Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SCNN1D	6339	broad.mit.edu	37	1	1222541	1222541	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1222541C>T	uc001adu.1	+	8	1304	c.680C>T	c.(679-681)GCG>GTG	p.A227V	SCNN1D_uc001adt.1_Missense_Mutation_p.A391V|SCNN1D_uc001adw.2_Missense_Mutation_p.A293V|SCNN1D_uc001adx.2_5'UTR|SCNN1D_uc001adv.2_Missense_Mutation_p.A227V	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		TCAGGCGTGGCGGCTGTCCAG	0.662													3	41	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11595162	11595162	+	Silent	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11595162C>G	uc001ash.3	+	19	3768	c.3630C>G	c.(3628-3630)CCC>CCG	p.P1210P		NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1210	Helical; (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TCCTGCTGCCCGTGCTCCTCA	0.682													4	11	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39806397	39806397	+	Intron	SNP	T	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39806397T>A	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAGGTAGCATTTTGCTTTTAT	0.393													5	39	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75039113	75039113	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75039113G>T	uc001dgg.2	-	14	2500	c.2281C>A	c.(2281-2283)CAA>AAA	p.Q761K		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	761	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TGCACCAATTGCTGGGATTCC	0.403													50	92	---	---	---	---	PASS
KCNC4	3749	broad.mit.edu	37	1	110775600	110775600	+	3'UTR	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110775600C>T	uc001dzh.2	+	4					KCNC4_uc001dzg.2_3'UTR|KCNC4_uc001dzi.2_RNA	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel						synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTTAAAGCGGCACCAACGTGA	0.522													7	9	---	---	---	---	PASS
LMX1A	4009	broad.mit.edu	37	1	165218633	165218633	+	Intron	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165218633C>T	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)					CTGCCCACCACCTGGCACTCA	0.627													34	77	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564599	176564599	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564599C>T	uc001gkz.2	+	3	3023	c.1859C>T	c.(1858-1860)TCC>TTC	p.S620F	PAPPA2_uc001gky.1_Missense_Mutation_p.S620F|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	620	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CGCTGCTACTCCTGGAACCGC	0.607													34	94	---	---	---	---	PASS
CHIT1	1118	broad.mit.edu	37	1	203188832	203188832	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203188832C>A	uc001gzn.2	-	8	971	c.875G>T	c.(874-876)GGC>GTC	p.G292V	FMOD_uc010pqi.1_Intron|CHIT1_uc001gzm.1_RNA|CHIT1_uc009xal.1_Missense_Mutation_p.G83V|CHIT1_uc009xam.1_RNA|CHIT1_uc009xan.1_RNA|CHIT1_uc001gzo.2_Missense_Mutation_p.G283V	NM_003465	NP_003456	Q13231	CHIT1_HUMAN	chitotriosidase precursor	292					chitin catabolic process|immune response|response to bacterium	extracellular space|lysosome	cation binding|chitin binding|endochitinase activity				0						GGTGAAGGGGCCTGGAGTGCC	0.587													46	149	---	---	---	---	PASS
ANGEL2	90806	broad.mit.edu	37	1	213181649	213181649	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213181649T>C	uc001hjz.2	-	3	700	c.545A>G	c.(544-546)GAT>GGT	p.D182G	ANGEL2_uc010pto.1_Missense_Mutation_p.D56G|ANGEL2_uc010ptp.1_Missense_Mutation_p.D56G|ANGEL2_uc001hka.2_Missense_Mutation_p.D13G|ANGEL2_uc010ptq.1_RNA|ANGEL2_uc001hkb.2_Missense_Mutation_p.D160G	NM_144567	NP_653168	Q5VTE6	ANGE2_HUMAN	LOC90806 protein	182											0				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		GTGAGAGTTATCTTCCAGTAA	0.363													39	89	---	---	---	---	PASS
AIDA	64853	broad.mit.edu	37	1	222867551	222867551	+	Splice_Site	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222867551C>A	uc001hnn.2	-	3	439	c.234_splice	c.e3+1	p.Q78_splice	AIDA_uc001hno.2_Splice_Site|AIDA_uc010pus.1_Splice_Site_p.Q54_splice	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated						dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						AAACTCCTTACCTGTAAAGCT	0.318													145	99	---	---	---	---	PASS
