Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PTCHD2	57540	broad.mit.edu	37	1	11561290	11561290	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11561290G>A	uc001ash.3	+	2	379	c.241G>A	c.(241-243)GGC>AGC	p.G81S	PTCHD2_uc001asi.1_Missense_Mutation_p.G81S	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	81	Helical; (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GCTCTTCCTGGGCTGCAGCAT	0.612													13	32	---	---	---	---	PASS
PAX7	5081	broad.mit.edu	37	1	19018313	19018313	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19018313C>A	uc001bay.2	+	5	1250	c.652C>A	c.(652-654)CGA>AGA	p.R218R	PAX7_uc001baz.2_Silent_p.R216R|PAX7_uc010oct.1_Silent_p.R218R	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1	218	Homeobox.				anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GCGCAAGCAGCGACGCAGTCG	0.642			T	FOXO1A	alveolar rhabdomyosarcoma								6	1	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39876375	39876375	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39876375G>T	uc009vvt.1	+	1	1200	c.438G>T	c.(436-438)GAG>GAT	p.E146D	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	10											0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATTTGCAGAGAGGATAGAAG	0.478													5	103	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62718729	62718729	+	Intron	SNP	T	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62718729T>G	uc001dah.3	-						KANK4_uc001dai.3_Intron|KANK4_uc001daf.3_Intron|KANK4_uc001dag.3_Intron	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38											ovary(3)|skin(2)|lung(1)	6						ATCCTGTTCATTCCACCCACC	0.473													20	74	---	---	---	---	PASS
USP1	7398	broad.mit.edu	37	1	62916148	62916148	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62916148G>T	uc001daj.1	+	9	2182	c.1854G>T	c.(1852-1854)ATG>ATT	p.M618I	USP1_uc001dak.1_Missense_Mutation_p.M618I|USP1_uc001dal.1_Missense_Mutation_p.M618I	NM_001017415	NP_001017415	O94782	UBP1_HUMAN	ubiquitin specific protease 1	618					DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		TTGACCAAATGTGTGAAATAG	0.378													11	20	---	---	---	---	PASS
ANKRD13C	81573	broad.mit.edu	37	1	70819844	70819844	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70819844G>A	uc001dex.3	-	1	574	c.248C>T	c.(247-249)TCC>TTC	p.S83F	ANKRD13C_uc009wbk.2_Missense_Mutation_p.S83F|ANKRD13C_uc001dey.3_Missense_Mutation_p.S83F|HHLA3_uc010oqp.1_5'Flank|HHLA3_uc001dfa.2_5'Flank|HHLA3_uc001dfb.2_5'Flank|HHLA3_uc001dfc.2_5'Flank	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	83					protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						AGTCACGGAGGAATTGTGCAG	0.652													9	19	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152323767	152323767	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152323767G>A	uc001ezw.3	-	3	6568	c.6495C>T	c.(6493-6495)TCC>TCT	p.S2165S	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2165	Filaggrin 10.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCTGTGTGGACTGTCCAT	0.507													36	175	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155791351	155791351	+	Intron	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155791351T>C	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_Intron|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_5'Flank	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TGGAGAAAGATGAAATTTCAC	0.393													11	25	---	---	---	---	PASS
MEF2D	4209	broad.mit.edu	37	1	156450735	156450735	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156450735C>T	uc001fpc.2	-	4	677	c.287G>A	c.(286-288)TGC>TAC	p.C96Y	MEF2D_uc001fpb.2_Missense_Mutation_p.C96Y|MEF2D_uc001fpd.2_Missense_Mutation_p.C96Y|MEF2D_uc001fpe.1_Missense_Mutation_p.C96Y|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	96					apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGGCTGTCGCAGCCGTTGAA	0.672											OREG0013874	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	31	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158908982	158908982	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158908982G>A	uc001ftb.2	+	4	769	c.524G>A	c.(523-525)CGT>CAT	p.R175H	PYHIN1_uc001fta.3_Missense_Mutation_p.R175H|PYHIN1_uc001ftc.2_Missense_Mutation_p.R166H|PYHIN1_uc001ftd.2_Missense_Mutation_p.R175H|PYHIN1_uc001fte.2_Missense_Mutation_p.R166H	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	175					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					GCCATGGGCCGTTCCCCACCT	0.532													12	75	---	---	---	---	PASS
FCGR3A	2214	broad.mit.edu	37	1	161518242	161518242	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161518242G>T	uc001gat.3	-	4	425	c.288C>A	c.(286-288)CTC>CTA	p.L96L	FCGR3A_uc001gar.2_Silent_p.L132L|FCGR3A_uc001gas.2_Silent_p.L131L|FCGR3A_uc009wuh.2_Silent_p.L95L|FCGR3A_uc009wui.2_Silent_p.L96L	NM_001127595	NP_001121067	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor	96	Ig-like C2-type 1.|Extracellular (Potential).				immune response|regulation of immune response	extracellular region|integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCGGGTCACTGAGGGTGGAGA	0.512													13	105	---	---	---	---	PASS
FCGR3B	2215	broad.mit.edu	37	1	161599599	161599599	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161599599G>T	uc009wul.2	-	3	562	c.288C>A	c.(286-288)CTC>CTA	p.L96L		NM_000570	NP_000561	O75015	FCG3B_HUMAN	low affinity immunoglobulin gamma Fc region	96	Ig-like C2-type 1.				immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity				0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCGGGTCACTGAGGGTGGAGA	0.502													6	57	---	---	---	---	PASS
RGS5	8490	broad.mit.edu	37	1	163172635	163172635	+	5'UTR	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163172635T>C	uc001gcn.2	-	1					RGS5_uc009wvb.2_RNA	NM_003617	NP_003608	O15539	RGS5_HUMAN	regulator of G-protein signalling 5						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity				0			LUSC - Lung squamous cell carcinoma(543;0.187)			TTTTGGCAGGTGGCTTAGCTC	0.433													6	11	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178425887	178425887	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178425887G>A	uc001glr.2	+	11	1945	c.1820G>A	c.(1819-1821)CGT>CAT	p.R607H	RASAL2_uc001glq.2_Missense_Mutation_p.R748H|RASAL2_uc009wxc.2_Missense_Mutation_p.R121H	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	607					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						CCTCTCCCTCGTGTTCTTGCT	0.453													53	214	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276983	186276983	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276983G>T	uc001gru.3	+	7	2183	c.2132G>T	c.(2131-2133)GGG>GTG	p.G711V	PRG4_uc001grt.3_Missense_Mutation_p.G670V|PRG4_uc009wyl.2_Missense_Mutation_p.G618V|PRG4_uc009wym.2_Missense_Mutation_p.G577V|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	711	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|43; approximate.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACCCCTAAAGGGACTGCTCCA	0.587													7	192	---	---	---	---	PASS
FAM58B	339521	broad.mit.edu	37	1	200183203	200183203	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200183203C>A	uc009wzi.1	+	1	548	c.512C>A	c.(511-513)GCC>GAC	p.A171D		NM_001105517	NP_001098987	P0C7Q3	FA58B_HUMAN	family with sequence similarity 58 member B	171					regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding				0	Prostate(682;0.19)					ACCCCCGTTGCCGTCACTGCC	0.632													8	31	---	---	---	---	PASS
TNNT2	7139	broad.mit.edu	37	1	201330503	201330503	+	Intron	SNP	C	T	T	rs113471285		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201330503C>T	uc001gwf.2	-						TNNT2_uc009wzn.2_5'Flank|TNNT2_uc009wzo.2_5'Flank|TNNT2_uc009wzp.2_Intron|TNNT2_uc001gwg.2_Intron|TNNT2_uc001gwh.2_Intron|TNNT2_uc001gwi.2_Intron|TNNT2_uc009wzr.2_Intron	NM_000364	NP_000355	P45379	TNNT2_HUMAN	troponin T type 2, cardiac isoform 1						ATP catabolic process|muscle filament sliding|negative regulation of ATPase activity|positive regulation of ATPase activity|regulation of heart contraction|response to calcium ion|response to calcium ion|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|tropomyosin binding|troponin C binding|troponin I binding				0						TCTCCCTGCACGGGCAAGGGT	0.607											OREG0014076	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	82	---	---	---	---	PASS
PPFIA4	8497	broad.mit.edu	37	1	203025576	203025576	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203025576C>A	uc001gyz.2	+	5	1255	c.662C>A	c.(661-663)CCC>CAC	p.P221H	PPFIA4_uc009xaj.2_Missense_Mutation_p.P852H|PPFIA4_uc010pqf.1_Missense_Mutation_p.P434H|PPFIA4_uc001gza.2_Missense_Mutation_p.P221H|PPFIA4_uc001gzb.1_5'Flank	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f	221					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						CCTTCCTCACCCAGGACGCTG	0.572													4	30	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203702376	203702376	+	Intron	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203702376C>T	uc001gzw.2	+						ATP2B4_uc001gzv.2_Missense_Mutation_p.T1112M|ATP2B4_uc009xaq.2_Missense_Mutation_p.T1112M|ATP2B4_uc001gzx.2_Missense_Mutation_p.T143M|ATP2B4_uc009xar.2_Missense_Mutation_p.T107M	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ACATTCCAGACGGGAGCCTCT	0.398													10	52	---	---	---	---	PASS
DUSP10	11221	broad.mit.edu	37	1	221913078	221913078	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221913078C>T	uc001hmy.1	-	2	191	c.9G>A	c.(7-9)CCG>CCA	p.P3P	DUSP10_uc001hmx.1_5'Flank|DUSP10_uc001hmz.1_Intron	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a	3					inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)		CTAAAGGAGACGGAGGCATGA	0.483													37	27	---	---	---	---	PASS
TTC13	79573	broad.mit.edu	37	1	231047278	231047278	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231047278G>A	uc001huf.3	-	20	2278	c.2247C>T	c.(2245-2247)TGC>TGT	p.C749C	TTC13_uc009xfi.2_Silent_p.C696C|TTC13_uc009xfj.2_RNA|TTC13_uc001hug.3_Silent_p.C695C|TTC13_uc009xfk.1_Silent_p.C638C	NM_024525	NP_078801	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13 isoform a	749							binding			ovary(1)|skin(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		AGATTAAGTTGCAGACAGCAT	0.289													7	13	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237664052	237664052	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237664052T>A	uc001hyl.1	+	21	2365	c.2245T>A	c.(2245-2247)TTA>ATA	p.L749I		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	749	Cytoplasmic (By similarity).|B30.2/SPRY 1.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCAACATCTGTTAAGAACTGA	0.393													99	105	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240370373	240370373	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370373T>G	uc010pyd.1	+	5	2486	c.2261T>G	c.(2260-2262)GTG>GGG	p.V754G	FMN2_uc010pye.1_Missense_Mutation_p.V758G	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	754					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GAGGGCGGGGTGCTGACACTG	0.542													6	16	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004842	248004842	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004842G>T	uc001idn.1	-	1	357	c.357C>A	c.(355-357)GCC>GCA	p.A119A		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AACGGTCATAGGCCATGAAGG	0.607													7	20	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11733151	11733151	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11733151T>C	uc002rbk.1	+	11	1895	c.1595T>C	c.(1594-1596)ATG>ACG	p.M532T	GREB1_uc002rbo.1_Missense_Mutation_p.M166T	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	532						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CTCTCCGAGATGTTCCGGCTG	0.662													10	12	---	---	---	---	PASS
FAM49A	81553	broad.mit.edu	37	2	16736368	16736368	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16736368C>G	uc010exm.1	-	10	1025	c.877G>C	c.(877-879)GAC>CAC	p.D293H	FAM49A_uc002rck.1_Missense_Mutation_p.D293H	NM_030797	NP_110424	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	293						intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			TCCACACTGTCTGGGGCCTGC	0.448													5	36	---	---	---	---	PASS
GALNT14	79623	broad.mit.edu	37	2	31165143	31165143	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31165143G>A	uc002rnr.2	-	9	1474	c.855C>T	c.(853-855)TTC>TTT	p.F285F	GALNT14_uc002rnq.2_Silent_p.F265F|GALNT14_uc002rns.2_Silent_p.F290F|GALNT14_uc010ymr.1_Silent_p.F250F|GALNT14_uc010ezo.1_Silent_p.F252F|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14	285	Lumenal (Potential).|Catalytic subdomain B.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					TGTCGATCACGAAGAGCCCTC	0.498													17	43	---	---	---	---	PASS
PROKR1	10887	broad.mit.edu	37	2	68882479	68882479	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68882479A>T	uc010yqj.1	+	2	953	c.953A>T	c.(952-954)AAG>ATG	p.K318M	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	318	Extracellular (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						GTGAAGGAGAAGCACTACCTC	0.557													25	40	---	---	---	---	PASS
GKN2	200504	broad.mit.edu	37	2	69173603	69173603	+	Intron	SNP	A	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69173603A>G	uc002sfa.2	-						GKN2_uc002sfb.3_Intron	NM_182536	NP_872342	Q86XP6	GKN2_HUMAN	trefoil factor interactions(z) 1 precursor							extracellular region					0						CTAGATCGGTATAACAGAAAA	0.358													45	72	---	---	---	---	PASS
REG3G	130120	broad.mit.edu	37	2	79253251	79253251	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79253251C>A	uc002snw.2	+	2	117	c.32C>A	c.(31-33)TCC>TAC	p.S11Y	REG3G_uc002snx.2_Missense_Mutation_p.S11Y|REG3G_uc010ffu.2_Missense_Mutation_p.S11Y	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor	11					acute-phase response	extracellular region	sugar binding				0						CCCAGTGTGTCCTGGATGCTG	0.537													18	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90109062	90109062	+	Intron	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90109062G>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		ATTACTGTCAGCAGGGCAATA	0.488													37	61	---	---	---	---	PASS
EDAR	10913	broad.mit.edu	37	2	109539886	109539886	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109539886G>A	uc002teq.3	-	5	811	c.380C>T	c.(379-381)CCG>CTG	p.P127L	EDAR_uc010fjn.2_Missense_Mutation_p.P127L|EDAR_uc010yws.1_Missense_Mutation_p.P127L	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor precursor	127	TNFR-Cys 3.|Extracellular (Potential).				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity			skin(1)	1						GATGTTCCTCGGTCTGTTCTC	0.547													25	30	---	---	---	---	PASS
ACTR3	10096	broad.mit.edu	37	2	114688952	114688952	+	Silent	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114688952A>T	uc002tkx.1	+	5	731	c.411A>T	c.(409-411)CCA>CCT	p.P137P	ACTR3_uc010yyc.1_Silent_p.P75P|ACTR3_uc010yyd.1_Silent_p.P86P	NM_005721	NP_005712	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog	137					cellular component movement|cilium morphogenesis	Arp2/3 protein complex	actin binding|ATP binding			skin(1)	1						TCAATGTTCCAGGCTTGTACA	0.318													18	24	---	---	---	---	PASS
MARCO	8685	broad.mit.edu	37	2	119750717	119750717	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119750717G>T	uc002tln.1	+	16	1402	c.1270G>T	c.(1270-1272)GTC>TTC	p.V424F	MARCO_uc010yyf.1_Missense_Mutation_p.V346F	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	424	SRCR.|Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						CTCAGTGTCCGTCAGGATTGT	0.517													12	138	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122227508	122227508	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122227508C>T	uc002tnc.2	-	9	1131	c.741G>A	c.(739-741)GTG>GTA	p.V247V	CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Silent_p.V247V|CLASP1_uc010yza.1_Silent_p.V247V|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tng.1_Silent_p.V247V	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	247					axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					TGTTACCATCCACAGAATCTT	0.388													26	64	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125262047	125262047	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125262047C>A	uc002tno.2	+	8	1602	c.1238C>A	c.(1237-1239)TCG>TAG	p.S413*	CNTNAP5_uc010flu.2_Nonsense_Mutation_p.S414*	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	413	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCTGAGGGCTCGGGAACCCTG	0.542													4	100	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141122335	141122335	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141122335C>A	uc002tvj.1	-	72	11998	c.11026G>T	c.(11026-11028)GCT>TCT	p.A3676S		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3676	Extracellular (Potential).|LDL-receptor class A 30.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AACTCATCAGCTCTACATATA	0.393										TSP Lung(27;0.18)			24	30	---	---	---	---	PASS
KIF5C	3800	broad.mit.edu	37	2	149838057	149838057	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149838057C>T	uc010zbu.1	+	14	1919	c.1551C>T	c.(1549-1551)GAC>GAT	p.D517D	KIF5C_uc002tws.1_RNA|KIF5C_uc002twt.2_Silent_p.D69D	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	517					microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		AGCTGACAGACGAGCTGGCCC	0.512													7	11	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190571740	190571740	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190571740G>T	uc002uqw.1	+	8	1774	c.1774G>T	c.(1774-1776)GCT>TCT	p.A592S	ANKAR_uc002uqu.2_RNA	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	663	ANK 4.					integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TTCTATCGGTGCTAACTGGAG	0.313													8	33	---	---	---	---	PASS
MSTN	2660	broad.mit.edu	37	2	190925015	190925015	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190925015G>T	uc002urp.2	-	2	653	c.520C>A	c.(520-522)CTG>ATG	p.L174M		NM_005259	NP_005250	O14793	GDF8_HUMAN	myostatin precursor	174					muscle organ development|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			ATGAGTCTCAGGATTTGCACA	0.398													6	78	---	---	---	---	PASS
RBM6	10180	broad.mit.edu	37	3	50012788	50012788	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50012788G>A	uc003cyc.2	+	5	1579	c.1446G>A	c.(1444-1446)ATG>ATA	p.M482I	RBM6_uc011bdh.1_RNA|RBM6_uc010hlc.1_Missense_Mutation_p.M1I|RBM6_uc003cyd.2_5'UTR|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_RNA|RBM6_uc010hle.1_RNA|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6	482	RRM.				RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CTGATGGCATGCCTGTAAAGA	0.383													32	33	---	---	---	---	PASS
POC1A	25886	broad.mit.edu	37	3	52130740	52130740	+	Intron	SNP	A	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52130740A>G	uc003dcu.2	-						POC1A_uc003dcv.2_Intron|POC1A_uc003dcw.2_Intron	NM_015426	NP_056241	Q8NBT0	POC1A_HUMAN	WD repeat domain 51A isoform 1							centriole|microtubule basal body					0						TAAAGACAGAAAGAAAAAAGT	0.522													5	89	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89456489	89456489	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89456489C>A	uc003dqy.2	+	8	1890	c.1665C>A	c.(1663-1665)CTC>CTA	p.L555L	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	555	Helical; (Potential).					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CAATTATTCTCCTCACTGTTG	0.413										TSP Lung(6;0.00050)			14	16	---	---	---	---	PASS
OR5H6	79295	broad.mit.edu	37	3	97983832	97983832	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97983832C>A	uc003dsi.1	+	1	704	c.704C>A	c.(703-705)ACA>AAA	p.T235K		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						ATATCTTATACAATTATCCTC	0.328													5	35	---	---	---	---	PASS
HSPBAP1	79663	broad.mit.edu	37	3	122512524	122512524	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122512524C>G	uc003efu.1	-	1	127	c.4G>C	c.(4-6)GCA>CCA	p.A2P	DIRC2_uc003efw.3_5'Flank|DIRC2_uc010hrl.2_5'Flank|DIRC2_uc010hrm.2_5'Flank|HSPBAP1_uc003efv.1_Missense_Mutation_p.A2P	NM_024610	NP_078886	Q96EW2	HBAP1_HUMAN	Hspb associated protein 1	2						cytoplasm				ovary(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.0531)		GAGCCTGCTGCCATGGCTACC	0.662													29	28	---	---	---	---	PASS
RUVBL1	8607	broad.mit.edu	37	3	127820473	127820473	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127820473C>A	uc003ekh.2	-	5	636	c.532G>T	c.(532-534)GAA>TAA	p.E178*	RUVBL1_uc003eke.2_5'UTR|RUVBL1_uc003ekf.2_Nonsense_Mutation_p.E118*|RUVBL1_uc010hss.2_Nonsense_Mutation_p.E178*	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1	178					cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		TGCAAACTTTCAAAAATGCTG	0.418													7	292	---	---	---	---	PASS
NPHP3	27031	broad.mit.edu	37	3	132400856	132400856	+	Silent	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132400856G>C	uc003epe.1	-	27	3968	c.3891C>G	c.(3889-3891)CTC>CTG	p.L1297L	NPHP3_uc003eoz.1_Silent_p.L176L|NPHP3_uc003epd.1_Silent_p.L539L	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	1297					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						TTCCACCCAAGAGTGATGTTT	0.388													58	30	---	---	---	---	PASS
NMD3	51068	broad.mit.edu	37	3	160952514	160952514	+	Splice_Site	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160952514G>T	uc003feb.1	+	6	477	c.358_splice	c.e6-1	p.V120_splice	NMD3_uc003fec.2_Splice_Site_p.V120_splice|NMD3_uc003fed.1_Splice_Site_p.V120_splice|NMD3_uc010hwh.2_5'Flank	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			TGTTTTATCAGGTGATGAATG	0.308													4	47	---	---	---	---	PASS
EPHB3	2049	broad.mit.edu	37	3	184297281	184297281	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184297281G>T	uc003foz.2	+	10	2255	c.1818G>T	c.(1816-1818)AAG>AAT	p.K606N		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	606	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			CTGGAATGAAGGTTTATATTG	0.567													7	313	---	---	---	---	PASS
ACAP2	23527	broad.mit.edu	37	3	195027353	195027353	+	Intron	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195027353G>C	uc003fun.3	-							NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						CTTCTAAAAGGAAATAACATA	0.373													36	65	---	---	---	---	PASS
WHSC2	7469	broad.mit.edu	37	4	1993339	1993339	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1993339G>T	uc003gem.2	-	2	587	c.347C>A	c.(346-348)TCG>TAG	p.S116*	WHSC2_uc003gel.2_Nonsense_Mutation_p.S30*|WHSC2_uc003gen.2_Intron	NM_005663	NP_005654	Q9H3P2	NELFA_HUMAN	Wolf-Hirschhorn syndrome candidate 2 protein	105					multicellular organismal development|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm				skin(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0155)			CAGGTTAAGCGAGCCTGTGTC	0.532													4	45	---	---	---	---	PASS
RGS12	6002	broad.mit.edu	37	4	3424106	3424106	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3424106G>A	uc003ggw.2	+	11	3746	c.2842G>A	c.(2842-2844)GAG>AAG	p.E948K	RGS12_uc003ggv.2_Missense_Mutation_p.E948K|RGS12_uc003ggy.1_Missense_Mutation_p.E346K|RGS12_uc003ggz.2_Missense_Mutation_p.E300K|RGS12_uc010icu.1_Missense_Mutation_p.E147K|RGS12_uc011bvs.1_Missense_Mutation_p.E290K|RGS12_uc003gha.2_Missense_Mutation_p.E290K|RGS12_uc010icv.2_Missense_Mutation_p.E147K|RGS12_uc003ghb.2_Missense_Mutation_p.E147K	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	948						condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCCCCAGTCGGAGGCCTGCAG	0.667													6	4	---	---	---	---	PASS
LGI2	55203	broad.mit.edu	37	4	25028544	25028544	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25028544G>A	uc003grf.2	-	3	386	c.287C>T	c.(286-288)TCA>TTA	p.S96L		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	96	LRR 1.					extracellular region					0		Breast(46;0.173)				GATCGTGAATGAGTTAGAATT	0.383													34	18	---	---	---	---	PASS
NPFFR2	10886	broad.mit.edu	37	4	73012827	73012827	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73012827A>C	uc003hgg.2	+	4	965	c.867A>C	c.(865-867)GAA>GAC	p.E289D	NPFFR2_uc010iig.1_Missense_Mutation_p.E71D|NPFFR2_uc003hgi.2_Missense_Mutation_p.E190D|NPFFR2_uc003hgh.2_Missense_Mutation_p.E187D|NPFFR2_uc003hgj.2_RNA	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	289	Extracellular (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TGCAAGAAGAAAAATATTACC	0.433													25	68	---	---	---	---	PASS
THAP6	152815	broad.mit.edu	37	4	76447060	76447060	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76447060C>T	uc003him.2	+	4	500	c.403C>T	c.(403-405)CAG>TAG	p.Q135*	THAP6_uc010iis.1_Nonsense_Mutation_p.Q94*|THAP6_uc003hin.2_Intron|THAP6_uc011cbm.1_Nonsense_Mutation_p.Q135*|THAP6_uc010iiu.1_RNA|THAP6_uc003hio.1_Intron|THAP6_uc010iiv.2_Nonsense_Mutation_p.Q135*	NM_144721	NP_653322	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	135						microtubule cytoskeleton	DNA binding|metal ion binding				0			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ATTCCAATCCCAGTTCATTTT	0.348													32	15	---	---	---	---	PASS
DMP1	1758	broad.mit.edu	37	4	88583873	88583873	+	Missense_Mutation	SNP	G	A	A	rs149603030		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88583873G>A	uc003hqv.2	+	6	1047	c.943G>A	c.(943-945)GGT>AGT	p.G315S	DMP1_uc003hqw.2_Missense_Mutation_p.G299S	NM_004407	NP_004398	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1 isoform 1	315					biomineral tissue development|ossification	cytoplasm|nucleus|proteinaceous extracellular matrix	calcium ion binding|integrin binding			pancreas(1)|skin(1)	2		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		AGACAGCAAGGGTGACTCTCA	0.512													13	36	---	---	---	---	PASS
NFKB1	4790	broad.mit.edu	37	4	103498032	103498032	+	Splice_Site	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103498032G>T	uc011ceq.1	+	7	872	c.405_splice	c.e7-1	p.G135_splice	NFKB1_uc011cep.1_Splice_Site_p.G136_splice|NFKB1_uc011cer.1_5'Flank	NM_003998	NP_003989	P19838	NFKB1_HUMAN	nuclear factor kappa-B, subunit 1 isoform 1						anti-apoptosis|apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of calcidiol 1-monooxygenase activity|nerve growth factor receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter	cytosol|I-kappaB/NF-kappaB complex|mitochondrion|nucleoplasm	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|breast(2)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Dexamethasone(DB01234)|Pranlukast(DB01411)|Thalidomide(DB01041)	TTTTTCTCCAGCTTCGCAAAC	0.383													39	18	---	---	---	---	PASS
NEIL3	55247	broad.mit.edu	37	4	178243682	178243682	+	Missense_Mutation	SNP	G	T	T	rs34112288	byFrequency	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178243682G>T	uc003iut.2	+	2	343	c.226G>T	c.(226-228)GTG>TTG	p.V76L	NEIL3_uc010irs.2_Intron	NM_018248	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3	76					base-excision repair|nucleotide-excision repair	nucleus	bubble DNA binding|damaged DNA binding|DNA N-glycosylase activity|DNA-(apurinic or apyrimidinic site) lyase activity|double-stranded DNA binding|single-stranded DNA binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		TTACAGTGGCGTGGAAACTTT	0.393								BER_DNA_glycosylases					12	62	---	---	---	---	PASS
F11	2160	broad.mit.edu	37	4	187188357	187188357	+	Intron	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187188357G>A	uc003iza.1	+						F11_uc003iyz.2_Intron	NM_000128	NP_000119	P03951	FA11_HUMAN	coagulation factor XI precursor						blood coagulation, intrinsic pathway|plasminogen activation|positive regulation of fibrinolysis	extracellular space|plasma membrane	heparin binding|serine-type endopeptidase activity				0		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	TAAGTAGAGTGTTATCTTAAC	0.378													16	10	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13737392	13737392	+	Silent	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13737392T>C	uc003jfd.2	-	66	11466	c.11424A>G	c.(11422-11424)CAA>CAG	p.Q3808Q	DNAH5_uc003jfc.2_Intron	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3808	Potential.				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CTGAGTTAATTTGAACTTCTG	0.413									Kartagener_syndrome				17	70	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33662055	33662055	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33662055G>C	uc003jia.1	-	6	1169	c.1006C>G	c.(1006-1008)CCT>GCT	p.P336A	ADAMTS12_uc010iuq.1_Missense_Mutation_p.P336A	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	336	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TGATGAACAGGATTGAGGTCA	0.493										HNSCC(64;0.19)			14	72	---	---	---	---	PASS
UGT3A2	167127	broad.mit.edu	37	5	36049132	36049132	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36049132C>A	uc003jjz.1	-	4	795	c.702G>T	c.(700-702)AGG>AGT	p.R234S	UGT3A2_uc011cos.1_Missense_Mutation_p.R200S|UGT3A2_uc011cot.1_Intron	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	234	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACAAAACTGGCCTAGAGCCTT	0.418													101	34	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37169396	37169396	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37169396C>A	uc011cpa.1	-	34	6961	c.6730G>T	c.(6730-6732)GGA>TGA	p.G2244*	C5orf42_uc011coy.1_Nonsense_Mutation_p.G744*|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Nonsense_Mutation_p.G1319*|C5orf42_uc003jkr.1_Nonsense_Mutation_p.G277*	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2244										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GGAATACTTCCTGTATGTAAG	0.448													6	139	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41052694	41052694	+	Intron	SNP	G	C	C	rs75061969	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41052694G>C	uc003jmj.3	-						HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2								binding			ovary(6)|central_nervous_system(2)	8						TCTTACCTAGGGTAAGAACAA	0.343													9	30	---	---	---	---	PASS
MAN2A1	4124	broad.mit.edu	37	5	109181611	109181611	+	Missense_Mutation	SNP	G	T	T	rs142363192		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109181611G>T	uc003kou.1	+	18	3709	c.2746G>T	c.(2746-2748)GTC>TTC	p.V916F		NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	916	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		TCAAGCAAATGTCTATCCCAT	0.378													37	21	---	---	---	---	PASS
FTMT	94033	broad.mit.edu	37	5	121188071	121188071	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121188071G>C	uc003kss.2	+	1	422	c.413G>C	c.(412-414)GGC>GCC	p.G138A		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	138	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CAGCGAGGAGGCCGGATCCGC	0.582													25	5	---	---	---	---	PASS
SEPT8	23176	broad.mit.edu	37	5	132099577	132099577	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132099577G>A	uc003kxr.2	-	4	593	c.355C>T	c.(355-357)CCC>TCC	p.P119S	SEPT8_uc003kxs.1_Missense_Mutation_p.P119S|SEPT8_uc003kxu.2_Missense_Mutation_p.P119S|SEPT8_uc011cxi.1_Missense_Mutation_p.P117S|SEPT8_uc003kxv.2_Missense_Mutation_p.P117S|SEPT8_uc003kxt.2_Missense_Mutation_p.P59S	NM_001098811	NP_001092281	Q92599	SEPT8_HUMAN	septin 8 isoform a	119					cell cycle	septin complex	GTP binding|protein binding			ovary(2)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAACTATGGGCCTGTAACTA	0.587											OREG0003468	type=REGULATORY REGION|Gene=LOC540614|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	10	70	---	---	---	---	PASS
HAVCR1	26762	broad.mit.edu	37	5	156482444	156482444	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156482444T>G	uc010jij.1	-	3	332	c.147A>C	c.(145-147)AGA>AGC	p.R49S	HAVCR1_uc011ddl.1_5'Flank|HAVCR1_uc003lwi.2_Missense_Mutation_p.R49S|HAVCR1_uc011ddm.1_Missense_Mutation_p.R49S	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	49	Extracellular (Potential).|Ig-like V-type.				interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AACATGAGCCTCTATTCCAGC	0.502													11	9	---	---	---	---	PASS
KCNMB1	3779	broad.mit.edu	37	5	169810700	169810700	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169810700G>T	uc003maq.1	-	3	689	c.289C>A	c.(289-291)CGG>AGG	p.R97R	KCNIP1_uc003map.2_Intron|KCNMB1_uc003mar.2_Silent_p.R97R	NM_004137	NP_004128	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated	97	Extracellular (Potential).				platelet activation|synaptic transmission		calcium-activated potassium channel activity|potassium channel regulator activity			ovary(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)		TTCTGGTCCCGAGTGTCCTCC	0.582													3	30	---	---	---	---	PASS
OR12D3	81797	broad.mit.edu	37	6	29342547	29342547	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29342547T>C	uc003nme.2	-	1	522	c.518A>G	c.(517-519)AAT>AGT	p.N173S		NM_030959	NP_112221	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D,	173	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3						GAAGAAGTGATTGAGTTTCTG	0.463													19	36	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32947734	32947734	+	Silent	SNP	A	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32947734A>G	uc003ocn.3	+	11	3672	c.1971A>G	c.(1969-1971)TTA>TTG	p.L657L	BRD2_uc003ocq.3_Silent_p.L657L|BRD2_uc003ocp.3_Silent_p.L537L|BRD2_uc010juh.2_Silent_p.L692L	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	657	ET.				spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						TCAACAAATTACCTGGGGAGA	0.502													13	19	---	---	---	---	PASS
UNC5CL	222643	broad.mit.edu	37	6	41002666	41002666	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41002666C>A	uc003opi.2	-	2	237	c.148G>T	c.(148-150)GAG>TAG	p.E50*	UNC5CL_uc010jxe.1_Nonsense_Mutation_p.E50*	NM_173561	NP_775832	Q8IV45	UN5CL_HUMAN	unc-5 homolog C-like	50	Cytoplasmic (Potential).				signal transduction	cytoplasm|integral to membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					ACTGGTTCCTCTTGACCATTC	0.597													4	42	---	---	---	---	PASS
RMND1	55005	broad.mit.edu	37	6	151766462	151766462	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151766462G>T	uc003qoi.2	-	2	665	c.485C>A	c.(484-486)CCA>CAA	p.P162Q	RMND1_uc011eeq.1_5'Flank|RMND1_uc003qoj.2_Missense_Mutation_p.P162Q|RMND1_uc011eer.1_Missense_Mutation_p.P162Q	NM_017909	NP_060379	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog	162											0		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		AGACAGAACTGGAAGGTTGGT	0.502													4	35	---	---	---	---	PASS
TIAM2	26230	broad.mit.edu	37	6	155578117	155578117	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155578117C>A	uc003qqb.2	+	29	6241	c.4968C>A	c.(4966-4968)CAC>CAA	p.H1656Q	TIAM2_uc003qqe.2_Missense_Mutation_p.H1656Q|TIAM2_uc010kjj.2_Missense_Mutation_p.H1218Q|TIAM2_uc003qqf.2_Missense_Mutation_p.H1032Q|TIAM2_uc011efl.1_Missense_Mutation_p.H1000Q|TIAM2_uc003qqg.2_Missense_Mutation_p.H968Q|TIAM2_uc003qqh.2_Missense_Mutation_p.H581Q|uc003qqi.1_5'Flank	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1656					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AGATCCGTCACCAGTCCCTTG	0.507													15	19	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155750148	155750148	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155750148G>A	uc003qqm.2	-	9	1028	c.925C>T	c.(925-927)CAC>TAC	p.H309Y		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	309	Extracellular (Potential).|FAD-binding FR-type.						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TTTTTCATGTGAAGTTCCAGG	0.493													5	115	---	---	---	---	PASS
TULP4	56995	broad.mit.edu	37	6	158900915	158900915	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158900915A>T	uc003qrf.2	+	7	2516	c.1159A>T	c.(1159-1161)AGC>TGC	p.S387C	TULP4_uc011efo.1_Missense_Mutation_p.S387C|TULP4_uc003qrg.2_Missense_Mutation_p.S387C	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	387	SOCS box.				intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGCCATCGCCAGCACCTTGCG	0.627													19	18	---	---	---	---	PASS
POM121L12	285877	broad.mit.edu	37	7	53104165	53104165	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53104165C>T	uc003tpz.2	+	1	817	c.801C>T	c.(799-801)TTC>TTT	p.F267F		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	267											0						TCTGGGACTTCTGGGAGGCGA	0.642													18	219	---	---	---	---	PASS
MRPS17	51373	broad.mit.edu	37	7	56020981	56020981	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56020981C>A	uc003trd.2	+	2	123	c.93C>A	c.(91-93)ACC>ACA	p.T31T	MRPS17_uc003trb.2_Silent_p.T126T	NM_015969	NP_057053	Q9Y2R5	RT17_HUMAN	mitochondrial ribosomal protein S17 precursor	31					translation	mitochondrial small ribosomal subunit	rRNA binding|structural constituent of ribosome				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGAGAGTGACCAGGCTTGTTC	0.458													7	447	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64452985	64452985	+	5'Flank	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64452985C>T	uc003ttr.2	-						ZNF117_uc011kdr.1_Missense_Mutation_p.M137I	NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				tatagtactccatggaactga	0.000													13	45	---	---	---	---	PASS
SEMA3C	10512	broad.mit.edu	37	7	80439994	80439994	+	Silent	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80439994G>C	uc003uhj.2	-	6	1033	c.471C>G	c.(469-471)TCC>TCG	p.S157S	SEMA3C_uc011kgw.1_Silent_p.S175S|SEMA3C_uc011kgx.1_Silent_p.S9S	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	157	Sema.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						ATTCACACTTGGAGTCAATCA	0.358													26	41	---	---	---	---	PASS
PVRIG	79037	broad.mit.edu	37	7	99816301	99816301	+	Intron	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99816301G>T	uc003uue.2	+						GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|GATS_uc011kjl.1_Intron|GATS_uc010lgu.2_Intron|PVRIG_uc003uuf.1_5'Flank	NM_024070	NP_076975	Q6DKI7	PVRIG_HUMAN	poliovirus receptor related immunoglobulin							integral to membrane				skin(2)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGGTGACACTGACTGGGGTTT	0.443													13	16	---	---	---	---	PASS
UFSP1	402682	broad.mit.edu	37	7	100486765	100486765	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100486765A>T	uc003uxc.3	-	1	575	c.128T>A	c.(127-129)CTG>CAG	p.L43Q	uc010lhm.1_5'Flank	NM_001015072	NP_001015072	Q6NVU6	UFSP1_HUMAN	inactive Ufm1-specific protease 1	43											0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTCCCCGTGCAGCCCCACTCC	0.701													12	26	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113558921	113558921	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113558921C>A	uc010ljy.1	-	1	162	c.131G>T	c.(130-132)CGA>CTA	p.R44L		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	44					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						ATCAGAACCTCGTCTACTTGG	0.378													4	96	---	---	---	---	PASS
GCC1	79571	broad.mit.edu	37	7	127222187	127222187	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127222187G>A	uc003vma.2	-	2	2627	c.2209C>T	c.(2209-2211)CTG>TTG	p.L737L		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	737	Potential.|GRIP.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						TGGCGGCCCAGGGAGTCAGGT	0.532													18	68	---	---	---	---	PASS
MKRN1	23608	broad.mit.edu	37	7	140156495	140156495	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140156495G>A	uc003vvt.2	-	5	1168	c.943C>T	c.(943-945)CGC>TGC	p.R315C	MKRN1_uc003vvs.2_Missense_Mutation_p.R251C|MKRN1_uc011krd.1_Missense_Mutation_p.R49C|MKRN1_uc003vvv.3_Missense_Mutation_p.R315C|MKRN1_uc003vvu.3_Missense_Mutation_p.R251C	NM_013446	NP_038474	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1 isoform 1	315	RING-type.						ligase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.00956)					CTCCACTTGCGAATGCACTTG	0.488													13	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144703132	144703132	+	IGR	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144703132C>A								TPK1 (169986 upstream) : None (None downstream)																							TCCTAAGCACCAGACTCTTAC	0.512													6	233	---	---	---	---	PASS
USP17L2	377630	broad.mit.edu	37	8	11995031	11995031	+	Silent	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11995031G>C	uc003wvc.1	-	1	1239	c.1239C>G	c.(1237-1239)CCC>CCG	p.P413P	FAM66D_uc011kxp.1_Intron|FAM66D_uc011kxo.1_Intron	NM_201402	NP_958804	Q6R6M4	U17L2_HUMAN	deubiquitinating enzyme 3	413					apoptosis|cell cycle|G2/M transition checkpoint|mitotic cell cycle G1/S transition checkpoint|protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)	3						CCTGGAGGCAGGGGTGGTCTC	0.567													39	68	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39602415	39602415	+	Intron	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39602415G>T	uc003xnj.2	-						ADAM2_uc003xnk.2_Intron|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein						cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CAGGTTGCCTGCatattaaaa	0.299													24	46	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55539267	55539267	+	Missense_Mutation	SNP	C	T	T	rs112323560		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55539267C>T	uc003xsd.1	+	4	2973	c.2825C>T	c.(2824-2826)ACG>ATG	p.T942M	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	942					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGAAATGAAACGAGTGTGGTA	0.303													12	34	---	---	---	---	PASS
HNF4G	3174	broad.mit.edu	37	8	76470903	76470903	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76470903C>A	uc003yaq.2	+	8	1013	c.743C>A	c.(742-744)CCA>CAA	p.P248Q	HNF4G_uc003yar.2_Missense_Mutation_p.P285Q	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	248					endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			TTTTTTGATCCAGGTTGGTTT	0.303													5	145	---	---	---	---	PASS
PSKH2	85481	broad.mit.edu	37	8	87060971	87060971	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87060971G>T	uc011lfy.1	-	3	878	c.878C>A	c.(877-879)GCG>GAG	p.A293E		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	293	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			AAAGTCCTTCGCCAAGTGGGA	0.413													9	30	---	---	---	---	PASS
MATN2	4147	broad.mit.edu	37	8	98943719	98943719	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98943719G>A	uc003yic.2	+	3	912	c.681G>A	c.(679-681)ACG>ACA	p.T227T	MATN2_uc003yib.1_Silent_p.T227T|MATN2_uc010mbh.1_Silent_p.T227T|MATN2_uc003yid.2_Silent_p.T227T|MATN2_uc003yie.1_Silent_p.T227T|MATN2_uc010mbi.1_Silent_p.T101T	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	227	VWFA 1.					proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			AGATTGAGACGCTGACCTCCG	0.443													17	45	---	---	---	---	PASS
MATN2	4147	broad.mit.edu	37	8	98943720	98943720	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98943720C>A	uc003yic.2	+	3	913	c.682C>A	c.(682-684)CTG>ATG	p.L228M	MATN2_uc003yib.1_Missense_Mutation_p.L228M|MATN2_uc010mbh.1_Missense_Mutation_p.L228M|MATN2_uc003yid.2_Missense_Mutation_p.L228M|MATN2_uc003yie.1_Missense_Mutation_p.L228M|MATN2_uc010mbi.1_Missense_Mutation_p.L102M	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	228	VWFA 1.					proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GATTGAGACGCTGACCTCCGT	0.443													17	45	---	---	---	---	PASS
KCNS2	3788	broad.mit.edu	37	8	99441494	99441494	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99441494C>A	uc003yin.2	+	2	1637	c.1287C>A	c.(1285-1287)AGC>AGA	p.S429R		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	429	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			CCATGCGCAGCTGTGACTTTG	0.488													15	124	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100789166	100789166	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100789166C>A	uc003yiv.2	+	41	7597	c.7486C>A	c.(7486-7488)CTT>ATT	p.L2496I	VPS13B_uc003yiw.2_Missense_Mutation_p.L2471I	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2496					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTGTCATCACCTTGACCAACT	0.408													5	97	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103309124	103309124	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103309124C>A	uc003ykr.1	-	28	3695	c.3662G>T	c.(3661-3663)TGC>TTC	p.C1221F	UBR5_uc003yks.1_Missense_Mutation_p.C1221F	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1221	UBR-type.				cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TACTCACTTGCAATCATGACC	0.328													10	15	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110478882	110478882	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110478882G>A	uc003yne.2	+	50	8593	c.8489G>A	c.(8488-8490)AGC>AAC	p.S2830N		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2830	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GCTGAGTGGAGCATTGGGTTC	0.468										HNSCC(38;0.096)			4	12	---	---	---	---	PASS
KLHL38	340359	broad.mit.edu	37	8	124663821	124663821	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124663821A>T	uc003yqs.1	-	1	1370	c.1346T>A	c.(1345-1347)ATC>AAC	p.I449N		NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN	kelch-like 38	449	Kelch 4.										0						ATTTACCTGGATAAGGCGCAC	0.507													21	102	---	---	---	---	PASS
SLURP1	57152	broad.mit.edu	37	8	143823221	143823221	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143823221C>A	uc003ywy.2	-	2	204	c.178G>T	c.(178-180)GAG>TAG	p.E60*		NM_020427	NP_065160	P55000	SLUR1_HUMAN	ARS component B precursor	60	UPAR/Ly6.				cell activation|cell adhesion	extracellular space	cytokine activity				0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CTGGCCTCACCTGCCTCCACC	0.662													6	22	---	---	---	---	PASS
SCRIB	23513	broad.mit.edu	37	8	144886281	144886281	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144886281C>T	uc003yzp.1	-	22	3062	c.3055G>A	c.(3055-3057)GTC>ATC	p.V1019I	SCRIB_uc003yzn.1_5'UTR|SCRIB_uc003yzo.1_Missense_Mutation_p.V1019I	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	1019	Interaction with ARHGEF7.|PDZ 3.				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GAGCCTCCGACAATACTAAGC	0.617													9	7	---	---	---	---	PASS
KIAA2026	158358	broad.mit.edu	37	9	5988539	5988539	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5988539C>A	uc003zjq.3	-	2	816	c.600G>T	c.(598-600)TTG>TTT	p.L200F		NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	200										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCTTTTCTCTCAAGTGCCTTG	0.428													4	37	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971120	21971120	+	Nonsense_Mutation	SNP	G	A	A	rs121913388		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971120G>A	uc003zpk.2	-	2	450	c.238C>T	c.(238-240)CGA>TGA	p.R80*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.P135L	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	80	ANK 3.		R -> P (in CMM2; loss of CDK4 binding).|R -> L (in a head and neck tumor).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.R80*(88)|p.?(13)|p.R80Q(2)|p.P135L(2)|p.T79fs*37(1)|p.L65fs*38(1)|p.R80fs*66(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)|p.R80?(1)|p.R80L(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGCACGGGTCGGGTGAGAGTG	0.726	R80*(MEWO_SKIN)|R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)	17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			11	1	---	---	---	---	PASS
DNAI1	27019	broad.mit.edu	37	9	34493264	34493264	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34493264A>G	uc003zum.2	+	9	947	c.754A>G	c.(754-756)ACC>GCC	p.T252A		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	252					cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		GAAGGCAAAGACCCCAGTGGC	0.463									Kartagener_syndrome				5	79	---	---	---	---	PASS
OR13C4	138804	broad.mit.edu	37	9	107289409	107289409	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107289409A>C	uc011lvn.1	-	1	82	c.82T>G	c.(82-84)TTT>GTT	p.F28V		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	28	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ATCAGAGCAAAGAAAATGATC	0.413													33	57	---	---	---	---	PASS
C5	727	broad.mit.edu	37	9	123780009	123780009	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123780009T>C	uc004bkv.2	-	13	1658	c.1628A>G	c.(1627-1629)TAT>TGT	p.Y543C	C5_uc010mvm.1_Missense_Mutation_p.Y543C|C5_uc010mvn.1_Missense_Mutation_p.Y543C	NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein	543					activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	GACGATGTAATAGACCAGAAG	0.408													25	59	---	---	---	---	PASS
INPP5E	56623	broad.mit.edu	37	9	139328548	139328548	+	Silent	SNP	G	T	T	rs143258290		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139328548G>T	uc004cho.2	-	3	1360	c.975C>A	c.(973-975)GCC>GCA	p.A325A	INPP5E_uc010nbm.2_Silent_p.A325A	NM_019892	NP_063945	Q9NRR6	INP5E_HUMAN	inositol polyphosphate-5-phosphatase E	325						cilium axoneme|cytoskeleton|Golgi cisterna membrane	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity			skin(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		AGTCGGCCTCGGCTGGGAGCA	0.682													3	16	---	---	---	---	PASS
FUT7	2529	broad.mit.edu	37	9	139925444	139925444	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139925444G>T	uc004ckq.2	-	2	1596	c.747C>A	c.(745-747)GGC>GGA	p.G249G	ABCA2_uc011mel.1_5'Flank|ABCA2_uc011mem.1_5'Flank|ABCA2_uc004ckl.1_5'Flank|ABCA2_uc004ckm.1_5'Flank|C9orf139_uc004ckp.1_Intron	NM_004479	NP_004470	Q11130	FUT7_HUMAN	fucosyltransferase 7	249	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity				0	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		CTGGCACAGTGCCAGCCACCA	0.622													41	63	---	---	---	---	PASS
MRC1	4360	broad.mit.edu	37	10	17949583	17949583	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17949583C>A	uc001ipk.2	+	28	4050	c.3947C>A	c.(3946-3948)TCC>TAC	p.S1316Y		NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor	1316	Extracellular (Potential).|C-type lectin 8.				receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						AGTCCGGTCTCCTTTGTCAAC	0.403													9	48	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50691393	50691393	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50691393T>A	uc001jhs.3	-	9	2145	c.1991A>T	c.(1990-1992)CAG>CTG	p.Q664L	ERCC6_uc010qgr.1_Missense_Mutation_p.Q34L|ERCC6_uc001jhr.3_Missense_Mutation_p.Q64L	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	664	Helicase ATP-binding.				base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						AGGTCATACCTGTTTGCAAGC	0.378								Direct_reversal_of_damage|NER					26	11	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108536394	108536394	+	Silent	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108536394T>C	uc001kym.2	-	4	791	c.783A>G	c.(781-783)GAA>GAG	p.E261E	SORCS1_uc001kyl.2_Silent_p.E261E|SORCS1_uc009xxs.2_Silent_p.E261E|SORCS1_uc001kyn.1_Silent_p.E261E|SORCS1_uc001kyo.2_Silent_p.E261E	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	261	Lumenal (Potential).|BNR 2.					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AAGTTGCCCCTTCATCTGAGC	0.403													26	18	---	---	---	---	PASS
C10orf84	63877	broad.mit.edu	37	10	120095118	120095118	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120095118C>T	uc001ldo.2	-	4	537	c.270G>A	c.(268-270)CAG>CAA	p.Q90Q	C10orf84_uc010qss.1_Silent_p.Q90Q	NM_022063	NP_071346	Q9H8W3	F204A_HUMAN	hypothetical protein LOC63877	90											0		Colorectal(252;0.101)		all cancers(201;0.0244)		TTGTGCTTTTCTGTTCAGAAT	0.313													13	6	---	---	---	---	PASS
C10orf137	26098	broad.mit.edu	37	10	127429673	127429673	+	Silent	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127429673T>C	uc001liq.1	+	17	2567	c.2274T>C	c.(2272-2274)AAT>AAC	p.N758N	C10orf137_uc001lin.2_Silent_p.N724N|C10orf137_uc001lio.1_Silent_p.N724N|C10orf137_uc001lip.1_Silent_p.N462N|C10orf137_uc001lir.2_Silent_p.N252N|C10orf137_uc001lis.1_Silent_p.N84N	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1	758					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGGCCCAGAATGCAAATAATA	0.438													42	24	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134898363	134898363	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134898363C>A	uc001llw.2	+	8	1425	c.1425C>A	c.(1423-1425)CTC>CTA	p.L475L				Q86SQ6	GP123_HUMAN	RecName: Full=Probable G-protein coupled receptor 123;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		AGCTGAGCCTCCCTGAGGAGG	0.647													4	27	---	---	---	---	PASS
LRRC56	115399	broad.mit.edu	37	11	551689	551689	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:551689G>T	uc010qvz.1	+	10	1340	c.835G>T	c.(835-837)GAG>TAG	p.E279*		NM_198075	NP_932341	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	279										skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACTTGACCCCGAGCTGTCCCT	0.687													3	16	---	---	---	---	PASS
DEAF1	10522	broad.mit.edu	37	11	686886	686886	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:686886G>A	uc001lqq.1	-	5	1469	c.776C>T	c.(775-777)GCG>GTG	p.A259V	DEAF1_uc009ycf.1_RNA	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1	259	SAND.				embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		GGGTCGGCCCGCGTAGCGAAT	0.607													9	13	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1093575	1093575	+	Silent	SNP	G	C	C	rs114864285	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093575G>C	uc001lsx.1	+	31	12507	c.12480G>C	c.(12478-12480)ACG>ACC	p.T4160T		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4160						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccacaactacGGTGACCGCAA	0.308													3	14	---	---	---	---	PASS
CCKBR	887	broad.mit.edu	37	11	6291936	6291936	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6291936C>T	uc001mcp.2	+	4	907	c.714C>T	c.(712-714)TAC>TAT	p.Y238Y	CCKBR_uc001mcq.2_Silent_p.Y166Y|CCKBR_uc001mcr.2_Silent_p.Y238Y|CCKBR_uc001mcs.2_Silent_p.Y238Y|CCKBR_uc001mct.1_5'Flank	NM_176875	NP_795344	P32239	GASR_HUMAN	cholecystokinin B receptor	238	Helical; Name=5; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding			lung(5)|ovary(2)|breast(1)	8		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CCGTGGCCTACGGGCTTATCT	0.582													9	31	---	---	---	---	PASS
