	0.302													4	2	---	---	---	---	
SLC37A1	54020	broad.mit.edu	37	21	43940071	43940074	+	Intron	DEL	TGTT	-	-	rs11277768		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43940071_43940074delTGTT	uc002zbi.2	+						SLC37A1_uc002zbj.2_Intron	NM_018964	NP_061837	P57057	GLPT_HUMAN	solute carrier family 37 member 1						carbohydrate transport|transmembrane transport	integral to membrane					0						ctccacagtgtgtttgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756250	44756252	+	IGR	DEL	CAC	-	-			TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756250_44756252delCAC								CRYAA (163337 upstream) : SIK1 (78146 downstream)																							ccaccaccatcaccaccaccatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																							accaccaccatcaccaccacca	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48761059	48761059	+	IGR	DEL	A	-	-	rs67488850		TCGA-66-2786-01A-01D-1522-08	TCGA-66-2786-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48761059delA								None (None upstream) : FAM19A5 (124229 downstream)																							TTTCATGAGGAAAAAAAAAGA	0.244													3	3	---	---	---	---	