C1orf65	164127	broad.mit.edu	37	1	223566951	223566951	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223566951G>T	uc001hoa.2	+	1	237	c.134G>T	c.(133-135)CGG>CTG	p.R45L		NM_152610	NP_689823	Q8N715	CA065_HUMAN	hypothetical protein LOC164127	45										central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0704)		GCGTGCTCCCGGGCCGGGACT	0.731													6	25	---	---	---	---	PASS
CAPN9	10753	broad.mit.edu	37	1	230903311	230903311	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230903311G>A	uc001htz.1	+	5	674	c.561G>A	c.(559-561)CTG>CTA	p.L187L	CAPN9_uc009xfg.1_Silent_p.L124L|CAPN9_uc001hua.1_Silent_p.L187L	NM_006615	NP_006606	O14815	CAN9_HUMAN	calpain 9 isoform 1	187	Calpain catalytic.				digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				ATGAAGCTCTGAAGGGAGGCA	0.562													50	134	---	---	---	---	PASS
IRF2BP2	359948	broad.mit.edu	37	1	234742956	234742956	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234742956C>A	uc001hwg.2	-	2	1722	c.1691G>T	c.(1690-1692)TGG>TTG	p.W564L	IRF2BP2_uc009xfw.2_Missense_Mutation_p.W174L|IRF2BP2_uc001hwf.2_Missense_Mutation_p.W548L	NM_182972	NP_892017	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	564					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CATAAAGGCCCAGGGGACATT	0.488													192	132	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237806748	237806748	+	Splice_Site	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237806748G>C	uc001hyl.1	+	48	7462	c.7342_splice	c.e48+1	p.D2448_splice		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATAGCCAAAGGTAAGGCCAAC	0.438													5	168	---	---	---	---	PASS
ATP6V1C2	245973	broad.mit.edu	37	2	10866706	10866706	+	Intron	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10866706C>A	uc002ras.2	+						ATP6V1C2_uc002rat.2_Intron	NM_001039362	NP_001034451	Q8NEY4	VATC2_HUMAN	vacuolar H+ ATPase C2 isoform a						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		GTAAAATATTCCTTATTTACT	0.443													56	91	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11355436	11355436	+	Intron	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11355436G>C	uc002rbd.1	-							NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CTACAAATTAGATCCACCTAC	0.308													8	9	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21237993	21237993	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21237993G>A	uc002red.2	-	23	3776	c.3648C>T	c.(3646-3648)GTC>GTT	p.V1216V		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1216					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTGTTTGAGGGACTCTGTGAT	0.388													79	238	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28771759	28771759	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28771759G>C	uc002rmb.1	+	15	969	c.969G>C	c.(967-969)TTG>TTC	p.L323F	PLB1_uc010ezj.1_Missense_Mutation_p.L334F|PLB1_uc002rmc.2_Missense_Mutation_p.L11F	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	323	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					ATGAGCCATTGAGTGTAAAAC	0.547													4	57	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50724591	50724591	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50724591G>T	uc010fbq.2	-	14	4356	c.2879C>A	c.(2878-2880)ACC>AAC	p.T960N	NRXN1_uc002rxb.3_Missense_Mutation_p.T592N|NRXN1_uc002rxe.3_Missense_Mutation_p.T920N|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GGCTTGCAAGGTAGCTAAGGC	0.398													16	76	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61510333	61510333	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61510333C>G	uc002sbe.2	-	37	4967	c.4945G>C	c.(4945-4947)GAT>CAT	p.D1649H	USP34_uc002sbf.2_5'Flank	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	1649					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			TGATCGCTATCAGCAAGGCTA	0.338													26	202	---	---	---	---	PASS
RGPD1	400966	broad.mit.edu	37	2	87214094	87214094	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87214094A>T	uc010fgv.2	+	20	4139	c.4072A>T	c.(4072-4074)AGA>TGA	p.R1358*	RMND5A_uc002srs.3_Intron|RGPD1_uc002ssb.2_Nonsense_Mutation_p.R1347*|RGPD1_uc002ssc.2_Nonsense_Mutation_p.R615*	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1	1350	RanBD1 2.				intracellular transport		binding				0						AGAACTCTACAGATATGATAA	0.358													111	242	---	---	---	---	PASS