OR2AG1	144125	broad.mit.edu	37	11	6806970	6806970	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6806970G>A	uc001mer.1	+	1	702	c.702G>A	c.(700-702)AGG>AGA	p.R234R		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATGAGGGGAGGAAGAAAGCCC	0.498													27	19	---	---	---	---	PASS
NRIP3	56675	broad.mit.edu	37	11	9005648	9005648	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9005648G>C	uc001mhg.2	-	5	700	c.586C>G	c.(586-588)CTT>GTT	p.L196V	NRIP3_uc010rbu.1_3'UTR	NM_020645	NP_065696	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3	196					proteolysis		aspartic-type endopeptidase activity				0				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		TGTAGACCAAGGGACAAGTTT	0.388													58	43	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17428178	17428178	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17428178G>T	uc001mnc.2	-	26	3446	c.3320C>A	c.(3319-3321)GCC>GAC	p.A1107D		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	1107	Cytoplasmic (By similarity).|ABC transmembrane type-1 2.				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CCTCATGGGGGCTAGGATGAT	0.413													9	4	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20005751	20005751	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20005751C>T	uc010rdm.1	+	12	3156	c.2795C>T	c.(2794-2796)ACC>ATC	p.T932I	NAV2_uc001mpp.2_Missense_Mutation_p.T845I|NAV2_uc001mpr.3_Missense_Mutation_p.T909I	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	932						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GTACGGGAGACCCTGCAACGA	0.572													27	14	---	---	---	---	PASS
SLC5A12	159963	broad.mit.edu	37	11	26725099	26725099	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26725099T>A	uc001mra.2	-	6	1113	c.800A>T	c.(799-801)AAA>ATA	p.K267I	SLC5A12_uc001mrb.2_RNA|SLC5A12_uc001mrc.3_Missense_Mutation_p.K267I	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	267	Cytoplasmic (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						CTTTTCTGTTTTGCAAGAGAT	0.358													38	22	---	---	---	---	PASS
OR5M8	219484	broad.mit.edu	37	11	56258265	56258265	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56258265C>A	uc001nix.1	-	1	582	c.582G>T	c.(580-582)AAG>AAT	p.K194N		NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	Esophageal squamous(21;0.00352)					TTGACAACTCCTTGTTGTAGG	0.418													20	82	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468292	56468292	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468292G>T	uc010rjn.1	+	1	429	c.429G>T	c.(427-429)CTG>CTT	p.L143L		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	143	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GTGCATTGCTGGTAGCAGTCT	0.468													6	162	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468738	56468738	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468738G>A	uc010rjn.1	+	1	875	c.875G>A	c.(874-876)AGG>AAG	p.R292K		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	292	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TACAGCCTAAGGAATAAGGAT	0.393													9	89	---	---	---	---	PASS
TCN1	6947	broad.mit.edu	37	11	59622223	59622223	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59622223T>A	uc001noj.2	-	7	1121	c.1023A>T	c.(1021-1023)AGA>AGT	p.R341S		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	341					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTCATTGATTCTCACAGAGT	0.408													13	54	---	---	---	---	PASS
GANAB	23193	broad.mit.edu	37	11	62397403	62397403	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62397403C>T	uc001nub.2	-	14	1653	c.1620G>A	c.(1618-1620)TGG>TGA	p.W540*	GANAB_uc001ntz.2_5'Flank|GANAB_uc001nua.2_Nonsense_Mutation_p.W562*|GANAB_uc001nuc.2_Nonsense_Mutation_p.W443*|GANAB_uc010rma.1_Nonsense_Mutation_p.W448*|GANAB_uc010rmb.1_Nonsense_Mutation_p.W426*	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	540					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						TCATGTCATTCCAGACAAAGA	0.532													20	64	---	---	---	---	PASS
RAB30	27314	broad.mit.edu	37	11	82708291	82708291	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82708291G>A	uc001ozu.2	-	3	329	c.68C>T	c.(67-69)ACG>ATG	p.T23M	RAB30_uc009yve.2_Missense_Mutation_p.T21M|RAB30_uc010rst.1_Missense_Mutation_p.T21M|RAB30_uc001ozv.2_Missense_Mutation_p.T21M|RAB30_uc009yvg.1_Missense_Mutation_p.T21M	NM_014488	NP_055303	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	23	GTP (By similarity).				protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity				0						GACGAGGCACGTCTTCCCCAC	0.408													8	44	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85447586	85447586	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85447586A>T	uc010rth.1	-	5	817	c.541T>A	c.(541-543)TCA>ACA	p.S181T	SYTL2_uc010rtg.1_Missense_Mutation_p.S182T|SYTL2_uc010rti.1_Missense_Mutation_p.S181T|SYTL2_uc010rtj.1_Missense_Mutation_p.S133T|SYTL2_uc001pbf.3_Missense_Mutation_p.S181T|SYTL2_uc010rtf.1_Missense_Mutation_p.S39T	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	181					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CCATTTTTTGACTGTTCATTT	0.323													6	22	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116729359	116729359	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116729359T>C	uc001ppy.2	-	20	2540	c.2504A>G	c.(2503-2505)CAT>CGT	p.H835R	SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron|SIK3_uc001ppw.2_Intron|SIK3_uc001ppx.2_Intron|SIK3_uc001pqb.2_Missense_Mutation_p.H138R	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	835	Gln-rich.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CGAAAACAGATGGGGGTGTAA	0.547													52	59	---	---	---	---	PASS
TNFRSF1A	7132	broad.mit.edu	37	12	6440025	6440025	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6440025C>T	uc001qnu.2	-	6	900	c.619G>A	c.(619-621)GAC>AAC	p.D207N	TNFRSF1A_uc001qnt.2_Missense_Mutation_p.D99N|TNFRSF1A_uc010sey.1_5'UTR|TNFRSF1A_uc010sez.1_Missense_Mutation_p.D99N|TNFRSF1A_uc009zek.2_Missense_Mutation_p.D164N	NM_001065	NP_001056	P19438	TNR1A_HUMAN	tumor necrosis factor receptor 1 precursor	207	Extracellular (Potential).				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|inflammatory response|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of inflammatory response|positive regulation of transcription from RNA polymerase II promoter|prostaglandin metabolic process	extracellular region|integral to plasma membrane|membrane raft	tumor necrosis factor receptor activity			lung(2)|skin(1)	3						TCACCTGAGTCCTCAGTGCCC	0.453													12	57	---	---	---	---	PASS
TNFRSF1A	7132	broad.mit.edu	37	12	6440077	6440077	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6440077C>A	uc001qnu.2	-	6	848	c.567G>T	c.(565-567)CTG>CTT	p.L189L	TNFRSF1A_uc001qnt.2_Silent_p.L81L|TNFRSF1A_uc010sey.1_5'UTR|TNFRSF1A_uc010sez.1_Silent_p.L81L|TNFRSF1A_uc009zek.2_Silent_p.L146L	NM_001065	NP_001056	P19438	TNR1A_HUMAN	tumor necrosis factor receptor 1 precursor	189	TNFR-Cys 4.|Extracellular (Potential).				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|inflammatory response|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of inflammatory response|positive regulation of transcription from RNA polymerase II promoter|prostaglandin metabolic process	extracellular region|integral to plasma membrane|membrane raft	tumor necrosis factor receptor activity			lung(2)|skin(1)	3						TCGTGCACTCCAGGCTTTTCT	0.512													4	45	---	---	---	---	PASS
KIAA1467	57613	broad.mit.edu	37	12	13208823	13208823	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13208823C>G	uc001rbi.2	+	2	399	c.376C>G	c.(376-378)CCC>GCC	p.P126A	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	126						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TTTCCTGATCCCCTGTCCTCC	0.577													13	33	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26220541	26220541	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26220541C>T	uc001rgx.2	+	4	1254	c.1033C>T	c.(1033-1035)CGG>TGG	p.R345W	RASSF8_uc001rgy.2_Missense_Mutation_p.R345W|RASSF8_uc001rgz.2_Missense_Mutation_p.R345W|RASSF8_uc009zjd.1_Missense_Mutation_p.R345W|RASSF8_uc009zje.1_Missense_Mutation_p.R345W	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	345					signal transduction						0	Colorectal(261;0.0847)					TAAGGAGTTGCGGCAAGTCAA	0.438													16	24	---	---	---	---	PASS
TFCP2	7024	broad.mit.edu	37	12	51489766	51489766	+	Intron	SNP	T	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51489766T>A	uc001rxw.2	-						TFCP2_uc001rxv.1_Intron|TFCP2_uc009zlx.1_Intron|TFCP2_uc001rxx.2_Intron	NM_005653	NP_005644	Q12800	TFCP2_HUMAN	transcription factor CP2						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTTGTCTTACTATTACCTTTC	0.313													19	18	---	---	---	---	PASS
KRT18	3875	broad.mit.edu	37	12	53345369	53345369	+	Silent	SNP	C	T	T	rs145578755		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53345369C>T	uc001sbe.2	+	5	831	c.762C>T	c.(760-762)GCC>GCT	p.A254A	KRT18_uc009zmn.1_Silent_p.A254A|KRT18_uc001sbf.1_Silent_p.A81A|KRT18_uc001sbg.2_Silent_p.A254A|KRT18_uc009zmo.2_Silent_p.A254A|KRT8_uc009zml.1_5'Flank|KRT8_uc009zmm.1_5'Flank	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	254	Interaction with DNAJB6.|Coil 2.|Rod.|Necessary for interaction with PNN.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						ACATCCGGGCCCAATATGACG	0.587													10	22	---	---	---	---	PASS
CALCOCO1	57658	broad.mit.edu	37	12	54115366	54115366	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54115366C>T	uc001sef.2	-	6	787	c.643G>A	c.(643-645)GAG>AAG	p.E215K	CALCOCO1_uc010som.1_Missense_Mutation_p.E182K|CALCOCO1_uc010son.1_Missense_Mutation_p.E92K|CALCOCO1_uc001seh.2_Missense_Mutation_p.E215K|CALCOCO1_uc009znd.2_Missense_Mutation_p.E215K|CALCOCO1_uc001seg.2_Missense_Mutation_p.E92K|CALCOCO1_uc010soo.1_Missense_Mutation_p.E208K	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	215					steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						ATGTCCCTCTCTTCTGTGATC	0.532													6	292	---	---	---	---	PASS
PAN2	9924	broad.mit.edu	37	12	56717636	56717636	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56717636C>T	uc001skx.2	-	14	2512	c.2139G>A	c.(2137-2139)CAG>CAA	p.Q713Q	PAN2_uc001skw.2_5'UTR|PAN2_uc001skz.2_Silent_p.Q712Q|PAN2_uc001sky.2_Silent_p.Q709Q	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog	713					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						CCTGTGTATTCTGGTCCAGGC	0.512													6	37	---	---	---	---	PASS
GAS2L3	283431	broad.mit.edu	37	12	101005798	101005798	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101005798G>A	uc001thu.2	+	6	550	c.324G>A	c.(322-324)GTG>GTA	p.V108V	GAS2L3_uc009zty.2_Silent_p.V108V|GAS2L3_uc001thv.2_Silent_p.V4V	NM_174942	NP_777602	Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	108	CH.				cell cycle arrest					skin(1)	1						TGAGAAAAGTGCCCTGTAAGA	0.353													31	20	---	---	---	---	PASS
PEBP1	5037	broad.mit.edu	37	12	118575878	118575878	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118575878G>T	uc001twu.1	+	2	315	c.170G>T	c.(169-171)GGT>GTT	p.G57V	PEBP1_uc010szc.1_Missense_Mutation_p.G57V	NM_002567	NP_002558	P30086	PEBP1_HUMAN	prostatic binding protein	57							ATP binding|phosphatidylethanolamine binding|serine-type endopeptidase inhibitor activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCGTGGGATGGTCTTGATTCA	0.438								Direct_reversal_of_damage					3	21	---	---	---	---	PASS
TAOK3	51347	broad.mit.edu	37	12	118693369	118693369	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118693369G>C	uc001twx.2	-	3	299	c.4C>G	c.(4-6)CGT>GGT	p.R2G	TAOK3_uc001twy.3_Missense_Mutation_p.R2G	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	2					MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACCCCTTTACGCATGATGGCC	0.398													39	102	---	---	---	---	PASS
TBC1D4	9882	broad.mit.edu	37	13	76055559	76055559	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76055559C>T	uc001vjl.1	-	1	692	c.345G>A	c.(343-345)GCG>GCA	p.A115A	TBC1D4_uc010aer.2_Silent_p.A115A|TBC1D4_uc010aes.2_Silent_p.A115A	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	115	PID 1.					cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		AGATGAATACCGCCGGGTTGG	0.662													31	7	---	---	---	---	PASS
RBM26	64062	broad.mit.edu	37	13	79946001	79946001	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79946001G>C	uc001vkz.2	-	4	406	c.392C>G	c.(391-393)TCA>TGA	p.S131*	RBM26_uc001vky.2_Nonsense_Mutation_p.S131*|RBM26_uc001vla.2_Nonsense_Mutation_p.S131*|RBM26_uc001vkx.2_5'Flank|RBM26_uc001vlb.1_5'Flank	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	131					mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		TCGGGAGCTTGACTGGGGAGG	0.368													9	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22539381	22539381	+	Intron	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22539381G>A	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wcy.2_Missense_Mutation_p.A93T					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AAGATTAAGCGCCACGACTGT	0.478													13	48	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	26917694	26917694	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26917694A>T	uc001wpy.2	-	5	1313	c.995T>A	c.(994-996)TTA>TAA	p.L332*	NOVA1_uc001wpz.2_Nonsense_Mutation_p.L308*|NOVA1_uc001wqa.2_Nonsense_Mutation_p.L210*	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	335	Ala-rich.				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		ACCTAAACCTAAAGTGTTGAG	0.299													17	16	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44974483	44974483	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44974483C>A	uc001wvn.2	-	1	2017	c.1708G>T	c.(1708-1710)GAA>TAA	p.E570*		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	570	Ala-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		GGGGCCTCTTCTATAGAAACT	0.517													17	37	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44975345	44975345	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44975345C>G	uc001wvn.2	-	1	1155	c.846G>C	c.(844-846)GAG>GAC	p.E282D		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	282						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		CAGGTCTGGGCTCCGCTTTAG	0.473													19	29	---	---	---	---	PASS
SOS2	6655	broad.mit.edu	37	14	50585051	50585051	+	3'UTR	SNP	T	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50585051T>G	uc001wxs.3	-	23					SOS2_uc010ans.2_3'UTR|SOS2_uc010tql.1_3'UTR|C14orf138_uc001wxn.1_5'Flank|C14orf138_uc001wxo.1_5'Flank|C14orf138_uc001wxp.1_5'Flank|C14orf138_uc001wxq.1_5'Flank	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					AATGACTACATATGGCTAAGG	0.353													12	25	---	---	---	---	PASS
EXOC5	10640	broad.mit.edu	37	14	57700535	57700535	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57700535C>T	uc001xct.2	-	9	1032	c.781G>A	c.(781-783)GTT>ATT	p.V261I	EXOC5_uc001xcs.2_5'Flank|EXOC5_uc010trg.1_Missense_Mutation_p.V206I|EXOC5_uc010trh.1_Missense_Mutation_p.V196I	NM_006544	NP_006535	O00471	EXOC5_HUMAN	SEC10 protein	261					exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm				ovary(2)|breast(1)	3						ATATCTCCAACTTGTTTGTTC	0.308													12	37	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58813807	58813807	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58813807T>G	uc001xdp.2	+	14	1398	c.1144T>G	c.(1144-1146)TCC>GCC	p.S382A	ARID4A_uc001xdo.2_Missense_Mutation_p.S382A|ARID4A_uc001xdq.2_Missense_Mutation_p.S382A|ARID4A_uc010apg.1_Missense_Mutation_p.S60A	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	382	ARID.				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						TTCAGCTGCTTCCTACAATGT	0.279													9	17	---	---	---	---	PASS
JDP2	122953	broad.mit.edu	37	14	75904629	75904629	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75904629G>A	uc010asj.2	+	2	73	c.6G>A	c.(4-6)ATG>ATA	p.M2I	JDP2_uc010tvb.1_Missense_Mutation_p.M2I|JDP2_uc010tvc.1_Missense_Mutation_p.M2I|JDP2_uc001xrq.2_Missense_Mutation_p.M13I	NM_001135047	NP_001128519	Q8WYK2	JDP2_HUMAN	Jun dimerization protein 2 isoform a	2						nucleus	sequence-specific DNA binding				0				BRCA - Breast invasive adenocarcinoma(234;0.0296)		CTGCTATGATGCCTGGGCAGA	0.667													8	6	---	---	---	---	PASS
TMED8	283578	broad.mit.edu	37	14	77810117	77810117	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77810117T>A	uc001xto.1	-	4	377	c.377A>T	c.(376-378)CAG>CTG	p.Q126L	TMED8_uc010ast.1_RNA|TMED8_uc001xtn.1_5'Flank	NM_213601	NP_998766	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain	126					transport	integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		ATGTTCAGACTGGATCATAAC	0.448													41	79	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94088266	94088266	+	Nonsense_Mutation	SNP	G	T	T	rs78490074	byFrequency	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94088266G>T	uc001ybv.1	+	28	4305	c.4222G>T	c.(4222-4224)GAG>TAG	p.E1408*	KIAA1409_uc001ybs.1_Nonsense_Mutation_p.E1386*	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1563						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		TGAAATCCCCGAGAACCCAGC	0.512													4	98	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20170141	20170141	+	IGR	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20170141G>T								None (None upstream) : GOLGA6L6 (566953 downstream)																							GGTGTATCCAGAAGCCTTGCA	0.582													42	63	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25310256	25310256	+	Intron	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25310256G>A	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-2_uc001yxp.2_RNA|SNORD116-5_uc001yxq.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CATTCTCATCGGAACTGAGGT	0.458													27	113	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31354881	31354881	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31354881C>G	uc001zfm.2	-	8	1052	c.924G>C	c.(922-924)GAG>GAC	p.E308D	TRPM1_uc010azy.2_Missense_Mutation_p.E215D|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	308	Extracellular (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTAGAAGCTGCTCCCTGAGGG	0.343													8	23	---	---	---	---	PASS
CKMT1A	548596	broad.mit.edu	37	15	43991299	43991299	+	3'UTR	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43991299C>A	uc001zsn.2	+	10					CKMT1A_uc010uea.1_3'UTR|CKMT1A_uc001zso.3_3'UTR	NM_001015001	NP_001015001	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1A precursor						creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TCCCCATCGCCAGCTGATGAC	0.512													5	117	---	---	---	---	PASS
DUOXA2	405753	broad.mit.edu	37	15	45408422	45408422	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45408422C>A	uc001zuo.2	+	3	586	c.306C>A	c.(304-306)CTC>CTA	p.L102L	DUOX2_uc010bea.2_5'Flank|DUOX2_uc001zun.2_5'Flank|DUOXA2_uc010beb.2_RNA	NM_207581	NP_997464	Q1HG44	DOXA2_HUMAN	dual oxidase activator 2	102	Extracellular (Potential).				protein transport	endoplasmic reticulum membrane|integral to membrane					0		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		TCCGTCTGCTCGTGGGCCTGG	0.567													5	155	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52561963	52561963	+	Silent	SNP	G	T	T	rs142061334	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52561963G>T	uc010bff.2	-	8	1064	c.927C>A	c.(925-927)ACC>ACA	p.T309T	MYO5C_uc010uga.1_RNA|MYO5C_uc010ugb.1_RNA|MYO5C_uc010ugc.1_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	309	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		GAAGCGTGAAGGTCTTTTGAG	0.323													5	98	---	---	---	---	PASS
CSNK1G1	53944	broad.mit.edu	37	15	64495336	64495336	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64495336C>G	uc002anf.2	-	10	1532	c.1052G>C	c.(1051-1053)CGA>CCA	p.R351P	CSNK1G1_uc002ane.2_RNA|CSNK1G1_uc002ang.1_Missense_Mutation_p.R351P|CSNK1G1_uc002anh.1_Missense_Mutation_p.R351P|CSNK1G1_uc002anj.2_Missense_Mutation_p.R333P	NM_022048	NP_071331	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	351					Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0						GTGGCTTTCTCGAGTTATTGC	0.453													9	19	---	---	---	---	PASS
PARP6	56965	broad.mit.edu	37	15	72542428	72542428	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72542428G>A	uc002auc.2	-	18	1883	c.1424C>T	c.(1423-1425)TCC>TTC	p.S475F	PARP6_uc002aua.2_Missense_Mutation_p.S321F|PARP6_uc002aub.2_RNA|PARP6_uc002aud.3_RNA|PARP6_uc002auf.1_Missense_Mutation_p.S476F	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	475	PARP catalytic.						NAD+ ADP-ribosyltransferase activity				0						CTCAATGTGGGACCCACTGTA	0.507													7	41	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79749056	79749056	+	Silent	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79749056C>G	uc002bew.1	+	2	642	c.567C>G	c.(565-567)GCC>GCG	p.A189A	KIAA1024_uc010unk.1_Silent_p.A189A	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	189						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						AAAACCGCGCCGCTTCCCTGG	0.572													14	32	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19041589	19041589	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19041589T>C	uc002dfq.2	+	6	885	c.755T>C	c.(754-756)ATT>ACT	p.I252T	TMC7_uc010vao.1_Missense_Mutation_p.I252T|TMC7_uc002dfp.2_Missense_Mutation_p.I252T|TMC7_uc010vap.1_Missense_Mutation_p.I142T	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	252	Extracellular (Potential).					integral to membrane				skin(2)|ovary(1)	3						CATTACACCATTGATGGGGTG	0.483													44	27	---	---	---	---	PASS
TMEM159	57146	broad.mit.edu	37	16	21181808	21181808	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21181808G>A	uc002dif.3	+	3	508	c.147G>A	c.(145-147)CCG>CCA	p.P49P	TMEM159_uc002dig.3_RNA|TMEM159_uc010vbf.1_Silent_p.P73P|TMEM159_uc002dih.3_Silent_p.P49P	NM_020422	NP_065155	Q96B96	TM159_HUMAN	transmembrane protein 159	49						integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(48;0.0972)		ACAGCCATCCGTTTCTGGCCT	0.537													55	19	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	960230	960230	+	Intron	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:960230G>T	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010vqg.1_Intron|ABR_uc002fsg.2_Intron|ABR_uc002fsh.1_Intron	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		TCTGGTTCCCGAGCTTACCGT	0.562													5	172	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5039221	5039221	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5039221C>T	uc002gau.1	+	17	2892	c.662C>T	c.(661-663)CCA>CTA	p.P221L	USP6_uc002gav.1_Missense_Mutation_p.P221L|USP6_uc010ckz.1_5'UTR|uc002gba.2_5'Flank|uc002gbb.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	221	Rab-GAP TBC.				protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CACTCCCTGCCAGGTAGGTGA	0.622			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								17	25	---	---	---	---	PASS
ATP1B2	482	broad.mit.edu	37	17	7557573	7557573	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7557573C>T	uc002gif.1	+	4	1133	c.550C>T	c.(550-552)CGG>TGG	p.R184W		NM_001678	NP_001669	P14415	AT1B2_HUMAN	Na+/K+ -ATPase beta 2 subunit	184	Extracellular (Potential).				ATP biosynthetic process|blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|sodium:potassium-exchanging ATPase activity	p.0?(2)|p.?(1)		central_nervous_system(1)|pancreas(1)	2		all_cancers(10;0.000178)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)		CAAGATGAACCGGGTATCTAT	0.557													37	123	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	A	A	rs121913344		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577022G>A	uc002gim.2	-	8	1110	c.916C>T	c.(916-918)CGA>TGA	p.R306*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.R306*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R174*|TP53_uc010cng.1_Nonsense_Mutation_p.R174*|TP53_uc002gii.1_Nonsense_Mutation_p.R174*|TP53_uc010cnh.1_Nonsense_Mutation_p.R306*|TP53_uc010cni.1_Nonsense_Mutation_p.R306*|TP53_uc002gij.2_Nonsense_Mutation_p.R306*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	306	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		R -> Q (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R306*(99)|p.0?(7)|p.?(3)|p.R306R(2)|p.R306fs*39(2)|p.K305fs*1(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGCTTACCTCGCTTAGTGCTC	0.562	R306*(MFE296_ENDOMETRIUM)|R306*(HCC1937_BREAST)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			39	60	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577138	7577138	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577138C>G	uc002gim.2	-	8	994	c.800G>C	c.(799-801)CGG>CCG	p.R267P	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R267P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R135P|TP53_uc010cng.1_Missense_Mutation_p.R135P|TP53_uc002gii.1_Missense_Mutation_p.R135P|TP53_uc010cnh.1_Missense_Mutation_p.R267P|TP53_uc010cni.1_Missense_Mutation_p.R267P|TP53_uc002gij.2_Missense_Mutation_p.R267P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	267	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> H (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R267W(20)|p.R267P(13)|p.0?(7)|p.R267Q(7)|p.R267R(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.R267fs*78(1)|p.N268fs*77(1)|p.L265_K305del41(1)|p.R267G(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.R267L(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AAAGCTGTTCCGTCCCAGTAG	0.527		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			5	18	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578177	7578177	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578177C>T	uc002gim.2	-	6	866	c.672G>A	c.(670-672)GAG>GAA	p.E224E	TP53_uc002gig.1_Silent_p.E224E|TP53_uc002gih.2_Silent_p.E224E|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Silent_p.E92E|TP53_uc010cng.1_Silent_p.E92E|TP53_uc002gii.1_Silent_p.E92E|TP53_uc010cnh.1_Silent_p.E224E|TP53_uc010cni.1_Silent_p.E224E|TP53_uc002gij.2_Silent_p.E224E|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Silent_p.E131E|TP53_uc002gio.2_Silent_p.E92E|TP53_uc010vug.1_Silent_p.E185E	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	224	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E224D(11)|p.0?(7)|p.E224E(6)|p.E224K(5)|p.E224*(4)|p.?(3)|p.E224G(2)|p.E224fs*4(1)|p.E224fs*5(1)|p.V218_E224delVPYEPPE(1)|p.E224fs*23(1)|p.V225fs*24(1)|p.E224fs*24(1)|p.E224_V225insXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAAACCAGACCTCAGGCGGCT	0.522		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			11	20	---	---	---	---	PASS
GLP2R	9340	broad.mit.edu	37	17	9792887	9792887	+	Silent	SNP	T	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9792887T>G	uc002gmd.1	+	13	1527	c.1527T>G	c.(1525-1527)GGT>GGG	p.G509G		NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	509	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	CCATGCGAGGTCTTGGGGAGC	0.627													18	31	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10359023	10359023	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10359023C>A	uc002gmn.2	-	19	2193	c.2082G>T	c.(2080-2082)CTG>CTT	p.L694L	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	694	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TCAGCTGATGCAGGACAAGCT	0.488													17	44	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10400644	10400644	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10400644G>T	uc002gmo.2	-	32	4585	c.4491C>A	c.(4489-4491)GAC>GAA	p.D1497E	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1497	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TTTCAAGTTGGTCTAAAGATT	0.338													11	37	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11532901	11532901	+	Silent	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11532901G>C	uc002gne.2	+	7	1586	c.1518G>C	c.(1516-1518)ACG>ACC	p.T506T		NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	506	Potential.|Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCCAAAGCACGGTAGGGTTGG	0.512													13	49	---	---	---	---	PASS
SUPT6H	6830	broad.mit.edu	37	17	27011913	27011913	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27011913C>A	uc002hby.2	+	19	2511	c.2421C>A	c.(2419-2421)GAC>GAA	p.D807E	SUPT6H_uc010crt.2_Missense_Mutation_p.D807E	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	807					chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					AAGTGACAGACTTCCTTCGAC	0.478													4	62	---	---	---	---	PASS
DDX52	11056	broad.mit.edu	37	17	35993348	35993348	+	Silent	SNP	G	A	A	rs145856014	byFrequency	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35993348G>A	uc002hoi.1	-	3	425	c.387C>T	c.(385-387)TCC>TCT	p.S129S	DDX52_uc002hoh.1_Silent_p.S21S|DDX52_uc002hoj.1_Silent_p.S37S	NM_007010	NP_008941	Q9Y2R4	DDX52_HUMAN	ATP-dependent RNA helicase ROK1 isoform a	129						nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|skin(1)	2		Breast(25;0.00637)|Ovarian(249;0.15)				CCAACTTTCCGGAAGTTAGTT	0.358													31	67	---	---	---	---	PASS
GSDMB	55876	broad.mit.edu	37	17	38073399	38073399	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38073399G>T	uc010cwj.2	-	1	176	c.171C>A	c.(169-171)ACC>ACA	p.T57T	GSDMB_uc010cwk.2_RNA|GSDMB_uc010cwl.2_RNA|GSDMB_uc010cwm.2_RNA|GSDMB_uc002htg.2_Silent_p.T57T|GSDMB_uc002hth.2_Silent_p.T57T|GSDMB_uc010wem.1_Silent_p.T57T	NM_001042471	NP_001035936	Q8TAX9	GSDMB_HUMAN	gasdermin B isoform 1	57						cytoplasm				breast(1)|pancreas(1)	2						TGTCCATCAGGGTGAGGCCTG	0.517													8	174	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56670914	56670914	+	Splice_Site	SNP	A	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56670914A>G	uc010dcz.1	-	15	2712	c.2594_splice	c.e15+1	p.S865_splice	TEX14_uc002iwr.1_Splice_Site_p.S859_splice|TEX14_uc002iws.1_Splice_Site_p.S859_splice|TEX14_uc010dda.1_Splice_Site_p.S639_splice	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATGTTGACCCACCTACTGGTA	0.423													14	31	---	---	---	---	PASS
KCNJ16	3773	broad.mit.edu	37	17	68128628	68128628	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68128628T>C	uc002jin.2	+	5	886	c.400T>C	c.(400-402)TAT>CAT	p.Y134H	KCNJ16_uc002jio.2_Missense_Mutation_p.Y134H|KCNJ16_uc002jip.2_Missense_Mutation_p.Y134H|KCNJ16_uc002jiq.2_Missense_Mutation_p.Y166H	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	134	Selectivity filter (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					CACCATAGGATATGGTTATCG	0.438													7	62	---	---	---	---	PASS
MGAT5B	146664	broad.mit.edu	37	17	74899417	74899417	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74899417C>T	uc002jti.2	+	4	614	c.511C>T	c.(511-513)CCC>TCC	p.P171S	MGAT5B_uc002jth.2_Missense_Mutation_p.P160S	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2	160	Lumenal (Potential).					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						GTGTGAGGCACCCAGTGACCC	0.647													12	45	---	---	---	---	PASS
SGSH	6448	broad.mit.edu	37	17	78184602	78184602	+	Silent	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78184602G>T	uc002jxz.3	-	8	1245	c.1158C>A	c.(1156-1158)CTC>CTA	p.L386L	SGSH_uc002jya.3_Silent_p.L183L|SGSH_uc002jxy.2_3'UTR	NM_000199	NP_000190	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase precursor	386			L -> R (in MPS3A).		proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGTTGTGCACGAGGCGGAAGT	0.627													4	90	---	---	---	---	PASS
C17orf70	80233	broad.mit.edu	37	17	79514423	79514423	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79514423G>C	uc002kaq.2	-	5	1740	c.1685C>G	c.(1684-1686)GCC>GGC	p.A562G	C17orf70_uc002kao.1_Missense_Mutation_p.A211G|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Missense_Mutation_p.A411G	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	562					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GTAGGTGATGGCGGAGCAGGC	0.682													35	33	---	---	---	---	PASS
WDR45L	56270	broad.mit.edu	37	17	80575270	80575270	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80575270G>A	uc002kfq.2	-	8	903	c.708C>T	c.(706-708)ATC>ATT	p.I236I	WDR45L_uc002kfr.2_RNA	NM_019613	NP_062559	Q5MNZ6	WIPI3_HUMAN	WDR45-like	236	WD 2.				autophagy|response to starvation	organelle membrane	phosphatidylinositol-3,5-bisphosphate binding			ovary(1)	1	Breast(20;0.00106)|all_neural(118;0.0952)	all_cancers(8;0.101)|all_epithelial(8;0.198)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.0835)			GATTGAAGTTGATGCTGCAGA	0.502													12	30	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21427528	21427528	+	Silent	SNP	A	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21427528A>G	uc002kuq.2	+	32	4118	c.4032A>G	c.(4030-4032)TCA>TCG	p.S1344S	LAMA3_uc002kur.2_Silent_p.S1344S	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1344	Laminin EGF-like 10.|Domain III B.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGACACACTCATTCAGCTTCC	0.657													24	4	---	---	---	---	PASS
MC4R	4160	broad.mit.edu	37	18	58038736	58038736	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58038736G>T	uc002lie.1	-	1	1266	c.847C>A	c.(847-849)CAC>AAC	p.H283N		NM_005912	NP_005903	P32245	MC4R_HUMAN	melanocortin 4 receptor	283	Helical; Name=7; (Potential).				feeding behavior|G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of bone resorption|positive regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|ubiquitin protein ligase binding			lung(1)	1		Colorectal(73;0.0946)				AAGTTAAAGTGAGACATGAAG	0.413													5	73	---	---	---	---	PASS
AP3D1	8943	broad.mit.edu	37	19	2137779	2137779	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2137779A>T	uc002luz.2	-	3	443	c.220T>A	c.(220-222)TGG>AGG	p.W74R	AP3D1_uc002luy.2_Missense_Mutation_p.W74R|AP3D1_uc002lva.2_Missense_Mutation_p.W74R	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1	74					eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCGGCCCAGCTGATGTCG	0.522													109	26	---	---	---	---	PASS
XAB2	56949	broad.mit.edu	37	19	7685168	7685168	+	Silent	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7685168C>T	uc002mgx.2	-	16	2285	c.2259G>A	c.(2257-2259)ACG>ACA	p.T753T		NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	753				SAT -> IP (in Ref. 2; AAF86951).	transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4						CACCGGTGCCCGTGGCACTGC	0.637								Direct_reversal_of_damage|NER					4	18	---	---	---	---	PASS
EVI5L	115704	broad.mit.edu	37	19	7913841	7913841	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7913841G>T	uc002min.2	+	4	516	c.362G>T	c.(361-363)CGG>CTG	p.R121L	EVI5L_uc010xjz.1_Missense_Mutation_p.R121L|EVI5L_uc002mio.1_5'Flank	NM_145245	NP_660288	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like isoform	121	Rab-GAP TBC.					intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						CACCACTTCCGGGCCATCGTG	0.672													3	12	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9077425	9077425	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9077425C>A	uc002mkp.2	-	3	10225	c.10021G>T	c.(10021-10023)GGA>TGA	p.G3341*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3342	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AATTCCATTCCAGTTGTCTTT	0.498													5	167	---	---	---	---	PASS
ASNA1	439	broad.mit.edu	37	19	12856427	12856427	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12856427G>T	uc002muv.2	+	4	477	c.463G>T	c.(463-465)GTG>TTG	p.V155L	ASNA1_uc002muw.2_Missense_Mutation_p.V154L	NM_004317	NP_004308	O43681	ASNA_HUMAN	arsA arsenite transporter, ATP-binding, homolog	155					response to arsenic-containing substance	endoplasmic reticulum|nucleolus|soluble fraction	arsenite-transporting ATPase activity|ATP binding|metal ion binding			ovary(2)	2					Adenosine triphosphate(DB00171)	CCTCAGGCTGGTGAAGGGCAT	0.667													38	14	---	---	---	---	PASS
PBX4	80714	broad.mit.edu	37	19	19680253	19680253	+	Intron	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19680253G>A	uc002nmy.2	-						PBX4_uc010xqz.1_Intron|PBX4_uc010xra.1_Intron	NM_025245	NP_079521	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2						AGGAGAGAACGTCACCTGGGA	0.557													7	99	---	---	---	---	PASS
C19orf46	163183	broad.mit.edu	37	19	36494565	36494565	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36494565C>G	uc002ocq.1	-	7	1070	c.981G>C	c.(979-981)AAG>AAC	p.K327N	C19orf46_uc002ocr.1_Missense_Mutation_p.E268Q|C19orf46_uc002ocs.1_Missense_Mutation_p.K214N|C19orf46_uc010een.1_Missense_Mutation_p.K242N	NM_001039876	NP_001034965	Q8N205	SYNE4_HUMAN	hypothetical protein LOC163183	327	Cytoplasmic (Potential).				establishment of epithelial cell apical/basal polarity	integral to nuclear outer membrane	actin binding			ovary(1)	1	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			ATGCTTGCCTCTTCTTGTCCT	0.433													4	22	---	---	---	---	PASS
ZNF568	374900	broad.mit.edu	37	19	37440987	37440987	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37440987G>C	uc002ofc.2	+	7	1447	c.932G>C	c.(931-933)TGT>TCT	p.C311S	ZNF568_uc010efg.2_Intron|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Missense_Mutation_p.C235S|ZNF568_uc010efe.2_Missense_Mutation_p.C235S|ZNF568_uc010eff.1_Intron	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	311	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTAAGGATTGTTGGAAAGCC	0.383													11	31	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39108208	39108208	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39108208C>T	uc002oix.1	-	2	265	c.157G>A	c.(157-159)GAT>AAT	p.D53N	MAP4K1_uc002oiy.1_Missense_Mutation_p.D53N|EIF3K_uc010xuh.1_5'Flank|EIF3K_uc002oiz.1_5'Flank|EIF3K_uc010xui.1_5'Flank	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	53	Protein kinase.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCCTCCTCACCAGGCTCCATC	0.602													10	26	---	---	---	---	PASS
CEACAM6	4680	broad.mit.edu	37	19	42265295	42265295	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42265295G>C	uc002orm.2	+	3	712	c.563G>C	c.(562-564)AGT>ACT	p.S188T		NM_002483	NP_002474	P40199	CEAM6_HUMAN	carcinoembryonic antigen-related cell adhesion	188	Ig-like C2-type 1.				cell-cell signaling|signal transduction	anchored to membrane|integral to plasma membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(3;0.00575)|all cancers(3;0.0352)|Epithelial(262;0.0797)		CTCCCGGTCAGTCCCAGGCTG	0.537													87	204	---	---	---	---	PASS
CADM4	199731	broad.mit.edu	37	19	44129408	44129408	+	Intron	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44129408T>C	uc002oxc.1	-							NM_145296	NP_660339	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4 precursor						cell adhesion	integral to membrane					0		Prostate(69;0.0199)				TTGGCCTGGGTGGGGATAAAG	0.582													9	9	---	---	---	---	PASS
ZNF230	7773	broad.mit.edu	37	19	44515453	44515453	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44515453A>G	uc002oyb.1	+	5	1513	c.1262A>G	c.(1261-1263)AAA>AGA	p.K421R		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	421	C2H2-type 10; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				AAACCCTTCAAATGTGAGGAT	0.438													47	21	---	---	---	---	PASS
PPP1R12C	54776	broad.mit.edu	37	19	55605706	55605706	+	Intron	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55605706C>A	uc002qix.2	-						PPP1R12C_uc010yfs.1_Intron|PPP1R12C_uc002qiy.2_Intron	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		cccagcccACCCCACACCTGT	0.313													30	18	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2384287	2384287	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2384287C>A	uc002wfy.1	+	9	1215	c.1154C>A	c.(1153-1155)GCT>GAT	p.A385D	TGM6_uc010gal.1_Missense_Mutation_p.A385D	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	385					cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	GTGCACCTGGCTCACGATGGC	0.622													31	45	---	---	---	---	PASS
SALL4	57167	broad.mit.edu	37	20	50406807	50406807	+	Missense_Mutation	SNP	C	T	T	rs41274696	byFrequency	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50406807C>T	uc002xwh.3	-	2	2316	c.2215G>A	c.(2215-2217)GCC>ACC	p.A739T	SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	739					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TTAAAAGGGGCAGGACCCACT	0.592													7	20	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61444873	61444873	+	Nonsense_Mutation	SNP	G	T	T	rs141833389		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61444873G>T	uc002ydj.2	+	7	1941	c.1906G>T	c.(1906-1908)GAG>TAG	p.E636*	OGFR_uc002ydk.2_Nonsense_Mutation_p.E619*|OGFR_uc002ydl.2_Nonsense_Mutation_p.E584*|uc011aam.1_Silent_p.R4R	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	636	6.|7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.731													6	6	---	---	---	---	PASS
KRTAP6-2	337967	broad.mit.edu	37	21	31971186	31971186	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31971186C>A	uc011adc.1	-	1	8	c.8G>T	c.(7-9)GGC>GTC	p.G3V	KRTAP22-1_uc011add.1_5'Flank	NM_181604	NP_853635	Q3LI66	KRA62_HUMAN	keratin associated protein 6-2	3						intermediate filament					0						GTAGTAGCTGCCGCACATCGT	0.493													21	31	---	---	---	---	PASS
GAL3ST1	9514	broad.mit.edu	37	22	30951444	30951444	+	Silent	SNP	G	A	A	rs35962480		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30951444G>A	uc003aig.1	-	4	908	c.768C>T	c.(766-768)GAC>GAT	p.D256D	GAL3ST1_uc003aih.1_Silent_p.D256D|GAL3ST1_uc003aii.1_Silent_p.D256D|GAL3ST1_uc010gvz.1_Silent_p.D256D	NM_004861	NP_004852	Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	256	Lumenal (Potential).				protein N-linked glycosylation	Golgi membrane|integral to plasma membrane|membrane fraction	galactosylceramide sulfotransferase activity				0						CCAGCGACTCGTCGAAGTACT	0.642													6	135	---	---	---	---	PASS
GAL3ST1	9514	broad.mit.edu	37	22	30951744	30951744	+	Silent	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30951744G>A	uc003aig.1	-	4	608	c.468C>T	c.(466-468)AAC>AAT	p.N156N	GAL3ST1_uc003aih.1_Silent_p.N156N|GAL3ST1_uc003aii.1_Silent_p.N156N|GAL3ST1_uc010gvz.1_Silent_p.N156N	NM_004861	NP_004852	Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	156	Lumenal (Potential).				protein N-linked glycosylation	Golgi membrane|integral to plasma membrane|membrane fraction	galactosylceramide sulfotransferase activity				0						TGAAGATGGCGTTGGTCGGCA	0.657													31	51	---	---	---	---	PASS
CDC42EP1	11135	broad.mit.edu	37	22	37964144	37964144	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37964144C>T	uc003asz.3	+	3	896	c.493C>T	c.(493-495)CGC>TGC	p.R165C		NM_152243	NP_689449	Q00587	BORG5_HUMAN	CDC42 effector protein 1	165					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|endomembrane system|Golgi apparatus|plasma membrane	protein binding				0	Melanoma(58;0.0574)					CACCATCTCCCGCCTGCCCCG	0.632													53	80	---	---	---	---	PASS
APOBEC3A	200315	broad.mit.edu	37	22	39357613	39357613	+	Silent	SNP	C	T	T	rs141631289		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39357613C>T	uc003awn.2	+	3	566	c.396C>T	c.(394-396)TAC>TAT	p.Y132Y	APOBEC3A_uc011aob.1_Silent_p.Y114Y|APOBEC3A_uc011aoc.1_Silent_p.Y132Y	NM_145699	NP_663745	P31941	ABC3A_HUMAN	phorbolin 1	132					cellular response to xenobiotic stimulus|defense response to virus|DNA cytosine deamination|DNA demethylation|innate immune response|negative regulation of transposition|negative regulation of viral genome replication	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					TCTATGATTACGACCCCCTAT	0.572													8	107	---	---	---	---	PASS
RBX1	9978	broad.mit.edu	37	22	41349630	41349630	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41349630G>A	uc003azk.2	+	2	168	c.150G>A	c.(148-150)ATG>ATA	p.M50I	XPNPEP3_uc011aoy.1_RNA	NM_014248	NP_055063	P62877	RBX1_HUMAN	ring-box 1	50					DNA repair|interspecies interaction between organisms|protein neddylation|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	Cul3-RING ubiquitin ligase complex|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytosol|nucleus|SCF ubiquitin ligase complex	NEDD8 ligase activity|protein binding|zinc ion binding			skin(1)	1						ACCACATTATGGATCTTTGTA	0.458													18	71	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42608247	42608247	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42608247C>T	uc003bcj.1	-	1	3199	c.3065G>A	c.(3064-3066)CGG>CAG	p.R1022Q	TCF20_uc003bck.1_Missense_Mutation_p.R1022Q|TCF20_uc003bnt.2_Missense_Mutation_p.R1022Q	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1022					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						GCCTCTGCTCCGCCCAGGAGA	0.547													14	37	---	---	---	---	PASS
CXorf22	170063	broad.mit.edu	37	X	35974179	35974179	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35974179A>C	uc004ddj.2	+	8	1335	c.1276A>C	c.(1276-1278)ATG>CTG	p.M426L	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	426										large_intestine(1)|lung(1)|ovary(1)	3						ACCTTGTTTCATGGGTGAACG	0.363													18	19	---	---	---	---	PASS
ZNF182	7569	broad.mit.edu	37	X	47862002	47862002	+	5'UTR	SNP	T	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47862002T>A	uc004dir.2	-	3					ZNF182_uc004dis.2_Nonsense_Mutation_p.K3*|ZNF182_uc004dit.2_5'UTR|ZNF182_uc011mlu.1_Nonsense_Mutation_p.K3*|ZNF630_uc010nhz.1_RNA|SPACA5_uc004diu.2_5'Flank	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						ACCTGGGGTTTGGCCATTTCC	0.423													4	13	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64749609	64749609	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64749609T>C	uc004dwa.1	-	5	736	c.664A>G	c.(664-666)ATC>GTC	p.I222V	LAS1L_uc004dwc.1_Missense_Mutation_p.I222V|LAS1L_uc004dwd.1_Missense_Mutation_p.I180V	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	222						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						TGTTCTGTGATGTCATCAACA	0.488													46	11	---	---	---	---	PASS
NOX1	27035	broad.mit.edu	37	X	100117753	100117753	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100117753C>T	uc004egj.2	-	5	600	c.394G>A	c.(394-396)GCC>ACC	p.A132T	uc010nnf.2_Intron|NOX1_uc004egl.3_Missense_Mutation_p.A132T|NOX1_uc010nne.2_Missense_Mutation_p.A95T	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long	132	Extracellular (Potential).|Ferric oxidoreductase.				angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1						CCATCTGTGGCCTGTCGGCTT	0.463													56	70	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107834432	107834432	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107834432C>T	uc004enz.1	+	20	1512	c.1310C>T	c.(1309-1311)CCT>CTT	p.P437L	COL4A5_uc011mso.1_Missense_Mutation_p.P437L|COL4A5_uc004eob.1_Missense_Mutation_p.P45L	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	437	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						CCAGGGCCTCCTGGCCCTGCT	0.468									Alport_syndrome_with_Diffuse_Leiomyomatosis				33	10	---	---	---	---	PASS
AKAP14	158798	broad.mit.edu	37	X	119048814	119048814	+	Silent	SNP	C	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119048814C>A	uc004ese.2	+	5	552	c.414C>A	c.(412-414)ACC>ACA	p.T138T	AKAP14_uc004esf.2_Intron	NM_178813	NP_848928	Q86UN6	AKA28_HUMAN	A kinase (PRKA) anchor protein 14 isoform a	138						cytoplasm					0						CCTACTTCACCATGAAGGTCT	0.388													6	123	---	---	---	---	PASS
RER1	11079	broad.mit.edu	37	1	2334241	2334241	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2334241delT	uc001aje.1	+						RER1_uc001ajf.1_Intron	NM_007033	NP_008964	O15258	RER1_HUMAN	RER1 retention in endoplasmic reticulum 1						retrograde vesicle-mediated transport, Golgi to ER	integral to Golgi membrane					0	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.28e-37)|OV - Ovarian serous cystadenocarcinoma(86;8.29e-23)|GBM - Glioblastoma multiforme(42;4.71e-08)|Colorectal(212;4.73e-05)|COAD - Colon adenocarcinoma(227;0.00021)|Kidney(185;0.00116)|BRCA - Breast invasive adenocarcinoma(365;0.00459)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0182)|Lung(427;0.204)		CCCCTTGCCCTTCCTCCACGG	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17054246	17054246	+	IGR	DEL	C	-	-	rs68142617		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17054246delC								ESPNP (7594 upstream) : CROCC (12522 downstream)																							AGAGAAGCTGCGGGCAGGACA	0.567													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30923042	30923042	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30923042delG								None (None upstream) : MATN1 (261084 downstream)																							tatcggatctggggactggac	0.000													4	2	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34197726	34197727	+	Intron	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34197726_34197727delCA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CGTGCACATGCACACACACACA	0.361													4	2	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34598125	34598125	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34598125delC	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ctaaaggatgcccagatagct	0.174													4	2	---	---	---	---	
CTPS	1503	broad.mit.edu	37	1	41448066	41448067	+	Intron	INS	-	T	T	rs138712726	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41448066_41448067insT	uc001cgk.3	+						CTPS_uc010ojo.1_Intron|CTPS_uc010ojp.1_Intron|CTPS_uc001cgl.3_5'Flank	NM_001905	NP_001896	P17812	PYRG1_HUMAN	CTP synthase						CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)	AAGAGAACTACtttttcttttt	0.213													2	5	---	---	---	---	
TIE1	7075	broad.mit.edu	37	1	43774021	43774028	+	Intron	DEL	GGGACCCA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43774021_43774028delGGGACCCA	uc001ciu.2	+						TIE1_uc010okd.1_Intron|TIE1_uc010oke.1_Intron|TIE1_uc009vwq.2_Intron|TIE1_uc010okf.1_Intron|TIE1_uc010okg.1_Intron|TIE1_uc010okc.1_Intron	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and						mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGTGGAGTAGGGGACCCAGGGATTGGGG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	45784816	45784817	+	IGR	DEL	TC	-	-	rs74346184		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45784816_45784817delTC								LOC400752 (13526 upstream) : HPDL (7728 downstream)																							ccattgcctatctcagcataat	0.000													0	7	---	---	---	---	
MAST2	23139	broad.mit.edu	37	1	46384979	46384979	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46384979delG	uc001cov.2	+						MAST2_uc001cow.2_Intron|MAST2_uc001cox.1_Intron|MAST2_uc001coy.1_Intron|MAST2_uc001coz.1_Intron|MAST2_uc009vya.2_Intron	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase						regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					tttagaggttggggcgatagt	0.005													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47921212	47921212	+	IGR	DEL	T	-	-	rs67072123		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47921212delT								FOXD2 (14850 upstream) : SKINTL (646175 downstream)																							GTCAGTAAtcttttttttttt	0.209													3	4	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49807225	49807225	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49807225delA	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		ttagaggcccacctcagtaag	0.000													4	2	---	---	---	---	
ZYG11A	440590	broad.mit.edu	37	1	53359783	53359783	+	3'UTR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53359783delT	uc001cuk.2	+	14					ZYG11A_uc001cul.2_3'UTR	NM_001004339	NP_001004339	Q6WRX3	ZY11A_HUMAN	zyg-11 homolog A								binding				0						gcacctggccTTTTTACAATT	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62076848	62076849	+	IGR	DEL	AG	-	-	rs75633278		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62076848_62076849delAG								NFIA (148389 upstream) : TM2D1 (69870 downstream)																							GCAGAGAAACAGAGTAAGGTCT	0.233													0	6	---	---	---	---	
WDR78	79819	broad.mit.edu	37	1	67356549	67356550	+	Intron	INS	-	GAAGAA	GAAGAA	rs144507356	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67356549_67356550insGAAGAA	uc001dcx.2	-						WDR78_uc001dcy.2_Intron|WDR78_uc001dcz.2_Intron|WDR78_uc009wax.2_5'Flank	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						aagaggaagaggaagaagaaga	0.104													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	81524728	81524729	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81524728_81524729delAC								None (None upstream) : LPHN2 (247116 downstream)																							CTAAacacaaacacacacacac	0.257													4	3	---	---	---	---	
LRRC8D	55144	broad.mit.edu	37	1	90368100	90368101	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90368100_90368101insT	uc001dnm.2	+						LRRC8D_uc001dnn.2_Intron	NM_001134479	NP_001127951	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane	protein binding			ovary(2)	2		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		ttctttttttcttttttttttt	0.198													3	3	---	---	---	---	
EVI5	7813	broad.mit.edu	37	1	93160645	93160645	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93160645delA	uc001dox.2	-						EVI5_uc010otf.1_Intron|EVI5_uc001doy.1_5'Flank	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5						cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		caagctacttaacctttctct	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	99002165	99002170	+	IGR	DEL	TTTCTT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99002165_99002170delTTTCTT								MIR137 (490438 upstream) : SNX7 (125066 downstream)																							ccttcctttctttcttttccttcctt	0.136													4	3	---	---	---	---	
VAV3	10451	broad.mit.edu	37	1	108296791	108296791	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108296791delA	uc001dvk.1	-						VAV3_uc010ouw.1_Intron|VAV3_uc001dvl.1_Intron|VAV3_uc010oux.1_Intron	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		CAGATCACTGAGGACCTTAAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116422584	116422585	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116422584_116422585delAC								NHLH2 (38837 upstream) : SLC22A15 (96534 downstream)																							acacacacagacacacacacac	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142623788	142623788	+	Intron	DEL	T	-	-	rs149122083		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142623788delT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		TGGGTTCTGGTTTTAGCACGT	0.413													5	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144533512	144533514	+	Intron	DEL	AAG	-	-	rs66523280		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144533512_144533514delAAG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						cgtatgtgaaaagaaccgttttt	0.172													5	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144550341	144550342	+	Intron	DEL	AA	-	-	rs71252608		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144550341_144550342delAA	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						CAGTTTTTGCAAAGTTACTAAA	0.386													5	4	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145012806	145012806	+	Intron	DEL	T	-	-	rs58323921		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145012806delT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_5'Flank	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCAACATAAATGATAATTGTC	0.343			T	PDGFRB	MPD								8	7	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145041738	145041738	+	Intron	DEL	T	-	-	rs11311233		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145041738delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_5'Flank|PDE4DIP_uc001eln.3_5'Flank|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_5'Flank|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						ATGTGTTGCATTTTTTTCCCA	0.289													3	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145054268	145054269	+	Intron	INS	-	G	G	rs149978567		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145054268_145054269insG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TGTGGTTACCTTCATTCATTTA	0.386													7	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145194931	145194934	+	Intron	DEL	CAAA	-	-	rs139628584		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145194931_145194934delCAAA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TATATTTTGTCAAACAAAAAGAAG	0.368													5	4	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145268060	145268060	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145268060delC	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GTGGAATCCACCCACATTGAA	0.204													3	3	---	---	---	---	
CTSK	1513	broad.mit.edu	37	1	150778115	150778117	+	Intron	DEL	AAA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150778115_150778117delAAA	uc001evp.1	-						CTSK_uc001evq.1_Intron	NM_000396	NP_000387	P43235	CATK_HUMAN	cathepsin K preproprotein						proteolysis	lysosome	cysteine-type endopeptidase activity|protein binding			skin(1)	1	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			actctatctcaaaaaaaaaaaaa	0.044													4	3	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151209320	151209321	+	Intron	DEL	AG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151209320_151209321delAG	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron|PIP5K1A_uc010pcv.1_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			ttttttttttagtttcactctt	0.198													4	2	---	---	---	---	
CELF3	11189	broad.mit.edu	37	1	151680217	151680217	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151680217delC	uc001eys.1	-						CELF3_uc010pdh.1_Intron|CELF3_uc001eyr.2_Intron|CELF3_uc009wmy.2_Intron|CELF3_uc009wmx.1_Intron|CELF3_uc001eyt.2_Intron|C1orf230_uc001eyu.2_5'Flank	NM_007185	NP_009116	Q5SZQ8	CELF3_HUMAN	trinucleotide repeat containing 4						nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding			ovary(1)|central_nervous_system(1)	2						AGGGTGGGGGCAAGATACAGG	0.701													10	7	---	---	---	---	
IL6R	3570	broad.mit.edu	37	1	154422581	154422582	+	Intron	DEL	TG	-	-	rs67952560		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154422581_154422582delTG	uc001fez.1	+						IL6R_uc001ffa.1_Intron	NM_000565	NP_000556	P08887	IL6RA_HUMAN	interleukin 6 receptor isoform 1 precursor						acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGAAATGTTCtgtgtgtgtgtg	0.243													7	5	---	---	---	---	
ADAR	103	broad.mit.edu	37	1	154563736	154563736	+	Intron	DEL	G	-	-	rs11335288		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154563736delG	uc001ffh.2	-						ADAR_uc001ffj.2_Intron|ADAR_uc001ffi.2_Intron|ADAR_uc001ffk.2_Intron	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a						adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ttcttaagcagaaatcagaag	0.184													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154792026	154792026	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154792026delC	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron|KCNN3_uc009wox.1_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			GTAGGAACCTCCCTCCCACTG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157918376	157918376	+	RNA	DEL	G	-	-	rs3832020		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157918376delG	uc001frl.1	+	4		c.556delG								Homo sapiens cDNA FLJ32876 fis, clone TESTI2004073.																		CCTGCCAGAAGCACCATACAG	0.453											OREG0013904	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161579608	161579610	+	IGR	DEL	CTC	-	-	rs41299295		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161579608_161579610delCTC								HSPA7 (1267 upstream) : FCGR3B (13380 downstream)																							tcaaccaattctcctgcctcagc	0.020													5	3	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162191050	162191050	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162191050delT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			TTTAAACACATTTTTGAAGTG	0.189													4	2	---	---	---	---	
SELP	6403	broad.mit.edu	37	1	169583092	169583092	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169583092delA	uc001ggi.3	-						SELP_uc001ggh.2_Intron|SELP_uc009wvr.2_Intron	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor						platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	GTCCCTTGTGAAAAGCATTGT	0.488													4	2	---	---	---	---	
DNM3	26052	broad.mit.edu	37	1	171990449	171990450	+	Intron	INS	-	T	T	rs77753897		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171990449_171990450insT	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						tgtctctacaattttttttttt	0.000													4	2	---	---	---	---	
TNR	7143	broad.mit.edu	37	1	175585291	175585291	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175585291delA	uc009wwu.1	-						TNR_uc010pmz.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					ATGCGACCCTAAAGGGCATTT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177625347	177625349	+	IGR	DEL	AAC	-	-	rs67426734		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177625347_177625349delAAC								FAM5B (373790 upstream) : SEC16B (272140 downstream)																							CTAAGGTAAAaacaacaacaaca	0.399													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	179679274	179679274	+	IGR	DEL	A	-	-	rs34563635		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179679274delA								TDRD5 (18876 upstream) : FAM163A (17641 downstream)																							GTCCCAGGAGAAAAAAAAAAA	0.423													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	179789035	179789036	+	IGR	DEL	TT	-	-	rs111292976		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179789035_179789036delTT								FAM163A (3709 upstream) : TOR1AIP2 (24918 downstream)																							ctaaagaacatttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	188017136	188017137	+	IGR	INS	-	GCAGA	GCAGA	rs149796008	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188017136_188017137insGCAGA								None (None upstream) : None (None downstream)																							TCTCTGAAAAGGCTCTGCTTAT	0.431													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201542455	201542456	+	IGR	DEL	GT	-	-	rs142683015		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201542455_201542456delGT								RPS10P7 (42853 upstream) : NAV1 (74994 downstream)																							gtgtgtatgcgtgtgtgtgtgt	0.317													4	2	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201792498	201792499	+	3'UTR	INS	-	TA	TA	rs140203725	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201792498_201792499insTA	uc001gwu.2	+	29					NAV1_uc001gwx.2_3'UTR	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						ctgcgtgtgtgtgtgtgtgtgt	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	202789954	202789954	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202789954delT	uc001gyh.2	+											Homo sapiens hypothetical protein LOC641515, mRNA (cDNA clone MGC:33633 IMAGE:4827085), complete cds.																		CCCCCACCCCttttttttttc	0.204													6	3	---	---	---	---	
LOC148709	148709	broad.mit.edu	37	1	202841549	202841550	+	Intron	INS	-	GCAGAGG	GCAGAGG	rs139009291	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202841549_202841550insGCAGAGG	uc001gyk.1	+							NR_002929				Homo sapiens cDNA FLJ31247 fis, clone KIDNE2005296, weakly similar to ACTIN, CYTOPLASMIC 1.												0						CCCTCACAGCAGCAGAGGCCTT	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203496678	203496679	+	IGR	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203496678_203496679delCA								OPTC (18601 upstream) : ATP2B4 (99249 downstream)																							acacatacaccacacacacaca	0.069													4	2	---	---	---	---	
MFSD4	148808	broad.mit.edu	37	1	205566501	205566501	+	Intron	DEL	G	-	-	rs34521321		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205566501delG	uc001hcv.3	+						MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_Intron|MFSD4_uc010prm.1_Intron|MFSD4_uc009xbn.2_Intron	NM_181644	NP_857595	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			AACCTAGGTTGtttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205572794	205572795	+	IGR	INS	-	ACAT	ACAT	rs149816409	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205572794_205572795insACAT								MFSD4 (749 upstream) : ELK4 (12440 downstream)																							accataaagaaacatacaggga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205861613	205861613	+	Intron	DEL	A	-	-	rs77152795		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205861613delA	uc001hdk.1	+											Homo sapiens cDNA FLJ31184 fis, clone KIDNE2000328.																		ggtcatactgaaaaaaaaaaa	0.000													3	3	---	---	---	---	
HHAT	55733	broad.mit.edu	37	1	210642206	210642207	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210642206_210642207insT	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_Intron	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TAAAATACTGCTTTTTTTTTGG	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212350979	212350979	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212350979delA								DTL (72793 upstream) : PPP2R5A (107900 downstream)																							TCTGACATGCAAAAACTAGct	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215633690	215633691	+	IGR	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215633690_215633691delTG								KCNK2 (223255 upstream) : KCTD3 (107044 downstream)																							tataaatgcatgtgtgtgtgtg	0.183													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215861437	215861438	+	Intron	INS	-	TT	TT	rs150121492	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215861437_215861438insTT	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		gaaattcttgattacaagggcg	0.000										HNSCC(13;0.011)			2	5	---	---	---	---	
DNAH14	127602	broad.mit.edu	37	1	225415135	225415135	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225415135delA	uc001how.2	+							NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						tcaatacaacacatgtttctg	0.000													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229106423	229106424	+	IGR	INS	-	TG	TG	rs150515210	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229106423_229106424insTG								RHOU (224014 upstream) : RAB4A (300455 downstream)																							AGTAAGTACTCTGGATGGTGGC	0.312													5	4	---	---	---	---	
URB2	9816	broad.mit.edu	37	1	229793754	229793754	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229793754delT	uc001hts.1	+						URB2_uc009xfd.1_Intron	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog							nucleolus				central_nervous_system(2)|ovary(1)	3						ACTGCTTTGGTTTTTTTCTAC	0.249													4	2	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234183427	234183428	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234183427_234183428delAC	uc001hvy.1	+							NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			tcatacacatacacacacacac	0.030													4	2	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240327856	240327856	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240327856delT	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ttctttagtgtttttggtctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242760960	242760960	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242760960delC								PLD5 (72962 upstream) : CEP170 (526771 downstream)																							ttcttgccatccacactacaa	0.000													4	2	---	---	---	---	
AKT3	10000	broad.mit.edu	37	1	243667735	243667735	+	3'UTR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243667735delA	uc001iab.1	-	13					AKT3_uc001hzz.1_Intron|AKT3_uc001iaa.2_5'Flank	NM_005465	NP_005456	Q9Y243	AKT3_HUMAN	AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			GTCAAGAAGGAAAAAAGGTTT	0.403													4	2	---	---	---	---	
C1orf150	148823	broad.mit.edu	37	1	247718611	247718612	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247718611_247718612insT	uc001idf.2	+						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823												0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CTCCAGGAAAAGGGGAAAAAAG	0.317													4	2	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1180151	1180151	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1180151delC	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		taaagaagtaccagaaactgg	0.095													4	2	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	2299484	2299485	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2299484_2299485delAC	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		agacagacagacagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4518009	4518011	+	IGR	DEL	AAG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4518009_4518011delAAG								ALLC (767751 upstream) : None (None downstream)																							ggaggagaacaaggaggaggagg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6169684	6169684	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6169684delG								LOC400940 (41320 upstream) : CMPK2 (810819 downstream)																							atgaggaattgggggaggggg	0.050													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6689800	6689800	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6689800delT								LOC400940 (561436 upstream) : CMPK2 (290703 downstream)																							tcctttttcctttcctttcAA	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8538516	8538517	+	IGR	DEL	CA	-	-	rs143190173		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8538516_8538517delCA								LOC339788 (421539 upstream) : ID2 (280823 downstream)																							cacgtacatgcacacacatgca	0.000													3	4	---	---	---	---	
ADAM17	6868	broad.mit.edu	37	2	9653132	9653132	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9653132delT	uc002qzu.2	-						ADAM17_uc010ewy.2_Intron|ADAM17_uc010ewz.2_Intron	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17						B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		gtatcctttctttttttttta	0.000													4	2	---	---	---	---	
GRHL1	29841	broad.mit.edu	37	2	10098304	10098304	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10098304delT	uc002raa.2	+						GRHL1_uc002rab.2_Intron|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Intron|uc002rac.2_5'Flank	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1						cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		tctttttttcttttttttttt	0.184													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11208855	11208855	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11208855delG								KCNF1 (154505 upstream) : C2orf50 (64324 downstream)																							tgtgtcacatggggacacagg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18676774	18676774	+	IGR	DEL	C	-	-	rs72118019		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18676774delC								KCNS3 (562550 upstream) : NT5C1B (59217 downstream)																							cttccttcctcccCTTCCCCT	0.050													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18956744	18956744	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18956744delT								NT5C1B (185906 upstream) : OSR1 (594503 downstream)																							gtcactcacatttggctcaga	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23027603	23027603	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23027603delT								None (None upstream) : KLHL29 (727852 downstream)																							tttgttgttgttttttttttg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	23325667	23325667	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23325667delA								None (None upstream) : KLHL29 (429788 downstream)																							CTTCCAGGGCAATGGCGTCAT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	24687002	24687002	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24687002delA								ITSN2 (103605 upstream) : NCOA1 (100177 downstream)																							CTTCATTGTTACCtttttttt	0.189													4	2	---	---	---	---	
SLC4A1AP	22950	broad.mit.edu	37	2	27914460	27914460	+	Intron	DEL	T	-	-	rs80052687		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27914460delT	uc002rlk.3	+							NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),							cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					taatctgttcttttttttttt	0.000													3	3	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28288452	28288452	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28288452delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					acctgggtggttttgtcctgt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	28588877	28588878	+	IGR	DEL	TC	-	-	rs3065567		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28588877_28588878delTC								BRE (27112 upstream) : FOSL2 (26901 downstream)																							AAGGGCCGAGTCTCTATTGGGC	0.337													4	2	---	---	---	---	
BIRC6	57448	broad.mit.edu	37	2	32725974	32725974	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32725974delT	uc010ezu.2	+							NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					gccctgccaattttttttttt	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37970471	37970472	+	IGR	INS	-	TG	TG	rs142322916		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37970471_37970472insTG								CDC42EP3 (71145 upstream) : FAM82A1 (181990 downstream)																							ATAGTGGACATTCTCTTACTCT	0.381													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37993535	37993535	+	IGR	DEL	T	-	-	rs33977020		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37993535delT								CDC42EP3 (94209 upstream) : FAM82A1 (158927 downstream)																							TGCCTAAAACTTGAGTTTCAG	0.318													6	3	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39047468	39047468	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39047468delC	uc002rrf.2	-						DHX57_uc002rrd.3_Intron|DHX57_uc002rre.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				TTCTCTCTCTCTTTTTTTTTT	0.303													4	2	---	---	---	---	
SLC8A1	6546	broad.mit.edu	37	2	40358155	40358155	+	Intron	DEL	T	-	-	rs5830604		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40358155delT	uc002rrx.2	-						uc002rrw.2_Intron|SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGTTTATCAGTGCATTGAAAT	0.209													3	8	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42808244	42808245	+	Intron	DEL	TC	-	-	rs139448308		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42808244_42808245delTC	uc002rso.1	+						MTA3_uc002rsp.1_Intron|MTA3_uc002rsq.2_Intron|MTA3_uc002rsr.2_Intron	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						ATTGTGTTTTTCTGTTTCTGTA	0.327													2	4	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45747814	45747819	+	Intron	DEL	AGAGAA	-	-	rs112252757		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45747814_45747819delAGAGAA	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			atggcgcagcagagaaagaggagaga	0.000													4	4	---	---	---	---	
LOC388946	388946	broad.mit.edu	37	2	46707131	46707132	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46707131_46707132insA	uc010yod.1	+							NM_001145051	NP_001138523	A6NEH6	YB028_HUMAN	hypothetical protein LOC388946							integral to membrane					0						TCCTGGTCCCCAAATATTTAGG	0.510													4	2	---	---	---	---	
LHCGR	3973	broad.mit.edu	37	2	48960903	48960904	+	Intron	INS	-	T	T	rs67673868		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48960903_48960904insT	uc002rwu.3	-						LHCGR_uc002rwv.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor						male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	AGACTTATATGTTTTTTTTTTC	0.386									Familial_Male-Limited_Precocious_Puberty				4	2	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54163035	54163035	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54163035delT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTTCAAAATGttttttttttt	0.149													3	3	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54840448	54840448	+	Intron	DEL	T	-	-	rs67979661		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54840448delT	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron|SPTBN1_uc002rxx.2_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			TAAAGATCTGTTTTGATTTTT	0.363													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59439939	59439939	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59439939delT								FANCL (971424 upstream) : None (None downstream)																							ATTGATAAGGTTTTTTTTTTG	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60038973	60038974	+	IGR	DEL	CC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60038973_60038974delCC								None (None upstream) : BCL11A (639329 downstream)																							CAGTTGGCATCCCATATATTCT	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60667962	60667963	+	IGR	DEL	AC	-	-	rs72354426		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60667962_60667963delAC								None (None upstream) : BCL11A (10340 downstream)																							gcacacccatacacacacacac	0.396													4	3	---	---	---	---	
PEX13	5194	broad.mit.edu	37	2	61261109	61261109	+	Intron	DEL	T	-	-	rs72121528		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61261109delT	uc002sau.3	+							NM_002618	NP_002609	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13						cerebral cortex cell migration|fatty acid alpha-oxidation|locomotory behavior|microtubule-based peroxisome localization|neuron migration|protein import into peroxisome matrix, docking|suckling behavior	integral to peroxisomal membrane|membrane fraction	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			gacttaggtgtttttttttgt	0.000													4	2	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61625660	61625661	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61625660_61625661insA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			gaggcggaagcggggaaggagg	0.015													4	5	---	---	---	---	
CCT4	10575	broad.mit.edu	37	2	62118313	62118313	+	5'Flank	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62118313delC	uc002sbo.2	-						CCT4_uc010ypp.1_5'Flank|CCT4_uc010ypq.1_5'Flank|CCT4_uc010ypr.1_5'Flank|CCT4_uc010yps.1_5'Flank	NM_006430	NP_006421	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)						'de novo' posttranslational protein folding	melanosome|microtubule organizing center|nucleus	ATP binding|unfolded protein binding			ovary(2)	2	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			ACTAGTTCTACCAGTGTAAGG	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	62632402	62632403	+	IGR	INS	-	CAA	CAA	rs139287927	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62632402_62632403insCAA								B3GNT2 (180538 upstream) : TMEM17 (94953 downstream)																							TAAACCCAGCCCAAGCCCTGTC	0.356													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67442750	67442751	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67442750_67442751insT	uc002sdx.2	+						uc002sdy.1_5'Flank					Homo sapiens, clone IMAGE:5541055, mRNA.																		TTGTTAAAGAGTTTTTTTCCTC	0.381											OREG0014654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67710079	67710079	+	IGR	DEL	G	-	-	rs36036356		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67710079delG								ETAA1 (72546 upstream) : C1D (559254 downstream)																							aaaaaaaaaagccatgtccat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67953654	67953654	+	IGR	DEL	A	-	-	rs112226035		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67953654delA								ETAA1 (316121 upstream) : C1D (315679 downstream)																							GTTTGGGACCAAAAAAAAAAA	0.443													2	5	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77226127	77226127	+	Intron	DEL	T	-	-	rs5832267		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77226127delT	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		TCAGTCTAACTTAGAGAGCTG	0.294													0	6	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	80346542	80346542	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80346542delG	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AAGCACCTATGGGAGGAATAT	0.383													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85145656	85145656	+	IGR	DEL	T	-	-	rs34279218		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85145656delT								TMSB10 (11857 upstream) : KCMF1 (52575 downstream)																							CTGTTTGAGGTTTTTTTTTTT	0.259													2	4	---	---	---	---	
RETSAT	54884	broad.mit.edu	37	2	85575882	85575883	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85575882_85575883insT	uc002spd.2	-						RETSAT_uc010fge.2_Intron|RETSAT_uc010ysm.1_Intron|RETSAT_uc010fgf.2_Intron	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase						retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(2)	2					Vitamin A(DB00162)	cttttcctttctttttttttga	0.099													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	86228871	86228872	+	IGR	INS	-	AC	AC	rs145578846	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86228871_86228872insAC								ST3GAL5 (112714 upstream) : LOC90784 (18467 downstream)																							TATCTTTGGCTacacacacaca	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90472399	90472400	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90472399_90472400insA								None (None upstream) : None (None downstream)																							actaaaaatacaaaaaattagg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91629266	91629266	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91629266delA								None (None upstream) : LOC654342 (175926 downstream)																							AATTCTTCTTAGATTGTCTCA	0.164													3	4	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91822185	91822186	+	Intron	INS	-	TT	TT			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91822185_91822186insTT	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						GGATGCTTAGAttttttttttt	0.104													4	2	---	---	---	---	
C2orf55	343990	broad.mit.edu	37	2	99516340	99516341	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99516340_99516341insA	uc002szf.1	-							NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990												0						GGCTCAGTGGGAGGGGAGGCAG	0.644													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102193307	102193308	+	IGR	INS	-	TG	TG	rs142855137	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102193307_102193308insTG								RFX8 (102142 upstream) : MAP4K4 (121180 downstream)																							AAAATAGGAGTtgtgtgtgtgt	0.277													4	3	---	---	---	---	
MAP4K4	9448	broad.mit.edu	37	2	102496974	102496974	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102496974delT	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Intron|MAP4K4_uc002tbk.2_Intron|MAP4K4_uc002tbl.2_Intron	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						tatagttctattttttttttt	0.000													4	2	---	---	---	---	
SEPT10	151011	broad.mit.edu	37	2	110355120	110355120	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110355120delA	uc002tew.2	-						SEPT10_uc010ywu.1_Intron|SEPT10_uc002tex.2_Intron|SEPT10_uc002tey.2_Intron|SEPT10_uc010ywv.1_Intron	NM_144710	NP_653311	Q9P0V9	SEP10_HUMAN	septin 10 isoform 1						cell cycle|cell division	septin complex	GTP binding				0						ACAAGGGGGTAAGGAGACTAA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	119846654	119846654	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119846654delA								MARCO (94418 upstream) : C1QL2 (67165 downstream)																							TGAAGTTGACAAGTGACAAGG	0.512													4	2	---	---	---	---	
EPB41L5	57669	broad.mit.edu	37	2	120915001	120915001	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120915001delA	uc002tmg.2	+						EPB41L5_uc010fll.2_Intron|EPB41L5_uc010flm.2_Intron	NM_020909	NP_065960	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1						agaagataagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125531342	125531343	+	Intron	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125531342_125531343delGT	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		taatcCTCTGgtgtgtgtgtgt	0.183													4	2	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128914130	128914130	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128914130delT	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						ATGTAGATAAttttttttttt	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129526388	129526388	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129526388delC								HS6ST1 (450217 upstream) : None (None downstream)																							CATTTTTGATCCAAGCTTCAG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129550233	129550234	+	IGR	INS	-	CACA	CACA	rs144317445		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129550233_129550234insCACA								HS6ST1 (474062 upstream) : None (None downstream)																							acagtgtctctcacacacgcac	0.050													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129696997	129696997	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129696997delA								HS6ST1 (620826 upstream) : LOC389033 (983438 downstream)																							tgagatgatgaaatgagcact	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129959906	129959907	+	IGR	INS	-	T	T	rs35269197		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129959906_129959907insT								HS6ST1 (883735 upstream) : LOC389033 (720528 downstream)																							gttttgtttccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132427332	132427332	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132427332delT								CCDC74A (136095 upstream) : C2orf27A (52732 downstream)																							AACCTTGGCCTTCTGTGCTCC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132779425	132779425	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132779425delT								C2orf27B (220191 upstream) : NCRNA00164 (125739 downstream)																							AACAAGTATCTTTTAAAAACA	0.418													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132854914	132854915	+	IGR	INS	-	T	T	rs143604842		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132854914_132854915insT								C2orf27B (295680 upstream) : NCRNA00164 (50249 downstream)																							TGTGTTTTTAGTTTTTATTTTG	0.233													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133104171	133104172	+	IGR	INS	-	T	T	rs148283604	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133104171_133104172insT								NCRNA00164 (88629 upstream) : GPR39 (69975 downstream)																							GGTTGCATCTGTTTTTTTTTGT	0.436													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	160782917	160782917	+	IGR	DEL	T	-	-	rs5835777		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160782917delT								LY75 (21655 upstream) : PLA2R1 (15095 downstream)																							TATAATAACCTTTTCTTTAGT	0.318													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	171604875	171604876	+	Intron	DEL	AA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171604875_171604876delAA	uc002ugf.1	-											Homo sapiens cDNA FLJ13453 fis, clone PLACE1003205.																		accccatctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DFNB59	494513	broad.mit.edu	37	2	179322311	179322312	+	Intron	INS	-	GGTCCCTCCCACC	GGTCCCTCCCACC	rs143243913	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179322311_179322312insGGTCCCTCCCACC	uc002umi.3	+						DFNB59_uc002umj.3_Intron	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59						sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			TGAAAAGCCGTGCTTTTGTGCT	0.436													4	2	---	---	---	---	
PPP1R1C	151242	broad.mit.edu	37	2	182910847	182910847	+	Intron	DEL	C	-	-	rs11312446		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182910847delC	uc002uoo.2	+						PPP1R1C_uc002uon.2_Intron|PPP1R1C_uc002uop.1_Intron|PPP1R1C_uc010frm.1_Intron|PPP1R1C_uc010frn.1_Intron	NM_001080545	NP_001074014	Q8WVI7	PPR1C_HUMAN	protein phosphatase 1, regulatory (inhibitor)						signal transduction	cytoplasm	protein phosphatase inhibitor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0628)			ttccttccttccttccttcct	0.000													6	3	---	---	---	---	
PDE1A	5136	broad.mit.edu	37	2	183197634	183197635	+	Intron	INS	-	A	A	rs150754367	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183197634_183197635insA	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uor.2_Intron|PDE1A_uc002uov.1_Intron	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			gaaagcaagacaaaaaaaagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	183739039	183739039	+	IGR	DEL	A	-	-	rs35959483		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183739039delA								FRZB (7541 upstream) : NCKAP1 (50567 downstream)																							acagagatatacaccaatgga	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	192729245	192729246	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192729245_192729246delAC								SDPR (17264 upstream) : TMEFF2 (85503 downstream)																							CTATTATCAAacacacacacac	0.307													4	2	---	---	---	---	
ANKRD44	91526	broad.mit.edu	37	2	198053471	198053472	+	Intron	INS	-	CA	CA	rs147961465	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198053471_198053472insCA	uc002uuc.2	-						ANKRD44_uc002uua.1_Intron|ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron|ANKRD44_uc002uud.1_Intron	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGGTAATTATGCACACACACAC	0.233													4	2	---	---	---	---	
COQ10B	80219	broad.mit.edu	37	2	198321186	198321187	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198321186_198321187insA	uc002uuh.1	+						COQ10B_uc010fsl.1_Intron	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor							mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			gactccatctcaaaaaaaaaaa	0.015													6	3	---	---	---	---	
SGOL2	151246	broad.mit.edu	37	2	201396996	201396996	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201396996delT	uc002uvw.2	+						SGOL2_uc002uvv.3_Intron|SGOL2_uc010zhd.1_Intron|SGOL2_uc010zhe.1_Intron	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1						cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						gagttttttgttttttttttt	0.095													3	4	---	---	---	---	
ALS2CR8	79800	broad.mit.edu	37	2	203798366	203798366	+	Intron	DEL	C	-	-	rs145842986		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203798366delC	uc002uzo.2	+						ALS2CR8_uc002uzn.2_Intron|ALS2CR8_uc002uzm.2_Intron|ALS2CR8_uc010zhy.1_Intron|ALS2CR8_uc010zhz.1_Intron|ALS2CR8_uc010ftu.1_Intron|ALS2CR8_uc010zia.1_Intron|ALS2CR8_uc010zib.1_Intron|ALS2CR8_uc010zic.1_Intron|ALS2CR8_uc002uzp.2_Intron	NM_001104586	NP_001098056	Q8N187	AL2S8_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)											large_intestine(1)|ovary(1)	2						tttctgtgctcgtcaatgctc	0.000													4	3	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	206225639	206225639	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206225639delT	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GGTGTCTTTATTTTTTTTTCT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	208174791	208174800	+	IGR	DEL	CACACACACA	-	-	rs72251796	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208174791_208174800delCACACACACA								MIR1302-4 (40643 upstream) : CREB1 (219816 downstream)																							CGCGCGCGCGcacacacacacacacacaca	0.386													4	2	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218432818	218432818	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218432818delG	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						CCCTGGGGGTGGGGGGGAAAC	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	220941557	220941557	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220941557delC								SLC4A3 (434856 upstream) : None (None downstream)																							TGTTCTCTGGCCACCAGGATA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221348583	221348586	+	IGR	DEL	ATTT	-	-	rs7419815	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221348583_221348586delATTT								SLC4A3 (841882 upstream) : EPHA4 (934163 downstream)																							tctttcattcatttattcattcat	0.201													4	2	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225863968	225863968	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225863968delT	uc010fwz.1	-						DOCK10_uc002vod.1_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		tctctctctcttttttttttt	0.080													4	2	---	---	---	---	
C2orf52	151477	broad.mit.edu	37	2	232373610	232373610	+	3'UTR	DEL	A	-	-	rs34321159		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232373610delA	uc002vrx.1	-	3						NR_024079				RecName: Full=Uncharacterized protein C2orf52;												0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;5.72e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		tctgtctcagaaaaaaaaaaa	0.169													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233211205	233211207	+	IGR	DEL	CAC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233211205_233211207delCAC								DIS3L2 (9298 upstream) : ALPP (32141 downstream)																							tcaagaaaaacaccaccaccacc	0.034													4	2	---	---	---	---	
DGKD	8527	broad.mit.edu	37	2	234359939	234359941	+	Intron	DEL	GAG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234359939_234359941delGAG	uc002vui.1	+						DGKD_uc002vuj.1_Intron|DGKD_uc010fyh.1_Intron|DGKD_uc010fyi.1_Intron	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	AGGCGCCATTGAGGAGGTGATGC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235222476	235222476	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235222476delT								SPP2 (236700 upstream) : ARL4C (179212 downstream)																							CTTGCTAGGGTTTTACCAGTC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237596256	237596256	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237596256delG								CXCR7 (105264 upstream) : COPS8 (397828 downstream)																							AGGCTTAAATGGGAAGCCATT	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238347070	238347070	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238347070delA								COL6A3 (24220 upstream) : MLPH (47983 downstream)																							CGCATGGTGTAAACATCTGTA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238351282	238351282	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238351282delC								COL6A3 (28432 upstream) : MLPH (43771 downstream)																							agagcctctgccagcccatca	0.189													4	2	---	---	---	---	
PRLH	51052	broad.mit.edu	37	2	238474132	238474133	+	5'Flank	DEL	AC	-	-	rs113835501		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238474132_238474133delAC	uc010znl.1	+							NM_015893	NP_056977	P81277	PRRP_HUMAN	prolactin releasing hormone precursor							extracellular region					0		Lung NSC(271;0.142)|all_lung(227;0.175)		Epithelial(121;8.28e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.03e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.19e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000329)|Lung(119;0.0106)|LUSC - Lung squamous cell carcinoma(224;0.0249)		ctacacacgtacacacacacat	0.000													4	2	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240208433	240208434	+	Intron	INS	-	A	A	rs148345573	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240208433_240208434insA	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		gagacacagacagacaaggaag	0.000													2	4	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241726139	241726139	+	Intron	DEL	G	-	-	rs10186490	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241726139delG	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCCTGAGTGAGGGGGTGGGGG	0.701													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5995817	5995817	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5995817delT								EDEM1 (734168 upstream) : GRM7 (906985 downstream)																							tttCTGTTTATTATaattttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	6146978	6146978	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6146978delT								EDEM1 (885329 upstream) : GRM7 (755824 downstream)																							ccttccttccttttttccctt	0.000													3	3	---	---	---	---	
SRGAP3	9901	broad.mit.edu	37	3	9181806	9181807	+	Intron	INS	-	AC	AC	rs138310347	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9181806_9181807insAC	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CTCAGAGGcatacacacacaca	0.054			T	RAF1	pilocytic astrocytoma								3	4	---	---	---	---	
SLC6A1	6529	broad.mit.edu	37	3	11069138	11069138	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11069138delT	uc010hdq.2	+							NM_003042	NP_003033	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)|skin(1)	2		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Cocaine(DB00907)|Tiagabine(DB00906)	tgttatcctgttttttttcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	31263206	31263206	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31263206delG								GADL1 (327053 upstream) : STT3B (311285 downstream)																							TGTCTTTTTTGCAGCCCAAAG	0.308													4	2	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49337677	49337677	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49337677delA	uc003cwq.2	-						USP4_uc003cwo.2_Intron|USP4_uc003cwp.2_Intron|USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		actctgtctcaaaaaaaaaaa	0.199													4	2	---	---	---	---	
FAM116A	201627	broad.mit.edu	37	3	57674410	57674411	+	Intron	INS	-	A	A	rs145426545	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57674410_57674411insA	uc003dja.2	-							NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627											pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)		AGACCAAAGACAAAAAAAAACA	0.495													4	7	---	---	---	---	
FRMD4B	23150	broad.mit.edu	37	3	69413316	69413316	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69413316delA	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dny.2_Intron	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		ACCCACAGGGAGCAAAGTAAC	0.313													4	2	---	---	---	---	
MITF	4286	broad.mit.edu	37	3	69834423	69834425	+	Intron	DEL	AGC	-	-	rs35669744		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69834423_69834425delAGC	uc003dnz.2	+						MITF_uc011bgb.1_Intron|MITF_uc003doa.2_Intron	NM_198159	NP_937802	O75030	MITF_HUMAN	microphthalmia-associated transcription factor						melanocyte differentiation|multicellular organismal development|protein complex assembly	nucleus|protein complex	DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			ovary(2)	2		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		AATAACAGCAagcagcagcagca	0.310			A		melanoma 		Waardenburg syndrome type 2|Tietz syndrome						3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	74174996	74174998	+	IGR	DEL	AAC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74174996_74174998delAAC								PDZRN3 (500924 upstream) : CNTN3 (136724 downstream)																							catcactactaacaacaacaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75741762	75741764	+	IGR	DEL	TTA	-	-	rs140744949		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75741762_75741764delTTA								MIR1324 (61753 upstream) : ZNF717 (17030 downstream)																							gaaagacttcttatgtttgagaa	0.000													2	4	---	---	---	---	
ZNF717	100131827	broad.mit.edu	37	3	75802876	75802877	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75802876_75802877insA	uc011bgi.1	-						ZNF717_uc003dpw.3_Intron	NM_001128223	NP_001121695	C9JSV9	C9JSV9_HUMAN	zinc finger protein 717						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						acactgctgtgtgatctgaatg	0.000													4	2	---	---	---	---	
FILIP1L	11259	broad.mit.edu	37	3	99737457	99737457	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99737457delA	uc003dtm.2	-						C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Intron	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1							cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						agtagaaaacaaaaaaaaatg	0.000													4	2	---	---	---	---	
ABI3BP	25890	broad.mit.edu	37	3	100684900	100684900	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100684900delC	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003dup.3_Intron	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						CTACTTTGATCCTAGGAGACC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	102466739	102466739	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102466739delT								ZPLD1 (268054 upstream) : None (None downstream)																							TCTCTCTCTCttttttttttt	0.204													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	102978215	102978216	+	IGR	DEL	CA	-	-	rs71103760		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102978215_102978216delCA								ZPLD1 (779530 upstream) : None (None downstream)																							catacacgcgcacacacacaca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107182708	107182708	+	RNA	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107182708delC	uc003dwj.2	+	3		c.1436delC								Homo sapiens cDNA clone IMAGE:5312582.																		AGCAAAACAGCCAAGCCTTTT	0.358													4	2	---	---	---	---	
DPPA2	151871	broad.mit.edu	37	3	109027972	109027972	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109027972delC	uc003dxo.2	-							NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2							nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						GACAAAGACTCCCATAATTAT	0.428													58	251	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	109112777	109112777	+	IGR	DEL	T	-	-	rs112631676		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109112777delT								DPPA4 (56358 upstream) : FLJ25363 (16060 downstream)																							TAGCCCTTACttttttttttt	0.035													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110661358	110661358	+	IGR	DEL	A	-	-	rs147259386		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110661358delA								None (None upstream) : PVRL3 (129507 downstream)																							actccatctcaaaaaaaaaaa	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112898209	112898210	+	IGR	DEL	AC	-	-	rs72327001		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112898209_112898210delAC								C3orf17 (159654 upstream) : BOC (32202 downstream)																							CAGTGCCTCTacacacacacac	0.366													5	8	---	---	---	---	
GRAMD1C	54762	broad.mit.edu	37	3	113630562	113630563	+	Intron	INS	-	TTTCT	TTTCT	rs146963689	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113630562_113630563insTTTCT	uc003eaq.3	+						GRAMD1C_uc011bil.1_Intron|GRAMD1C_uc011bim.1_Intron|GRAMD1C_uc003ear.2_Intron|GRAMD1C_uc003eas.2_Intron|GRAMD1C_uc003eat.2_5'Flank	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C							integral to membrane				ovary(2)|skin(1)	3						ttccttccttccttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	119146341	119146342	+	IGR	INS	-	GTTTGTTTTCTATA	GTTTGTTTTCTATA	rs146978390	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119146341_119146342insGTTTGTTTTCTATA								ARHGAP31 (8019 upstream) : TMEM39A (3359 downstream)																							attcctttgtggtagtatgctt	0.000													4	3	---	---	---	---	
SEMA5B	54437	broad.mit.edu	37	3	122736377	122736377	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122736377delC	uc003efz.1	-						SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_Intron|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		CCACAAGCATCCAGCAACAGA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126089041	126089042	+	IGR	INS	-	T	T	rs148331479	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126089041_126089042insT								KLF15 (12805 upstream) : CCDC37 (24740 downstream)																							TCAGATGTGTCAAAGCCATGGC	0.510													0	10	---	---	---	---	
UROC1	131669	broad.mit.edu	37	3	126209513	126209513	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126209513delA	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		gtctttctccaaaaaaaaaaa	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128935550	128935550	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128935550delA								CNBP (32740 upstream) : COPG (32903 downstream)																							actccgtctcaaaaaaaaaaa	0.269													4	2	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131836975	131836975	+	Intron	DEL	C	-	-	rs11315894		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131836975delC	uc003eom.2	-							NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						ATATTTATTTCCCCCCAAATG	0.313													1	5	---	---	---	---	
RAB6B	51560	broad.mit.edu	37	3	133614494	133614496	+	5'UTR	DEL	GGA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133614494_133614496delGGA	uc003epy.2	-	1					RAB6B_uc011blu.1_5'UTR	NM_016577	NP_057661	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family						protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding			pancreas(1)	1						GTCCGGCGGCggaggaggaggag	0.512													4	2	---	---	---	---	
BPESC1	60467	broad.mit.edu	37	3	138829383	138829383	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138829383delG	uc003eta.2	+							NR_026783				Homo sapiens blepharophimosis, epicanthus inversus and ptosis, candidate 1 (BPESC1) mRNA, complete cds.												0						AGGCCATTTAGGAGCACCACC	0.537													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140239891	140239891	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140239891delT	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						cttttttgcattttttttttt	0.000										HNSCC(16;0.037)			5	3	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143420121	143420121	+	Intron	DEL	G	-	-	rs143734144	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143420121delG	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						agaccaccgtggaaaacataa	0.000													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143539749	143539750	+	Intron	INS	-	T	T	rs36029573		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143539749_143539750insT	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						TCTTTGTCTTATTTTTTTTTTT	0.366													2	4	---	---	---	---	
PLSCR4	57088	broad.mit.edu	37	3	145940886	145940887	+	Intron	INS	-	ATGTT	ATGTT	rs141340768	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145940886_145940887insATGTT	uc010huy.2	-						PLSCR4_uc010huz.2_Intron|PLSCR4_uc003evt.3_Intron|PLSCR4_uc010hva.2_Intron|PLSCR4_uc003evu.3_Intron	NM_001128305	NP_001121777	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4 isoform a						blood coagulation|phospholipid scrambling	integral to membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding				0						tagactggggcatgttTAAGAA	0.129													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149452008	149452008	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149452008delT								WWTR1 (30893 upstream) : COMMD2 (4252 downstream)																							CTTTCCTATCTTTTCTAAATC	0.249													4	2	---	---	---	---	
EIF2A	83939	broad.mit.edu	37	3	150280207	150280207	+	Intron	DEL	A	-	-	rs5853482		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150280207delA	uc003eya.2	+						SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Intron|EIF2A_uc003eyc.2_Intron|EIF2A_uc011bnv.1_Intron|EIF2A_uc011bnw.1_Intron|EIF2A_uc003eyd.2_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A						regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			actccatctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	150490853	150490853	+	IGR	DEL	A	-	-	rs35936053		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150490853delA								SIAH2 (9590 upstream) : CLRN1OS (79418 downstream)																							CCGACTCTTTAAAAAAAAAAA	0.149													4	2	---	---	---	---	