SLC5A7	60482	broad.mit.edu	37	2	108608587	108608587	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108608587C>T	uc002tdv.2	+	3	480	c.204C>T	c.(202-204)ATC>ATT	p.I68I	SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Silent_p.I68I|SLC5A7_uc010ywn.1_5'UTR	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	68	Helical; (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	GAGGGTATATCAATGGCACAG	0.393													25	89	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137814256	137814256	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137814256C>T	uc002tva.1	+	2	313	c.313C>T	c.(313-315)CAT>TAT	p.H105Y	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GACGGCTCAGCATGGACTGCA	0.542													29	89	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138000107	138000107	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138000107G>T	uc002tva.1	+	9	2138	c.2138G>T	c.(2137-2139)AGT>ATT	p.S713I	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.S603I	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		ACTGCTTTCAGTGAGTGGACA	0.463													35	66	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179201135	179201135	+	Silent	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179201135G>T	uc002ulx.2	+	9	1143	c.765G>T	c.(763-765)TCG>TCT	p.S255S	OSBPL6_uc002ulw.2_Silent_p.S255S|OSBPL6_uc002uly.2_Silent_p.S255S|OSBPL6_uc010zfe.1_Silent_p.S255S|OSBPL6_uc002ulz.2_Silent_p.S255S|OSBPL6_uc002uma.2_Silent_p.S234S	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	255					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TACAGGACTCGGAAGAGATGG	0.507													93	213	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179736975	179736975	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179736975T>C	uc002unf.1	-	3	296	c.239A>G	c.(238-240)AAC>AGC	p.N80S		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	80	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TGCTTTCTGGTTTTCCATGGT	0.413													31	101	---	---	---	---	PASS
PTH2R	5746	broad.mit.edu	37	2	209358341	209358341	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209358341C>A	uc002vdb.2	+	13	1823	c.1610C>A	c.(1609-1611)CCA>CAA	p.P537Q	PTH2R_uc010zjb.1_Missense_Mutation_p.P548Q|PTH2R_uc010fuo.1_Intron	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor	537	Cytoplasmic (Potential).					integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		GAATCTAACCCAGACACTGAA	0.507													40	132	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216296577	216296577	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216296577C>G	uc002vfa.2	-	4	792	c.526G>C	c.(526-528)GAA>CAA	p.E176Q	FN1_uc002vfb.2_Missense_Mutation_p.E176Q|FN1_uc002vfc.2_Missense_Mutation_p.E176Q|FN1_uc002vfd.2_Missense_Mutation_p.E176Q|FN1_uc002vfe.2_Missense_Mutation_p.E176Q|FN1_uc002vff.2_Missense_Mutation_p.E176Q|FN1_uc002vfg.2_Missense_Mutation_p.E176Q|FN1_uc002vfh.2_Missense_Mutation_p.E176Q|FN1_uc002vfi.2_Missense_Mutation_p.E176Q|FN1_uc002vfj.2_Missense_Mutation_p.E176Q|FN1_uc002vfl.2_Missense_Mutation_p.E176Q	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	176	Fibrin- and heparin-binding 1.|Fibronectin type-I 3.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAGGTCCATTCTCCTTTTCCA	0.488													10	312	---	---	---	---	PASS
SPP2	6694	broad.mit.edu	37	2	234975204	234975204	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234975204C>G	uc002vvk.1	+	5	557	c.472C>G	c.(472-474)CAT>GAT	p.H158D	SPP2_uc010fyl.1_Missense_Mutation_p.H78D	NM_006944	NP_008875	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa precursor	158					bone remodeling|skeletal system development	extracellular region	endopeptidase inhibitor activity				0		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		GTTGGGATCTCATAAATGGAG	0.313													30	138	---	---	---	---	PASS
HDAC4	9759	broad.mit.edu	37	2	240055998	240055998	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240055998G>C	uc002vyk.3	-	11	2029	c.1237C>G	c.(1237-1239)CTT>GTT	p.L413V	HDAC4_uc010fyz.1_Missense_Mutation_p.L408V|HDAC4_uc010zoa.1_Missense_Mutation_p.L408V|HDAC4_uc010fza.2_Missense_Mutation_p.L413V|HDAC4_uc010fyy.2_Missense_Mutation_p.L365V|HDAC4_uc010znz.1_Missense_Mutation_p.L296V|HDAC4_uc010fzb.1_RNA	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	413					B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TGCTGCAGAAGAGGGCTGTGC	0.667													17	44	---	---	---	---	PASS
CTNNB1	1499	broad.mit.edu	37	3	41266698	41266698	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41266698G>T	uc010hia.1	+	5	651	c.495G>T	c.(493-495)CAG>CAT	p.Q165H	CTNNB1_uc003ckp.2_Missense_Mutation_p.Q165H|CTNNB1_uc003ckq.2_Missense_Mutation_p.Q165H|CTNNB1_uc003ckr.2_Missense_Mutation_p.Q165H|CTNNB1_uc011azf.1_Missense_Mutation_p.Q158H|CTNNB1_uc011azg.1_Missense_Mutation_p.Q93H|uc010hib.1_5'Flank	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	165	ARM 1.				adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.M1_V173del(1)|p.I35_K170del(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	ACGAGGACCAGGTAAGCAATG	0.398		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				38	78	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49690377	49690377	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49690377C>A	uc003cxe.3	+	5	3502	c.3388C>A	c.(3388-3390)CCC>ACC	p.P1130T		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1130					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CTCACCCTCACCCTCCCTTGA	0.612													52	121	---	---	---	---	PASS
CACNA2D2	9254	broad.mit.edu	37	3	50402576	50402576	+	Silent	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50402576G>C	uc003daq.2	-	37	3197	c.3159C>G	c.(3157-3159)CTC>CTG	p.L1053L	CACNA2D2_uc003dap.2_Silent_p.L1046L|CACNA2D2_uc003dao.2_Missense_Mutation_p.L92V	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	1053	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	CCACCACAAAGAGAAGATTGG	0.562													20	42	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62518672	62518672	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62518672C>A	uc003dll.2	-	13	2525	c.2165G>T	c.(2164-2166)CGG>CTG	p.R722L	CADPS_uc003dlk.1_Missense_Mutation_p.R226L|CADPS_uc003dlm.2_Missense_Mutation_p.R722L|CADPS_uc003dln.2_Missense_Mutation_p.R705L	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	722					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GTGACACCCCCGGACTCCATT	0.493													47	151	---	---	---	---	PASS
SHQ1	55164	broad.mit.edu	37	3	72891517	72891517	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72891517C>T	uc003dpf.2	-	3	352	c.245G>A	c.(244-246)GGC>GAC	p.G82D	SHQ1_uc010hod.2_5'UTR	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog	82	CS.				ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		AAAATGCTGGCCAGGGGTTTC	0.328													40	90	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73433433	73433433	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73433433C>A	uc003dpl.1	-	10	2380	c.2284G>T	c.(2284-2286)GAG>TAG	p.E762*	PDZRN3_uc011bgh.1_Nonsense_Mutation_p.E419*|PDZRN3_uc010hoe.1_Nonsense_Mutation_p.E460*|PDZRN3_uc011bgf.1_Nonsense_Mutation_p.E479*|PDZRN3_uc011bgg.1_Nonsense_Mutation_p.E482*	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	762							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CGGCAGCTCTCGCCTGTGTTG	0.632													13	39	---	---	---	---	PASS
VGLL3	389136	broad.mit.edu	37	3	87027889	87027889	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87027889C>G	uc003dqn.2	-	2	554	c.190G>C	c.(190-192)GAG>CAG	p.E64Q		NM_016206	NP_057290	A8MV65	VGLL3_HUMAN	colon carcinoma related protein	64					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		tcctcctcctcTTGTTTGCTG	0.378													29	67	---	---	---	---	PASS
HHLA2	11148	broad.mit.edu	37	3	108094593	108094593	+	Intron	SNP	A	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108094593A>G	uc003dwy.3	+						HHLA2_uc011bhl.1_Intron|HHLA2_uc010hpu.2_Intron|HHLA2_uc003dwz.2_Intron	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor							integral to membrane				ovary(1)	1						tctctgatctacagcccagct	0.000													3	39	---	---	---	---	PASS