CLRN1OS	116933	broad.mit.edu	37	3	150639617	150639618	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150639617_150639618delAC	uc011bny.1	+											Homo sapiens usher critical region protein (UCRP) pseudogene mRNA, complete sequence.												0						acacacacagacacacacacac	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151548070	151548071	+	IGR	INS	-	ACAA	ACAA	rs148502508	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151548070_151548071insACAA								AADAC (1794 upstream) : SUCNR1 (43366 downstream)																							ctaagcagaacacaaacaaaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	157661962	157661962	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157661962delT								C3orf55 (342943 upstream) : SHOX2 (151839 downstream)																							ccctacacaatttttttttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	160400228	160400229	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160400228_160400229delAC								ARL14 (3995 upstream) : PPM1L (73767 downstream)																							CCAAGATTAAacacacacacac	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167932482	167932482	+	IGR	DEL	T	-	-	rs111438851		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167932482delT								GOLIM4 (119065 upstream) : MIR551B (337160 downstream)																							ttttcttttgttttttttttt	0.129													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168608410	168608411	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168608410_168608411delAC								C3orf50 (60038 upstream) : MECOM (192876 downstream)																							atataGAGAGACACACACACAC	0.228													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	169045428	169045429	+	Intron	DEL	AA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169045428_169045429delAA	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						actgtgtctcaaaaaaaaaaaa	0.134													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	169250647	169250648	+	Intron	DEL	AT	-	-	rs59329432		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169250647_169250648delAT	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						ATTTTTACACATAGACATTTTT	0.371													2	5	---	---	---	---	
CLDN11	5010	broad.mit.edu	37	3	170360568	170360569	+	Intron	INS	-	AC	AC	rs150223590	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170360568_170360569insAC	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			GTTATAAGCAAacacacacaca	0.198													4	3	---	---	---	---	
CLDN11	5010	broad.mit.edu	37	3	170415462	170415462	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170415462delT	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			CATCATCACATTTGTTCATCA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	171675204	171675205	+	IGR	INS	-	CTCT	CTCT	rs139571335	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171675204_171675205insCTCT								TMEM212 (98096 upstream) : FNDC3B (82213 downstream)																							gcatcttctccgtgtcctcacc	0.000													1	6	---	---	---	---	
SPATA16	83893	broad.mit.edu	37	3	172837877	172837878	+	Intron	INS	-	A	A	rs74674625		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172837877_172837878insA	uc003fin.3	-							NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			aactccatctcaaaaaaaaaaa	0.163													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174049105	174049105	+	IGR	DEL	T	-	-	rs74461699		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174049105delT								NLGN1 (47989 upstream) : NAALADL2 (528006 downstream)																							cttcttcctcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174107136	174107137	+	IGR	INS	-	C	C	rs149900712	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174107136_174107137insC								NLGN1 (106020 upstream) : NAALADL2 (469974 downstream)																							tgcccctgtgtctttgcagggt	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174159515	174159516	+	Intron	INS	-	TT	TT	rs111370736		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174159515_174159516insTT	uc003fiq.1	+						uc003fir.2_Intron|uc003fis.2_Intron|uc010hwx.1_Intron					Homo sapiens NAALADL2 gene, partial 5'UTR, variant 1.																		ACATTCTTTGCTTTTTTTTTTT	0.426													7	8	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175460788	175460788	+	Intron	DEL	T	-	-	rs113136524		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175460788delT	uc003fit.2	+							NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		attccaaatcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	175580406	175580407	+	IGR	INS	-	TG	TG	rs141111859	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175580406_175580407insTG								NAALADL2 (56980 upstream) : None (None downstream)																							TTAAAAGCCTTtgtgtgtgtgt	0.188													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	175905075	175905077	+	IGR	DEL	AAC	-	-	rs67157836		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175905075_175905077delAAC								NAALADL2 (381649 upstream) : TBL1XR1 (833466 downstream)																							TCATATAGATAACAACAACCACA	0.177													2	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	179892011	179892012	+	IGR	DEL	CT	-	-	rs76028244		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179892011_179892012delCT								PEX5L (137494 upstream) : TTC14 (427906 downstream)																							gaattaaagactctaagattaa	0.000													1	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180770634	180770635	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180770634_180770635insT								DNAJC19 (63104 upstream) : SOX2OT (510874 downstream)																							tttatgcactcttttttttttt	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181205097	181205098	+	IGR	DEL	TT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181205097_181205098delTT								DNAJC19 (497567 upstream) : SOX2OT (76411 downstream)																							CAAGCCTAGGTTTTTTTTTTTT	0.302													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182441747	182441748	+	IGR	INS	-	A	A	rs111671493		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182441747_182441748insA								SOX2OT (982744 upstream) : ATP11B (69543 downstream)																							caccattgtggaaaaaaaaaAA	0.114													4	8	---	---	---	---	
KLHL6	89857	broad.mit.edu	37	3	183247113	183247113	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183247113delT	uc003flr.2	-						KLHL6_uc003fls.1_Intron|KLHL6_uc003flt.1_Intron	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6											haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GATATAGAGATTTTTTTTTTT	0.224													4	2	---	---	---	---	
VWA5B2	90113	broad.mit.edu	37	3	183955104	183955105	+	Frame_Shift_Ins	INS	-	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183955104_183955105insC	uc011bra.1	+	11	1624_1625	c.1624_1625insC	c.(1624-1626)ACCfs	p.T542fs	VWA5B2_uc011brb.1_Frame_Shift_Ins_p.T323fs|VWA5B2_uc003fnd.2_Frame_Shift_Ins_p.T262fs	NM_138345	NP_612354	B9EGN7	B9EGN7_HUMAN	von Willebrand factor A domain containing 5B2	542											0						GGCACTGCTGACCCCCCGGGAG	0.629													7	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184505351	184505352	+	IGR	INS	-	TTT	TTT	rs113092787		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184505351_184505352insTTT								MAGEF1 (75515 upstream) : VPS8 (24579 downstream)																							aTGCAACTACAttttttttttt	0.020													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184770795	184770795	+	IGR	DEL	T	-	-	rs11359249		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184770795delT								VPS8 (393 upstream) : C3orf70 (25045 downstream)																							TAGGTAGAAAttttttttttt	0.020													5	8	---	---	---	---	
C3orf70	285382	broad.mit.edu	37	3	184799202	184799203	+	3'UTR	INS	-	A	A	rs78897820		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184799202_184799203insA	uc003fpd.2	-	2						NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382												0						aactccatctcaaaaaaaaaaa	0.208													2	4	---	---	---	---	
EHHADH	1962	broad.mit.edu	37	3	184929348	184929349	+	Intron	DEL	TC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184929348_184929349delTC	uc003fpf.2	-						EHHADH_uc011brs.1_Intron	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl							peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	AAGGAATCTGTCTCTCTCTCTC	0.426													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186252701	186252704	+	IGR	DEL	ACAC	-	-	rs149888001		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186252701_186252704delACAC								DGKG (172678 upstream) : CRYGS (3529 downstream)																							ACAAGTTAAAacacacacacacac	0.279													6	3	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	187979148	187979149	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187979148_187979149delAC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		CTCTacacagacacacacacac	0.228			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	3	---	---	---	---	
IL1RAP	3556	broad.mit.edu	37	3	190345044	190345048	+	Intron	DEL	TTTTG	-	-	rs10538189		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190345044_190345048delTTTTG	uc003fsm.1	+						IL1RAP_uc003fsk.2_Intron|IL1RAP_uc003fsl.2_Intron|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		TGTCTTTGttttttgttttgttttg	0.283													8	5	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	191909624	191909625	+	Intron	INS	-	A	A	rs139402046		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191909624_191909625insA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		gactccgtctcaaaaaaaaaaa	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	192872921	192872921	+	IGR	DEL	T	-	-	rs138378895		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192872921delT								C3orf59 (236971 upstream) : HRASLS (85997 downstream)																							AGTAATGCTGTTTTTTTTTTT	0.323													2	4	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194949547	194949547	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194949547delT	uc003fum.3	-						C3orf21_uc011bsw.1_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		TATGTATCTCttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196359137	196359137	+	IGR	DEL	A	-	-	rs63053761		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196359137delA								FBXO45 (43209 upstream) : LRRC33 (7519 downstream)																							GAGAAGAAAGAAAAACCTACT	0.522													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197149800	197149801	+	IGR	INS	-	G	G	rs9325392	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197149800_197149801insG								DLG1 (123657 upstream) : BDH1 (86854 downstream)																							TTAAATTTTTTTGGGGGGGCTG	0.050													4	2	---	---	---	---	
LRCH3	84859	broad.mit.edu	37	3	197551233	197551233	+	Intron	DEL	T	-	-	rs67343015		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197551233delT	uc011bul.1	+						LRCH3_uc003fyj.1_Intron|LRCH3_uc011bum.1_Intron|LRCH3_uc011bun.1_Intron	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)							extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		cacgcccggcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197778431	197778431	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197778431delC								LMLN (7842 upstream) : LOC348840 (5973 downstream)																							tggtagtggtcccctggaccc	0.000													4	2	---	---	---	---	
GAK	2580	broad.mit.edu	37	4	898493	898495	+	In_Frame_Del	DEL	AGA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:898493_898495delAGA	uc003gbm.3	-	5	654_656	c.455_457delTCT	c.(454-459)TTCTAC>TAC	p.F152del	GAK_uc003gbn.3_In_Frame_Del_p.F73del|GAK_uc010ibk.1_Intron|GAK_uc003gbo.2_RNA|GAK_uc003gbl.3_In_Frame_Del_p.F16del	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	152	Protein kinase.				cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		CACGTCTGGTAGAAGATCTTCAG	0.552													11	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3585779	3585780	+	Intron	INS	-	AT	AT	rs149107570		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3585779_3585780insAT	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		cacacacacacacacacccatg	0.163													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3600521	3600522	+	IGR	INS	-	GC	GC	rs67212369		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3600521_3600522insGC								LRPAP1 (66297 upstream) : ADRA2C (167553 downstream)																							tgagcagttgtgcgtgtgtgtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3600621	3600623	+	IGR	DEL	AGC	-	-	rs71960441		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3600621_3600623delAGC								LRPAP1 (66397 upstream) : ADRA2C (167452 downstream)																							tgtgcatgtgagcagatgtgcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3606037	3606038	+	IGR	INS	-	TCAC	TCAC			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3606037_3606038insTCAC								LRPAP1 (71813 upstream) : ADRA2C (162037 downstream)																							TTTGAattcattcattcattca	0.421													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3619124	3619127	+	IGR	DEL	TCCT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3619124_3619127delTCCT								LRPAP1 (84900 upstream) : ADRA2C (148948 downstream)																							ccatcccctctcctcccttccttc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3624355	3624356	+	IGR	DEL	CT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3624355_3624356delCT								LRPAP1 (90131 upstream) : ADRA2C (143719 downstream)																							ggcttccggactctctcttagg	0.059													5	3	---	---	---	---	
PPP2R2C	5522	broad.mit.edu	37	4	6524941	6524941	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6524941delA	uc011bwd.1	-						PPP2R2C_uc011bwe.1_Intron	NM_181876	NP_870991	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						GCTCCAGAGGAAATAAAGGCC	0.408													4	2	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7298813	7298814	+	Intron	INS	-	G	G	rs147438239	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7298813_7298814insG	uc003gkb.3	+							NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						TCAGAGTGCCTGGGGGGGTCCT	0.614													7	4	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7527576	7527576	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7527576delG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						GGGCCCTCCTGCAGtcacctg	0.328													4	3	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7726316	7726317	+	Intron	INS	-	GAG	GAG			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7726316_7726317insGAG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						atggtggtggtgttggtgatgg	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8191055	8191056	+	IGR	DEL	AG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8191055_8191056delAG								ABLIM2 (30496 upstream) : SH3TC1 (10004 downstream)																							TGGTGGTGACAGATGATGGCCC	0.688													4	3	---	---	---	---	
BOD1L	259282	broad.mit.edu	37	4	13589266	13589266	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13589266delG	uc003gmz.1	-							NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division								DNA binding			ovary(5)|breast(1)	6						TCACTCTTTTGGATATAAAAA	0.318													4	2	---	---	---	---	
CD38	952	broad.mit.edu	37	4	15787162	15787163	+	Intron	INS	-	T	T	rs71281283		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15787162_15787163insT	uc011bxc.1	+						CD38_uc003goj.1_Intron|CD38_uc003gol.1_Intron	NM_001775	NP_001766	P28907	CD38_HUMAN	CD38 antigen						B cell receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of apoptosis|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of transcription, DNA-dependent|response to drug	integral to membrane|plasma membrane	binding|NAD+ nucleosidase activity|receptor activity			ovary(2)	2						CGTTCCTTTTCTTTTTTTTTTT	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33043235	33043235	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33043235delG								None (None upstream) : None (None downstream)																							cagagatcccgccagtgcact	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38322564	38322565	+	IGR	INS	-	T	T	rs140167494	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38322564_38322565insT								TBC1D1 (181771 upstream) : FLJ13197 (291757 downstream)																							TGTTCCTGTGATTTTTTTTGTT	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49094343	49094347	+	IGR	DEL	TGTTG	-	-	rs150471087		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49094343_49094347delTGTTG								CWH43 (30250 upstream) : None (None downstream)																							cattccgttctgttgcattccattc	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49533879	49533880	+	IGR	INS	-	A	A	rs142139508		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49533879_49533880insA								CWH43 (469786 upstream) : None (None downstream)																							tgtctacatggaaaaaaaaatt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53661678	53661679	+	IGR	INS	-	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53661678_53661679insG								KIAA0114 (81373 upstream) : RASL11B (66816 downstream)																							gaaggaaggaagaagaagaaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	73480290	73480290	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73480290delT								ADAMTS3 (45774 upstream) : COX18 (440126 downstream)																							gctaaatcactcctggacttc	0.000													4	2	---	---	---	---	
MTHFD2L	441024	broad.mit.edu	37	4	75074020	75074021	+	Intron	INS	-	T	T	rs140429550	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75074020_75074021insT	uc011cbk.1	+						MTHFD2L_uc011cbj.1_Intron	NM_001144978	NP_001138450	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase 2-like						folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity			ovary(1)|central_nervous_system(1)	2			all cancers(17;0.0101)|Lung(101;0.196)			TGTCTTCTAAATTCAGTGTCTT	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	86296425	86296425	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86296425delT								C4orf12 (368257 upstream) : ARHGAP24 (99859 downstream)																							gttcactccctctggtatctc	0.000													4	2	---	---	---	---	
ADH5	128	broad.mit.edu	37	4	100009805	100009806	+	Intron	INS	-	TT	TT			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100009805_100009806insTT	uc003hui.2	-						ADH5_uc003huk.1_Intron|uc003hum.1_5'Flank|uc003hul.1_5'Flank	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	CACTCCCTCCCTTGGACTCAGG	0.688													28	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	101547672	101547673	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101547672_101547673insA								EMCN (108422 upstream) : PPP3CA (396914 downstream)																							aacaatcatttaaaaaaaagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	105662937	105662938	+	IGR	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105662937_105662938delCA								CXXC4 (246879 upstream) : TET2 (405005 downstream)																							TGCATGCACGCACACACACACA	0.163													5	3	---	---	---	---	
GSTCD	79807	broad.mit.edu	37	4	106696970	106696970	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106696970delG	uc003hxz.3	+						GSTCD_uc003hxx.2_Intron|GSTCD_uc003hxy.3_Intron|GSTCD_uc011cfb.1_Intron	NM_001031720	NP_001026890	Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain							cytoplasm	rRNA methyltransferase activity			breast(1)|central_nervous_system(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		ctcccagtcaggaggcacggt	0.000													4	2	---	---	---	---	
C4orf21	55345	broad.mit.edu	37	4	113486586	113486587	+	Intron	INS	-	A	A	rs35098422		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113486586_113486587insA	uc003iau.2	-						C4orf21_uc003iav.2_Intron	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		ATTTCATTCTCaaaaaaaaaaa	0.312													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	122313538	122313539	+	IGR	INS	-	TGGA	TGGA	rs145912527	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122313538_122313539insTGGA								QRFPR (11357 upstream) : ANXA5 (275614 downstream)																							TGGGACTGGGCTGGAGGCTGTC	0.515													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	131000276	131000276	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131000276delG								C4orf33 (966434 upstream) : None (None downstream)																							ctgcatggctggggaggcctc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138330575	138330575	+	IGR	DEL	T	-	-	rs145232696		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138330575delT								None (None upstream) : PCDH18 (109501 downstream)																							CTTTCCCACAttttttttttt	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	141530760	141530760	+	IGR	DEL	A	-	-	rs5862489		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141530760delA								UCP1 (40801 upstream) : TBC1D9 (11177 downstream)																							GGGGGCAGAGAAAAAAAAAAT	0.512													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	145456038	145456039	+	IGR	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145456038_145456039delTG								GYPA (394134 upstream) : HHIP (111134 downstream)																							GACGAAAAGCtgtgtgtgtgtg	0.129													4	2	---	---	---	---	
PALLD	23022	broad.mit.edu	37	4	169514647	169514647	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169514647delC	uc011cjx.1	+						PALLD_uc003iru.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GAAATTCAGACCAAAAGCACA	0.413									Pancreatic_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	171533647	171533647	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171533647delA								AADAT (522275 upstream) : None (None downstream)																							acaaacagataaaaaataaat	0.060													4	2	---	---	---	---	
GLRA3	8001	broad.mit.edu	37	4	175578924	175578925	+	Intron	DEL	AT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175578924_175578925delAT	uc003ity.1	-						GLRA3_uc003itz.1_Intron	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	CCCCATCACAATATGTTTCAGT	0.297													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184411226	184411226	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184411226delA								CDKN2AIP (42177 upstream) : ING2 (14994 downstream)																							CTGGCTTTTTAAAAACATACA	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190615855	190615856	+	IGR	INS	-	TC	TC	rs146855852		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190615855_190615856insTC								None (None upstream) : FRG1 (246118 downstream)																							aattggtgggttcttggtctca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190643932	190643932	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190643932delA								None (None upstream) : FRG1 (218042 downstream)																							agcGTGCttcaacgcccttcg	0.015													9	4	---	---	---	---	
PLEKHG4B	153478	broad.mit.edu	37	5	166538	166539	+	Intron	INS	-	GC	GC			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166538_166539insGC	uc003jak.2	+							NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CTAATGCTCTGACGGGGCGGAG	0.614													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4326944	4326945	+	IGR	DEL	CT	-	-	rs10577409		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4326944_4326945delCT								IRX1 (725428 upstream) : LOC340094 (707527 downstream)																							TGCCCTCCACCTCTACTGCCCT	0.540													3	3	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11090905	11090905	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11090905delC	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						CCAGTAAGTTCAGCCTTTTTt	0.154													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11311389	11311393	+	Intron	DEL	CCTCA	-	-	rs72483583		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11311389_11311393delCCTCA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ctccatgcaccctcacctcacatgc	0.088													1	5	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11312112	11312113	+	Intron	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11312112_11312113delCA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						atatgcaccccacacacacact	0.134													7	4	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11592278	11592278	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11592278delG	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ctgcctgcctgccttcctgcc	0.100													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	11942322	11942323	+	IGR	DEL	AC	-	-	rs35757266		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11942322_11942323delAC								CTNND2 (38212 upstream) : None (None downstream)																							TTTTTATcatacacacacacac	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13009170	13009171	+	IGR	INS	-	A	A	rs71597511		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13009170_13009171insA								None (None upstream) : DNAH5 (681266 downstream)																							acgaacataggaaaaaaaaagc	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13379451	13379451	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13379451delA								None (None upstream) : DNAH5 (310986 downstream)																							accctagaggaaggaatgctt	0.000													4	2	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16809115	16809115	+	Intron	DEL	A	-	-	rs11360576		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16809115delA	uc003jft.3	-						MYO10_uc003jfu.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						GACAAGGAAGAAAAAAAAAAA	0.244													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17765295	17765296	+	IGR	INS	-	T	T	rs138116899	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17765295_17765296insT								BASP1 (488360 upstream) : None (None downstream)																							AATGACAACTATTTTTGTATCC	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18730675	18730676	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18730675_18730676delAC								None (None upstream) : CDH18 (742481 downstream)																							AGAAAGATGTacacacacacac	0.312													4	2	---	---	---	---	
CDH18	1016	broad.mit.edu	37	5	19909410	19909411	+	Intron	DEL	TT	-	-	rs11352062		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19909410_19909411delTT	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TTTCCTTCACtttttttttttt	0.178													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26805249	26805250	+	IGR	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26805249_26805250delCA								None (None upstream) : CDH9 (75459 downstream)																							tgtgaatgtgcacacacacaca	0.000													4	2	---	---	---	---	
CAPSL	133690	broad.mit.edu	37	5	35929185	35929185	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35929185delA	uc003jjt.1	-						CAPSL_uc003jju.1_Intron	NM_001042625	NP_001036090	Q8WWF8	CAPSL_HUMAN	calcyphosine-like							cytoplasm	calcium ion binding			skin(1)	1	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)			AAGAGGTAGTAAATACAGTTG	0.259													4	2	---	---	---	---	
SLC1A3	6507	broad.mit.edu	37	5	36612188	36612191	+	Intron	DEL	CACA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36612188_36612191delCACA	uc003jkj.3	+						SLC1A3_uc011cox.1_Intron|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity						D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)	cacacacacgcacacacacacaca	0.324													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38092853	38092853	+	IGR	DEL	T	-	-	rs55768103		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38092853delT								GDNF (253071 upstream) : EGFLAM (165680 downstream)																							CTTTAAAAGCTGTTGTCCTGC	0.433													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42732413	42732414	+	IGR	INS	-	TTTT	TTTT	rs142308679	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42732413_42732414insTTTT								GHR (10488 upstream) : CCDC152 (24506 downstream)																							ATCACTTCTTCTTTTTTGTAGT	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42846297	42846297	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42846297delA								SEPP1 (20299 upstream) : C5orf39 (192886 downstream)																							CTCCTTCCCGAAAAAAAAAAA	0.343													4	2	---	---	---	---	
C5orf28	64417	broad.mit.edu	37	5	43456097	43456098	+	Intron	INS	-	T	T	rs78452044		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43456097_43456098insT	uc003jny.2	-						C5orf28_uc003jnv.3_Intron|C5orf28_uc003jnx.2_Intron	NM_022483	NP_071928	Q0VDI3	CE028_HUMAN	hypothetical protein LOC64417							integral to membrane					0	Lung NSC(6;2.07e-05)					gtcaccatgccttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	45156811	45156812	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45156811_45156812insA								MRPS30 (341197 upstream) : HCN1 (102541 downstream)																							actatgcagccaaaaaaggaac	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	46378529	46378530	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46378529_46378530insA								HCN1 (682309 upstream) : None (None downstream)																							tatcttcacataaaactagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	54114727	54114727	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54114727delA								SNX18 (272312 upstream) : ESM1 (158969 downstream)																							ctgaacaatgaaaacacatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55985969	55985971	+	IGR	DEL	TGC	-	-	rs72093267		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55985969_55985971delTGC								ANKRD55 (456783 upstream) : MAP3K1 (124929 downstream)																							GGTGAAAtgttgctgctgctgct	0.394													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	72078921	72078921	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72078921delA								ZNF366 (275672 upstream) : TNPO1 (33497 downstream)																							ggcaatgcctagtggcattgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	72668074	72668074	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72668074delT								TMEM174 (197106 upstream) : FOXD1 (74013 downstream)																							TCTGAGCCTGTTCCAAATCCT	0.443													4	2	---	---	---	---	
SV2C	22987	broad.mit.edu	37	5	75544449	75544449	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75544449delT	uc003kei.1	+							NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		tgctcagtgattttttttttt	0.030													4	2	---	---	---	---	
SCAMP1	9522	broad.mit.edu	37	5	77697847	77697847	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77697847delT	uc003kfl.2	+						SCAMP1_uc010jaa.2_Intron|SCAMP1_uc011ctc.1_Intron|SCAMP1_uc011ctd.1_Intron	NM_004866	NP_004857	O15126	SCAM1_HUMAN	secretory carrier membrane protein 1						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|recycling endosome membrane|trans-Golgi network	protein binding				0		all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		aagatgtacatttttttttcc	0.000													4	2	---	---	---	---	
CKMT2	1160	broad.mit.edu	37	5	80548428	80548441	+	Intron	DEL	TGGAAGGATGGGCA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80548428_80548441delTGGAAGGATGGGCA	uc003khc.3	+						RNU5E_uc011cto.1_Intron|CKMT2_uc010jaq.2_Intron|CKMT2_uc003khd.3_Intron|uc003khe.1_Intron|uc003khf.1_Intron|uc003khg.1_Intron	NM_001825	NP_001816	P17540	KCRS_HUMAN	sarcomeric mitochondrial creatine kinase						creatine metabolic process|muscle contraction	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	GGGAGCCTAGTGGAAGGATGGGCAAACAACAAGT	0.556													7	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90759200	90759201	+	IGR	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90759200_90759201delCA								LOC100129716 (42669 upstream) : None (None downstream)																							tcacaattgtcacacacacaca	0.000													4	2	---	---	---	---	
LNPEP	4012	broad.mit.edu	37	5	96288327	96288327	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96288327delG	uc003kmv.1	+							NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1						cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		GGTTATGTGCGGATTCTACCG	0.403													3	4	---	---	---	---	
RGMB	285704	broad.mit.edu	37	5	98106505	98106506	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98106505_98106506insA	uc003knc.2	+						RGMB_uc003knb.2_Intron|uc003knd.2_RNA|uc003kne.2_RNA	NM_001012761	NP_001012779	Q6NW40	RGMB_HUMAN	RGM domain family, member B						axon guidance|BMP signaling pathway|cell adhesion|positive regulation of transcription, DNA-dependent	anchored to plasma membrane|ER-Golgi intermediate compartment|membrane raft	identical protein binding				0		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		ctcttgctctgaaaAAAAAAAT	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	100449856	100449856	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100449856delT								ST8SIA4 (210869 upstream) : None (None downstream)																							tgttaatcacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103397716	103397716	+	IGR	DEL	C	-	-	rs113015686		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103397716delC								NUDT12 (499226 upstream) : None (None downstream)																							tagcccgcctccccccacccc	0.000													3	3	---	---	---	---	
APC	324	broad.mit.edu	37	5	112130654	112130654	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112130654delG	uc010jby.2	+						APC_uc011cvt.1_Intron|APC_uc003kpz.3_Intron|APC_uc003kpy.3_Intron|APC_uc010jbz.2_Intron	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli						canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity			large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		gaatggggatgggggtgcaga	0.000		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			4	2	---	---	---	---	
MCC	4163	broad.mit.edu	37	5	112667393	112667393	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112667393delT	uc003kql.3	-						MCC_uc003kqk.3_Intron	NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		agtacagtggtgccatcttgg	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	114894168	114894169	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114894168_114894169insT								FEM1C (13577 upstream) : TMED7-TICAM2 (20171 downstream)																							cagccaaaggatttttttttgc	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124527880	124527881	+	IGR	DEL	AA	-	-	rs72419270		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124527880_124527881delAA								ZNF608 (443380 upstream) : None (None downstream)																							agtgtaaaagaaaaaaaaaaaa	0.000													2	4	---	---	---	---	
TXNDC15	79770	broad.mit.edu	37	5	134215485	134215485	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134215485delT	uc003lac.1	+						TXNDC15_uc010jdy.1_Intron|TXNDC15_uc011cxv.1_Intron	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor						cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTACCTGCCttttttttttt	0.244													3	3	---	---	---	---	
BRD8	10902	broad.mit.edu	37	5	137440854	137440855	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137440854_137440855insA	uc003lcc.1	-							NM_001164326		Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 4						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ctccgtctcagaaaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	138011970	138011970	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138011970delT								HSPA9 (100855 upstream) : CTNNA1 (77137 downstream)																							cacactactcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141133966	141133966	+	IGR	DEL	G	-	-	rs139133850		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141133966delG								ARAP3 (72166 upstream) : PCDH1 (98717 downstream)																							GAAGTAGGGCGGGGGGGTGGC	0.512													4	2	---	---	---	---	
PRELID2	153768	broad.mit.edu	37	5	145179864	145179865	+	Intron	INS	-	AC	AC	rs141244679	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145179864_145179865insAC	uc003lnp.1	-						PRELID2_uc003lnq.1_Intron|PRELID2_uc003lno.1_Intron|PRELID2_uc003lnr.1_Intron	NM_182960	NP_892005	Q8N945	PRLD2_HUMAN	PRELI domain containing 2 isoform a												0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ccccttctcTTacacacacaca	0.248													4	2	---	---	---	---	
JAKMIP2	9832	broad.mit.edu	37	5	147085131	147085132	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147085131_147085132insA	uc003loq.1	-						JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Intron	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein							Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			agacctgtctcaaaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	150067251	150067251	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150067251delA								MYOZ3 (8326 upstream) : RBM22 (3102 downstream)																							ttctatctccaaaaaaaaaag	0.000													4	2	---	---	---	---	
EBF1	1879	broad.mit.edu	37	5	158206091	158206091	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158206091delC	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			agatgatcttccccaaatcaa	0.164			T	HMGA2	lipoma								4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166854731	166854731	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166854731delG	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		aggaagggaaggaagaaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172868102	172868103	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172868102_172868103insT								STC2 (111596 upstream) : LOC285593 (138543 downstream)																							tcctcagacactttgcacttgc	0.000													4	2	---	---	---	---	
RASGEF1C	255426	broad.mit.edu	37	5	179549864	179549864	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179549864delC	uc003mlq.2	-						RASGEF1C_uc003mlr.2_Intron|RASGEF1C_uc003mlp.3_Intron	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ccaaaggaagcaaaggaagga	0.000													4	2	---	---	---	---	
RASGEF1C	255426	broad.mit.edu	37	5	179593515	179593515	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179593515delC	uc003mlr.2	-							NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			aagaatttttctttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3705375	3705376	+	IGR	INS	-	A	A	rs149392959	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3705375_3705376insA								SLC22A23 (248582 upstream) : C6orf145 (17460 downstream)																							aattggtagataaaggtgctgt	0.025													4	6	---	---	---	---	
LOC285780	285780	broad.mit.edu	37	6	6378715	6378716	+	Intron	DEL	CT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6378715_6378716delCT	uc003mww.3	-						LOC285780_uc003mwx.2_Intron	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0						ccctccctccctctctctccct	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8995541	8995544	+	IGR	DEL	ACAC	-	-	rs142196708		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8995541_8995544delACAC								HULC (341464 upstream) : None (None downstream)																							acatgcacatacacacacacacac	0.137													4	2	---	---	---	---	
JARID2	3720	broad.mit.edu	37	6	15271172	15271172	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15271172delA	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				gctccctctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	26709268	26709268	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26709268delC								ZNF322A (49305 upstream) : GUSBL1 (129998 downstream)																							cctagctactcgggaggctga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	31067916	31067917	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31067916_31067917insA								HCG22 (40263 upstream) : C6orf15 (11083 downstream)																							cgaaaaaaaagaaaaaaaaagt	0.000													4	2	---	---	---	---	
MICB	4277	broad.mit.edu	37	6	31464452	31464453	+	5'Flank	DEL	TT	-	-	rs112885823		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31464452_31464453delTT	uc003ntn.3	+						MICB_uc011dnm.1_Intron|MICB_uc003nto.3_5'Flank	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B						antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0						CCCTTTTTCCTTTTTTTTTTTT	0.025													3	3	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32516417	32516418	+	Intron	INS	-	G	G	rs149288376	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32516417_32516418insG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						tagcttcctgaggccctcacca	0.000													3	5	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32557290	32557291	+	Intron	INS	-	T	T	rs145132878	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32557290_32557291insT	uc003obk.3	-						HLA-DRB1_uc003obp.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TTTGGGATCCAATGATAAAGAT	0.416													5	6	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34039881	34039882	+	Intron	INS	-	CA	CA	rs148378602		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34039881_34039882insCA	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	tcaccacccaccacagatacac	0.000													5	3	---	---	---	---	
ZNF76	7629	broad.mit.edu	37	6	35253703	35253704	+	Intron	INS	-	A	A	rs11402496		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35253703_35253704insA	uc003oki.1	+						ZNF76_uc011dsy.1_Intron|ZNF76_uc011dsz.1_Intron|ZNF76_uc003okj.1_Intron|ZNF76_uc011dsx.1_Intron	NM_003427	NP_003418	P36508	ZNF76_HUMAN	zinc finger protein 76 (expressed in testis)						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTGATGGGTTCGGCAAGGCAAG	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37368739	37368740	+	IGR	INS	-	AC	AC			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37368739_37368740insAC								RNF8 (6226 upstream) : FTSJD2 (32167 downstream)																							gaaCAGTGTAAACACACACACA	0.054													4	2	---	---	---	---	
CUL9	23113	broad.mit.edu	37	6	43185461	43185461	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43185461delT	uc003ouk.2	+						CUL9_uc003oul.2_Intron|CUL9_uc010jyk.2_Intron|CUL9_uc003oun.2_Intron	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein						ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						TTATGCTCCCTTTTCCCCAGG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	53547996	53547996	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53547996delT								KLHL31 (17490 upstream) : LRRC1 (111782 downstream)																							attaaataacttactctaggt	0.000													4	2	---	---	---	---	
COL21A1	81578	broad.mit.edu	37	6	56173844	56173844	+	Intron	DEL	T	-	-	rs71809650		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56173844delT	uc003pcu.1	-							NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTCAATTATCttttttttttt	0.209													3	3	---	---	---	---	
DST	667	broad.mit.edu	37	6	56558255	56558255	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56558255delT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc011dxl.1_Intron|DST_uc003pde.2_5'Flank	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGGCAAACCCTTAGCTTCACT	0.378													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57492883	57492883	+	Intron	DEL	T	-	-	rs63666464		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57492883delT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AAAGATTGAGTTTTTTTAGGA	0.348													3	6	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57507154	57507154	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57507154delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ctgaatgggcaaaaactggaa	0.000													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57509591	57509593	+	Intron	DEL	CTC	-	-	rs10582063		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57509591_57509593delCTC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		catagaacaactctttttattta	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57519622	57519622	+	IGR	DEL	A	-	-	rs66662983		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57519622delA								PRIM2 (6247 upstream) : GUSBL2 (726537 downstream)																							tcTAGGGGGGAAAAAATAGAC	0.249													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57544979	57544979	+	IGR	DEL	A	-	-	rs112612652		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57544979delA								PRIM2 (31604 upstream) : GUSBL2 (701180 downstream)																							aactagaaataagtaacagaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	64202268	64202268	+	IGR	DEL	A	-	-	rs34682665		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64202268delA								LGSN (172386 upstream) : PTP4A1 (29383 downstream)																							AGGACAAATTAATTGCATGGT	0.338													3	5	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	64513144	64513145	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64513144_64513145insT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						ATTTGCCAGGCTTTTTTTTTTT	0.351													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	68252439	68252439	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68252439delT								None (None upstream) : None (None downstream)																							atttagcccctgccctagaga	0.000													4	2	---	---	---	---	
HMGN3	9324	broad.mit.edu	37	6	79911546	79911547	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79911546_79911547insT	uc003pit.2	-						HMGN3_uc003pis.2_Intron|HMGN3_uc003piu.1_3'UTR	NM_004242	NP_004233	Q15651	HMGN3_HUMAN	high mobility group nucleosomal binding domain 3						chromatin modification	chromatin|cytoplasm|nucleus	DNA binding|thyroid hormone receptor binding				0		all_cancers(76;0.000116)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0393)		BRCA - Breast invasive adenocarcinoma(397;0.125)		CATTTGTTTTCTTTTTTTTTTC	0.317													4	2	---	---	---	---	
BCKDHB	594	broad.mit.edu	37	6	80907652	80907655	+	Intron	DEL	CATC	-	-	rs145203628		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80907652_80907655delCATC	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		tccatctgttcatccatccatcca	0.206													5	3	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90400704	90400704	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90400704delA	uc003pnn.1	-							NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCCATGGAATAAAGAGCAAAT	0.358													4	2	---	---	---	---	
SERINC1	57515	broad.mit.edu	37	6	122774789	122774789	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122774789delT	uc003pyy.1	-							NM_020755	NP_065806	Q9NRX5	SERC1_HUMAN	serine incorporator 1						phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	L-serine transmembrane transporter activity|protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.126)		ACTCACAAAGTTTAAATTAAA	0.274													4	2	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	125107274	125107274	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125107274delT	uc003pzo.2	+						NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		ttactggggcttttaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	135550794	135550795	+	IGR	DEL	AG	-	-	rs113182371		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135550794_135550795delAG								MYB (10481 upstream) : MIR548A2 (9503 downstream)																							GCAGGAAGACAGAGAGAGAGAG	0.426													4	2	---	---	---	---	
TXLNB	167838	broad.mit.edu	37	6	139613219	139613220	+	5'Flank	INS	-	CA	CA	rs57153646		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139613219_139613220insCA	uc011eds.1	-							NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN	taxilin beta							cytoplasm				large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		gcacgcacgcgcgcgcacacac	0.391													4	3	---	---	---	---	
AIG1	51390	broad.mit.edu	37	6	143392916	143392917	+	Intron	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143392916_143392917delTG	uc003qjh.2	+						AIG1_uc003qjf.2_Intron|AIG1_uc003qji.2_Intron|AIG1_uc011edw.1_Intron|AIG1_uc003qjg.2_Intron	NM_016108	NP_057192	Q9NVV5	AIG1_HUMAN	androgen-induced 1							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		tttcttttcttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
ZDHHC14	79683	broad.mit.edu	37	6	157969472	157969472	+	Intron	DEL	T	-	-	rs71705103		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157969472delT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjm.1_Intron	NM_024630	NP_078906	Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		gttgttgttgtttgtttgttt	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159887911	159887914	+	IGR	DEL	AAAC	-	-	rs68125418	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159887911_159887914delAAAC								FNDC1 (194772 upstream) : SOD2 (212237 downstream)																							agaaagaaagaaacaaacaaacaa	0.074													3	3	---	---	---	---	
C6orf176	90632	broad.mit.edu	37	6	166338493	166338494	+	Intron	DEL	CA	-	-	rs142866443		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166338493_166338494delCA	uc011egl.1	-						uc003qup.1_Intron	NR_026861				Homo sapiens cDNA FLJ76352 complete cds.												0						gaaatgttggcacacctcatgt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166459858	166459858	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166459858delC								LOC441177 (56755 upstream) : T (111228 downstream)																							GCAGCCTAGTCCAAACACACT	0.333													4	2	---	---	---	---	
KIF25	3834	broad.mit.edu	37	6	168430556	168430556	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168430556delA	uc003qwk.1	+						KIF25_uc003qwl.1_Intron	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN	kinesin family member 25 isoform 1						microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AACACCTCATAAGGGTCCCCT	0.468													4	6	---	---	---	---	
FRMD1	79981	broad.mit.edu	37	6	168475280	168475281	+	Intron	DEL	TG	-	-	rs71794132		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168475280_168475281delTG	uc003qwo.3	-						FRMD1_uc003qwn.3_Intron	NM_024919	NP_079195	Q8N878	FRMD1_HUMAN	FERM domain containing 1 isoform 1							cytoskeleton	binding			ovary(1)	1		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		ggtgtgtaactgtgtgcatgtg	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168792932	168792932	+	IGR	DEL	C	-	-	rs35492825		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168792932delC								DACT2 (72530 upstream) : SMOC2 (49099 downstream)																							CTGTCCCCATCCCCCAGCACA	0.637													3	3	---	---	---	---	
PSMB1	5689	broad.mit.edu	37	6	170801358	170801358	+	Intron	DEL	T	-	-	rs66915698		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170801358delT	uc003qxq.2	-							NM_002793		P20618	PSB1_HUMAN	proteasome beta 1 subunit precursor						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cell junction|cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)	ctcagttctcttttttttttt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	175000	175000	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:175000delT								None (None upstream) : FAM20C (17969 downstream)																							AGTTTCTGCCTTTTTTTTTTT	0.443													3	3	---	---	---	---	
INTS1	26173	broad.mit.edu	37	7	1538685	1538687	+	In_Frame_Del	DEL	TGA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1538685_1538687delTGA	uc003skn.2	-	8	1162_1164	c.1061_1063delTCA	c.(1060-1065)CTCACC>CCC	p.354_355LT>P	INTS1_uc003skq.2_In_Frame_Del_p.354_355LT>P	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	354_355					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CAGGTGGAGGTGAGGAGCCGCAG	0.567													3	3	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14518428	14518429	+	Intron	INS	-	A	A	rs148428275	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14518428_14518429insA	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	TCGTTGAATAGAAAAAAAAAAC	0.361													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22642698	22642699	+	IGR	DEL	CT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22642698_22642699delCT								MGC87042 (102900 upstream) : IL6 (122804 downstream)																							tcttctcttcctctctcattca	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	23604013	23604013	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23604013delT								TRA2A (32357 upstream) : CLK2P (20322 downstream)																							CCAAAATGGCttttttttttt	0.254													4	2	---	---	---	---	