KIAA1407	57577	broad.mit.edu	37	3	113737550	113737550	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113737550C>G	uc003eax.2	-	8	1285	c.1138G>C	c.(1138-1140)GAA>CAA	p.E380Q	KIAA1407_uc011bin.1_RNA|KIAA1407_uc011bio.1_Missense_Mutation_p.E358Q|KIAA1407_uc011bip.1_Missense_Mutation_p.E367Q	NM_020817	NP_065868	Q8NCU4	K1407_HUMAN	hypothetical protein LOC57577	380	Potential.									ovary(2)	2						AGATCATTTTCCAAGGCTTGA	0.433													130	320	---	---	---	---	PASS
HCLS1	3059	broad.mit.edu	37	3	121356041	121356041	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121356041G>C	uc003eeh.3	-	7	642	c.517C>G	c.(517-519)CTG>GTG	p.L173V	HCLS1_uc011bjj.1_Intron|HCLS1_uc011bjk.1_RNA	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	173	Cortactin 3.				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		TCATATCCCAGAGCTGCTTTG	0.547													60	161	---	---	---	---	PASS
P2RY1	5028	broad.mit.edu	37	3	152553885	152553885	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152553885C>T	uc003ezq.2	+	1	1150	c.314C>T	c.(313-315)CCA>CTA	p.P105L		NM_002563	NP_002554	P47900	P2RY1_HUMAN	purinergic receptor P2Y1	105	Helical; Name=2; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CTGACTCTGCCAGCCCTGATC	0.498													60	120	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155200013	155200013	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155200013C>T	uc011bok.1	-	23	4103	c.3826G>A	c.(3826-3828)GAA>AAA	p.E1276K	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.E1238K	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1276					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CAGGTAGTTTCATAAACTGTG	0.478													100	238	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164766907	164766907	+	Intron	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164766907G>T	uc003fei.2	-							NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	GAATGAAATTGCACTTACTGC	0.323										HNSCC(35;0.089)			93	31	---	---	---	---	PASS
KLHL6	89857	broad.mit.edu	37	3	183226065	183226065	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183226065C>T	uc003flr.2	-	3	749	c.691G>A	c.(691-693)GAG>AAG	p.E231K	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Missense_Mutation_p.E229K	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	231	BACK.									haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TGagcctcctcggtcacgtaa	0.274													30	937	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186943271	186943271	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186943271C>T	uc003frh.1	-	13	1914	c.1582G>A	c.(1582-1584)GAA>AAA	p.E528K		NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	528	Peptidase S1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGTTCATTTTCATCTGACCGG	0.542													62	700	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196386691	196386691	+	Silent	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196386691C>A	uc003fwv.2	+	3	281	c.177C>A	c.(175-177)GCC>GCA	p.A59A		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	59	Extracellular (Potential).|LRR 1.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		CGCCCCACGCCCGGATGCTCA	0.672													26	175	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196771488	196771488	+	3'UTR	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196771488G>C	uc003fxo.3	-	26					DLG1_uc011bub.1_3'UTR|DLG1_uc011buc.1_3'UTR|DLG1_uc011bud.1_3'UTR|DLG1_uc003fxn.3_3'UTR|DLG1_uc011bue.1_3'UTR|DLG1_uc010ial.2_3'UTR	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		AGAGAAACATGAGTTTTCATA	0.388													28	195	---	---	---	---	PASS
IQCG	84223	broad.mit.edu	37	3	197640812	197640812	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197640812C>G	uc003fyo.2	-	7	974	c.828G>C	c.(826-828)CAG>CAC	p.Q276H	IQCG_uc003fyn.2_Missense_Mutation_p.Q178H|IQCG_uc003fyp.2_Missense_Mutation_p.Q276H|IQCG_uc003fyq.3_Missense_Mutation_p.Q276H|IQCG_uc003fym.2_5'Flank	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	276											0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TCTGGGCAATCTGCAGCTCGG	0.458													81	652	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56830468	56830468	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56830468G>T	uc003hbi.2	+	7	962	c.728G>T	c.(727-729)CGA>CTA	p.R243L	CEP135_uc003hbj.2_5'Flank|CEP135_uc010igz.1_Missense_Mutation_p.R73L	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	243	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					GAGATAGAACGACTGTCAGTT	0.363													28	78	---	---	---	---	PASS