ADCY1	107	broad.mit.edu	37	7	45672338	45672338	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45672338delT	uc003tne.3	+						ADCY1_uc003tnd.2_Intron	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	aatttttaaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53501449	53501449	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53501449delA								POM121L12 (396832 upstream) : HPVC1 (767468 downstream)																							AAAATGTGGTAACTGAAGAGT	0.199													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53612862	53612862	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53612862delC								POM121L12 (508245 upstream) : HPVC1 (656055 downstream)																							gcaccattttcccaacaacat	0.020													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53882937	53882937	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53882937delT								POM121L12 (778320 upstream) : HPVC1 (385980 downstream)																							attaatcatgttttttttccc	0.139													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	54433251	54433252	+	IGR	INS	-	A	A	rs140785772	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54433251_54433252insA								HPVC1 (163137 upstream) : VSTM2A (176767 downstream)																							ttccttccctgaaaaaaaaaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56360826	56360827	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56360826_56360827insA								PSPH (176736 upstream) : DKFZp434L192 (203089 downstream)																							actccatctccaaaaaaaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56616900	56616900	+	IGR	DEL	A	-	-	rs34580571		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56616900delA								DKFZp434L192 (51923 upstream) : ZNF479 (570428 downstream)																							ggctccatttaaaaaaaaaaa	0.005													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56732878	56732878	+	IGR	DEL	G	-	-	rs59105289		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56732878delG								DKFZp434L192 (167901 upstream) : ZNF479 (454450 downstream)																							ccagcacctagttgatacgac	0.000													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56974907	56974907	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56974907delT								DKFZp434L192 (409930 upstream) : ZNF479 (212421 downstream)																							GATTATCTGAttttttttttc	0.189													5	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57212344	57212347	+	IGR	DEL	CTCT	-	-	rs68131410		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57212344_57212347delCTCT								ZNF479 (4773 upstream) : ZNF716 (297536 downstream)																							ctttccctccctctttctttcttt	0.000													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57212454	57212457	+	IGR	DEL	TCTC	-	-	rs147306925		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57212454_57212457delTCTC								ZNF479 (4883 upstream) : ZNF716 (297426 downstream)																							tccttttctttctctttctttctt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57297150	57297151	+	IGR	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57297150_57297151delTG								ZNF479 (89579 upstream) : ZNF716 (212732 downstream)																							TTTCAGGGTTtgtgtgtgtgtg	0.233													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57625723	57625723	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57625723delA								ZNF716 (92458 upstream) : None (None downstream)																							GCTATTTTATAGTAGTTAGCA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57761278	57761278	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57761278delA								ZNF716 (228013 upstream) : None (None downstream)																							cacactccggaaaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57982943	57982944	+	IGR	INS	-	TGGA	TGGA	rs112951286		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57982943_57982944insTGGA								ZNF716 (449678 upstream) : None (None downstream)																							aaacctttcttttgagcagttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62433051	62433052	+	IGR	INS	-	A	A	rs113642971		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62433051_62433052insA								None (None upstream) : LOC643955 (318620 downstream)																							aggcctacggtaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71569808	71569808	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71569808delG	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				cagttgtggtggtgcatgcct	0.000													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71854305	71854306	+	Intron	INS	-	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71854305_71854306insC	uc003twb.3	-						CALN1_uc003twc.3_Intron	NM_031468	NP_113656	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 1							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AGTAGAAGTTTCCTTTACTTCT	0.401													4	2	---	---	---	---	
TYW1B	441250	broad.mit.edu	37	7	72041399	72041399	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72041399delT	uc011kej.1	-						TYW1B_uc011keh.1_Intron|TYW1B_uc011kei.1_Intron	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B isoform						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0						AGGCTTTTAATTCAAAGCATT	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79352664	79352665	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79352664_79352665delAC								MAGI2 (269774 upstream) : GNAI1 (411475 downstream)																							gcatgcacaaacacacacacac	0.129													4	2	---	---	---	---	
SEMA3E	9723	broad.mit.edu	37	7	83120357	83120357	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83120357delG	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				CCTAGACTCTGGATGCTAAAG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	84566571	84566579	+	IGR	DEL	AGGAGGAGG	-	-	rs3050997		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84566571_84566579delAGGAGGAGG								SEMA3A (742354 upstream) : SEMA3D (58295 downstream)																							gagaaggagaaggaggaggaggaggagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	89733105	89733105	+	IGR	DEL	T	-	-	rs74614363		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89733105delT								ZNF804B (766761 upstream) : DPY19L2P4 (15609 downstream)																							GCCCTTACACTTTTTACTCCA	0.323													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	90086677	90086678	+	IGR	INS	-	A	A	rs139526283	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90086677_90086678insA								CLDN12 (41411 upstream) : CDK14 (9060 downstream)																							ggggctgtctgaaaaaagtgtg	0.000													4	2	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90630356	90630357	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90630356_90630357insT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						TATTGTTACTGTTTTTTTTGTC	0.297													4	2	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90699585	90699587	+	Intron	DEL	TGG	-	-	rs35224137		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90699585_90699587delTGG	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						ctgctgctgctggtggtggtggt	0.118													4	7	---	---	---	---	
CDK6	1021	broad.mit.edu	37	7	92454775	92454776	+	Intron	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92454775_92454776delCA	uc011khw.1	-						CDK6_uc010lez.2_Intron	NM_001259	NP_001250	Q00534	CDK6_HUMAN	cyclin-dependent kinase 6						cell dedifferentiation|cell division|G1 phase of mitotic cell cycle|gliogenesis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|negative regulation of osteoblast differentiation|positive regulation of cell-matrix adhesion|positive regulation of fibroblast proliferation|regulation of erythrocyte differentiation|regulation of gene expression|response to virus	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleus|ruffle	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			central_nervous_system(1)|skin(1)	2	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CACATGCGTGcacacacacaca	0.178			T	MLLT10	ALL								4	3	---	---	---	---	
CALCR	799	broad.mit.edu	37	7	93070871	93070871	+	Intron	DEL	A	-	-	rs141370313		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93070871delA	uc003umv.1	-						CALCR_uc011kia.1_Intron|CALCR_uc003ums.1_Intron|CALCR_uc003umt.1_Intron|CALCR_uc003umu.1_Intron|CALCR_uc003umw.2_Intron	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor						activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	GCTAAAAGAGAAAAAAAAAAA	0.403													3	4	---	---	---	---	
SMURF1	57154	broad.mit.edu	37	7	98667333	98667334	+	Intron	INS	-	A	A	rs145967781	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98667333_98667334insA	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			TGCATTGAAGGAAAAAAAGTCA	0.342													4	3	---	---	---	---	
SMURF1	57154	broad.mit.edu	37	7	98740993	98741019	+	Intron	DEL	AGGGGCGGGGCCAGGAAAAGAGAAGCG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98740993_98741019delAGGGGCGGGGCCAGGAAAAGAGAAGCG	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			aggagatgcaaggggcggggccaggaaaagagaagcgaggggcgggg	0.000													6	8	---	---	---	---	
ARPC1B	10095	broad.mit.edu	37	7	98992321	98992322	+	3'UTR	INS	-	A	A	rs67137624		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98992321_98992322insA	uc003upz.2	+	10					ARPC1B_uc003uqa.2_3'UTR|ARPC1B_uc003uqb.2_3'UTR|ARPC1B_uc003uqc.2_3'UTR|ARPC1B_uc003uqd.2_3'UTR	NM_005720	NP_005711	O15143	ARC1B_HUMAN	actin related protein 2/3 complex subunit 1B						cellular component movement|regulation of actin filament polymerization	Arp2/3 protein complex|cytoplasm	actin binding|structural constituent of cytoskeleton				0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TTCATTTATTGAAAAAAAAAAA	0.366													8	4	---	---	---	---	
ZKSCAN5	23660	broad.mit.edu	37	7	99120101	99120102	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99120101_99120102insT	uc003uqv.2	+						ZKSCAN5_uc010lfx.2_Intron|ZKSCAN5_uc003uqw.2_Intron|ZKSCAN5_uc003uqx.2_Intron|ZKSCAN5_uc003uqy.2_Intron	NM_145102	NP_659570	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					tttgtttccccttttttttttt	0.000													4	2	---	---	---	---	
ZNF3	7551	broad.mit.edu	37	7	99667789	99667790	+	3'UTR	INS	-	T	T	rs148676350	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99667789_99667790insT	uc003usq.2	-	6					ZNF3_uc003usp.2_Intron|ZNF3_uc003usr.2_3'UTR|ZNF3_uc010lgj.2_3'UTR|ZNF3_uc003uss.2_3'UTR|ZNF3_uc003ust.3_3'UTR	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2						cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			ttgtttttttgttttttttttc	0.485													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100266061	100266061	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100266061delA								ACTL6B (11977 upstream) : GNB2 (5302 downstream)																							ggggaccactagggggaagaa	0.000													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100708109	100708109	+	IGR	DEL	C	-	-	rs73170203	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100708109delC								MUC17 (5969 upstream) : TRIM56 (20677 downstream)																							tccccttgttcgctccagggt	0.005													4	2	---	---	---	---	
AP1S1	1174	broad.mit.edu	37	7	100797438	100797439	+	5'Flank	INS	-	C	C	rs151063268	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100797438_100797439insC	uc003uxv.3	+							NM_001283	NP_001274	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1						intracellular protein transport|post-Golgi vesicle-mediated transport|receptor-mediated endocytosis|regulation of defense response to virus by virus|response to virus|viral reproduction	AP-1 adaptor complex|coated pit|cytosol|lysosomal membrane	protein binding|protein transporter activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)					CATTCACCTCTCACCCCTTTTC	0.584													7	4	---	---	---	---	
EMID2	136227	broad.mit.edu	37	7	101078189	101078190	+	Intron	INS	-	TCA	TCA	rs141551537	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101078189_101078190insTCA	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)					GGAGGACATGTTCAAAGATTCA	0.347													6	6	---	---	---	---	
EMID2	136227	broad.mit.edu	37	7	101106989	101106990	+	Intron	DEL	TC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101106989_101106990delTC	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)					tctctctctttctttctttttt	0.000													4	2	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	103938595	103938595	+	IGR	DEL	G	-	-	rs35423295		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103938595delG								ORC5L (90132 upstream) : LHFPL3 (30509 downstream)																							CTCTTTTGCAGagatctcttc	0.209													4	3	---	---	---	---	
SRPK2	6733	broad.mit.edu	37	7	104815587	104815587	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104815587delA	uc003vct.2	-						SRPK2_uc003vcu.2_Intron|SRPK2_uc003vcv.2_Intron|SRPK2_uc003vcw.1_Intron	NM_182691	NP_872633	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						actccgtttcaaaaaaaaaaa	0.000													3	4	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105286454	105286454	+	Intron	DEL	A	-	-	rs77039301		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105286454delA	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						tctctgtctcaaaaaaaaaaa	0.020													5	3	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105295193	105295194	+	Intron	INS	-	T	T	rs112303767		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105295193_105295194insT	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						CCTTCAGGCCAttttttttttt	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	106158874	106158875	+	Intron	INS	-	CCTCC	CCTCC	rs141647524	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106158874_106158875insCCTCC	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																		tcctcccctctccttgtctttt	0.035													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	106623937	106623938	+	IGR	INS	-	TGTT	TGTT	rs144333259	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106623937_106623938insTGTT								PIK3CG (76352 upstream) : PRKAR2B (61240 downstream)																							tctgaactttctgtttgtttgt	0.005													6	3	---	---	---	---	
COG5	10466	broad.mit.edu	37	7	107049676	107049676	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107049676delA	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						AACGTCAAGGaaaaaaaaaaa	0.234													4	4	---	---	---	---	
LAMB1	3912	broad.mit.edu	37	7	107582101	107582101	+	Intron	DEL	T	-	-	rs67531076		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107582101delT	uc003vew.2	-						LAMB1_uc003vev.2_Intron	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor						axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTTTCTCGGAttttttttttt	0.204													3	4	---	---	---	---	
LAMB4	22798	broad.mit.edu	37	7	107744731	107744732	+	Intron	INS	-	A	A	rs142737442	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107744731_107744732insA	uc010ljo.1	-						LAMB4_uc003vey.2_Intron	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor						cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						GTTTCATTTTTAAAGTTAAACT	0.431													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108640673	108640674	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108640673_108640674insT								C7orf66 (116036 upstream) : EIF3IP1 (958610 downstream)																							CATTTGCCTTGTTTTTTTTTTC	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	110174606	110174606	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110174606delA								EIF3IP1 (574336 upstream) : IMMP2L (128504 downstream)																							TTTTAATGTTAAAAAAAAAAA	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	114349779	114349779	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114349779delG								FOXP2 (18687 upstream) : MDFIC (212430 downstream)																							ACAATAGCATGTCTTCAACTT	0.393													4	2	---	---	---	---	
CAV1	857	broad.mit.edu	37	7	116117053	116117056	+	Intron	DEL	TGTG	-	-	rs71957068	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116117053_116117056delTGTG	uc010lkd.1	+						CAV2_uc003vhv.2_Intron|CAV2_uc003vhw.2_Intron|CAV2_uc003vhx.2_Intron|CAV2_uc010lkb.1_Intron|CAV2_uc010lkc.2_Intron|CAV2_uc003vib.2_Intron|CAV2_uc003vhz.2_Intron|CAV2_uc003via.2_Intron|CAV1_uc010lke.1_Intron	NM_001753	NP_001744	Q03135	CAV1_HUMAN	caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			ATAGACTGACtgtgtgtgtgtgtg	0.377													5	3	---	---	---	---	
CTTNBP2	83992	broad.mit.edu	37	7	117502111	117502112	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117502111_117502112delAC	uc003vjf.2	-							NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2											ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ACCAGcacatacacacacacac	0.257													4	2	---	---	---	---	
C7orf58	79974	broad.mit.edu	37	7	120927333	120927334	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120927333_120927334delAC	uc003vjq.3	+							NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					acagacacagacacacacacac	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123432208	123432208	+	IGR	DEL	A	-	-	rs11305491		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123432208delA								WASL (43092 upstream) : HYALP1 (21985 downstream)																							AAATAGGGGGAAAAAAATCAA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	124697032	124697032	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124697032delT	uc010lkx.1	+						uc003vlp.2_Intron|uc003vlq.1_Intron					Homo sapiens cDNA FLJ33356 fis, clone BRACE2005160.																		AGAATTGAGGTTTGATGGGAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	126976406	126976406	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126976406delC								GRM8 (83259 upstream) : ZNF800 (33948 downstream)																							atcaaggcatcagcagggctg	0.000													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127391200	127391201	+	Intron	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127391200_127391201delGT	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CCATGGTAGGgtgtgtgtgtgt	0.337													3	3	---	---	---	---	
MKLN1	4289	broad.mit.edu	37	7	130983032	130983032	+	Intron	DEL	A	-	-	rs66518779		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130983032delA	uc011kpl.1	+							NM_001145354	NP_001138826	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					tcggtctcagaaaaaaaaaaa	0.159													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131572686	131572687	+	IGR	DEL	GA	-	-	rs35791892		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131572686_131572687delGA								PODXL (331310 upstream) : PLXNA4 (235405 downstream)																							gttcatgatggagagggtgcta	0.000													3	3	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133861609	133861610	+	Intron	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133861609_133861610delGT	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						TCCTGTGAGGGTGTGTGTGGGA	0.460													7	5	---	---	---	---	
NUP205	23165	broad.mit.edu	37	7	135306104	135306105	+	Intron	INS	-	CT	CT	rs144624100	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135306104_135306105insCT	uc003vsw.2	+						NUP205_uc003vsx.2_Intron	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						GGATTTCTCCACTCAGCACCTC	0.351													4	5	---	---	---	---	
SLC13A4	26266	broad.mit.edu	37	7	135411319	135411323	+	Intron	DEL	AGGGA	-	-	rs66494820		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135411319_135411323delAGGGA	uc003vta.2	-						SLC13A4_uc003vtb.2_Intron|SLC13A4_uc003vtc.1_Intron	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate							integral to plasma membrane	sodium:sulfate symporter activity				0						AGAACAGCGGAGGGAAGGGAAGGGA	0.537													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	135960834	135960835	+	IGR	DEL	AC	-	-	rs34196488		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135960834_135960835delAC								LUZP6 (298630 upstream) : CHRM2 (592564 downstream)																							CATGCCTTAGacacacacacac	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	136764777	136764777	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136764777delC	uc003vtp.1	-											Homo sapiens clone N1 NTera2D1 teratocarcinoma mRNA.																		tgtttcgagacagggtctcac	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	137854210	137854211	+	IGR	DEL	AG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137854210_137854211delAG								AKR1D1 (51160 upstream) : TRIM24 (290868 downstream)																							GAAACTCCTTAGCTCCCTTGCC	0.411													4	2	---	---	---	---	
ZC3HAV1	56829	broad.mit.edu	37	7	138796704	138796705	+	5'Flank	INS	-	A	A	rs147780151	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138796704_138796705insA	uc003vun.2	-						ZC3HAV1_uc003vup.2_5'Flank	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1						response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						AAAGGGAAgagagggaaaggga	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142165540	142165548	+	Intron	DEL	TGTGTCTGT	-	-	rs11270134		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142165540_142165548delTGTGTCTGT	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TTAGGTGCGCTGTGTCTGTGAGACTCCCA	0.402													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142394633	142394634	+	Intron	INS	-	G	G	rs147398442	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142394633_142394634insG	uc011krp.1	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc011ksg.1_Intron					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		ccctcctttttcctggtaaaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148604700	148604701	+	IGR	DEL	AC	-	-	rs67593911		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148604700_148604701delAC								EZH2 (23286 upstream) : MIR1975 (33879 downstream)																							TCCAACACCAacacacacacac	0.391													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148963082	148963083	+	Intron	DEL	TG	-	-	rs150092162		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148963082_148963083delTG	uc003wfr.3	+											Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																		aagaggaaactgagacccaaga	0.208													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149939305	149939305	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149939305delA								ATP6V0E2 (361519 upstream) : ACTR3C (4997 downstream)																							aacttgtctcaaaaaaaaaaa	0.090													6	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151863209	151863209	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151863209delT	uc003wla.2	-						MLL3_uc003wkz.2_Intron|MLL3_uc003wky.2_Intron	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		agcactcaCAttttttttttt	0.005			N		medulloblastoma								4	2	---	---	---	---	
LOC100132707	100132707	broad.mit.edu	37	7	154721159	154721161	+	Intron	DEL	AAC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154721159_154721161delAAC	uc003wln.2	+						LOC100132707_uc011kvr.1_Intron|LOC100132707_uc003wlo.2_Intron					Homo sapiens cDNA FLJ32047 fis, clone NTONG2001137.												0						aaaacaaacaaacaacaacaaca	0.172													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	154966846	154966847	+	IGR	INS	-	CACA	CACA	rs150703972	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154966846_154966847insCACA								HTR5A (89387 upstream) : INSIG1 (122639 downstream)																							GTGCGTGCGCGcacacacacac	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155120257	155120258	+	IGR	DEL	AA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155120257_155120258delAA								INSIG1 (18315 upstream) : EN2 (130566 downstream)																							CTCCCTCCCCAAAGACACCCAC	0.500													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155684044	155684049	+	IGR	DEL	GTGGTG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155684044_155684049delGTGGTG								SHH (79077 upstream) : C7orf4 (649136 downstream)																							ggtggtgatagtggtggaggtggtga	0.000													4	2	---	---	---	---	
NOM1	64434	broad.mit.edu	37	7	156740263	156740272	+	5'Flank	DEL	GGGAAGCGGC	-	-	rs11279799		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156740263_156740272delGGGAAGCGGC	uc003wmy.2	+							NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1						RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		ctggagcggggggaagcggcgggaagcggc	0.019													5	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157912307	157912310	+	Intron	DEL	GAGA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157912307_157912310delGAGA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ttgaaagagggagagagagagaga	0.000													4	2	---	---	---	---	
NCAPG2	54892	broad.mit.edu	37	7	158478840	158478841	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158478840_158478841insA	uc003wnv.1	-						NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Intron|NCAPG2_uc011kwe.1_Intron	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5						cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		AAATAAGTGTTAACATTTAAAA	0.272													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158999583	158999584	+	IGR	DEL	GG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158999583_158999584delGG								VIPR2 (61934 upstream) : None (None downstream)																							gagagagagaggggggacagca	0.035													4	4	---	---	---	---	
AGPAT5	55326	broad.mit.edu	37	8	6612539	6612540	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6612539_6612540insA	uc003wqo.2	+						AGPAT5_uc011kwm.1_Intron	NM_018361	NP_060831	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5						phospholipid biosynthetic process	integral to membrane|mitochondrion	1-acylglycerol-3-phosphate O-acyltransferase activity				0			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		TCTAAAATAGTAAAAAAAAAGA	0.267													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	16368415	16368416	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16368415_16368416delAC								MSR1 (318115 upstream) : FGF20 (481918 downstream)																							TAGTGGCAGGacacacacacac	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	22433415	22433416	+	IGR	INS	-	TG	TG	rs71546820		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22433415_22433416insTG								SORBS3 (408 upstream) : PDLIM2 (3227 downstream)																							ACCGAAGCCCTtgtgtgtgtgt	0.431													4	4	---	---	---	---	
DPYSL2	1808	broad.mit.edu	37	8	26458897	26458898	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26458897_26458898insT	uc003xfb.1	+						DPYSL2_uc003xfa.2_Intron|DPYSL2_uc011lag.1_Intron|DPYSL2_uc010luk.1_Intron|DPYSL2_uc011lah.1_Intron	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		ttttgtttttgtttttttttgt	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30431804	30431805	+	IGR	DEL	CT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30431804_30431805delCT								RBPMS (2070 upstream) : GTF2E2 (4227 downstream)																							CACACAGTTGCTCTCCTCTCCA	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33512348	33512348	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33512348delC								DUSP26 (54909 upstream) : None (None downstream)																							taaaaaaatacaaaaatcagc	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37458088	37458089	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37458088_37458089insA								KCNU1 (664447 upstream) : ZNF703 (95212 downstream)																							ccatataaactaaaaaaaaaaa	0.000													6	3	---	---	---	---	
ANK1	286	broad.mit.edu	37	8	41512649	41512650	+	3'UTR	DEL	GT	-	-	rs33981001		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41512649_41512650delGT	uc003xok.2	-	42					NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_3'UTR|ANK1_uc003xoi.2_3'UTR|ANK1_uc003xoj.2_3'UTR|ANK1_uc003xol.2_3'UTR|ANK1_uc003xom.2_3'UTR|ANK1_uc011lcl.1_3'UTR|ANK1_uc003xod.2_3'UTR|ANK1_uc003xoc.2_3'UTR|ANK1_uc003xof.2_3'UTR	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GAGGCGAGTGgtgtgtgtgtgt	0.416													3	3	---	---	---	---	
ANK1	286	broad.mit.edu	37	8	41641136	41641141	+	Intron	DEL	GAGACT	-	-	rs68174435		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41641136_41641141delGAGACT	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			cctcttaatggagactgacACTgcat	0.005													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49055169	49055170	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49055169_49055170insA								UBE2V2 (80717 upstream) : EFCAB1 (568181 downstream)																							tccatctcaagaaaaaaaaaaa	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50624965	50624965	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50624965delA								C8orf22 (636324 upstream) : SNTG1 (197384 downstream)																							agtaggagctaaataatgaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50693578	50693578	+	IGR	DEL	A	-	-	rs79602725		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50693578delA								C8orf22 (704937 upstream) : SNTG1 (128771 downstream)																							tattgccctgaaaaaagtctt	0.000													5	5	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	51282163	51282163	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51282163delA	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				tcccaaaaagaaaaaaaaaaa	0.000													5	3	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	51314147	51314148	+	Intron	INS	-	TG	TG	rs150210446	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51314147_51314148insTG	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TAGGTATAAACtgtgtgtgtgt	0.059													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	51874618	51874618	+	IGR	DEL	A	-	-	rs34726995		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51874618delA								SNTG1 (169191 upstream) : PXDNL (357526 downstream)																							GAAAGGCAGCAAAAAAAAAAA	0.279													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52072743	52072743	+	IGR	DEL	A	-	-	rs11285195		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52072743delA								SNTG1 (367316 upstream) : PXDNL (159401 downstream)																							aatgatcaataaaaaaaaaaa	0.085													3	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52123708	52123708	+	IGR	DEL	G	-	-	rs34911870		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52123708delG								SNTG1 (418281 upstream) : PXDNL (108436 downstream)																							tactggagaagctgaggcagg	0.000													0	13	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53037421	53037422	+	Intron	INS	-	GCTCGAGT	GCTCGAGT	rs139810366	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53037421_53037422insGCTCGAGT	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AACAGTAGGAAGCTTTCCCTCC	0.441													21	11	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53088588	53088588	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53088588delT	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron|ST18_uc003xrb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CAGCTAACTCttttttttttt	0.159													9	4	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53294532	53294534	+	Intron	DEL	AAC	-	-	rs141136035		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53294532_53294534delAAC	uc003xra.2	-						ST18_uc003xrb.2_Intron|ST18_uc010lyb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGCATTAAAAAACAAAAAAAAAC	0.305													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53686149	53686150	+	IGR	INS	-	A	A	rs147548330	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53686149_53686150insA								RB1CC1 (59123 upstream) : NPBWR1 (166318 downstream)																							ACACACAGAAGAAAAAAAGGAG	0.287													9	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	54198701	54198702	+	IGR	INS	-	AA	AA			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54198701_54198702insAA								OPRK1 (34507 upstream) : ATP6V1H (429414 downstream)																							cagcttttcctatattctcttt	0.000													4	2	---	---	---	---	
ATP6V1H	51606	broad.mit.edu	37	8	54662303	54662304	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54662303_54662304insA	uc003xrl.2	-						ATP6V1H_uc003xrk.2_Intron|ATP6V1H_uc003xrm.2_Intron|ATP6V1H_uc003xrn.2_Intron|ATP6V1H_uc011ldv.1_Intron|ATP6V1H_uc010lyd.2_Intron	NM_213620	NP_998785	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism				0		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			cagacTCCTTTAAAAAAAAAAA	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61981968	61981971	+	IGR	DEL	CTTC	-	-	rs35758644		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61981968_61981971delCTTC								CHD7 (202505 upstream) : CLVS1 (218554 downstream)																							ttctctctctcttccttccttcct	0.255													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64617767	64617768	+	IGR	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64617767_64617768delGT								YTHDF3 (492422 upstream) : MIR124-2 (673938 downstream)																							TGTGTATGGAgtgtgtgtgtgt	0.396													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66513830	66513830	+	IGR	DEL	T	-	-	rs68072884		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66513830delT								CYP7B1 (802482 upstream) : ARMC1 (1242 downstream)																							agctagctaattttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	71013591	71013591	+	IGR	DEL	C	-	-	rs113815096		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71013591delC								PRDM14 (30029 upstream) : NCOA2 (10676 downstream)																							atcttccaatctgtttccttc	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	84358342	84358343	+	IGR	INS	-	A	A	rs72540520		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84358342_84358343insA								None (None upstream) : RALYL (737110 downstream)																							ggatagatagcgaatgattttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	87190322	87190323	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87190322_87190323insA								ATP6V0D2 (23868 upstream) : SLC7A13 (35965 downstream)																							cctgacaaaagaaaaaaaaaTA	0.173													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	87267197	87267197	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87267197delA								SLC7A13 (24588 upstream) : WWP1 (87797 downstream)																							catgtgagagaaggagaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	88800612	88800612	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88800612delT								CNBD1 (405657 upstream) : DCAF4L2 (82361 downstream)																							GCTTGTCATATTTTTTTTTGT	0.358													4	2	---	---	---	---	
RIPK2	8767	broad.mit.edu	37	8	90788460	90788460	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90788460delT	uc003yee.2	+						RIPK2_uc003yef.2_Intron	NM_003821	NP_003812	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2						activation of MAPK activity|anti-apoptosis|apoptosis|inflammatory response|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|CARD domain binding|LIM domain binding|protein homodimerization activity|protein serine/threonine kinase activity|signal transducer activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.0474)			GAATTCCTCCTATACTTCTCT	0.279													4	2	---	---	---	---	
STK3	6788	broad.mit.edu	37	8	99471213	99471214	+	Intron	INS	-	A	A	rs148806082	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99471213_99471214insA	uc003yip.2	-						STK3_uc003yio.2_Intron	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		gctataaagatacttgaaatgt	0.010													3	3	---	---	---	---	
STK3	6788	broad.mit.edu	37	8	99876553	99876553	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99876553delT	uc003yio.2	-							NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		aatcaacttgtaaacctgagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101337037	101337040	+	IGR	DEL	CTTC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101337037_101337040delCTTC								RNF19A (14710 upstream) : ANKRD46 (184947 downstream)																							tctctttcttcttccttccttcct	0.093													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103654931	103654932	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103654931_103654932insT								ODF1 (81686 upstream) : KLF10 (6073 downstream)																							AAGGTGTCATCTTTTTATATTT	0.361													4	2	---	---	---	---	
EXT1	2131	broad.mit.edu	37	8	118911063	118911064	+	Intron	DEL	AA	-	-	rs111809064		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118911063_118911064delAA	uc003yok.1	-							NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			AGACGGCAGGAAAAAAAAAAAA	0.361			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122304334	122304337	+	IGR	DEL	CTTG	-	-	rs147048421		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122304334_122304337delCTTG								SNTB1 (480025 upstream) : HAS2 (320934 downstream)																							tccttccttccttgcttcctttct	0.054													4	2	---	---	---	---	
TMEM65	157378	broad.mit.edu	37	8	125371983	125371983	+	Intron	DEL	A	-	-	rs74603065		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125371983delA	uc010mdl.2	-							NM_194291	NP_919267	Q6PI78	TMM65_HUMAN	transmembrane protein 65							integral to membrane					0	Lung NSC(37;1.18e-11)|Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			actctgtttcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127002442	127002443	+	IGR	DEL	GA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127002442_127002443delGA								TRIB1 (551800 upstream) : FAM84B (562244 downstream)																							agaagcgagggagagagagaga	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128742128	128742128	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128742128delA	uc003ysg.2	-											Homo sapiens, clone IMAGE:5554747, mRNA.																		TGTAAAAAGCAAAAGTTTCTC	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	130828266	130828266	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130828266delA								GSDMC (29132 upstream) : FAM49B (25452 downstream)																							aagagccatgaaaaaatgcct	0.095													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131665615	131665616	+	IGR	INS	-	AA	AA	rs112835891		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131665615_131665616insAA								ASAP1 (251399 upstream) : ADCY8 (126932 downstream)																							AGCCTCTGAGGaaaaaaaaaaa	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134354002	134354006	+	IGR	DEL	TTAAA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134354002_134354006delTTAAA								NDRG1 (44455 upstream) : ST3GAL1 (113085 downstream)																							TCTTTGCCTTTTAAATTATCTAGAA	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134443110	134443111	+	IGR	DEL	CT	-	-	rs10554114		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134443110_134443111delCT								NDRG1 (133563 upstream) : ST3GAL1 (23980 downstream)																							caaaatcatcctctctttggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	137588110	137588110	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137588110delT								KHDRBS3 (928264 upstream) : None (None downstream)																							CTCTCCCAACTTTTTCCTCCT	0.318													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140221476	140221476	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140221476delT								COL22A1 (295240 upstream) : KCNK9 (391606 downstream)																							TGTCCTGCACTTTTTTTTTTT	0.483													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143153784	143153785	+	IGR	INS	-	A	A	rs139763000		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143153784_143153785insA								MIR1302-7 (286110 upstream) : NCRNA00051 (125932 downstream)																							gattctgtctcaaaaaaaaaaa	0.188													4	4	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143421044	143421044	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143421044delC	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ATGAGGCAGTCGGGGAAGCAT	0.602													4	2	---	---	---	---	
DMRT1	1761	broad.mit.edu	37	9	866528	866529	+	Intron	DEL	CT	-	-	rs141140321		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:866528_866529delCT	uc003zgv.2	+						DMRT1_uc003zgu.1_Intron	NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor						cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		CTTGAAAACACTCTCAAAACTT	0.386													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	1959680	1959680	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1959680delA								DMRT2 (902127 upstream) : SMARCA2 (55662 downstream)																							CCATGCCTGGAAAAAAAGTCA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	2994121	2994122	+	IGR	INS	-	AAAGA	AAAGA	rs142629653	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2994121_2994122insAAAGA								KIAA0020 (149991 upstream) : RFX3 (230527 downstream)																							TCCATGGTCCCAAAGAAAAATG	0.381													3	3	---	---	---	---	
KDM4C	23081	broad.mit.edu	37	9	7040370	7040371	+	Intron	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7040370_7040371delTG	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						tACCCCACTCtgtgtgtgtgtg	0.089													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTCCTCTGATTATTTTCACTTATTTTCAC	0.276										TSP Lung(15;0.13)			2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	15515846	15515846	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15515846delT								PSIP1 (4843 upstream) : C9orf93 (37026 downstream)																							TGATTTTGCCTTTTTCCCTGC	0.413													4	2	---	---	---	---	
BNC2	54796	broad.mit.edu	37	9	16861993	16861994	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16861993_16861994insA	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_Intron|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		tctcaaaagacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SLC24A2	25769	broad.mit.edu	37	9	19615993	19616002	+	Intron	DEL	CACACACACA	-	-	rs141639973		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19615993_19616002delCACACACACA	uc003zoa.1	-						SLC24A2_uc003zob.1_Intron	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24						visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CACAGGCGTGcacacacacacacacacaca	0.333													4	3	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20993167	20993168	+	Intron	INS	-	AT	AT			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20993167_20993168insAT	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		aaaatcacCTCATATATATAGG	0.317													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	25140140	25140140	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25140140delC								None (None upstream) : TUSC1 (536254 downstream)																							caggcgtgagccaacacaccc	0.000													0	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	30688992	30688992	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30688992delC								None (None upstream) : None (None downstream)																							GGTCCTCGGACCCGGCAGCCG	0.507													4	2	---	---	---	---	
UBE2R2	54926	broad.mit.edu	37	9	33872227	33872227	+	Intron	DEL	A	-	-	rs75858180		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33872227delA	uc003ztm.2	+							NM_017811	NP_060281	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme UBC3B						protein K48-linked ubiquitination|protein monoubiquitination		ATP binding|ubiquitin-protein ligase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		tatctctaccaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34052451	34052452	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34052451_34052452insA								UBAP2 (3504 upstream) : DCAF12 (33929 downstream)																							agattcctctcaaaaaaaaaaa	0.015													4	3	---	---	---	---	
GALT	2592	broad.mit.edu	37	9	34650279	34650280	+	Intron	INS	-	A	A	rs56121779		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34650279_34650280insA	uc003zve.2	+						GALT_uc003zvf.2_Intron|GALT_uc003zvg.2_Intron|GALT_uc003zvh.2_Intron|IL11RA_uc003zvi.2_5'Flank|IL11RA_uc011loq.1_5'Flank	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase						galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		gacctcgtctcaaaaaaaaaaa	0.223									Galactosemia				12	6	---	---	---	---	
PAX5	5079	broad.mit.edu	37	9	36924572	36924572	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36924572delC	uc003zzo.1	-						PAX5_uc011lpt.1_Intron|PAX5_uc011lpu.1_Intron|PAX5_uc011lpv.1_Intron|PAX5_uc011lpw.1_Intron|PAX5_uc011lpx.1_Intron|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Intron|PAX5_uc011lpz.1_Intron|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_Intron|PAX5_uc011lqb.1_Intron|PAX5_uc010mlo.1_Intron|PAX5_uc010mlp.1_Intron|PAX5_uc011lqc.1_Intron|PAX5_uc010mlr.1_Intron	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5						cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(19)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		caaaaattagccaggtgtggt	0.000			T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	38657291	38657291	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38657291delT								C9orf122 (34016 upstream) : CNTNAP3 (415475 downstream)																							GTGTGAGTTGTGCCAGCTTGT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66460027	66460027	+	5'Flank	DEL	T	-	-	rs112286776		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66460027delT	uc010mng.1	-						uc004aeb.2_5'Flank|uc004aec.2_Intron					Homo sapiens cDNA, FLJ98602.																		ttgggaaggcttttcacatat	0.000													9	5	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66496434	66496434	+	5'Flank	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66496434delC	uc004aee.1	+						LOC442421_uc004aed.1_5'Flank					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						ttcctcttcaccgatttggat	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66527855	66527855	+	Intron	DEL	A	-	-	rs5897901		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66527855delA	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		AACTCTCATCAAAAAAAAGGC	0.418													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68412348	68412348	+	RNA	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68412348delA	uc004aew.1	+	2		c.510delA			uc004aex.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		GAGGGCAAAGAAACGTGGAAT	0.552													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69000319	69000320	+	IGR	INS	-	TGTT	TGTT	rs149203682		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69000319_69000320insTGTT								None (None upstream) : MIR1299 (1919 downstream)																							gagtgtctgaatgttcctcaca	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	71183362	71183369	+	IGR	DEL	TGTGTGTG	-	-	rs72497064	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71183362_71183369delTGTGTGTG								C9orf71 (27579 upstream) : PIP5K1B (137247 downstream)																							tttcacaccttgtgtgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
PIP5K1B	8395	broad.mit.edu	37	9	71598377	71598377	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71598377delT	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		tgtgtgtgtgttttttttttc	0.179													4	2	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71695879	71695879	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71695879delA	uc011lrr.1	+							NM_001161706	NP_001155178	Q16595	FRDA_HUMAN	frataxin isoform 3 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						aaagaaaaagaaaaaaaaaat	0.000													4	2	---	---	---	---	
TLE4	7091	broad.mit.edu	37	9	82243789	82243790	+	Intron	DEL	GT	-	-	rs140782307		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82243789_82243790delGT	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5						TTAAAGTTAAgtgtgtgtgtgt	0.282													4	3	---	---	---	---	
TLE4	7091	broad.mit.edu	37	9	82327437	82327437	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82327437delC	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5						ACCATACATACCCACAATGTA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87076614	87076615	+	IGR	INS	-	CACC	CACC	rs139888770	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87076614_87076615insCACC								SLC28A3 (93201 upstream) : NTRK2 (206851 downstream)																							acacacacccacacacacacac	0.198													3	3	---	---	---	---	
NAA35	60560	broad.mit.edu	37	9	88590183	88590183	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88590183delT	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						GTGCTTTGTATTTTTTTTTTG	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89815583	89815583	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89815583delA								C9orf170 (40942 upstream) : DAPK1 (297075 downstream)																							AGAGTGAAGGAAAAATAGTCT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92198696	92198697	+	IGR	INS	-	AAC	AAC	rs147973789	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92198696_92198697insAAC								SEMA4D (85808 upstream) : GADD45G (21230 downstream)																							actaaaacaataacaacaacaa	0.000													2	4	---	---	---	---	
PHF2	5253	broad.mit.edu	37	9	96385349	96385350	+	Intron	INS	-	T	T	rs151296781		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96385349_96385350insT	uc004aub.2	+						PHF2_uc011lug.1_Intron	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2						liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CTGGAGCAGCCAGGGGCCAGGT	0.599													4	2	---	---	---	---	
GABBR2	9568	broad.mit.edu	37	9	101365333	101365333	+	Intron	DEL	C	-	-	rs71913586		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101365333delC	uc004ays.2	-							NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GACTTGGCCACCCCCAAGGGA	0.383													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102232625	102232626	+	IGR	INS	-	CA	CA	rs142612997	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102232625_102232626insCA								SEC61B (239725 upstream) : NR4A3 (351511 downstream)																							acacgcgcgctcacacacacac	0.238													4	3	---	---	---	---	
GRIN3A	116443	broad.mit.edu	37	9	104446400	104446401	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104446400_104446401insT	uc004bbp.1	-						GRIN3A_uc004bbq.1_Intron	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	ttctttctttcttttttttttt	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	106407988	106407988	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106407988delT								CYLC2 (627218 upstream) : SMC2 (448553 downstream)																							TTTGCAGCAGTTTTCCAGAAC	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	107488167	107488168	+	IGR	INS	-	AC	AC			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107488167_107488168insAC								OR13D1 (30425 upstream) : NIPSNAP3A (21801 downstream)																							ggaaactctggacacactttta	0.000													4	2	---	---	---	---	
SLC44A1	23446	broad.mit.edu	37	9	108159003	108159003	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108159003delT	uc004bco.1	+							NM_080546	NP_536856	Q8WWI5	CTL1_HUMAN	CDW92 antigen							integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)	CCTTTTTGTCTTTTTTTTTTT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111119215	111119216	+	IGR	DEL	AT	-	-	rs149260031		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111119215_111119216delAT								KLF4 (867168 upstream) : ACTL7B (497655 downstream)																							caaggcaaagatatctcttccc	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	112268761	112268764	+	IGR	DEL	TTCT	-	-	rs146228465	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112268761_112268764delTTCT								PTPN3 (8168 upstream) : PALM2 (134308 downstream)																							ccttccttccttctttcctaccta	0.181													6	3	---	---	---	---	
DNAJC25	548645	broad.mit.edu	37	9	114410717	114410717	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114410717delT	uc004bfl.2	+						DNAJC25-GNG10_uc004bfn.2_Intron|DNAJC25_uc004bfm.2_Intron	NM_001015882	NP_001015882	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25						protein folding	integral to membrane	heat shock protein binding|unfolded protein binding				0						aatttttgtattttttttttt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116606492	116606492	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116606492delG								RGS3 (246475 upstream) : ZNF618 (32070 downstream)																							tgacagatgaggctactgagg	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	117454804	117454807	+	IGR	DEL	ATTG	-	-	rs72180620		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117454804_117454807delATTG								C9orf91 (46108 upstream) : TNFSF15 (96806 downstream)																							GAATCATTTTattgattgattgat	0.191													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	117663315	117663316	+	IGR	DEL	GT	-	-	rs113133989		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117663315_117663316delGT								TNFSF15 (94907 upstream) : TNFSF8 (1808 downstream)																							AGTACACTGAgtgtgtgtgtgt	0.332													4	3	---	---	---	---	
TNC	3371	broad.mit.edu	37	9	117803586	117803587	+	Intron	INS	-	C	C	rs150638560	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117803586_117803587insC	uc004bjj.3	-						TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor						cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						AGCCAGGAGGGGCGGGGGAAAA	0.426													3	7	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	120106464	120106465	+	Intron	INS	-	A	A	rs141636896	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120106464_120106465insA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						AGCACGTGGAGAAAAAAAAACC	0.460													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	121763410	121763410	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121763410delA								None (None upstream) : DBC1 (165498 downstream)																							AGCTAAGAAGAAAAGGTGTAA	0.418													4	2	---	---	---	---	
DAB2IP	153090	broad.mit.edu	37	9	124407051	124407051	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124407051delG	uc004bln.2	+							NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						cttaggaaatggaggcacaga	0.114													4	2	---	---	---	---	
TTLL11	158135	broad.mit.edu	37	9	124722008	124722008	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124722008delA	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						tgatggttttaaaacataaac	0.000													4	2	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126462245	126462245	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126462245delG	uc004bnz.1	-						DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						ccaaagtgctgggattacagg	0.000													4	2	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126625877	126625877	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126625877delA	uc004bnz.1	-						DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						CTAACAAGTTAAAAAAAAAAA	0.348													3	3	---	---	---	---	
NEK6	10783	broad.mit.edu	37	9	127065638	127065640	+	Intron	DEL	TGA	-	-	rs67405073		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127065638_127065640delTGA	uc004bog.2	+						NEK6_uc004bof.2_Intron|NEK6_uc004boh.2_Intron|NEK6_uc010mwj.2_Intron|NEK6_uc010mwk.2_Intron|NEK6_uc004boi.2_Intron	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2						apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						TCAGATTGGCTGATGTTTGACCT	0.286													6	3	---	---	---	---	
OLFML2A	169611	broad.mit.edu	37	9	127571880	127571880	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127571880delT	uc004bov.2	+						OLFML2A_uc004bow.2_Intron	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor												0						cctctgagccttttttttttt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	130785805	130785808	+	IGR	DEL	TTTG	-	-	rs138698192		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130785805_130785808delTTTG								FAM102A (43310 upstream) : NAIF1 (37705 downstream)																							tgttttggtttttgtttgtttgtt	0.069													4	2	---	---	---	---	
ASS1	445	broad.mit.edu	37	9	133326694	133326694	+	Intron	DEL	G	-	-	rs11337242		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133326694delG	uc004bzm.2	+						ASS1_uc004bzn.2_Intron|ASS1_uc010mza.2_Intron|ASS1_uc004bzo.2_Intron|ASS1_uc010mzb.2_Intron|ASS1_uc004bzp.2_5'Flank|ASS1_uc010mzc.2_5'Flank	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GGGCCTGGCTGCAGAGAGCCC	0.587													4	3	---	---	---	---	
LAMC3	10319	broad.mit.edu	37	9	133961063	133961065	+	In_Frame_Del	DEL	AAG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133961063_133961065delAAG	uc004caa.1	+	25	4281_4283	c.4183_4185delAAG	c.(4183-4185)AAGdel	p.K1397del	LAMC3_uc010mze.1_In_Frame_Del_p.K85del	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	1397	Domain II and I.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CTCCAGTGCCAAGAAGAAGGGCA	0.616													25	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	134449681	134449682	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134449681_134449682insT								UCK1 (43019 upstream) : RAPGEF1 (2476 downstream)																							TAGtttttcccttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	134698792	134698793	+	IGR	INS	-	C	C	rs143583995	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134698792_134698793insC								RAPGEF1 (83575 upstream) : MED27 (36706 downstream)																							ctgtgcttttgagggagagagt	0.297													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	136376955	136376956	+	IGR	INS	-	GT	GT	rs145646901	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136376955_136376956insGT								SLC2A6 (32679 upstream) : TMEM8C (2803 downstream)																							gtgtatgtgtggtgtgtgtgtg	0.000													4	3	---	---	---	---	
CAMSAP1	157922	broad.mit.edu	37	9	138759543	138759543	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138759543delA	uc004cgr.3	-						CAMSAP1_uc004cgq.3_Intron|CAMSAP1_uc010nbg.2_Intron	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein							cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		caagaagactaaacagagtaa	0.139													4	2	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140563960	140563960	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140563960delC	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TCCCAAGACGCCCCGCACAGC	0.502													4	2	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140585193	140585193	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140585193delT	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		agcCCTCTCCtttaaacattc	0.025													4	2	---	---	---	---	
IDI1	3422	broad.mit.edu	37	10	1091807	1091808	+	Intron	DEL	GT	-	-	rs71676367		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1091807_1091808delGT	uc001iga.2	-						IDI1_uc001ifz.2_5'Flank|IDI1_uc001igb.2_Intron|IDI1_uc001igc.2_Intron	NM_004508	NP_004499	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase						carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		TAGGGTCTGGgtgtgtgtgtgt	0.282													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3972531	3972532	+	IGR	INS	-	C	C	rs143819383		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3972531_3972532insC								KLF6 (145058 upstream) : LOC100216001 (648912 downstream)																							ttcccttccttccttccttcct	0.000													3	3	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7437246	7437246	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7437246delA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						accttggaggaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10825949	10825950	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10825949_10825950insA								None (None upstream) : SFTA1P (452 downstream)																							gactccttcccaaaaaaaaaaa	0.168													4	2	---	---	---	---	
CAMK1D	57118	broad.mit.edu	37	10	12533148	12533149	+	Intron	INS	-	TG	TG	rs143508843	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12533148_12533149insTG	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		GTATGAGAgtatgtgtgtgtgt	0.381													3	3	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	13749258	13749259	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13749258_13749259delAC	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						CTCTTGCTTGacacacacacac	0.431													2	5	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	13909229	13909229	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13909229delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						TGTAAACTTCAAATATACACA	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	15802262	15802262	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15802262delC								ITGA8 (40492 upstream) : FAM188A (17913 downstream)																							caaaccccatcctgttgattt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16339079	16339079	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16339079delG								FAM188A (436560 upstream) : PTER (139888 downstream)																							agagaggggaggggagagatg	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	21792624	21792624	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21792624delA								C10orf114 (6411 upstream) : C10orf140 (9787 downstream)																							AATGGATGGGAAAAAACCCTT	0.378													4	2	---	---	---	---	
APBB1IP	54518	broad.mit.edu	37	10	26851567	26851567	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26851567delA	uc001iss.2	+							NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						tctctactagaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	27860932	27860932	+	IGR	DEL	A	-	-	rs76239075	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27860932delA								RAB18 (31835 upstream) : MKX (100872 downstream)																							tgctatttttaaaaaaaaagc	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	31368116	31368116	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31368116delG								ZNF438 (47250 upstream) : LOC220930 (237342 downstream)																							CCCCTCCTGTGGTCAGTGTCG	0.408													4	2	---	---	---	---	
CREM	1390	broad.mit.edu	37	10	35480866	35480867	+	Intron	INS	-	CCACCTGGTG	CCACCTGGTG	rs148904125	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35480866_35480867insCCACCTGGTG	uc001iyb.2	+						CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Intron|CREM_uc001iyc.2_Intron|CREM_uc001iyd.2_Intron|CREM_uc001iye.2_Intron|CREM_uc001iyf.2_Intron|CREM_uc001iyg.2_Intron|CREM_uc001iyh.2_Intron|CREM_uc001iyi.2_Intron|CREM_uc001iyj.2_Intron|CREM_uc001iyk.2_Intron	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a						cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCACTACTATCCTTGATGCCAG	0.465													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38877438	38877438	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38877438delG								LOC399744 (136358 upstream) : None (None downstream)																							aaatatcatcgaaattgaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42796640	42796641	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42796640_42796641insA								None (None upstream) : LOC441666 (30674 downstream)																							cattccattctttccattcgcg	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42800561	42800562	+	IGR	INS	-	TCCAT	TCCAT	rs139500319		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42800561_42800562insTCCAT								None (None upstream) : LOC441666 (26753 downstream)																							ttccaatccaatccattccatt	0.000													4	2	---	---	---	---	
ZNF33B	7582	broad.mit.edu	37	10	43108996	43108996	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43108996delA	uc001jaf.1	-						ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Intron|ZNF33B_uc001jad.2_Intron	NM_006955	NP_008886	Q06732	ZN33B_HUMAN	zinc finger protein 33B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						actctctctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	43841433	43841433	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43841433delG								RASGEF1A (79066 upstream) : FXYD4 (25659 downstream)																							GTTAAATgccgggcacagtgg	0.005													4	2	---	---	---	---	
CCDC6	8030	broad.mit.edu	37	10	61633876	61633877	+	Intron	INS	-	ACAC	ACAC	rs142308836	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61633876_61633877insACAC	uc001jks.3	-							NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		TTACCTAGCAAacacacacaca	0.312													4	2	---	---	---	---	
SUPV3L1	6832	broad.mit.edu	37	10	70960397	70960397	+	Intron	DEL	A	-	-	rs35423280		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70960397delA	uc001jpe.1	+						SUPV3L1_uc010qjd.1_Intron	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor						DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2						AAACTGCATTAAAAAAAGCCC	0.408													4	2	---	---	---	---	
TSPAN15	23555	broad.mit.edu	37	10	71209168	71209169	+	5'Flank	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71209168_71209169insT	uc001jpo.1	+							NM_012339	NP_036471	O95858	TSN15_HUMAN	transmembrane 4 superfamily member 15							integral to plasma membrane|membrane fraction					0						tttccctgttgttttttttttg	0.183													4	2	---	---	---	---	
UNC5B	219699	broad.mit.edu	37	10	73040761	73040762	+	Intron	DEL	TC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73040761_73040762delTC	uc001jro.2	+						UNC5B_uc001jrp.2_Intron	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3						cctgctcatttctctctctctc	0.109													4	2	---	---	---	---	
CCDC109A	90550	broad.mit.edu	37	10	74470980	74470981	+	Intron	DEL	TT	-	-	rs111528354		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74470980_74470981delTT	uc001jtc.2	+						CCDC109A_uc009xqp.1_Intron|CCDC109A_uc009xqq.1_Intron|CCDC109A_uc010qjy.1_Intron|CCDC109A_uc009xqr.2_Intron|CCDC109A_uc001jtd.2_Intron	NM_138357	NP_612366	Q8NE86	MCU_HUMAN	coiled-coil domain containing 109A						elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)					tctgcaaatctttttttttttt	0.000													3	3	---	---	---	---	
NUDT13	25961	broad.mit.edu	37	10	74883845	74883845	+	Intron	DEL	C	-	-	rs112860011		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74883845delC	uc001jtj.2	+						NUDT13_uc010qkc.1_Intron|NUDT13_uc010qkd.1_Intron|NUDT13_uc009xqw.2_Intron|NUDT13_uc001jtk.2_Intron|NUDT13_uc010qke.1_Intron|NUDT13_uc001jtl.2_Intron	NM_015901	NP_056985	Q86X67	NUD13_HUMAN	nudix-type motif 13								hydrolase activity|metal ion binding				0	Prostate(51;0.0119)					caggcacacgccccccacacc	0.174													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	85036573	85036573	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85036573delA								NRG3 (289638 upstream) : GHITM (862612 downstream)																							AAAGAGGGCTAAAAAAAAAAT	0.085													4	2	---	---	---	---	
LDB3	11155	broad.mit.edu	37	10	88447808	88447811	+	Intron	DEL	GTGT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88447808_88447811delGTGT	uc001kdv.2	+						LDB3_uc010qml.1_Intron|LDB3_uc010qmm.1_Intron|LDB3_uc001kdu.2_Intron|LDB3_uc009xsz.2_Intron|LDB3_uc001kdr.2_Intron|LDB3_uc009xsy.2_Intron|LDB3_uc001kds.2_Intron|LDB3_uc001kdt.2_Intron	NM_007078	NP_009009	O75112	LDB3_HUMAN	LIM domain binding 3 isoform 1							cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding			ovary(1)	1						cccGACCCTCgtgtgtgtgtgtgt	0.132													5	3	---	---	---	---	
ENTPD1	953	broad.mit.edu	37	10	97627404	97627404	+	3'UTR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97627404delC	uc001klh.3	+	10					ENTPD1_uc001kli.3_3'UTR|uc001klg.1_Intron|ENTPD1_uc010qoj.1_3'UTR|ENTPD1_uc010qok.1_3'UTR|ENTPD1_uc010qol.1_3'UTR|ENTPD1_uc010qom.1_3'UTR|ENTPD1_uc010qon.1_3'UTR|ENTPD1_uc009xva.2_3'UTR|ENTPD1_uc009xuz.2_RNA	NM_001776	NP_001767	P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		ATAGACCTTACCATGGAAACA	0.463													4	2	---	---	---	---	
NT5C2	22978	broad.mit.edu	37	10	104908361	104908361	+	Intron	DEL	A	-	-	rs111361847		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104908361delA	uc001kwo.2	-						NT5C2_uc010qqp.1_Intron|NT5C2_uc001kwq.2_Intron|NT5C2_uc001kwp.2_Intron	NM_012229	NP_036361	P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II						purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|metal ion binding|nucleotide binding|protein binding				0		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	actccgtctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105564823	105564823	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105564823delA	uc001kxj.1	-							NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GCAGGACATTAGACATCAGCC	0.572													4	2	---	---	---	---	
VTI1A	143187	broad.mit.edu	37	10	114496381	114496381	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114496381delG	uc001kzy.2	+						VTI1A_uc001kzz.2_Intron	NM_145206	NP_660207	Q96AJ9	VTI1A_HUMAN	SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		AAAGCCTGCTGTTCTAAATGC	0.398													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125000581	125000581	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125000581delA								BUB3 (75695 upstream) : GPR26 (425290 downstream)																							aaaggtcgctaagacatgacc	0.119													4	2	---	---	---	---	
PTPRE	5791	broad.mit.edu	37	10	129829093	129829093	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129829093delC	uc001lkb.2	+						PTPRE_uc009yat.2_Intron|PTPRE_uc010qup.1_Intron|PTPRE_uc009yau.2_Intron|PTPRE_uc001lkc.1_Intron	NM_006504	NP_006495	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)				TCCCTCACCTCCCCAGCCTCC	0.677													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	131909116	131909116	+	5'Flank	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131909116delT	uc010qus.1	-						uc001lkl.2_5'Flank					Homo sapiens cDNA FLJ36799 fis, clone ADRGL2007357.																		CACAAGGCCCTGGGGAGCCAA	0.692													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135461246	135461247	+	IGR	INS	-	G	G	rs140694261		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135461246_135461247insG								FRG2B (20947 upstream) : LOC653544 (29032 downstream)																							atttattgcaaaaaaaaagaat	0.000													4	4	---	---	---	---	
PGAP2	27315	broad.mit.edu	37	11	3839573	3839574	+	Intron	DEL	AC	-	-	rs71041399		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3839573_3839574delAC	uc001lys.2	+						PGAP2_uc001lyl.2_Intron|PGAP2_uc010qxw.1_Intron|PGAP2_uc010qxx.1_Intron|PGAP2_uc001lyp.3_Intron|PGAP2_uc010qxy.1_Intron|PGAP2_uc010qxz.1_Intron|PGAP2_uc001lyn.3_Intron|PGAP2_uc010qya.1_Intron|PGAP2_uc001lyr.2_Intron|PGAP2_uc010qyb.1_Intron|PGAP2_uc001lyt.2_Intron	NM_014489	NP_055304	Q9UHJ9	PGAP2_HUMAN	FGF receptor activating protein 1 isoform 1						GPI anchor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein transporter activity				0						AAAAAAAAAAACAATAACAGTG	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	8348066	8348067	+	IGR	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8348066_8348067delGT								LMO1 (57884 upstream) : STK33 (65351 downstream)																							gggtgtgtgcgtgtgtgtgtgt	0.243													4	2	---	---	---	---	
TEAD1	7003	broad.mit.edu	37	11	12824649	12824650	+	Intron	INS	-	T	T	rs144981643		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12824649_12824650insT	uc001mkj.3	+							NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TTTCACCTGTATTTTTTTTTTT	0.475													5	3	---	---	---	---	
FAR1	84188	broad.mit.edu	37	11	13701763	13701763	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13701763delT	uc001mld.2	+						FAR1_uc009ygp.2_Intron	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1						ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2						ACACTTTGGGTTTGCATTTTG	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13978071	13978071	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13978071delA								FAR1 (224180 upstream) : SPON1 (5843 downstream)																							ACACCACATGAAAAAAAAAAT	0.403											OREG0020787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14281993	14281994	+	Intron	DEL	CT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14281993_14281994delCT	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		ATAGATTTCACTCTTATTTGAA	0.505													5	6	---	---	---	---	
IGSF22	283284	broad.mit.edu	37	11	18741911	18741911	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18741911delT	uc009yht.2	-						IGSF22_uc001mpa.2_Intron	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22											ovary(4)|large_intestine(2)|kidney(1)	7						GTAGGAGGCCTTTTTTTTTTT	0.483													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34749672	34749672	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34749672delT								EHF (66591 upstream) : APIP (147042 downstream)																							cacttgatagttttttttcac	0.000													4	2	---	---	---	---	
PAMR1	25891	broad.mit.edu	37	11	35546637	35546637	+	Intron	DEL	T	-	-	rs111913054		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35546637delT	uc001mwg.2	-						PAMR1_uc001mwf.2_Intron|PAMR1_uc010rew.1_Intron|PAMR1_uc010rex.1_Intron	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN	regeneration associated muscle protease isoform						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						tattcctttctttctttccct	0.403													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42338212	42338213	+	IGR	INS	-	G	G	rs145443988	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42338212_42338213insG								LRRC4C (856889 upstream) : API5 (995292 downstream)																							TTCCCTTTCCTGTACCGTCATT	0.248													3	4	---	---	---	---	
TTC17	55761	broad.mit.edu	37	11	43511286	43511286	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43511286delA	uc001mxi.2	+						TTC17_uc010rfj.1_Intron|TTC17_uc001mxl.2_Intron|TTC17_uc001mxm.2_5'Flank	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17								binding			ovary(5)	5						actctgtctcaaaaaaaaaag	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45586894	45586894	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45586894delC								SYT13 (279010 upstream) : CHST1 (83533 downstream)																							ACTCCATAGACCCGTCAGTGG	0.428													4	4	---	---	---	---	
SLC39A13	91252	broad.mit.edu	37	11	47379128	47379129	+	Intron	DEL	TT	-	-	rs139772356		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47379128_47379129delTT	uc001nfd.2	+						SPI1_uc001nfb.1_Intron|SPI1_uc001nfc.1_Intron			Q96H72	S39AD_HUMAN	RecName: Full=Zinc transporter ZIP13; AltName: Full=Zrt- and Irt-like protein 13;          Short=ZIP-13; AltName: Full=Solute carrier family 39 member 13; AltName: Full=LIV-1 subfamily of ZIP zinc transporter 9; AltName: Full=LZT-Hs9;						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				Lung(87;0.0936)		acccattctcttgtttttgaga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48365579	48365579	+	IGR	DEL	G	-	-	rs67239811		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48365579delG								OR4C3 (18099 upstream) : OR4C45 (1323 downstream)																							tgaaaaaaaagacatgtaatg	0.090													3	3	---	---	---	---	
OR4C45	403257	broad.mit.edu	37	11	48375374	48375375	+	5'Flank	INS	-	G	G	rs5791833		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48375374_48375375insG	uc010rhw.1	-							NM_001005513	NP_001005513			olfactory receptor, family 4, subfamily C,												0						TGTAGTAATATGGAAGTCAAGA	0.302													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48888361	48888361	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48888361delT								OR4A47 (377089 upstream) : FOLH1 (279827 downstream)																							tgaaccttccttttgagagag	0.000													4	2	---	---	---	---	
SYT7	9066	broad.mit.edu	37	11	61321781	61321782	+	Intron	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61321781_61321782delCA	uc001nrv.2	-						SYT7_uc009ynr.2_Intron|SYT7_uc001nrx.1_Intron	NM_004200	NP_004191	O43581	SYT7_HUMAN	synaptotagmin VII							cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4						cacccacacccacacacacaca	0.480													4	2	---	---	---	---	
TUT1	64852	broad.mit.edu	37	11	62353005	62353006	+	Intron	INS	-	T	T	rs138014517	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62353005_62353006insT	uc001nto.2	-							NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6						mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						GGACTGGCAGATTCAGAAGACT	0.292													6	5	---	---	---	---	
POLR2G	5436	broad.mit.edu	37	11	62530608	62530609	+	Intron	INS	-	C	C	rs4963318		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62530608_62530609insC	uc001nva.2	+						POLR2G_uc001nvb.2_Intron	NM_002696	NP_002687	P62487	RPB7_HUMAN	DNA directed RNA polymerase II polypeptide G						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA-directed RNA polymerase activity|protein binding|RNA binding				0						tcactttttttttttttttttt	0.084													6	6	---	---	---	---	
PCNXL3	399909	broad.mit.edu	37	11	65392147	65392149	+	Intron	DEL	CTC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65392147_65392149delCTC	uc001oey.2	+						PCNXL3_uc009yqn.2_5'Flank|PCNXL3_uc001oez.2_5'Flank	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3							integral to membrane					0						GCGGAACCTTCTCCTGCGTCTGT	0.591													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68634138	68634139	+	IGR	INS	-	T	T	rs150260613	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68634138_68634139insT								CPT1A (24739 upstream) : MRPL21 (24608 downstream)																							atctccccgtgttttTTTTTGT	0.025													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69497244	69497245	+	IGR	INS	-	A	A	rs146476342	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69497244_69497245insA								ORAOV1 (7079 upstream) : FGF19 (15762 downstream)																							gaccctgtttcaaaaaaaaaGC	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	74765722	74765723	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74765722_74765723insT								NEU3 (46981 upstream) : OR2AT4 (34074 downstream)																							ATTTtttaaaattttaatcatt	0.168													4	2	---	---	---	---	
C11orf67	28971	broad.mit.edu	37	11	77577057	77577057	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77577057delT	uc001oyq.2	+						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron	NM_024684	NP_078960	Q9H7C9	CK067_HUMAN	hypothetical protein LOC28971												0	all_cancers(14;5.69e-19)|all_epithelial(13;2.15e-21)|Breast(9;1.16e-15)|Ovarian(111;0.152)		Epithelial(5;1.37e-49)|all cancers(3;5.58e-46)|BRCA - Breast invasive adenocarcinoma(5;7.26e-31)			AGGGGATAGATTCCAGAGATC	0.428													4	2	---	---	---	---	
GAB2	9846	broad.mit.edu	37	11	77998417	77998418	+	Intron	INS	-	G	G	rs140048351	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77998417_77998418insG	uc001ozh.2	-						GAB2_uc001ozg.2_Intron	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			ctcaacctcctggctcaagtga	0.000													4	5	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	78894676	78894677	+	Intron	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78894676_78894677delTG	uc001ozl.3	-						ODZ4_uc009yvc.2_Intron	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						gtggcaaggttgtgtgtgtgtg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79966872	79966873	+	IGR	DEL	AC	-	-	rs36056334		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79966872_79966873delAC								ODZ4 (815177 upstream) : None (None downstream)																							acacacacgtacacacacacac	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	80828668	80828669	+	IGR	INS	-	TGTGTG	TGTGTG	rs139582359	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80828668_80828669insTGTGTG								None (None upstream) : None (None downstream)																							TCTCTTTACCCtgtgtgtgtgt	0.297													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	82337727	82337727	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82337727delA								None (None upstream) : FAM181B (105326 downstream)																							catgcagtgcaaaaacccaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	97295544	97295544	+	IGR	DEL	A	-	-	rs35143860		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97295544delA								None (None upstream) : None (None downstream)																							actctgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	100468649	100468650	+	IGR	DEL	AA	-	-	rs145446666		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100468649_100468650delAA								CNTN5 (241177 upstream) : ARHGAP42 (89757 downstream)																							ATACTGACACAAAGAGAAATAT	0.386													4	2	---	---	---	---	
MMP20	9313	broad.mit.edu	37	11	102449521	102449522	+	Intron	INS	-	AA	AA	rs59621557	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102449521_102449522insAA	uc001phc.2	-							NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein						proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		aacacacacacacaaaaacaaa	0.109													2	4	---	---	---	---	
SLC35F2	54733	broad.mit.edu	37	11	107699863	107699863	+	Intron	DEL	G	-	-	rs73003365		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107699863delG	uc001pjq.2	-						SLC35F2_uc010rvu.1_Intron|SLC35F2_uc001pjs.2_Intron	NM_017515	NP_059985	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2						transport	integral to membrane				central_nervous_system(1)	1		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		aaaaaaaaaagaaaaaaaaaa	0.000													3	4	---	---	---	---	
ARHGAP20	57569	broad.mit.edu	37	11	110528615	110528616	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110528615_110528616insA	uc001pkz.1	-						ARHGAP20_uc001pky.1_Intron|ARHGAP20_uc009yyb.1_Intron|ARHGAP20_uc001pla.1_Intron	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		gagactccgacaaaaaaaaaaa	0.064													4	2	---	---	---	---	
ARHGAP20	57569	broad.mit.edu	37	11	110529503	110529504	+	Intron	INS	-	TTGTTTTGTTTTGTT	TTGTTTTGTTTTGTT	rs143753056	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110529503_110529504insTTGTTTTGTTTTGTT	uc001pkz.1	-						ARHGAP20_uc001pky.1_Intron|ARHGAP20_uc009yyb.1_Intron|ARHGAP20_uc001pla.1_Intron	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GTTGTTATTTATTGTTTTGTTT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116523303	116523304	+	IGR	DEL	CA	-	-	rs55874354		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116523303_116523304delCA								None (None upstream) : BUD13 (95584 downstream)																							CTCTCTcactcacacacacaca	0.361													4	3	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117480273	117480273	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117480273delC	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		cctcttgcgtcggcctcccaa	0.000													4	2	---	---	---	---	
USP2	9099	broad.mit.edu	37	11	119241318	119241319	+	Intron	INS	-	AG	AG	rs148327395	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119241318_119241319insAG	uc001pwm.3	-						USP2_uc001pwn.3_Intron	NM_004205	NP_004196	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2 isoform a						cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity			ovary(2)|urinary_tract(1)|skin(1)	4		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		AAATGACGATAAGGGGTGGAGA	0.515													4	2	---	---	---	---	
POU2F3	25833	broad.mit.edu	37	11	120184727	120184729	+	Intron	DEL	CAA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120184727_120184729delCAA	uc001pxc.2	+						POU2F3_uc010rzk.1_Intron|POU2F3_uc010rzl.1_Intron|POU2F3_uc001pxe.1_Intron	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor						negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		catctcaaaCcaacaacaacaac	0.207													5	3	---	---	---	---	
ASAM	79827	broad.mit.edu	37	11	123038665	123038668	+	Intron	DEL	AGAC	-	-	rs112277747		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123038665_123038668delAGAC	uc001pyt.2	-							NM_024769	NP_079045	Q9H6B4	CLMP_HUMAN	adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		CAGGAAGGAAagacagacagacag	0.417													4	2	---	---	---	---	
ETS1	2113	broad.mit.edu	37	11	128429785	128429785	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128429785delG	uc001qej.2	-							NM_001143820	NP_001137292	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		ACACCAAACAGGTCCCTGCTT	0.493													4	2	---	---	---	---	
ADAMTS15	170689	broad.mit.edu	37	11	130331416	130331416	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130331416delG	uc010scd.1	+	2	990	c.990delG	c.(988-990)CTGfs	p.L330fs		NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease	330	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GTGACACCCTGGGCATGGCTG	0.597													28	44	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131582750	131582750	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131582750delC	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ttcctgggagccatggtgccc	0.030													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	132138552	132138553	+	Intron	INS	-	TT	TT	rs71477753		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132138552_132138553insTT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						gtgtggggtcctctctctctct	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	134379048	134379049	+	IGR	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134379048_134379049delTG								B3GAT1 (97236 upstream) : None (None downstream)																							ATCAACAAATtgtgtgtgtgtg	0.243													3	4	---	---	---	---	
LOC100288778	100288778	broad.mit.edu	37	12	80626	80627	+	Intron	INS	-	AG	AG			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80626_80627insAG	uc010scy.1	+						uc010scx.1_Intron|LOC100288778_uc010scz.1_Intron|LOC100288778_uc010sdb.1_Intron					SubName: Full=Actin nucleation promoting factor; Flags: Fragment;												0						CCAATAGTAACAAAGTGCTGGA	0.401													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2370911	2370912	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2370911_2370912delAC	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	TCCTTGTGCAACACACACACAC	0.460													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2571500	2571500	+	Intron	DEL	G	-	-	rs4993572		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2571500delG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	tcctcggcccgccccttggct	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6291666	6291666	+	IGR	DEL	G	-	-	rs68072398		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6291666delG								VWF (57830 upstream) : CD9 (17207 downstream)																							CAGGATGGGCGGGGGAAGGAC	0.637													4	4	---	---	---	---	
LTBR	4055	broad.mit.edu	37	12	6490480	6490480	+	5'Flank	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6490480delG	uc001qny.1	+						LTBR_uc010sfc.1_Intron|LTBR_uc001qnz.1_5'Flank	NM_002342	NP_002333	P36941	TNR3_HUMAN	lymphotoxin beta receptor precursor						apoptosis|cellular response to mechanical stimulus|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	protein binding|receptor activity			lung(2)	2						ttatggaagtggggaaggaag	0.000													4	2	---	---	---	---	
CLEC9A	283420	broad.mit.edu	37	12	10180307	10180308	+	5'Flank	DEL	CT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10180307_10180308delCT	uc001qxa.2	+							NM_207345	NP_997228	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1						ccttctctccctctctctctct	0.129													4	2	---	---	---	---	
CREBL2	1389	broad.mit.edu	37	12	12765341	12765341	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12765341delC	uc001rap.1	+							NM_001310	NP_001301	O60519	CRBL2_HUMAN	cAMP responsive element binding protein-like 2						cell cycle|signal transduction	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Prostate(47;0.0684)		BRCA - Breast invasive adenocarcinoma(232;0.0503)		ATTTTTCACTCCCAGGGCGTT	0.517													4	2	---	---	---	---	
PLCZ1	89869	broad.mit.edu	37	12	18881501	18881501	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18881501delA	uc010sid.1	-						PLCZ1_uc001rdv.3_Intron|PLCZ1_uc001rdw.3_Intron	NM_033123	NP_149114	Q86YW0	PLCZ1_HUMAN	phospholipase C, zeta 1						intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					CACAGGACAGAAGGAGAAGGA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	30467783	30467786	+	IGR	DEL	GTGT	-	-	rs151138354		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30467783_30467786delGTGT								TMTC1 (530091 upstream) : IPO8 (314137 downstream)																							acattcttccgtgtgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	30764800	30764801	+	IGR	INS	-	A	A	rs34352929		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30764800_30764801insA								TMTC1 (827108 upstream) : IPO8 (17122 downstream)																							gaccctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31017750	31017750	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31017750delT								CAPRIN2 (110302 upstream) : TSPAN11 (61612 downstream)																							AGCCCCATCATTTTTCCCTTC	0.448													4	2	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32497338	32497339	+	Intron	INS	-	C	C	rs147238628	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32497338_32497339insC	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GTGAGAGCAGACTTACCACGGG	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32564475	32564477	+	IGR	DEL	CAA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32564475_32564477delCAA								BICD1 (33335 upstream) : FGD4 (74429 downstream)																							ctcaCAACAGCAACAACAACAAC	0.207													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32585285	32585288	+	IGR	DEL	CGCC	-	-	rs113528041		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32585285_32585288delCGCC								BICD1 (54145 upstream) : FGD4 (53618 downstream)																							tgagccaccgcgcccgaccaatcc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38006732	38006732	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38006732delG								None (None upstream) : ALG10B (703825 downstream)																							gaatctgcttgtggatatatg	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	49381667	49381668	+	IGR	DEL	AG	-	-	rs71902144		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49381667_49381668delAG								WNT1 (5272 upstream) : DDN (7265 downstream)																							CAagaaagacagagagagagag	0.292											OREG0021777	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	52264280	52264280	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52264280delT								FIGNL2 (48072 upstream) : ANKRD33 (17513 downstream)																							gcccagatccttcccaggaac	0.000													4	2	---	---	---	---	
ATP5G2	517	broad.mit.edu	37	12	54072125	54072127	+	5'Flank	DEL	CAC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54072125_54072127delCAC	uc009znc.2	-						ATP5G2_uc001sec.2_5'Flank|ATP5G2_uc001sed.2_5'Flank	NM_001002031	NP_001002031	Q06055	AT5G2_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP hydrolysis coupled proton transport|ATP synthesis coupled proton transport	integral to membrane|mitochondrial proton-transporting ATP synthase complex|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|lipid binding			ovary(1)	1						tcatcatcgtcaccaccaccacc	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54311188	54311189	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54311188_54311189insT								CALCOCO1 (189881 upstream) : HOXC13 (21387 downstream)																							attctccagtgttttttttttt	0.000													4	2	---	---	---	---	
HOXC10	3226	broad.mit.edu	37	12	54376972	54376972	+	5'Flank	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54376972delA	uc001sen.2	+							NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10						positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1						AAAGCCATATAATTCTCAATT	0.423													4	2	---	---	---	---	
BLOC1S1	2647	broad.mit.edu	37	12	56112594	56112595	+	Intron	INS	-	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56112594_56112595insC	uc009zny.1	+						BLOC1S1_uc001shi.2_Intron|BLOC1S1_uc001shj.3_Intron|RDH5_uc010spt.1_5'Flank|RDH5_uc010spu.1_5'Flank|RDH5_uc001shk.2_5'Flank|RDH5_uc001shl.2_5'Flank			P78537	BL1S1_HUMAN	RecName: Full=Biogenesis of lysosome-related organelles complex 1 subunit 1;          Short=BLOC-1 subunit 1; AltName: Full=GCN5-like protein 1; AltName: Full=Protein RT14;						cellular membrane organization|melanosome organization|platelet dense granule organization|post-Golgi vesicle-mediated transport	BLOC-1 complex|lysosomal membrane	protein binding				0						CCCCAGGTTTTCCCTCCCTTCC	0.535													4	2	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56580134	56580134	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56580134delT	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TTGATCTCCCttttttttttt	0.179													3	3	---	---	---	---	
RNF41	10193	broad.mit.edu	37	12	56608613	56608613	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56608613delA	uc001skf.1	-						RNF41_uc001ske.1_Intron|RNF41_uc001skg.1_Intron|RNF41_uc010sqg.1_Intron|RNF41_uc010sqh.1_Intron|RNF41_uc001skh.2_Intron	NM_005785	NP_005776	Q9H4P4	RNF41_HUMAN	ring finger protein 41 isoform 1						apoptosis|induction of apoptosis|protein polyubiquitination|regulation of reactive oxygen species metabolic process		protein binding|protein tag|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						actctgccttaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	66387142	66387142	+	IGR	DEL	T	-	-	rs66802812		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66387142delT								HMGA2 (27074 upstream) : LLPH (129708 downstream)																							CTTTGTGGGGTTTTTTTTTCT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	67450295	67450296	+	IGR	INS	-	G	G	rs141702149	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67450295_67450296insG								GRIP1 (252401 upstream) : CAND1 (212765 downstream)																							ccagctagcaagggggaagctg	0.000													1	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	72489914	72489915	+	IGR	INS	-	ACAC	ACAC	rs144560604	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72489914_72489915insACAC								TPH2 (63693 upstream) : LOC283392 (166413 downstream)																							cttatgtgtatacacacacaca	0.035													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	73916640	73916641	+	IGR	DEL	AA	-	-	rs78906812		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73916640_73916641delAA								TRHDE (857219 upstream) : None (None downstream)																							gtgcacacagaaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	91035359	91035360	+	IGR	INS	-	AGGA	AGGA			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91035359_91035360insAGGA								LOC338758 (929631 upstream) : C12orf12 (310633 downstream)																							ggaagacagggagggagggaag	0.124													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	93767375	93767377	+	IGR	DEL	TTT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93767375_93767377delTTT								EEA1 (444268 upstream) : NUDT4 (4324 downstream)																							Cttttttgaattttttttttttt	0.192													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98382243	98382244	+	IGR	INS	-	AAGGGAAGGA	AAGGGAAGGA			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98382243_98382244insAAGGGAAGGA								RMST (423450 upstream) : LOC100128191 (524509 downstream)																							gaagagaaaggaagggaaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106248353	106248356	+	IGR	DEL	ACAC	-	-	rs144841211		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106248353_106248356delACAC								C12orf75 (483058 upstream) : NUAK1 (208769 downstream)																							ccagcagtgGacacacacacacac	0.069													5	3	---	---	---	---	
SLC24A6	80024	broad.mit.edu	37	12	113740877	113740878	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113740877_113740878delAC	uc001tvc.2	-						SLC24A6_uc001tuz.2_Intron|SLC24A6_uc001tva.2_Intron|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						acacacacgtacacacacacac	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114139950	114139965	+	IGR	DEL	CCTTCCTTCCTTCCTT	-	-	rs142815001		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114139950_114139965delCCTTCCTTCCTTCCTT								LHX5 (230073 upstream) : RBM19 (114578 downstream)																							tccctccctcccttccttccttccttccttccttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114767374	114767377	+	IGR	DEL	TGGA	-	-	rs34854444		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114767374_114767377delTGGA								RBM19 (363198 upstream) : TBX5 (24359 downstream)																							aatggatggttggatggatggatg	0.167													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115652879	115652880	+	IGR	INS	-	T	T	rs113880201		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115652879_115652880insT								TBX3 (530910 upstream) : MED13L (743503 downstream)																							tctttttcttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116388002	116388003	+	IGR	INS	-	G	G	rs145518429	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116388002_116388003insG								None (None upstream) : MED13L (8380 downstream)																							GAAGGAATTGTGGGGGGGGACA	0.535													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127942715	127942715	+	IGR	DEL	T	-	-	rs5801729		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127942715delT								LOC100128554 (985385 upstream) : TMEM132C (956576 downstream)																							atttccttgattttttttttt	0.000													4	2	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	129697010	129697012	+	Intron	DEL	GAG	-	-	rs3830309		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129697010_129697012delGAG	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTTCAGATAAGAGGAGGACAAAA	0.438													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133004634	133004634	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133004634delC								GALNT9 (98729 upstream) : FBRSL1 (62523 downstream)																							cagggtctttccgcgaccaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27880467	27880468	+	IGR	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27880467_27880468delGT								RASL11A (32640 upstream) : GTF3A (118213 downstream)																							GTGAGTGTACGTGTGTGTGTGT	0.475													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	28681786	28681786	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28681786delG								FLT3 (7057 upstream) : PAN3 (30857 downstream)																							GGCACACACTGGGTCACGCCA	0.622													4	15	---	---	---	---	
FLJ37307	283521	broad.mit.edu	37	13	52390790	52390791	+	3'UTR	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52390790_52390791delTG	uc010tgq.1	-	5					FLJ37307_uc001vft.1_3'UTR	NR_027047				Homo sapiens cDNA FLJ37307 fis, clone BRAMY2016327.												0						TCTCTGAACCtgtgtgtgtgtg	0.361													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55072236	55072236	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55072236delC								MIR1297 (186053 upstream) : None (None downstream)																							ggtggtataactaaaatgggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	56039151	56039152	+	IGR	INS	-	TG	TG	rs66553725		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:56039151_56039152insTG								None (None upstream) : None (None downstream)																							TTATATACATAtgtgtgtgtgt	0.238													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	60016208	60016208	+	IGR	DEL	A	-	-	rs11326872		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60016208delA								None (None upstream) : DIAPH3 (223517 downstream)																							cgtgtaccccaaatatacaca	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88635577	88635577	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88635577delC								SLITRK5 (303709 upstream) : None (None downstream)																							tctctcccatcccctaacatt	0.109													4	2	---	---	---	---	
UBAC2	337867	broad.mit.edu	37	13	99955272	99955273	+	Intron	INS	-	T	T	rs145932004	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99955272_99955273insT	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron|GPR183_uc001vog.2_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCCCTGCCTCCTGGGGGCTTGC	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	103856035	103856035	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103856035delT								SLC10A2 (136839 upstream) : None (None downstream)																							TCCGTCATCATtttttttttc	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	107078571	107078572	+	IGR	DEL	AA	-	-	rs33997668		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107078571_107078572delAA								DAOA (935189 upstream) : EFNB2 (63526 downstream)																							agcctcagacaaaaaaaaaaaa	0.000													3	3	---	---	---	---	
C13orf35	400165	broad.mit.edu	37	13	113299698	113299706	+	5'Flank	DEL	GAGGACAGT	-	-	rs67835733		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113299698_113299706delGAGGACAGT	uc001vsh.1	+							NM_207440	NP_997323	Q6ZP68	CM035_HUMAN	hypothetical protein LOC400165											ovary(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)		all cancers(43;0.201)			cgaggatggcgaggacagtgaggatggtg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19034958	19034958	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19034958delG								None (None upstream) : OR11H12 (342636 downstream)																							tctgtgagttgaatgcaaaca	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19787468	19787468	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19787468delG								POTEG (202526 upstream) : P704P (196486 downstream)																							AGGCCCTCCTGGATGCAGGGC	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19890463	19890464	+	Intron	DEL	CT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19890463_19890464delCT	uc001vvq.1	-						uc001vvr.1_Intron|uc010ahe.1_Intron					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																		GACTTGGCCCCTGTTATCCCCG	0.554													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21472575	21472576	+	IGR	INS	-	T	T	rs147919007	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21472575_21472576insT								SLC39A2 (2545 upstream) : NDRG2 (12347 downstream)																							aaggagaaaggtttttttagaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22342605	22342607	+	Intron	DEL	GCA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22342605_22342607delGCA	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc001wby.2_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CTATTCCAGGgcagcagcagcag	0.360													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23224760	23224761	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23224760_23224761insT								ABHD4 (143503 upstream) : OXA1L (10970 downstream)																							gaggtgctctgtttttttttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23572382	23572383	+	Intron	INS	-	G	G	rs139760029	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23572382_23572383insG	uc010aki.1	-											Homo sapiens cDNA clone IMAGE:40134016.																		AGTGGTATCAAGGGATGGCTGT	0.441													4	2	---	---	---	---	
NGDN	25983	broad.mit.edu	37	14	23939928	23939928	+	Intron	DEL	T	-	-	rs113444783		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23939928delT	uc001wjy.2	+						NGDN_uc001wjz.2_Intron	NM_001042635	NP_001036100	Q8NEJ9	NGDN_HUMAN	neuroguidin isoform 1						regulation of translation	axon|cytoplasm|dendrite|filopodium|nucleus					0	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		AAGTGGAAAGTTTTTTTTTTT	0.343													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	26726580	26726580	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26726580delC								None (None upstream) : NOVA1 (188510 downstream)																							acttggaactccaggcagtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28265279	28265279	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28265279delT								None (None upstream) : FOXG1 (971008 downstream)																							ttttgttttgttttgttttgt	0.030													4	2	---	---	---	---	
SCFD1	23256	broad.mit.edu	37	14	31175237	31175238	+	Intron	INS	-	T	T	rs150091343	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31175237_31175238insT	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_Intron|SCFD1_uc010ame.1_Intron	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		AGTTCTCCTGGTTTTTTTTTTC	0.208													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	32429055	32429055	+	IGR	DEL	A	-	-	rs150027499		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32429055delA								NUBPL (98638 upstream) : C14orf128 (115571 downstream)																							ATTGTGGGTGAAAAAAAAAAA	0.333													1	6	---	---	---	---	
ARHGAP5	394	broad.mit.edu	37	14	32584738	32584738	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32584738delG	uc001wrl.2	+						ARHGAP5_uc001wrm.2_Intron|ARHGAP5_uc001wrn.2_Intron|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b						cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		cgggcgtggtggcgggcacca	0.000													4	2	---	---	---	---	
LRFN5	145581	broad.mit.edu	37	14	42171665	42171668	+	Intron	DEL	TTTG	-	-	rs67033957		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42171665_42171668delTTTG	uc001wvm.2	+						LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGGTGAAGGttttgtttgtttgtt	0.181										HNSCC(30;0.082)			3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	45158999	45159001	+	IGR	DEL	GAG	-	-	rs113334732		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45158999_45159001delGAG								FSCB (182500 upstream) : C14orf28 (207506 downstream)																							aGAGAgaggagaggaggaggagg	0.010													6	4	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	48036110	48036110	+	Intron	DEL	T	-	-	rs76085987		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48036110delT	uc001wwj.3	-						MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						tccatcttCCttttttttttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56964811	56964812	+	IGR	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56964811_56964812delCA								PELI2 (196781 upstream) : C14orf101 (81526 downstream)																							cacacacacgcacacacacaca	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	60666583	60666583	+	IGR	DEL	A	-	-	rs75408071		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60666583delA								DHRS7 (30022 upstream) : PPM1A (45887 downstream)																							agtttaaaggaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62140966	62140967	+	IGR	INS	-	A	A	rs34856466		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62140966_62140967insA								PRKCH (123271 upstream) : HIF1A (21152 downstream)																							actaaaaagacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	69496662	69496662	+	IGR	DEL	T	-	-	rs76107798		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69496662delT								ACTN1 (50579 upstream) : DCAF5 (20976 downstream)																							gtgacttttgttttacattga	0.020													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	70072608	70072609	+	IGR	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70072608_70072609delTG								C14orf162 (34690 upstream) : KIAA0247 (5701 downstream)																							GACCAGGAGCtgtgtgtgtgtg	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	72373506	72373507	+	IGR	INS	-	TGAAA	TGAAA	rs3053911		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72373506_72373507insTGAAA								SIPA1L1 (167388 upstream) : RGS6 (25649 downstream)																							GAGGTCAGATCAGTTTATGCTG	0.376													4	3	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72951002	72951002	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72951002delT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CCAGGCCTCGTTTTTGTTGGA	0.378													4	2	---	---	---	---	
DPF3	8110	broad.mit.edu	37	14	73196148	73196149	+	Intron	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73196148_73196149delGT	uc001xnc.2	-						DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		aagaggaagagtggagtcagag	0.000													4	2	---	---	---	---	
PAPLN	89932	broad.mit.edu	37	14	73727247	73727247	+	Intron	DEL	A	-	-	rs71112723		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73727247delA	uc010ttx.1	+						PAPLN_uc001xnw.3_Intron|PAPLN_uc010arl.2_Intron|PAPLN_uc010ttw.1_Intron|PAPLN_uc010tty.1_Intron|PAPLN_uc010arm.2_5'Flank|PAPLN_uc010arn.2_5'Flank	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin							proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GGATTTAGGCAGAGATTGCGG	0.602													3	4	---	---	---	---	
ADCK1	57143	broad.mit.edu	37	14	78321008	78321009	+	Intron	INS	-	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78321008_78321009insC	uc001xui.2	+						ADCK1_uc010tvo.1_Intron|ADCK1_uc001xuj.2_Intron	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a							extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		caagtgattcttgtgcctcagg	0.000													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	78798662	78798663	+	Intron	DEL	TT	-	-	rs5809877		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78798662_78798663delTT	uc001xum.1	+									Q9Y4C0	NRX3A_HUMAN	Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		tttcttcttctttttttttttt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87410308	87410309	+	IGR	INS	-	CTTC	CTTC	rs11622972	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87410308_87410309insCTTC								None (None upstream) : GALC (893855 downstream)																							ttccttccttgcttccttcctt	0.000													4	4	---	---	---	---	
CCDC88C	440193	broad.mit.edu	37	14	91850618	91850620	+	Intron	DEL	TTT	-	-	rs113591067		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91850618_91850620delTTT	uc010aty.2	-						CCDC88C_uc010twk.1_Intron|CCDC88C_uc001xzl.3_Intron	NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE						microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				cccatctctCttttttttttttt	0.108													4	2	---	---	---	---	
RIN3	79890	broad.mit.edu	37	14	93077640	93077640	+	Intron	DEL	T	-	-	rs113700931		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93077640delT	uc001yap.2	+						RIN3_uc010auk.2_Intron|RIN3_uc001yaq.2_Intron	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3						endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				catgaccttctttttttttgg	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95841286	95841287	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95841286_95841287insT								CLMN (55041 upstream) : C14orf139 (32319 downstream)																							cctccttcccccttccttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98338742	98338743	+	IGR	INS	-	A	A	rs151171788	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98338742_98338743insA								VRK1 (990792 upstream) : C14orf64 (53204 downstream)																							CTATCAAAAAGAAAAAAAAGTG	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99540226	99540226	+	IGR	DEL	T	-	-	rs34438102		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99540226delT								C14orf177 (356129 upstream) : BCL11B (95401 downstream)																							gcattggagatgagtccaaac	0.139													2	4	---	---	---	---	
SNORD114-3	767579	broad.mit.edu	37	14	101419402	101419403	+	5'Flank	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101419402_101419403insA	uc001yit.2	+						SNORD114-4_uc001yiu.2_5'Flank|SNORD114-5_uc001yiv.2_5'Flank	NR_003195				Homo sapiens cDNA FLJ10247 fis, clone HEMBB1000705.												0						acaagcagggtaaaattcacat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101683953	101683954	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101683953_101683954delAC								MIR656 (150815 upstream) : DIO3OS (334606 downstream)																							TTTTAAAAGGACACACACACAC	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102414743	102414744	+	IGR	INS	-	AG	AG	rs142081354	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102414743_102414744insAG								PPP2R5C (20417 upstream) : DYNC1H1 (16121 downstream)																							GGGAAACGGCCAGAGACCTCGA	0.624													2	4	---	---	---	---	
TECPR2	9895	broad.mit.edu	37	14	102903897	102903898	+	Intron	INS	-	A	A	rs144527153	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102903897_102903898insA	uc001ylw.1	+						TECPR2_uc010awl.2_Intron|TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2								protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						tctcaaaaaggaaaaaaaaaag	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	105987445	105987445	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105987445delC								C14orf80 (21861 upstream) : TMEM121 (5508 downstream)																							GGGGCGAATGCTACTGGGTCT	0.617													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20441971	20441973	+	IGR	DEL	CTC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20441971_20441973delCTC								None (None upstream) : GOLGA6L6 (295121 downstream)																							cacatccaatctcctcctttatg	0.000													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20480900	20480901	+	IGR	INS	-	G	G	rs141078893		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20480900_20480901insG								None (None upstream) : GOLGA6L6 (256193 downstream)																							tgtcaaaaaaaaaaacaggaaa	0.168													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20511819	20511835	+	IGR	DEL	TGCCCTGTTTTTGGCCA	-	-	rs143404794	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20511819_20511835delTGCCCTGTTTTTGGCCA								None (None upstream) : GOLGA6L6 (225259 downstream)																							GCTATGgccctgccctgtttttggccatgccctgtgc	0.253													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20624044	20624044	+	Intron	DEL	C	-	-	rs8037873	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20624044delC	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron					RecName: Full=Putative HERC2-like protein 3;																		cctcaaaaaacaaaacaaaaa	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22406459	22406459	+	IGR	DEL	G	-	-	rs146365158		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22406459delG								OR4N4 (22644 upstream) : OR4N3P (7243 downstream)																							tgggagatctgctgctccctt	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23681279	23681279	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23681279delT								GOLGA8E (232856 upstream) : MKRN3 (129175 downstream)																							AATAAGCAGGTGGATGTAAAT	0.343													4	2	---	---	---	---	
ATP10A	57194	broad.mit.edu	37	15	25966691	25966692	+	Intron	DEL	GT	-	-	rs149148268		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25966691_25966692delGT	uc010ayu.2	-							NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCCCTGAAGCgtgtgtgtgtgt	0.421													14	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	29889773	29889773	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29889773delA								FAM189A1 (26846 upstream) : TJP1 (102586 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	31973887	31973887	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31973887delA	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		CTGACAGTCTAATTTCTATTG	0.433													4	2	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	32019622	32019623	+	Intron	INS	-	T	T	rs140300063	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32019622_32019623insT	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		ATCCACCCTCCTTTTTTTCCCC	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	36715296	36715296	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36715296delA								ATPBD4 (876892 upstream) : C15orf41 (156516 downstream)																							ttgtactgataaagctgtgtt	0.000													4	2	---	---	---	---	
GPR176	11245	broad.mit.edu	37	15	40159526	40159527	+	Intron	INS	-	A	A	rs145535518	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40159526_40159527insA	uc001zkj.1	-						GPR176_uc001zkk.1_Intron	NM_007223	NP_009154	Q14439	GP176_HUMAN	G protein-coupled receptor 176						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		TGGGACCACAGAAAAGGAAAAC	0.480													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	41679507	41679507	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41679507delA								NUSAP1 (6260 upstream) : NDUFAF1 (46 downstream)																							actccatctcaaaaaaaaaaa	0.114													6	3	---	---	---	---	
SPTBN5	51332	broad.mit.edu	37	15	42152116	42152116	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42152116delA	uc001zos.2	-							NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5						actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TGAGAAGGACAAAAGCCCCCA	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45238644	45238645	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45238644_45238645insA								TRIM69 (178619 upstream) : C15orf43 (10258 downstream)																							ccacatgagagaaaaaaaaact	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	47394902	47394902	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47394902delA								None (None upstream) : SEMA6D (81501 downstream)																							ATACATTTACATTTTTTCTCC	0.323													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	48142975	48142975	+	IGR	DEL	C	-	-	rs34703120		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48142975delC								SEMA6D (76556 upstream) : SLC24A5 (270194 downstream)																							agagaaagaactttttaggtg	0.000													2	6	---	---	---	---	
C15orf33	196951	broad.mit.edu	37	15	49688250	49688251	+	Intron	INS	-	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49688250_49688251insC	uc001zxl.2	-							NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951											ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)		cgacgcagaagatggtgatttc	0.005													4	2	---	---	---	---	
NEDD4	4734	broad.mit.edu	37	15	56277958	56277959	+	Intron	INS	-	AC	AC	rs142847474	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56277958_56277959insAC	uc002adl.2	-							NM_006154	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally						development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		agagtacacatacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56348071	56348072	+	IGR	INS	-	T	T	rs147514156	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56348071_56348072insT								NEDD4 (62236 upstream) : RFX7 (31407 downstream)																							tccagctaaCCGTCGAGCATGG	0.059													3	3	---	---	---	---	
ZNF280D	54816	broad.mit.edu	37	15	56928684	56928685	+	Intron	DEL	TT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56928684_56928685delTT	uc002adu.2	-						ZNF280D_uc002adv.2_Intron|ZNF280D_uc010bfq.2_Intron|ZNF280D_uc002adt.2_5'Flank|ZNF280D_uc010bfp.2_Intron	NM_017661	NP_060131	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		TTCCTTCCTAtttttttttttt	0.223													4	2	---	---	---	---	
MYO1E	4643	broad.mit.edu	37	15	59462845	59462845	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59462845delG	uc002aga.2	-							NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE						actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		GCTGCAAAATGGACACTGCGG	0.438													4	2	---	---	---	---	
ITGA11	22801	broad.mit.edu	37	15	68658037	68658043	+	Intron	DEL	TTTTCTT	-	-	rs10580840		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68658037_68658043delTTTTCTT	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	ttcttttctcttttctttttttttaat	0.280													5	4	---	---	---	---	
SENP8	123228	broad.mit.edu	37	15	72421710	72421710	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72421710delT	uc002atp.2	+							NM_145204	NP_660205	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8						proteolysis		cysteine-type peptidase activity|protein binding			ovary(1)|skin(1)	2						tctctacaaattttttttttt	0.000													4	2	---	---	---	---	
HCN4	10021	broad.mit.edu	37	15	73659094	73659094	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73659094delG	uc002avp.2	-							NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic						blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		TTGGGTCTCTGGGGTATGGAT	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	74101843	74101844	+	IGR	DEL	CA	-	-	rs34779562		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74101843_74101844delCA								C15orf59 (58027 upstream) : TBC1D21 (64124 downstream)																							cacacatatgcacacacacaca	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	76078719	76078720	+	5'Flank	INS	-	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76078719_76078720insC	uc002bbb.1	-						uc002bbc.1_5'Flank					DQ577530																		GCAGTGCCAAACACGCGGCACC	0.614													47	37	---	---	---	---	
ADAMTS7	11173	broad.mit.edu	37	15	79061201	79061202	+	Intron	INS	-	G	G	rs145725806	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79061201_79061202insG	uc002bej.3	-						ADAMTS7_uc010und.1_Intron	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						GAGGGGTGACCGGGGCTGGGGC	0.624													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80119451	80119452	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80119451_80119452insT								KIAA1024 (354809 upstream) : MTHFS (17868 downstream)																							acaaatcagtcttttttttctg	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80283156	80283156	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80283156delC								BCL2A1 (19513 upstream) : ZFAND6 (68865 downstream)																							GGTTTGGAGACCCCATGGCCT	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85266873	85266874	+	IGR	INS	-	T	T	rs56284713		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85266873_85266874insT								SEC11A (7199 upstream) : ZNF592 (24944 downstream)																							tttcttttttcttttttttttt	0.040													3	3	---	---	---	---	
AGBL1	123624	broad.mit.edu	37	15	87089452	87089453	+	Intron	INS	-	T	T	rs66611676		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87089452_87089453insT	uc002blz.1	+							NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						CATTTATTTAGTTTTTTTTTTT	0.356													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	87764129	87764130	+	IGR	INS	-	TGTGTGTGTGTG	TGTGTGTGTGTG	rs146149925	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87764129_87764130insTGTGTGTGTGTG								AGBL1 (191846 upstream) : NCRNA00052 (356030 downstream)																							tcttctatttctgtgtgtgtgt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	88979215	88979216	+	IGR	INS	-	AC	AC	rs148381848	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88979215_88979216insAC								NTRK3 (179554 upstream) : MRPL46 (23492 downstream)																							cacacacacatacacacacaca	0.252													4	2	---	---	---	---	
SV2B	9899	broad.mit.edu	37	15	91727196	91727197	+	Intron	INS	-	AA	AA	rs139524462	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91727196_91727197insAA	uc010uqv.1	+						SV2B_uc002bqt.2_Intron|SV2B_uc002bqu.3_Intron	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog						neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CGCCTGGGGACAAAAAAAACTG	0.381													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92888983	92888983	+	IGR	DEL	A	-	-	rs113075057		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92888983delA								SLCO3A1 (173318 upstream) : ST8SIA2 (48157 downstream)																							CCAGCCAAGCAAAAAAAAAAA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96167935	96167936	+	IGR	INS	-	A	A	rs142007849	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96167935_96167936insA								LOC145820 (116861 upstream) : NR2F2 (701221 downstream)																							ATCAGGCCTGGAAAATTGCCCA	0.396													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96417651	96417652	+	IGR	DEL	TT	-	-	rs66922935		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96417651_96417652delTT								LOC145820 (366577 upstream) : NR2F2 (451505 downstream)																							GGAGAAAGAATTTTTTTTTTTT	0.317													4	2	---	---	---	---	
MEF2A	4205	broad.mit.edu	37	15	100180765	100180766	+	Intron	DEL	TT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100180765_100180766delTT	uc010urw.1	+						MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Intron|MEF2A_uc002bve.2_Intron|MEF2A_uc002bvg.2_Intron|MEF2A_uc002bvi.2_Intron|MEF2A_uc010bot.2_Intron	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1						apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			ctttcttttctttttttttttt	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102296056	102296057	+	5'Flank	INS	-	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102296056_102296057insG	uc002bxr.2	-						uc010usk.1_5'Flank|uc002bxs.2_5'Flank|uc002bxu.1_5'Flank|uc002bxv.1_5'Flank|uc002bxw.1_5'Flank|uc002bxy.1_5'Flank|uc002byb.1_5'Flank|uc002byc.2_5'Flank|uc002byh.2_5'Flank|uc002byj.2_5'Flank|uc002byl.1_5'Flank|uc010usl.1_5'Flank|uc010usn.1_5'Flank|uc002byq.2_5'Flank|uc002bys.2_RNA|uc002byv.2_5'Flank|uc002byx.3_5'Flank|uc002bza.2_5'Flank|uc002bzb.2_5'Flank|uc002bzc.1_5'Flank|uc002bzd.2_5'Flank|uc002bze.2_5'Flank|uc002bzg.2_5'Flank|uc002bzi.1_5'Flank|uc002bzj.2_5'Flank|uc002bzl.2_5'Flank|uc002bzm.2_5'Flank|uc002bzo.2_5'Flank|uc002bzp.2_5'Flank|uc002bzq.2_5'Flank|uc002bzr.2_5'Flank|uc002bzt.2_5'Flank|uc010usp.1_5'Flank|uc002bzu.2_5'Flank|uc002bzv.3_5'Flank|uc010usq.1_5'Flank|uc010usr.1_5'Flank|uc010uss.1_5'Flank|uc002bzz.2_5'Flank|uc002cab.2_5'Flank|uc002cac.2_5'Flank|uc010ust.1_5'Flank|uc002cad.2_5'Flank|uc010usu.1_5'Flank|uc002cae.2_5'Flank					DQ598276																		AACCTGTACTCGCGTCGGAACC	0.599													3	3	---	---	---	---	
LMF1	64788	broad.mit.edu	37	16	988324	988339	+	Intron	DEL	GTGGCTCGCGGGGACA	-	-	rs72500504		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:988324_988339delGTGGCTCGCGGGGACA	uc002ckj.2	-						LMF1_uc010brh.2_Intron|LMF1_uc010bri.2_Intron|LMF1_uc002ckk.2_Intron|LMF1_uc010uuu.1_Intron|LMF1_uc010uuv.1_Intron	NM_022773	NP_073610	Q96S06	LMF1_HUMAN	lipase maturation factor 1							endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)				GGGCTGGATGGTGGCTCGCGGGGACAGCAGGGACGG	0.699													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1294284	1294284	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1294284delG								TPSAB1 (1730 upstream) : TPSD1 (11989 downstream)																							GTCCAATGGTGGGGGGGAACG	0.652													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1332313	1332314	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1332313_1332314insA								TPSD1 (23819 upstream) : UBE2I (26866 downstream)																							cgtctcaaaagaaaaaaaaaaG	0.287													4	2	---	---	---	---	
PMM2	5373	broad.mit.edu	37	16	8926634	8926635	+	Intron	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8926634_8926635delTG	uc002czf.3	+						PMM2_uc010uyf.1_Intron|PMM2_uc010uyg.1_Intron|PMM2_uc010uyh.1_Intron|PMM2_uc010buj.2_Intron|PMM2_uc010uyi.1_Intron	NM_000303	NP_000294	O15305	PMM2_HUMAN	phosphomannomutase 2						dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	phosphomannomutase activity			ovary(1)	1						TACCACAATCTGTGAGGCCCGC	0.604													2	6	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	9971728	9971729	+	Intron	INS	-	C	C	rs144962530	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9971728_9971729insC	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	tgcctccctctcccccaactct	0.139													0	8	---	---	---	---	
C16orf75	116028	broad.mit.edu	37	16	11428826	11428827	+	Intron	INS	-	A	A	rs74660902		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11428826_11428827insA	uc002daq.1	+									Q96E14	RMI2_HUMAN	Homo sapiens cDNA FLJ41770 fis, clone IMR322007225.						DNA replication	nucleus	DNA binding				0						tctcgaaaaataaaaaaaaaaa	0.000			T	CIITA	PMBL|Hodgkin Lymphona|								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	14365457	14365458	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14365457_14365458insA								MKL2 (4828 upstream) : MIR193B (32366 downstream)																							tcacacacacgaaaaaaagcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16698390	16698390	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16698390delC								LOC339047 (253953 upstream) : XYLT1 (497793 downstream)																							aacaatcacaccaactctctg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22678958	22678958	+	IGR	DEL	G	-	-	rs146639918		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22678958delG								LOC653786 (90772 upstream) : HS3ST2 (146902 downstream)																							gtactttttagggttatttct	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	23728760	23728763	+	IGR	DEL	AGAG	-	-	rs148138347		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23728760_23728763delAGAG								ERN2 (3939 upstream) : CHP2 (37185 downstream)																							GAAATCAGAAAGAGAGAGAGAGAA	0.348													1	5	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	25940709	25940710	+	Intron	INS	-	A	A	rs149549585	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25940709_25940710insA	uc002dof.2	+							NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		aaaacaagaagaaaaaaAAAAG	0.203													4	2	---	---	---	---	
BOLA2	552900	broad.mit.edu	37	16	29569440	29569441	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29569440_29569441insT	uc010bzb.1	-						LOC440354_uc002dsp.3_Intron|uc002dtf.2_Intron|LOC440354_uc010bza.1_Intron|LOC440354_uc002dtj.2_Intron|LOC440354_uc010vds.1_Intron			Q9H3K6	BOLA2_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0						CAACGTGTATCtttttttttct	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32480842	32480842	+	IGR	DEL	T	-	-	rs112323562		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32480842delT								HERC2P4 (316968 upstream) : TP53TG3B (203999 downstream)																							ttcccaccacttttttccaag	0.040													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33041000	33041001	+	IGR	DEL	AT	-	-	rs79665710		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33041000_33041001delAT								SLC6A10P (144537 upstream) : MIR1826 (924507 downstream)																							tgaaagaaacatagacttagag	0.084													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33371342	33371342	+	IGR	DEL	G	-	-	rs28624695		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33371342delG								SLC6A10P (474879 upstream) : MIR1826 (594166 downstream)																							acttgaacccggggggcagag	0.020													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33958440	33958441	+	IGR	INS	-	TG	TG			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33958440_33958441insTG								None (None upstream) : MIR1826 (7067 downstream)																							ccatctgtctctctgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33967927	33967927	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33967927delG								MIR1826 (2335 upstream) : UBE2MP1 (435875 downstream)																							GTAAAGAATAGGATCTTCGTT	0.259													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33997072	33997072	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33997072delA								MIR1826 (31480 upstream) : UBE2MP1 (406730 downstream)																							tggacacatcacaaagaactt	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34184292	34184293	+	IGR	INS	-	TA	TA			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34184292_34184293insTA								MIR1826 (218700 upstream) : UBE2MP1 (219509 downstream)																							tgattccattctattccattcc	0.030													4	2	---	---	---	---	
NKD1	85407	broad.mit.edu	37	16	50652638	50652638	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50652638delG	uc002egg.1	+							NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1						Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CATGCTGGGAGGGGCCCCTGG	0.617													4	2	---	---	---	---	
BBS2	583	broad.mit.edu	37	16	56532618	56532619	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56532618_56532619insA	uc002ejd.2	-						BBS2_uc010ccg.2_3'UTR	NM_031885	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2 protein						adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding			ovary(1)	1						GCTTTGTTGAGAAAAAAAAAAA	0.351									Bardet-Biedl_syndrome				4	2	---	---	---	---	
NFAT5	10725	broad.mit.edu	37	16	69602280	69602285	+	Intron	DEL	TATATA	-	-	rs62052822		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69602280_69602285delTATATA	uc002exm.1	+						NFAT5_uc002exh.1_Intron|NFAT5_uc002exi.2_Intron|NFAT5_uc002exj.1_Intron|NFAT5_uc002exk.1_Intron|NFAT5_uc002exl.1_Intron|NFAT5_uc002exn.1_Intron|MIR1538_hsa-mir-1538|MI0007259_5'Flank	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c						excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						tgtgtgtgtgtATATATATATATATA	0.146													1	5	---	---	---	---	
WDR59	79726	broad.mit.edu	37	16	74947333	74947335	+	Intron	DEL	TTG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74947333_74947335delTTG	uc002fdh.1	-						WDR59_uc002fdi.2_Intron|WDR59_uc002fdj.2_Intron|WDR59_uc002fdg.1_Intron	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59											ovary(1)|breast(1)	2						aatctttgttttgttgttgttgt	0.000													4	2	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76532271	76532272	+	Intron	DEL	AG	-	-	rs145551640		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76532271_76532272delAG	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						cctgggagacagagtgagaccc	0.119													2	5	---	---	---	---	
MAF	4094	broad.mit.edu	37	16	79632162	79632162	+	3'UTR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79632162delA	uc002ffn.2	-	1					MAF_uc002ffm.2_Intron	NM_001031804	NP_001026974	O75444	MAF_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene						transcription from RNA polymerase II promoter	chromatin|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		AAGTAAAATTAAAAAAAAAAA	0.358			T	IGH@	MM								4	2	---	---	---	---	
FAM38A	9780	broad.mit.edu	37	16	88800396	88800398	+	In_Frame_Del	DEL	CTG	-	-	rs62639697		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88800396_88800398delCTG	uc010vpb.1	-	17	2248_2250	c.2245_2247delCAG	c.(2245-2247)CAGdel	p.Q749del	FAM38A_uc002flr.3_In_Frame_Del_p.Q317del|FAM38A_uc010cib.2_In_Frame_Del_p.Q286del|uc010vpc.1_Intron	NM_001142864	NP_001136336	Q92508	PIEZ1_HUMAN	family with sequence similarity 38, member A	749						endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane	ion channel activity				0						cctcctcctcctgctgctgctgc	0.458													0	7	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	164228	164228	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:164228delC	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		AGTCCCTCTGCCCCCACCTCC	0.582													6	3	---	---	---	---	
PITPNA	5306	broad.mit.edu	37	17	1455207	1455208	+	Intron	INS	-	TA	TA			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1455207_1455208insTA	uc002fst.3	-						PITPNA_uc010cjt.2_Intron|PITPNA_uc010cju.2_Intron|PITPNA_uc010vqn.1_Intron	NM_006224	NP_006215	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha						axon guidance|lipid metabolic process|visual perception	cytoplasm	phosphatidylcholine transmembrane transporter activity|phosphatidylinositol transporter activity|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		TGGTGAGACTCCTCCCCGCTGG	0.658													4	2	---	---	---	---	
SMG6	23293	broad.mit.edu	37	17	2041447	2041447	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2041447delA	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						AGGAGGCAGGAAAAAAAAAAC	0.393													4	2	---	---	---	---	
PAFAH1B1	5048	broad.mit.edu	37	17	2514766	2514767	+	Intron	INS	-	A	A	rs113597989		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2514766_2514767insA	uc002fuw.3	+						PAFAH1B1_uc010ckb.1_Intron	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,						acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1						cgtctcggggcaaaaaaaaaaa	0.054													4	2	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2814554	2814555	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2814554_2814555insT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						TTTGAAGGGGATTTTTTTTTTT	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4557758	4557759	+	IGR	INS	-	G	G	rs72569834	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4557758_4557759insG								ALOX15 (12169 upstream) : PELP1 (16921 downstream)																							AGACAGAGTATTTAACATAAAG	0.376													4	2	---	---	---	---	
AIPL1	23746	broad.mit.edu	37	17	6328628	6328629	+	3'UTR	DEL	TT	-	-	rs34148596		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6328628_6328629delTT	uc002gcp.2	-	6					AIPL1_uc002gcq.2_3'UTR|AIPL1_uc002gcr.2_3'UTR|AIPL1_uc010clk.2_3'UTR|AIPL1_uc010cll.2_3'UTR	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting						protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		cttgggattgtttttttttttt	0.084													3	3	---	---	---	---	
MED31	51003	broad.mit.edu	37	17	6549394	6549394	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6549394delC	uc002gdg.3	-						MED31_uc002gdh.3_Intron	NM_016060	NP_057144	Q9Y3C7	MED31_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	protein binding				0						aaagaaaagaccactgagatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6559524	6559525	+	IGR	DEL	AG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6559524_6559525delAG								C17orf100 (2907 upstream) : SLC13A5 (28516 downstream)																							GGAGCCAGAAAGAGAGAAAATG	0.663													4	2	---	---	---	---	
ASGR2	433	broad.mit.edu	37	17	7017119	7017120	+	Intron	INS	-	CA	CA	rs141684817	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7017119_7017120insCA	uc002gep.3	-						ASGR2_uc002gem.1_Intron|ASGR2_uc002gen.1_Intron|ASGR2_uc002geo.1_Intron|ASGR2_uc002ger.3_Intron|ASGR2_uc002geq.3_Intron|ASGR2_uc010clw.2_Intron|ASGR2_uc010vtl.1_Intron	NM_001181	NP_001172	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2 isoform a						cell surface receptor linked signaling pathway|endocytosis	focal adhesion|integral to membrane|nucleolus	asialoglycoprotein receptor activity|protein binding|sugar binding			ovary(1)	1					Antihemophilic Factor(DB00025)	caacattcactcacacacacac	0.223													2	5	---	---	---	---	
NTN1	9423	broad.mit.edu	37	17	8994771	8994772	+	Intron	INS	-	TT	TT	rs150028835		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8994771_8994772insTT	uc002glw.3	+							NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor						apoptosis|axon guidance		protein binding				0						aaccccccgccttttttttttt	0.000													4	2	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	9932001	9932001	+	Intron	DEL	A	-	-	rs112239350		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9932001delA	uc002gmg.1	-						GAS7_uc002gmi.2_5'Flank|GAS7_uc002gmj.1_Intron|GAS7_uc010coh.1_Intron	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						agttggtttgaaaaaaaaaaa	0.000			T	MLL	AML*								5	3	---	---	---	---	
SHISA6	388336	broad.mit.edu	37	17	11235061	11235062	+	Intron	DEL	AC	-	-	rs68171794		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11235061_11235062delAC	uc002gna.3	+						SHISA6_uc002gnb.3_Intron|SHISA6_uc010com.2_Intron	NM_207386	NP_997269	Q6ZSJ9	SHSA6_HUMAN	shisa homolog 6							integral to membrane				breast(1)	1						GCTCTCTCAAACACACACACAC	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14535749	14535750	+	IGR	DEL	AC	-	-	rs72082695		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14535749_14535750delAC								HS3ST3B1 (286257 upstream) : PMP22 (597347 downstream)																							TGTGTCTTCTacacacacacac	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14684861	14684862	+	IGR	INS	-	A	A	rs112006552		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14684861_14684862insA								HS3ST3B1 (435369 upstream) : PMP22 (448235 downstream)																							CATTTTCACTTAAAAAAAAAAA	0.228													4	2	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15535474	15535474	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15535474delG	uc002gox.2	-						TRIM16_uc002gor.1_Intron|TRIM16_uc002gow.2_Intron|TRIM16_uc002goy.2_Intron	NM_006470	NP_006461	O95361	TRI16_HUMAN	tripartite motif-containing 16						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		aggctgaggtgggcagatcat	0.085													4	2	---	---	---	---	
C17orf76	388341	broad.mit.edu	37	17	16387681	16387682	+	Intron	INS	-	A	A	rs141622969	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16387681_16387682insA	uc010cph.1	-						C17orf76_uc002gqh.2_Intron	NM_001113567	NP_001107039	Q8NAA5	CQ076_HUMAN	hypothetical protein LOC388341 isoform 1												0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)		aaacaaaaaacaaaaaaaAATC	0.218													4	3	---	---	---	---	
ZNF287	57336	broad.mit.edu	37	17	16459480	16459481	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16459480_16459481delAC	uc002gqi.2	-							NM_020653	NP_065704	Q9HBT7	ZN287_HUMAN	zinc finger protein 287						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		acagacacagacacacacacac	0.312													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16491328	16491329	+	IGR	INS	-	T	T	rs79101964		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16491328_16491329insT								ZNF287 (18808 upstream) : ZNF624 (32719 downstream)																							tttcttttttcttttttttttt	0.376													5	3	---	---	---	---	
LOC162632	162632	broad.mit.edu	37	17	16700876	16700877	+	Intron	INS	-	T	T	rs139799467		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16700876_16700877insT	uc010cpj.1	+						LOC162632_uc010cpk.1_Intron|LOC162632_uc010vwq.1_Intron|LOC162632_uc002gqm.2_Intron					Homo sapiens mRNA for KIAA0565 protein, partial cds.												0						tgtgttttttattttttttttt	0.000													4	3	---	---	---	---	
NT5M	56953	broad.mit.edu	37	17	17233127	17233127	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17233127delT	uc002grf.2	+						NT5M_uc002gre.2_Intron|NT5M_uc002grg.2_Intron	NM_020201	NP_064586	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial precursor						DNA replication|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	5'-nucleotidase activity|metal ion binding|nucleotide binding				0						ccatctgtactaaaaaaaaat	0.000													4	2	---	---	---	---	
ULK2	9706	broad.mit.edu	37	17	19720307	19720308	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19720307_19720308insT	uc002gwm.3	-						ULK2_uc002gwn.2_Intron	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2						signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					AGACTAAGGAATTTTTTTTTTT	0.322													9	4	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21316859	21316860	+	Intron	INS	-	G	G	rs142216456		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21316859_21316860insG	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	AGCTCCTCCGTCGGGGCTAATG	0.653										Prostate(3;0.18)			7	4	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21322489	21322490	+	3'UTR	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21322489_21322490delGT	uc002gyv.1	+	3						NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CCCCTGGGGAGTGTGTGTGTGG	0.540										Prostate(3;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21335417	21335419	+	IGR	DEL	ACA	-	-	rs112205373		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21335417_21335419delACA								KCNJ12 (12238 upstream) : C17orf51 (96153 downstream)																							atggaatcacacaacatgtggcc	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21542115	21542116	+	IGR	INS	-	TT	TT	rs140996132		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21542115_21542116insTT								C17orf51 (64384 upstream) : FAM27L (283254 downstream)																							TAATGTGAATCTTTTTTTTTTA	0.262													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25311471	25311473	+	IGR	DEL	GGA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25311471_25311473delGGA								None (None upstream) : WSB1 (309633 downstream)																							TGGGGAGCAGGGAGGAGGAGGAG	0.502													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25482601	25482602	+	IGR	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25482601_25482602delCA								None (None upstream) : WSB1 (138504 downstream)																							cacacacagccacacacacaca	0.262													4	2	---	---	---	---	
LGALS9	3965	broad.mit.edu	37	17	25975496	25975503	+	Intron	DEL	ACATTTGT	-	-	rs72528663		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25975496_25975503delACATTTGT	uc002gzp.2	+						LGALS9_uc002gzq.2_Intron|LGALS9_uc002gzr.2_Intron|LGALS9_uc010waa.1_Intron|LGALS9_uc002gzs.2_Intron	NM_009587	NP_033665	O00182	LEG9_HUMAN	galectin-9 isoform long						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	galactose binding|signal transducer activity				0	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		GGAGgttttaacatttgtaccctgactg	0.120													3	3	---	---	---	---	
TRAF4	9618	broad.mit.edu	37	17	27072569	27072569	+	Intron	DEL	C	-	-	rs72099036		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27072569delC	uc002hcs.2	+						TRAF4_uc002hcq.1_Intron	NM_004295	NP_004286	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4						apoptosis|positive regulation of JNK cascade|positive regulation of protein homodimerization activity|positive regulation of protein kinase activity|regulation of apoptosis|signal transduction	cytoskeleton|nucleus|perinuclear region of cytoplasm|tight junction	DNA binding|ubiquitin-protein ligase activity|WW domain binding|zinc ion binding			upper_aerodigestive_tract(1)|lung(1)	2	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			accttcttggcccccctctct	0.348													2	4	---	---	---	---	
MYO1D	4642	broad.mit.edu	37	17	30931219	30931220	+	Intron	DEL	AC	-	-	rs149807715	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30931219_30931220delAC	uc002hho.1	-						MYO1D_uc002hhp.1_Intron	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			AAAAAAAAAAACATACTAATAA	0.302													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31626557	31626558	+	Intron	INS	-	T	T	rs142868646	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31626557_31626558insT	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	CCCTCACTCTGTTTTTTTTTGT	0.446													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32561027	32561028	+	IGR	DEL	CA	-	-	rs67060397		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32561027_32561028delCA								ACCN1 (77202 upstream) : CCL2 (21268 downstream)																							cacgcgcgcgcacacacacaca	0.376													5	3	---	---	---	---	
MYO19	80179	broad.mit.edu	37	17	34855702	34855703	+	Intron	INS	-	T	T	rs75751423		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34855702_34855703insT	uc010wcy.1	-						MYO19_uc002hmw.2_Intron|MYO19_uc010cuu.2_Intron	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2							mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		ATGttttgttgttttttttttt	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	37157724	37157724	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37157724delT								FBXO47 (34069 upstream) : PLXDC1 (61832 downstream)																							tctttcttccttttttttttt	0.124													4	2	---	---	---	---	
ARL5C	390790	broad.mit.edu	37	17	37320322	37320323	+	Intron	INS	-	TTG	TTG	rs146280050	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37320322_37320323insTTG	uc010wea.1	-						ARL5C_uc010cvs.1_RNA	NM_001143968	NP_001137440	A6NH57	ARL5C_HUMAN	ADP-ribosylation factor-like 5C						small GTPase mediated signal transduction	intracellular	GTP binding				0						tgctcagccCTttgttgttgtt	0.005													6	4	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39924814	39924814	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39924814delA	uc002hxq.2	-						JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Intron|JUP_uc002hxs.2_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		gcctcatctcaaaaaaaaaaa	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41489457	41489458	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41489457_41489458delAC								ARL4D (10954 upstream) : MIR2117 (32716 downstream)																							ATGCATGCGAacacacacacaa	0.470													4	2	---	---	---	---	
C17orf53	78995	broad.mit.edu	37	17	42229796	42229796	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42229796delA	uc002ifi.1	+						C17orf53_uc010czq.1_Intron|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_Intron	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AAGCAATCAGaaaaaaaaaaa	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42860733	42860734	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42860733_42860734insA								ADAM11 (1521 upstream) : GJC1 (15083 downstream)																							tctgtctcaagaaaaaaaaaaa	0.267													4	2	---	---	---	---	
EFTUD2	9343	broad.mit.edu	37	17	42929595	42929595	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42929595delT	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				CTATTATTTCTTTTTTTTTTT	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43188742	43188743	+	IGR	DEL	GT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43188742_43188743delGT								NMT1 (2362 upstream) : PLCD3 (266 downstream)																							gtatgtgtgagtgtgtgtgtgt	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46731506	46731515	+	IGR	DEL	GACTACAGGC	-	-	rs112725599		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46731506_46731515delGACTACAGGC								MIR196A1 (21585 upstream) : PRAC (67577 downstream)																							gagtagctaggactacaggcgagtcttgtg	0.000													4	2	---	---	---	---	
ANKRD40	91369	broad.mit.edu	37	17	48782781	48782782	+	Intron	INS	-	A	A	rs11459587		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48782781_48782782insA	uc002iso.2	-							NM_052855	NP_443087	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40												0			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			CAAAGACCTGTAAAAAAAAAAA	0.401													2	4	---	---	---	---	
MBTD1	54799	broad.mit.edu	37	17	49303147	49303147	+	Intron	DEL	T	-	-	rs71355739		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49303147delT	uc002itr.3	-						MBTD1_uc002itq.3_Intron	NM_017643	NP_060113	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			ttcctagcacttttttttttt	0.000													4	2	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	49800939	49800944	+	Intron	DEL	CAAGGA	-	-	rs72370088		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49800939_49800944delCAAGGA	uc002itw.3	-						CA10_uc002itu.3_Intron|CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			TGTATAATATCAAGGAATGACATACA	0.403													4	3	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	49809385	49809387	+	Intron	DEL	ATT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49809385_49809387delATT	uc002itw.3	-						CA10_uc002itu.3_Intron|CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			ggttgacatcattattattatta	0.034													4	2	---	---	---	---	
TOM1L1	10040	broad.mit.edu	37	17	53036978	53036978	+	Intron	DEL	T	-	-	rs67895226		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53036978delT	uc002iud.2	+						TOM1L1_uc010dca.1_Intron|TOM1L1_uc010wnb.1_Intron|TOM1L1_uc010wnc.1_Intron|TOM1L1_uc010dbz.2_Intron|TOM1L1_uc010wnd.1_Intron|COX11_uc010wne.1_Intron|COX11_uc010wnf.1_Intron|COX11_uc002iue.2_Intron	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1						intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						GGAAGATTAAttttttttttt	0.159													2	4	---	---	---	---	
PCTP	58488	broad.mit.edu	37	17	53854433	53854433	+	3'UTR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53854433delT	uc002iul.3	+	6					PCTP_uc002ium.3_3'UTR|PCTP_uc010dcg.2_3'UTR|PCTP_uc010dch.2_RNA	NM_021213	NP_067036	Q9UKL6	PPCT_HUMAN	phosphatidylcholine transfer protein isoform 1							cytosol	phosphatidylcholine binding|phosphatidylcholine transmembrane transporter activity			lung(1)	1			BRCA - Breast invasive adenocarcinoma(1;0.00207)			ACTCTGCACCTTTTTCTCAGG	0.368													4	2	---	---	---	---	
PPM1E	22843	broad.mit.edu	37	17	56972840	56972840	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56972840delA	uc002iwx.2	+						PPM1E_uc010ddd.2_Intron	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E						protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			aaagttcttgaaaaaaattac	0.000													4	2	---	---	---	---	
APPBP2	10513	broad.mit.edu	37	17	58588943	58588944	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58588943_58588944insA	uc002iys.1	-						APPBP2_uc010ddl.1_Intron	NM_006380	NP_006371	Q92624	APBP2_HUMAN	amyloid beta precursor protein-binding protein						intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			agactccattgaaaaaaaaaaa	0.119													3	3	---	---	---	---	
TBX4	9496	broad.mit.edu	37	17	59561080	59561081	+	3'UTR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59561080_59561081insA	uc002izi.2	+	8					TBX4_uc010ddo.2_3'UTR|TBX4_uc010woy.1_3'UTR	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4						leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						TCATGACAAGGAAAAAAAACAC	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	61547221	61547222	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61547221_61547222insT								CYB561 (23499 upstream) : ACE (7212 downstream)																							tctgttttttgttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62661734	62661735	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62661734_62661735insT								SMURF2 (3348 upstream) : LOC146880 (84046 downstream)																							CAGAACCAttcttttttttttt	0.158													4	2	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64762496	64762497	+	Intron	INS	-	A	A	rs151081939	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64762496_64762497insA	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	GATGGCTTTCCAATTCGGACAT	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	64947416	64947417	+	IGR	DEL	TT	-	-	rs34536781		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64947416_64947417delTT								CACNG5 (66060 upstream) : CACNG4 (13596 downstream)																							cactgctgtatttttttttttt	0.059													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68135661	68135661	+	IGR	DEL	A	-	-	rs11308231		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68135661delA								KCNJ16 (3917 upstream) : KCNJ2 (29153 downstream)																							AAACAAAGGTAAAAAAAAAGA	0.214													3	4	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70916477	70916478	+	Intron	INS	-	C	C	rs146998034	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70916477_70916478insC	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						ccattttatttcccccttcctc	0.000													2	6	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70923947	70923948	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70923947_70923948delAC	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						GGAAATGTATacacacacacac	0.297													4	2	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71642106	71642106	+	5'Flank	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71642106delG	uc010dfm.2	-							NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						CCCGGGCACTGGGAAAATTTC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71702725	71702726	+	IGR	INS	-	CA	CA	rs139114929	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71702725_71702726insCA								SDK2 (62498 upstream) : C17orf54 (42683 downstream)																							ACACAGGCGTGCACACACACAC	0.470													4	2	---	---	---	---	
UBE2O	63893	broad.mit.edu	37	17	74405056	74405057	+	Intron	INS	-	T	T	rs79488198		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74405056_74405057insT	uc002jrm.3	-						UBE2O_uc002jrn.3_Intron	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O								ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						TCTAACAtttcttttttttttt	0.223													4	2	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77240778	77240779	+	Intron	INS	-	CCTTCCCTTCTC	CCTTCCCTTCTC	rs140890605	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77240778_77240779insCCTTCCCTTCTC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			CCCTCCTAGAGccttcccttcc	0.257													3	4	---	---	---	---	
CCDC137	339230	broad.mit.edu	37	17	79636220	79636220	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79636220delT	uc002kbc.3	+						C17orf90_uc002kba.2_5'Flank|C17orf90_uc002kbb.2_5'Flank|CCDC137_uc002kbd.2_Intron	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137											central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			gtgcctggccttttttttttt	0.015													6	3	---	---	---	---	
CD7	924	broad.mit.edu	37	17	80273830	80273831	+	Intron	INS	-	GCACACGC	GCACACGC	rs111506197		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80273830_80273831insGCACACGC	uc002kel.1	-						CD7_uc010din.2_3'UTR|CD7_uc002kem.2_3'UTR	NM_006137	NP_006128	P09564	CD7_HUMAN	CD7 antigen precursor						immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity				0	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			CACTCACACCTgcacacgcgca	0.624													6	4	---	---	---	---	
FN3K	64122	broad.mit.edu	37	17	80706379	80706381	+	Intron	DEL	TTT	-	-	rs35166088		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80706379_80706381delTTT	uc010wvs.1	+						FN3K_uc002kfw.1_Intron	NM_022158	NP_071441	Q9H479	FN3K_HUMAN	fructosamine 3 kinase						fructoselysine metabolic process		fructosamine-3-kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			cctttcaagcttttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	1160738	1160739	+	IGR	INS	-	GA	GA	rs144262316	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1160738_1160739insGA								ADCYAP1 (248567 upstream) : C18orf2 (93651 downstream)																							agagagagagtgagagagagaa	0.000													4	2	---	---	---	---	
SEH1L	81929	broad.mit.edu	37	18	12979076	12979076	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12979076delT	uc002krr.2	+						SEH1L_uc002krq.2_Intron	NM_031216	NP_112493	Q96EE3	SEH1_HUMAN	sec13-like protein isoform 2						attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|carbohydrate metabolic process|cell division|glucose transport|mitotic metaphase plate congression|mitotic prometaphase|mRNA transport|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex					0						Tttttctttcttttttttttt	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15383163	15383163	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15383163delG								LOC644669 (57245 upstream) : None (None downstream)																							ggccaatggtggtaaaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15404499	15404502	+	IGR	DEL	CTCT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15404499_15404502delCTCT								LOC644669 (78581 upstream) : None (None downstream)																							agttttgagactctctttttgtag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	19931140	19931141	+	IGR	DEL	GT	-	-	rs35511725		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19931140_19931141delGT								GATA6 (148913 upstream) : CTAGE1 (62423 downstream)																							gcgtgcgtgcgtgtgtgtgtgt	0.332													5	6	---	---	---	---	
ZNF521	25925	broad.mit.edu	37	18	22864875	22864876	+	Intron	DEL	CA	-	-	rs34702394	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22864875_22864876delCA	uc002kvk.2	-						ZNF521_uc010xbe.1_Intron|ZNF521_uc010dly.2_Intron|ZNF521_uc002kvl.2_Intron	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGCGCGCGCGcacacacacaca	0.376			T	PAX5	ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	23449655	23449666	+	IGR	DEL	ACACACACACAC	-	-	rs71999928		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23449655_23449666delACACACACACAC								ZNF521 (517441 upstream) : SS18 (146553 downstream)																							GACCCTCCTAacacacacacacacacacacac	0.175													3	3	---	---	---	---	
KCTD1	284252	broad.mit.edu	37	18	24173511	24173512	+	Intron	INS	-	ACA	ACA			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24173511_24173512insACA	uc010xbk.1	-							NM_198991	NP_945342	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			ggaggaagaagacgaggaggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	25389191	25389192	+	IGR	DEL	CT	-	-	rs72511116		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25389191_25389192delCT								C18orf16 (618541 upstream) : CDH2 (141738 downstream)																							cactttctcactctctctctct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	26046103	26046103	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26046103delT								CDH2 (288658 upstream) : None (None downstream)																							TAGAAGTCtgtaatggttagt	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	38337978	38337978	+	IGR	DEL	G	-	-	rs111793011		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38337978delG								LOC647946 (957696 upstream) : KC6 (722260 downstream)																							tggaagatcagttttttcctg	0.000													4	3	---	---	---	---	
KATNAL2	83473	broad.mit.edu	37	18	44563954	44563954	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44563954delT	uc002lco.2	+						KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Intron|TCEB3B_uc002lcr.1_5'Flank	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						TTGAATGGCCTGGGCAGAAAG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45547214	45547215	+	IGR	DEL	AC	-	-	rs55854000		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45547214_45547215delAC								SMAD2 (89699 upstream) : ZBTB7C (6533 downstream)																							ctcccctcctaccctccctcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	46426684	46426684	+	IGR	DEL	A	-	-	rs74625951		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46426684delA								KIAA0427 (37106 upstream) : SMAD7 (19540 downstream)																							ttttaaaGtcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
MBD2	8932	broad.mit.edu	37	18	51700029	51700029	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51700029delA	uc002lfg.1	-							NM_003927	NP_003918	Q9UBB5	MBD2_HUMAN	methyl-CpG binding domain protein 2 isoform 1						transcription, DNA-dependent		C2H2 zinc finger domain binding|methyl-CpG binding|satellite DNA binding				0				Colorectal(16;0.0212)|READ - Rectum adenocarcinoma(32;0.188)	Hexobarbital(DB01355)	ACTCCTCATTAAAATAATGCA	0.383													4	2	---	---	---	---	
BCL2	596	broad.mit.edu	37	18	60885993	60885994	+	Intron	INS	-	CAT	CAT	rs111996677		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60885993_60885994insCAT	uc002lit.1	-						BCL2_uc002liu.1_Intron	NM_000633	NP_000624	P10415	BCL2_HUMAN	B-cell lymphoma protein 2 alpha isoform						activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)	ccactcatccccctctactcat	0.079			T	IGH@	NHL|CLL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	62932155	62932155	+	IGR	DEL	T	-	-	rs74171758		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62932155delT								None (None upstream) : CDH7 (485333 downstream)																							ccaatgaatcttttttttttt	0.000													3	3	---	---	---	---	
CNDP1	84735	broad.mit.edu	37	18	72246449	72246450	+	Intron	INS	-	CTTG	CTTG	rs142853251		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72246449_72246450insCTTG	uc002llq.2	+						CNDP1_uc002lls.2_Intron	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor						proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		ccttcccttacccttcccttcc	0.000													4	4	---	---	---	---	
PTBP1	5725	broad.mit.edu	37	19	808772	808788	+	Intron	DEL	GGGCCGGGGGGCTCATG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:808772_808788delGGGCCGGGGGGCTCATG	uc002lpr.2	+						PTBP1_uc002lpp.2_Intron|PTBP1_uc002lpq.2_Intron|PTBP1_uc002lps.2_Intron|PTBP1_uc002lpt.2_Intron|PTBP1_uc002lpu.1_Intron	NM_031991	NP_114368	P26599	PTBP1_HUMAN	polypyrimidine tract-binding protein 1 isoform						negative regulation of muscle cell differentiation|nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	mRNA binding|nucleotide binding|poly-pyrimidine tract binding|protein binding			kidney(1)|skin(1)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGAGTGCTGGGCCGGGGGGCTCATGGGGCCGGGGG	0.645													5	6	---	---	---	---	
HMHA1	23526	broad.mit.edu	37	19	1079503	1079503	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1079503delA	uc002lqz.1	+						HMHA1_uc010xgd.1_Intron|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Intron|HMHA1_uc002lrb.1_Intron|HMHA1_uc002lrc.1_Intron	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SBNO2	22904	broad.mit.edu	37	19	1164524	1164526	+	Intron	DEL	AGG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1164524_1164526delAGG	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gaggaggaacaggaggaggagga	0.158													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	1340150	1340150	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1340150delG								EFNA2 (40206 upstream) : MUM1 (14826 downstream)																							AGGTCACCCTGGATTCTAATC	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	2018962	2018963	+	IGR	DEL	CA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2018962_2018963delCA								BTBD2 (3260 upstream) : MKNK2 (18507 downstream)																							cacacacaggcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3319245	3319246	+	IGR	INS	-	AC	AC	rs72227785		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3319245_3319246insAC								CELF5 (22174 upstream) : NFIC (40370 downstream)																							caaacagacaaacacacacaca	0.005													3	3	---	---	---	---	
EBI3	10148	broad.mit.edu	37	19	4227950	4227953	+	5'Flank	DEL	TCTG	-	-	rs147517935		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4227950_4227953delTCTG	uc002lzu.2	+							NM_005755	NP_005746	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3 precursor						humoral immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of interferon-gamma biosynthetic process|T-helper 1 type immune response	extracellular space|plasma membrane	cytokine activity|cytokine receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)		tctctcttcctctgtctgtctgct	0.000													2	5	---	---	---	---	
DPP9	91039	broad.mit.edu	37	19	4685932	4685933	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4685932_4685933insT	uc002mba.2	-							NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9						proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		TGAAAAAAACGTTTTTTTTTCA	0.282													4	2	---	---	---	---	
CD70	970	broad.mit.edu	37	19	6585359	6585359	+	Intron	DEL	T	-	-	rs71960153		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6585359delT	uc010xjf.1	-							NM_001252	NP_001243	P32970	CD70_HUMAN	tumor necrosis factor ligand superfamily, member						cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to membrane of membrane fraction|integral to plasma membrane	cytokine activity|protease binding|tumor necrosis factor receptor binding				0						AAAACAGAACttttttttttt	0.184													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8330869	8330870	+	IGR	INS	-	AC	AC			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8330869_8330870insAC								LASS4 (3567 upstream) : CD320 (36141 downstream)																							cagcctgcgcaacagagagacc	0.000													3	3	---	---	---	---	
C19orf43	79002	broad.mit.edu	37	19	12843411	12843411	+	Intron	DEL	T	-	-	rs77618103		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12843411delT	uc002muu.2	-							NM_024038	NP_076943	Q9BQ61	CS043_HUMAN	hypothetical protein MGC2803												0						ACTATTTCCAttttttttttt	0.269													3	3	---	---	---	---	
CYP4F22	126410	broad.mit.edu	37	19	15658780	15658781	+	Intron	DEL	GA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15658780_15658781delGA	uc002nbh.3	+							NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						AGCTGCCCCTgagagagagaga	0.292													5	8	---	---	---	---	
NWD1	284434	broad.mit.edu	37	19	16914738	16914739	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16914738_16914739insA	uc002neu.3	+						NWD1_uc002net.3_Intron|NWD1_uc002nev.3_Intron			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;								ATP binding			skin(3)|ovary(2)|pancreas(2)	7						tccaccacccgaaaaaaaaaag	0.158													4	3	---	---	---	---	
CPAMD8	27151	broad.mit.edu	37	19	17101063	17101063	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17101063delA	uc002nfb.2	-							NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain							extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						actctgactcaaaaaaaaaag	0.080													4	2	---	---	---	---	
IL12RB1	3594	broad.mit.edu	37	19	18182219	18182220	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18182219_18182220insT	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron|IL12RB1_uc002nhy.2_Intron	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						TTCTttctctcttttttctttt	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	19944580	19944580	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19944580delT								ZNF506 (12020 upstream) : ZNF253 (32134 downstream)																							ATGTTTAATCttttttttttt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23079445	23079446	+	IGR	INS	-	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23079445_23079446insG								ZNF99 (126661 upstream) : ZNF91 (441973 downstream)																							ccttccttccttcctccctccc	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27876097	27876097	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27876097delC								None (None upstream) : LOC148189 (405305 downstream)																							catataaaaactagacagaag	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29821827	29821827	+	Intron	DEL	T	-	-	rs71714486		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29821827delT	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																		GCTTCTGGTGTTTTTTTTTTC	0.284													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30003060	30003062	+	Intron	DEL	GGG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30003060_30003062delGGG	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																		agaagagggagggtgaggaggaa	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30371238	30371238	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30371238delA								CCNE1 (56020 upstream) : C19orf2 (43313 downstream)																							actctgtctcaaaaaaaaaaT	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30819856	30819856	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30819856delT								C19orf2 (313245 upstream) : ZNF536 (43472 downstream)																							AACAATAGAATTTTGCGGCAT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32823441	32823441	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32823441delA								TSHZ3 (983251 upstream) : ZNF507 (13073 downstream)																							CTGTGAAAGCAGGGATTCTCT	0.358													4	2	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33620855	33620856	+	Intron	INS	-	A	A	rs140157903		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33620855_33620856insA	uc002nug.1	+						GPATCH1_uc002nuh.1_Intron|WDR88_uc002nui.2_5'Flank	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					catctcgggggaaaaaaaaaaa	0.213													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34040644	34040644	+	IGR	DEL	T	-	-	rs149727292		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34040644delT								PEPD (27843 upstream) : CHST8 (72217 downstream)																							CGGTAGGAtcttttttttttt	0.308													4	2	---	---	---	---	
KCTD15	79047	broad.mit.edu	37	19	34301714	34301715	+	Intron	INS	-	T	T	rs147666737	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34301714_34301715insT	uc002nuy.3	+						KCTD15_uc002nuv.2_Intron|KCTD15_uc002nuw.3_Intron|KCTD15_uc010xrt.1_Intron|KCTD15_uc002nux.3_Intron	NM_001129994	NP_001123466	Q96SI1	KCD15_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	Esophageal squamous(110;0.162)					TGGAGAAGAACTTTTTTTGCTT	0.545													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34471185	34471185	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34471185delA								KCTD15 (164520 upstream) : LSM14A (192167 downstream)																							accttgtctcaaaaaaaaaaa	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34506106	34506107	+	IGR	INS	-	GT	GT	rs56156434		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34506106_34506107insGT								KCTD15 (199441 upstream) : LSM14A (157245 downstream)																							agaaaatgcgggtgtgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34565430	34565433	+	IGR	DEL	TATT	-	-	rs522503		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34565430_34565433delTATT								KCTD15 (258765 upstream) : LSM14A (97919 downstream)																							tgtatgtatgtatttatgtatgta	0.025													4	2	---	---	---	---	
MAG	4099	broad.mit.edu	37	19	35784178	35784179	+	Intron	INS	-	TG	TG	rs140556593	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35784178_35784179insTG	uc002nyy.1	+						MAG_uc002nyx.1_Intron|MAG_uc010eds.1_Intron|MAG_uc002nyz.1_Intron	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GCATGCTGGGCtgtgtgtgtgt	0.500													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37291734	37291734	+	Intron	DEL	T	-	-	rs111933297		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37291734delT	uc002oeu.1	+						uc002oev.1_Intron					Homo sapiens cDNA FLJ37005 fis, clone BRACE2009122.																		CTAATAtttcttttttttttt	0.040													3	3	---	---	---	---	
DPF1	8193	broad.mit.edu	37	19	38716214	38716215	+	5'Flank	INS	-	CAAA	CAAA	rs145561509	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38716214_38716215insCAAA	uc002ohl.2	-						DPF1_uc002ohm.2_5'Flank|DPF1_uc002ohn.2_Intron|DPF1_uc010xtu.1_Intron|DPF1_uc010xtv.1_Intron|DPF1_uc010xtw.1_Intron	NM_004647	NP_004638	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1 isoform						induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding				0	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			gtctctaaaagcaaacaaacaa	0.005													4	2	---	---	---	---	
SELV	348303	broad.mit.edu	37	19	40008927	40008935	+	Intron	DEL	AAAAAAACA	-	-	rs56385355		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40008927_40008935delAAAAAAACA	uc010xvc.1	+							NM_182704	NP_874363	P59797	SELV_HUMAN	selenoprotein V						cell redox homeostasis		selenium binding				0	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			acaaaaaaacaaaaaaacaaaaaaaaaag	0.000													5	3	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40778692	40778693	+	Intron	INS	-	AC	AC	rs138144953	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40778692_40778693insAC	uc002onf.2	-						AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			ACGCCACACTAAGAGGCAGGAG	0.327			A		ovarian|pancreatic 								6	4	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41041398	41041398	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41041398delT	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron|SPTBN4_uc010egy.1_Intron|SPTBN4_uc002ooa.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			tccagtgcccttgactcttca	0.139													4	2	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41061823	41061824	+	Intron	INS	-	A	A	rs148222208	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41061823_41061824insA	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron|SPTBN4_uc002ooa.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			accctgtctccaaaaaaaaaga	0.213													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42176397	42176398	+	IGR	DEL	AA	-	-	rs78262980		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42176397_42176398delAA								CEACAM4 (42955 upstream) : CEACAM7 (837 downstream)																							tctcaaaaagaaaaaaaaaaaa	0.153													4	2	---	---	---	---	
KCNC3	3748	broad.mit.edu	37	19	50819707	50819708	+	Intron	DEL	GA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50819707_50819708delGA	uc002pru.1	-						KCNC3_uc002prt.1_Intron	NM_004977	NP_004968	Q14003	KCNC3_HUMAN	Shaw-related voltage-gated potassium channel						cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)		GACAATTAGGGAGGGAAGAAgc	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50997152	50997152	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50997152delA								C19orf63 (10545 upstream) : JOSD2 (12107 downstream)																							CCCGCAGAGCAAAAGCAGAAG	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50997653	50997654	+	IGR	INS	-	GAG	GAG	rs57239148		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50997653_50997654insGAG								C19orf63 (11046 upstream) : JOSD2 (11605 downstream)																							gaggaggaagagaggaggagga	0.109													3	5	---	---	---	---	
ZNF610	162963	broad.mit.edu	37	19	52840526	52840526	+	Intron	DEL	A	-	-	rs113679599		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52840526delA	uc002pyx.3	+						uc002pyw.1_Intron|ZNF610_uc002pyy.3_Intron|ZNF610_uc002pyz.3_Intron	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		CAAGGAGAGCAGAGGGAGAAC	0.592													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55409455	55409456	+	IGR	INS	-	CTGT	CTGT	rs147476530	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55409455_55409456insCTGT								FCAR (7617 upstream) : NCR1 (8052 downstream)																							agttacctagactgtgatggtc	0.000													4	2	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56815708	56815708	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56815708delC	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						ggttctgaaacgggggtgacg	0.209													4	2	---	---	---	---	
NRSN2	80023	broad.mit.edu	37	20	340045	340047	+	3'UTR	DEL	CAC	-	-	rs142345508		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:340045_340047delCAC	uc002wdl.2	+	3						NM_024958	NP_079234	Q9GZP1	NRSN2_HUMAN	neurensin 2							integral to membrane|plasma membrane|transport vesicle					0		all_cancers(10;0.0834)				tgaaggctggcaccaccagtcaa	0.000													4	2	---	---	---	---	
SNPH	9751	broad.mit.edu	37	20	1258704	1258705	+	Intron	INS	-	TGTT	TGTT	rs4813075		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1258704_1258705insTGTT	uc002wes.2	+						SNPH_uc002wet.2_Intron	NM_014723	NP_055538	O15079	SNPH_HUMAN	syntaphilin						synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2						gtgtgtgtgtctgtgtgtgtat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	1994425	1994425	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1994425delA								PDYN (19722 upstream) : STK35 (88103 downstream)																							gatttggaccaaaaaaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2625968	2625970	+	IGR	DEL	GAG	-	-	rs72005009		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2625968_2625970delGAG								TMC2 (3538 upstream) : NOP56 (7284 downstream)																							tgagtaggctgaggaggaggagg	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3076261	3076262	+	IGR	DEL	TC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3076261_3076262delTC								AVP (10891 upstream) : UBOX5 (11958 downstream)																							tttttttttttcttttgagaca	0.248													4	2	---	---	---	---	
CRLS1	54675	broad.mit.edu	37	20	6019521	6019521	+	3'UTR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6019521delA	uc002wmn.3	+	7					CRLS1_uc010gbq.2_RNA|CRLS1_uc010gbr.2_3'UTR	NM_019095	NP_061968	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1 isoform 1						phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphotransferase activity, for other substituted phosphate groups				0						TCTGGTTAATAAACGTTTCCC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6723995	6723996	+	IGR	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6723995_6723996delAC								FERMT1 (619804 upstream) : BMP2 (24749 downstream)																							acatacaaaaacacacacacac	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10046179	10046188	+	Intron	DEL	AGAAAGAAAG	-	-	rs147616870		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10046179_10046188delAGAAAGAAAG	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																		aaaaaaagaaagaaagaaagagaaagaaag	0.057													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10194561	10194561	+	Intron	DEL	C	-	-	rs33925489		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10194561delC	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																		GTCCTTTGGACCATGACCAAG	0.473													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11739384	11739384	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11739384delT								None (None upstream) : BTBD3 (132093 downstream)																							actggcaggattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12747692	12747694	+	IGR	DEL	AAC	-	-	rs74181365		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12747692_12747694delAAC								BTBD3 (840450 upstream) : SPTLC3 (241933 downstream)																							ttccatctAAaacaacaacaaca	0.025													2	4	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15676434	15676435	+	Intron	INS	-	TT	TT	rs150278369	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15676434_15676435insTT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				attcctgcgtatttttttttca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	18203619	18203620	+	IGR	INS	-	T	T	rs67795473	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18203619_18203620insT								CSRP2BP (34604 upstream) : ZNF133 (65501 downstream)																							agttataaaagtaagagctaac	0.069													4	3	---	---	---	---	
HSPC072	29075	broad.mit.edu	37	20	18775373	18775374	+	5'Flank	INS	-	G	G	rs144598150	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18775373_18775374insG	uc002wrg.2	-						HSPC072_uc002wri.3_5'Flank|HSPC072_uc002wrh.3_5'Flank|LOC100270804_uc010zsc.1_RNA	NR_026884				Homo sapiens HSPC072 mRNA, complete cds.												0						AAGACACGTGTGGGGAAAAAGG	0.480													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	20913800	20913800	+	IGR	DEL	T	-	-	rs35649383		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20913800delT								RALGAPA2 (220534 upstream) : PLK1S1 (192824 downstream)																							CTCATGTTTCTTTTTTTTTTT	0.348													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	21779143	21779144	+	IGR	INS	-	TG	TG	rs148316878	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21779143_21779144insTG								PAX1 (82523 upstream) : LOC284788 (601827 downstream)																							gtgtgtgtgcctgtgtgtgtgt	0.193													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23327362	23327363	+	IGR	INS	-	CT	CT	rs72533798		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23327362_23327363insCT								CD93 (260385 upstream) : NXT1 (4010 downstream)																							cagaatcccccgcttcctttgg	0.188													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23949845	23949848	+	IGR	DEL	TTTG	-	-	rs77035301		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23949845_23949848delTTTG								CST5 (89465 upstream) : GGTLC1 (15843 downstream)																							aagatataactttgtttgatttga	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26075417	26075418	+	IGR	INS	-	TCC	TCC	rs147363891		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26075417_26075418insTCC								FAM182A (7865 upstream) : C20orf191 (8635 downstream)																							tctcaccatcatcatcctcagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26082949	26082950	+	IGR	DEL	AT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26082949_26082950delAT								FAM182A (15397 upstream) : C20orf191 (1103 downstream)																							taaacaaaacatagtatactca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29602221	29602222	+	IGR	INS	-	G	G			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29602221_29602222insG								None (None upstream) : FRG1B (9657 downstream)																							aaacattcaattgggaaagaca	0.000													6	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29636111	29636112	+	Intron	INS	-	TGTTA	TGTTA	rs140827717		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29636111_29636112insTGTTA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						acacaactgattattttaattt	0.040													4	2	---	---	---	---	
COMMD7	149951	broad.mit.edu	37	20	31318365	31318366	+	Intron	INS	-	AAC	AAC	rs139776527	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31318365_31318366insAAC	uc002wya.3	-						COMMD7_uc010ged.2_Intron|COMMD7_uc002wyb.2_Intron	NM_053041	NP_444269	Q86VX2	COMD7_HUMAN	COMM domain containing 7 isoform 1						negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|tumor necrosis factor-mediated signaling pathway		NF-kappaB binding			breast(1)	1						ccgtttcaaaaaacaacaacaa	0.030													4	2	---	---	---	---	
C20orf186	149954	broad.mit.edu	37	20	31681641	31681644	+	Intron	DEL	CATC	-	-	rs148116551		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31681641_31681644delCATC	uc010zue.1	+							NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor							cytoplasm|extracellular region	lipid binding				0						cttcacaattcatccatccatcca	0.005													4	2	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32337107	32337107	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32337107delT	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CTATTTTGACttttttttttg	0.254													4	2	---	---	---	---	
EPB41L1	2036	broad.mit.edu	37	20	34756459	34756459	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34756459delT	uc002xfb.2	+						EPB41L1_uc002xeu.2_Intron|EPB41L1_uc010zvo.1_Intron|EPB41L1_uc002xev.2_Intron|EPB41L1_uc002xew.2_Intron|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Intron	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					tgttaagtgcttttttttttt	0.189													3	3	---	---	---	---	
VSTM2L	128434	broad.mit.edu	37	20	36571931	36571932	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36571931_36571932insT	uc002xhk.3	+							NM_080607	NP_542174	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like											ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				GTGTTCTGCCCTAGGGTCTACC	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38945589	38945590	+	IGR	DEL	TG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38945589_38945590delTG								None (None upstream) : MAFB (368929 downstream)																							TCTCTCTGTCTGTGTGTGTGTG	0.243													4	2	---	---	---	---	
RIMS4	140730	broad.mit.edu	37	20	43408689	43408690	+	Intron	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43408689_43408690insA	uc002xms.2	-						RIMS4_uc010ggu.2_Intron	NM_182970	NP_892015	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis|neurotransmitter transport	cell junction|synapse				ovary(4)|central_nervous_system(1)	5		Myeloproliferative disorder(115;0.0122)				GGAAGGAGGGGAAAAGGCCTGT	0.396													4	2	---	---	---	---	
WFDC9	259240	broad.mit.edu	37	20	44252661	44252661	+	Intron	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44252661delT	uc002xoy.2	-							NM_147198	NP_671731	Q8NEX5	WFDC9_HUMAN	protease inhibitor WAP9 precursor							extracellular region					0		Myeloproliferative disorder(115;0.0122)				gaaacacccgtctctactaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48334361	48334361	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48334361delG								B4GALT5 (3940 upstream) : SLC9A8 (94889 downstream)																							aataattgttgaaggaCGACA	0.119													4	2	---	---	---	---	
DPM1	8813	broad.mit.edu	37	20	49565404	49565404	+	Intron	DEL	T	-	-	rs35950937		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49565404delT	uc002xvw.1	-						DPM1_uc002xvv.1_5'Flank|DPM1_uc002xvx.1_Intron	NM_003859	NP_003850	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase 1						C-terminal protein lipidation|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|protein N-linked glycosylation via asparagine|protein O-linked mannosylation	dolichol-phosphate-mannose synthase complex|endoplasmic reticulum membrane|membrane fraction	dolichyl-phosphate beta-D-mannosyltransferase activity|dolichyl-phosphate-mannose-protein mannosyltransferase activity|protein binding			ovary(1)	1						GTAGCTAACAttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51085024	51085025	+	IGR	DEL	GG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51085024_51085025delGG								ZFP64 (276500 upstream) : TSHZ2 (503852 downstream)																							ccctgaggctgggaggccagtg	0.069													4	2	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51655852	51655853	+	Intron	INS	-	C	C	rs141078221	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51655852_51655853insC	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CAGAGAACTTTCCACACTCTTG	0.421													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55295125	55295125	+	IGR	DEL	G	-	-	rs74181075		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55295125delG								TFAP2C (80789 upstream) : BMP7 (448684 downstream)																							TGTGTCTTTTGGGGGCTATGA	0.184													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56020147	56020149	+	IGR	DEL	TCC	-	-	rs111771843		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56020147_56020149delTCC								RBM38 (35763 upstream) : CTCFL (43731 downstream)																							ctcctcctcttcctcctcctcct	0.123													4	2	---	---	---	---	
NPEPL1	79716	broad.mit.edu	37	20	57287014	57287014	+	Intron	DEL	A	-	-	rs5842239		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57287014delA	uc010zzs.1	+						NPEPL1_uc010zzr.1_Intron|NPEPL1_uc002xzn.2_Intron|NPEPL1_uc010gjo.1_Intron|NPEPL1_uc002xzp.2_Intron	NM_024663	NP_078939	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1						proteolysis	cytoplasm	aminopeptidase activity|manganese ion binding|metalloexopeptidase activity				0	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			CTTCGGGGTCAGGGGGCACCC	0.557													3	6	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60430464	60430465	+	Intron	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60430464_60430465insT	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGGGGCAGGCAGGGGGTGAGCA	0.584													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9576271	9576271	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9576271delC								None (None upstream) : None (None downstream)																							ggccCCAGGACACACAGCTTT	0.259													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10421787	10421788	+	IGR	INS	-	CT	CT			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10421787_10421788insCT								None (None upstream) : TPTE (484955 downstream)																							gattctcctgcctcagcctcct	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10427974	10427975	+	IGR	INS	-	T	T			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10427974_10427975insT								None (None upstream) : TPTE (478768 downstream)																							gggaagatgcccgaggagaaac	0.000													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10727382	10727383	+	IGR	INS	-	C	C	rs148720919		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10727382_10727383insC								None (None upstream) : TPTE (179360 downstream)																							tatttccttttcacattaggac	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10790317	10790321	+	IGR	DEL	GAATG	-	-	rs112648902		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10790317_10790321delGAATG								None (None upstream) : TPTE (116422 downstream)																							gagtggattcgaatggaatggaatg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10794940	10794941	+	IGR	INS	-	GAGTA	GAGTA	rs62219549		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10794940_10794941insGAGTA								None (None upstream) : TPTE (111802 downstream)																							aaattggagtggagtggagtgg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10795987	10795991	+	IGR	DEL	GTGAA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10795987_10795991delGTGAA								None (None upstream) : TPTE (110752 downstream)																							tggagtggaggtgaataaagtgtag	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10820554	10820558	+	IGR	DEL	TGGAA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10820554_10820558delTGGAA								None (None upstream) : TPTE (86185 downstream)																							tggaatggactggaatggaatggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10821736	10821737	+	IGR	DEL	GA	-	-	rs74970823		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10821736_10821737delGA								None (None upstream) : TPTE (85006 downstream)																							gaaaacactcgaatggaatgga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10841844	10841848	+	IGR	DEL	TGGAA	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10841844_10841848delTGGAA								None (None upstream) : TPTE (64895 downstream)																							tggactcgagtggaatggaatggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10857185	10857189	+	IGR	DEL	GAATG	-	-	rs150941992		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10857185_10857189delGAATG								None (None upstream) : TPTE (49554 downstream)																							gaatggaatagaatggaatggaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10873042	10873044	+	IGR	DEL	TTG	-	-	rs111484177		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10873042_10873044delTTG								None (None upstream) : TPTE (33699 downstream)																							TTCTCTTTATTTGTTGTTGTTAT	0.468													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11058603	11058603	+	Intron	DEL	G	-	-	rs57429001		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11058603delG	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAAACCTAAAGATTTTTTTTT	0.269													6	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11058732	11058733	+	Intron	DEL	TT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11058732_11058733delTT	uc002yit.1	-						BAGE_uc002yiw.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CATATTACTATTTTTTACCCTG	0.257													5	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11062462	11062466	+	Intron	DEL	AATGA	-	-	rs71766602		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11062462_11062466delAATGA	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATATAAAATGAAtgaaatactttgg	0.122													9	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11064868	11064868	+	Intron	DEL	A	-	-	rs141260459		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11064868delA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ctaaaaatacaaaaaaaaaaa	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	24134646	24134647	+	IGR	INS	-	A	A			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24134646_24134647insA								None (None upstream) : None (None downstream)																							aactccgtctcaaaaaaaaaaa	0.015													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28369734	28369735	+	IGR	DEL	GG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28369734_28369735delGG								ADAMTS5 (30295 upstream) : NCRNA00113 (724963 downstream)																							ccagaagccagggggatggact	0.000													4	2	---	---	---	---	
C21orf7	56911	broad.mit.edu	37	21	30464623	30464624	+	Intron	INS	-	ACTCCAGTTTATAGG	ACTCCAGTTTATAGG	rs147901306	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30464623_30464624insACTCCAGTTTATAGG	uc002yne.2	+						C21orf7_uc011acr.1_Intron|C21orf7_uc002ynd.2_Intron|C21orf7_uc010gln.2_Intron|C21orf7_uc002ynf.2_Intron	NM_020152	NP_064537	P57077	TAK1L_HUMAN	chromosome 21 open reading frame 7							cytosol|nucleus	protein binding			ovary(2)	2				Colorectal(56;0.248)		TCCAGATTTAAACCATTAACAA	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37396142	37396143	+	IGR	INS	-	T	T	rs66526506		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37396142_37396143insT								RUNX1 (39095 upstream) : SETD4 (10697 downstream)																							AAGTTTCCTCCttttttttttt	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47030725	47030725	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47030725delC								SLC19A1 (66400 upstream) : PCBP3 (32958 downstream)																							cctccttgtgccccatcccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47468090	47468090	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47468090delT								COL6A1 (43127 upstream) : COL6A2 (49943 downstream)																							ATGAGGCATCTTTTTTGGGGT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16857104	16857104	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16857104delT								OR11H1 (407300 upstream) : CCT8L2 (214544 downstream)																							tggaatcgaatggaatcatca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16920274	16920275	+	IGR	DEL	AT	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16920274_16920275delAT								OR11H1 (470470 upstream) : CCT8L2 (151373 downstream)																							TTATAGTGACATGTATGAAAAC	0.267													4	3	---	---	---	---	
HIRA	7290	broad.mit.edu	37	22	19325187	19325187	+	Intron	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19325187delC	uc002zpf.1	-						HIRA_uc011agx.1_Intron|HIRA_uc010grn.1_Intron|HIRA_uc010gro.1_Intron	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective						chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					tcaaagaacacctgggaaatt	0.000													4	2	---	---	---	---	
GNB1L	54584	broad.mit.edu	37	22	19800455	19800455	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19800455delG	uc002zqe.1	-						GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqf.1_Intron	NM_053004	NP_443730	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)					ctgttccagtgggtgaattag	0.000													4	2	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						ATGATGAAATACTAACTGTTTTAC	0.402													4	2	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22972287	22972287	+	Intron	DEL	C	-	-	rs11359573		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22972287delC	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CCCAACTGGGCGGGGCAGAGG	0.667													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	24605996	24605997	+	IGR	INS	-	T	T	rs34013488		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24605996_24605997insT								SUSD2 (20922 upstream) : GGT5 (9626 downstream)																							TTTATTCAGTGTTTTTTTTTTT	0.109													4	2	---	---	---	---	
UPB1	51733	broad.mit.edu	37	22	24925959	24925962	+	Intron	DEL	AAAC	-	-	rs71787087		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24925959_24925962delAAAC	uc011ajt.1	+							NM_016327	NP_057411	Q9UBR1	BUP1_HUMAN	beta-ureidopropionase						pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	beta-ureidopropionase activity|metal ion binding			ovary(2)	2	Colorectal(2;0.0339)					aaaaaaaaaaaaacaaacaaacaa	0.000													4	3	---	---	---	---	
SGSM1	129049	broad.mit.edu	37	22	25228683	25228683	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25228683delA	uc003abg.2	+						SGSM1_uc003abh.2_Intron|SGSM1_uc010guu.1_Intron|SGSM1_uc003abj.2_Intron|SGSM1_uc003abf.2_Intron	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1							Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						ttacttcactagggctgccct	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	26435580	26435583	+	IGR	DEL	TTTG	-	-	rs72393673		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26435580_26435583delTTTG								MYO18B (8573 upstream) : SEZ6L (129897 downstream)																							TTtttttgtttttgtttttgtttt	0.260													2	4	---	---	---	---	
TPST2	8459	broad.mit.edu	37	22	26979520	26979520	+	Intron	DEL	A	-	-	rs112444411		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26979520delA	uc003acx.2	-						TPST2_uc011akf.1_Intron	NM_003595	NP_003586	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2						peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity			central_nervous_system(1)	1						GGAGCGTGTCAAAAAAAAAAA	0.264													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27175435	27175436	+	IGR	INS	-	TT	TT	rs35816801		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27175435_27175436insTT								MIAT (60486 upstream) : MN1 (968830 downstream)																							ACCAAAATGTATTTTTTTTTTT	0.257													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27492944	27492945	+	IGR	INS	-	AT	AT	rs140194413	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27492944_27492945insAT								MIAT (377995 upstream) : MN1 (651321 downstream)																							CACACACACACGTCCTCCACTC	0.198													4	4	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28809737	28809738	+	Intron	INS	-	A	A	rs138398638	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28809737_28809738insA	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						GGCTAAAAGTTAAAAAAAAGGT	0.312													3	5	---	---	---	---	
LIMK2	3985	broad.mit.edu	37	22	31665021	31665024	+	Intron	DEL	TTTG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31665021_31665024delTTTG	uc003akh.2	+						LIMK2_uc003akg.2_Intron|LIMK2_uc003aki.2_Intron|LIMK2_uc003akj.2_Intron|LIMK2_uc003akk.2_Intron|LIMK2_uc011aln.1_Intron	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a							mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						ttttggtttttttgtttgtttgtt	0.270													4	2	---	---	---	---	
BPIL2	254240	broad.mit.edu	37	22	32828000	32828001	+	Intron	INS	-	GC	GC	rs141704012	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32828000_32828001insGC	uc003amn.2	-						BPIL2_uc010gwo.2_Intron|BPIL2_uc011amb.1_Intron	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						agctcactgtagcctcaaactc	0.104													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34257390	34257391	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34257390_34257391delAC	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				acacacacaaacacacacacac	0.391													4	2	---	---	---	---	
MB	4151	broad.mit.edu	37	22	36009733	36009733	+	Intron	DEL	G	-	-	rs35141221		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36009733delG	uc003anz.2	-						MB_uc003aoa.2_Intron|MB_uc003aob.2_Intron	NM_005368	NP_005359	P02144	MYG_HUMAN	myoglobin								heme binding|oxygen transporter activity				0						ttgtagagaaggggggtctca	0.000													4	3	---	---	---	---	
RBM9	23543	broad.mit.edu	37	22	36422492	36422492	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36422492delA	uc003aon.3	-						RBM9_uc003aoo.3_Intron	NM_001082578	NP_001076047	O43251	RFOX2_HUMAN	RNA binding motif protein 9 isoform 5						estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0						AGCCAGTTTGAAGGCAACCAA	0.438													4	2	---	---	---	---	
APOL3	80833	broad.mit.edu	37	22	36542057	36542058	+	Intron	INS	-	CACA	CACA	rs72243096		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36542057_36542058insCACA	uc003aot.2	-						APOL3_uc003aoq.2_Intron|APOL3_uc003aor.2_Intron|APOL3_uc003aos.2_Intron|APOL3_uc003aou.2_Intron|APOL3_uc003aov.2_Intron	NM_145640	NP_663615	O95236	APOL3_HUMAN	apolipoprotein L3 isoform 1						inflammatory response|lipoprotein metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	lipid binding|lipid transporter activity|signal transducer activity				0						tctcacacactcacacacacac	0.193													4	2	---	---	---	---	
RAC2	5880	broad.mit.edu	37	22	37623512	37623513	+	Intron	INS	-	A	A	rs111793008		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37623512_37623513insA	uc003arc.2	-							NM_002872	NP_002863	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2						axon guidance|platelet activation|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding			breast(2)|central_nervous_system(1)|skin(1)	4						acgccatacaccccctcccacg	0.000													4	2	---	---	---	---	
PLA2G6	8398	broad.mit.edu	37	22	38508896	38508897	+	Intron	DEL	CT	-	-	rs34550422		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38508896_38508897delCT	uc003auy.1	-						PLA2G6_uc003auz.1_Intron|PLA2G6_uc003ava.1_Intron|PLA2G6_uc003avb.2_Intron|PLA2G6_uc010gxk.1_Intron|BAIAP2L2_uc003auw.2_5'Flank|PLA2G6_uc003aux.1_Intron	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a						cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	TCCCTCCCTCCTCTCTCtctct	0.322													3	3	---	---	---	---	
PLA2G6	8398	broad.mit.edu	37	22	38569380	38569381	+	Intron	DEL	AC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38569380_38569381delAC	uc003auy.1	-						PLA2G6_uc003auz.1_Intron|PLA2G6_uc003ava.1_Intron|PLA2G6_uc003avb.2_Intron|PLA2G6_uc010gxk.1_Intron|PLA2G6_uc011ano.1_Intron	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a						cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	AGGTCACCTGACACAGACCGCA	0.569													5	4	---	---	---	---	
LOC646851	646851	broad.mit.edu	37	22	39045873	39045873	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39045873delA	uc011anx.1	-						LOC646851_uc011anw.1_Intron			B7Z7C6	B7Z7C6_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000348086;												0						actccatctcaaaaaaaaaaa	0.124													4	3	---	---	---	---	
PACSIN2	11252	broad.mit.edu	37	22	43370862	43370864	+	Intron	DEL	AAC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43370862_43370864delAAC	uc003bdg.3	-							NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				gaggagaaggaACAACAACAACA	0.236													6	4	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43479724	43479725	+	Intron	INS	-	C	C	rs138241428	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43479724_43479725insC	uc003bdi.2	-						TTLL1_uc003bdj.2_Intron|TTLL1_uc003bdh.2_Intron	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		acaagagcaaactccatctcag	0.000													3	3	---	---	---	---	
BIK	638	broad.mit.edu	37	22	43504245	43504245	+	5'Flank	DEL	T	-	-	rs67106280		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43504245delT	uc003bdk.2	+							NM_001197	NP_001188	Q13323	BIK_HUMAN	BCL2-interacting killer						apoptosis|induction of apoptosis|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria	endomembrane system|integral to membrane					0		Ovarian(80;0.0694)				CTTCGTGAGCttttttttttt	0.194													4	2	---	---	---	---	
TTLL12	23170	broad.mit.edu	37	22	43572091	43572091	+	Intron	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43572091delA	uc003bdq.2	-						TTLL12_uc003bdr.1_Intron	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12						protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)				actctgtctcaaaaaaaaaaa	0.289													4	2	---	---	---	---	
PRR5	55615	broad.mit.edu	37	22	45096943	45096944	+	5'Flank	DEL	AT	-	-	rs141951031		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45096943_45096944delAT	uc003bfb.1	+						PRR5_uc003bew.1_Intron|PRR5_uc003bex.1_Intron|PRR5_uc010gzt.1_Intron|PRR5_uc010gzu.1_Intron|PRR5_uc003bey.1_Intron|PRR5_uc003bez.1_Intron|PRR5-ARHGAP8_uc003bfc.2_5'Flank|PRR5-ARHGAP8_uc003bfd.2_5'Flank|PRR5-ARHGAP8_uc011aqi.1_5'Flank|PRR5_uc003bfa.1_5'Flank|PRR5_uc003bfe.1_5'Flank	NM_181333	NP_851850	P85299	PRR5_HUMAN	proline rich 5 (renal) isoform 1						cell cycle					skin(1)	1		all_neural(38;0.00409)|Ovarian(80;0.024)|Glioma(61;0.0647)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)		tgtatttttaatagagatgggg	0.000													3	3	---	---	---	---	
C22orf9	23313	broad.mit.edu	37	22	45614061	45614062	+	Intron	DEL	AG	-	-	rs34831912		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45614061_45614062delAG	uc003bfx.1	-							NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b								protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		tttttgagacagagttttgttc	0.218													3	4	---	---	---	---	
C22orf9	23313	broad.mit.edu	37	22	45636356	45636356	+	Intron	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45636356delG	uc003bfx.1	-							NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b								protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		CAGGGACGGTGGGGGGGGGGC	0.682													4	3	---	---	---	---	
FBLN1	2192	broad.mit.edu	37	22	45961597	45961598	+	Intron	INS	-	ATGG	ATGG	rs138161204	by1000genomes	TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45961597_45961598insATGG	uc003bgj.1	+							NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D						interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		tggacagaccaatggatggatg	0.089													3	3	---	---	---	---	
WNT7B	7477	broad.mit.edu	37	22	46375610	46375612	+	5'Flank	DEL	ACA	-	-	rs148019771		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46375610_46375612delACA	uc003bgo.2	-							NM_058238	NP_478679	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family,						activation of JUN kinase activity|anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|central nervous system vasculogenesis|chorio-allantoic fusion|developmental growth involved in morphogenesis|embryonic placenta morphogenesis|establishment or maintenance of polarity of embryonic epithelium|fibroblast proliferation|forebrain regionalization|inner medullary collecting duct development|lens fiber cell development|lobar bronchus development|lung epithelium development|lung morphogenesis|lung-associated mesenchyme development|mammary gland epithelium development|metanephric collecting duct development|metanephric loop of Henle development|metanephros morphogenesis|negative regulation of smoothened signaling pathway|outer medullary collecting duct development|oxygen homeostasis|positive regulation of JNK cascade|positive regulation of osteoblast differentiation|renal inner medulla development|renal outer medulla development|stem cell proliferation|synapse organization|trachea cartilage morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled binding|signal transducer activity			lung(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		cacaccacacacaacacacacac	0.000													4	3	---	---	---	---	
TBC1D22A	25771	broad.mit.edu	37	22	47529530	47529531	+	Intron	DEL	TC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47529530_47529531delTC	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		CCGTGGGCTGTCTCTCTCTCTC	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	47738987	47738988	+	IGR	INS	-	C	C			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47738987_47738988insC								TBC1D22A (169265 upstream) : None (None downstream)																							ccaatccctatctacccaatcc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	47766312	47766312	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47766312delA								TBC1D22A (196590 upstream) : None (None downstream)																							GAGTAACCATACTCACAACCA	0.537													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48677147	48677150	+	IGR	DEL	AAGG	-	-	rs78398015		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48677147_48677150delAAGG								None (None upstream) : FAM19A5 (208138 downstream)																							taagaatcaaaaggaaggaaatgg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49542405	49542405	+	IGR	DEL	G	-	-	rs34910351		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49542405delG								FAM19A5 (394663 upstream) : C22orf34 (265771 downstream)																							GGGTAAGCCAGGGTCCACTCA	0.607													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	51034991	51034992	+	IGR	INS	-	A	A	rs79483831		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51034991_51034992insA								LOC100144603 (12638 upstream) : MAPK8IP2 (4139 downstream)																							gaccctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	872648	872648	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:872648delT								SHOX (252503 upstream) : CRLF2 (442239 downstream)																							tgtgtcGCCCTtttttttttt	0.020													4	3	---	---	---	---	
ARAF	369	broad.mit.edu	37	X	47424714	47424714	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47424714delC	uc011mlq.1	+	6	655	c.522delC	c.(520-522)CGCfs	p.R174fs	ARAF_uc011mln.1_RNA|ARAF_uc011mlo.1_Frame_Shift_Del_p.R40fs|ARAF_uc011mlp.1_Frame_Shift_Del_p.R174fs|ARAF_uc004dic.1_5'UTR	NM_001654	NP_001645	P10398	ARAF_HUMAN	v-raf murine sarcoma 3611 viral oncogene	174					intracellular signal transduction|negative regulation of apoptosis|positive regulation of peptidyl-serine phosphorylation		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity			large_intestine(3)|lung(2)|ovary(1)|skin(1)	7					Adenosine triphosphate(DB00171)	CCTCGAACCGCCCCCTGAATG	0.572													4	8	---	---	---	---	
IQSEC2	23096	broad.mit.edu	37	X	53296225	53296227	+	Intron	DEL	CTC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53296225_53296227delCTC	uc004dsd.2	-						IQSEC2_uc004dsc.2_Intron|IQSEC2_uc004dse.2_RNA|IQSEC2_uc004dsf.2_RNA	NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2 isoform1						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3						cttcctcagtctcctcctcctcc	0.483													3	3	---	---	---	---	
TSC22D3	1831	broad.mit.edu	37	X	107019852	107019852	+	5'Flank	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107019852delC	uc004enh.2	-						TSC22D3_uc004eni.2_5'Flank|TSC22D3_uc004enj.2_5'Flank	NM_198057	NP_932174	Q99576	T22D3_HUMAN	TSC22 domain family, member 3 isoform 1								sequence-specific DNA binding transcription factor activity				0						CTCGCTGTGTCCTCTCTTCCC	0.493													4	2	---	---	---	---	
ODZ1	10178	broad.mit.edu	37	X	124029738	124029740	+	Intron	DEL	AAG	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124029738_124029740delAAG	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TATTAAATGAAAGAAGGGCAGAT	0.350													4	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9981809	9981809	+	IGR	DEL	C	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9981809delC								TTTY22 (330955 upstream) : None (None downstream)																							TGATCTCAGACCAAAATATAG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10045084	10045084	+	IGR	DEL	A	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10045084delA								TTTY22 (394230 upstream) : None (None downstream)																							aacttcttttaaatgagtgct	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13428109	13428109	+	IGR	DEL	T	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13428109delT								None (None upstream) : None (None downstream)																							gcctttaaaattttttcattc	0.000													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28793079	28793079	+	IGR	DEL	T	-	-	rs112404551		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28793079delT								None (None upstream) : None (None downstream)																							ACAaatagaattgaatggaat	0.139													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28810433	28810436	+	IGR	DEL	TATT	-	-	rs113526887		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28810433_28810436delTATT								None (None upstream) : None (None downstream)																							gagtggaatgtattggttggaatg	0.157													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28811028	28811028	+	IGR	DEL	G	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28811028delG								None (None upstream) : None (None downstream)																							aaaatggaatggagtagaatc	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58975537	58975551	+	IGR	DEL	CATTCCATTCGATTC	-	-			TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58975537_58975551delCATTCCATTCGATTC								None (None upstream) : None (None downstream)																							cactcgattgcattccattcgattccattccattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58981571	58981575	+	IGR	DEL	TCCTT	-	-	rs145359324		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58981571_58981575delTCCTT								None (None upstream) : None (None downstream)																							tccactccactcctttccagtccat	0.010													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59013975	59013976	+	IGR	INS	-	T	T	rs55787552		TCGA-66-2792-01A-01D-0983-08	TCGA-66-2792-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59013975_59013976insT								None (None upstream) : None (None downstream)																							accaaactaccttttttttttt	0.000													4	2	---	---	---	---	