UTP3	57050	broad.mit.edu	37	4	71554761	71554761	+	Missense_Mutation	SNP	G	A	A	rs139549167		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71554761G>A	uc003hfo.2	+	1	566	c.367G>A	c.(367-369)GTG>ATG	p.V123M		NM_020368	NP_065101	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit processome component	123	Glu-rich.				brain development|chromatin modification|gene silencing	nucleolus					0			Lung(101;0.235)			TGAGGCCTCTGTGGATCCCAG	0.368													32	77	---	---	---	---	PASS
NAA11	84779	broad.mit.edu	37	4	80247029	80247029	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80247029C>G	uc003hlt.3	-	1	143	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_032693	NP_116082	Q9BSU3	NAA11_HUMAN	alpha-N-acetyltransferase 1B	1	Interaction with NAA15 (By similarity).|N-acetyltransferase.					cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2						TGCGGATGTTCATAATGGCAG	0.507													12	39	---	---	---	---	PASS
GK2	2712	broad.mit.edu	37	4	80328678	80328678	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80328678G>A	uc003hlu.2	-	1	695	c.677C>T	c.(676-678)CCA>CTA	p.P226L		NM_033214	NP_149991	Q14410	GLPK2_HUMAN	glycerol kinase 2	226					glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity			ovary(2)|skin(2)	4						AAGGTCCATTGGAATTTCAAA	0.413													64	142	---	---	---	---	PASS
SLC39A8	64116	broad.mit.edu	37	4	103236990	103236990	+	Intron	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103236990G>A	uc003hwb.1	-						SLC39A8_uc011ceo.1_Intron|SLC39A8_uc003hwa.1_Intron|SLC39A8_uc003hwc.2_Intron	NM_022154	NP_071437	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter),							integral to membrane|organelle membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		GTTAAACACTGAAATAGAATA	0.348													27	50	---	---	---	---	PASS
ADAD1	132612	broad.mit.edu	37	4	123350789	123350789	+	Silent	SNP	T	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123350789T>A	uc003ieo.2	+	13	1858	c.1626T>A	c.(1624-1626)TCT>TCA	p.S542S	ADAD1_uc003iep.2_Silent_p.S531S|ADAD1_uc003ieq.2_Silent_p.S524S	NM_139243	NP_640336	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1	542	A to I editase.				multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding				0						AGTGTATGTCTGCCTCCTATC	0.348													45	96	---	---	---	---	PASS
SLC25A31	83447	broad.mit.edu	37	4	128689967	128689967	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128689967G>C	uc003ifl.2	+	5	840	c.694G>C	c.(694-696)GTG>CTG	p.V232L		NM_031291	NP_112581	Q9H0C2	ADT4_HUMAN	solute carrier family 25 (mitochondrial carrier;	232	Helical; Name=5; (Potential).|Solcar 3.				transmembrane transport	cilium|flagellum|integral to membrane|mitochondrial inner membrane	binding|transporter activity				0						TGCTCAAGTTGTGACTACATG	0.343													23	41	---	---	---	---	PASS
TLR3	7098	broad.mit.edu	37	4	187004154	187004154	+	Silent	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187004154G>T	uc003iyq.2	+	4	1415	c.1314G>T	c.(1312-1314)CTG>CTT	p.L438L	TLR3_uc011ckz.1_Silent_p.L161L|TLR3_uc003iyr.2_Silent_p.L161L	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	438	LRR 16.|Lumenal (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)|prostate(1)|lung(1)|breast(1)	5		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TACTTGACCTGGGCCTTAATG	0.413													33	64	---	---	---	---	PASS
EXOC3	11336	broad.mit.edu	37	5	454073	454073	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:454073C>A	uc003jba.2	+	4	1081	c.953C>A	c.(952-954)GCC>GAC	p.A318D		NM_007277	NP_009208	O60645	EXOC3_HUMAN	Sec6 protein	329					exocytosis|protein transport						0		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TACCACCAAGCCCTGAGCACG	0.512													5	78	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11732354	11732354	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11732354G>A	uc003jfa.1	-	2	213	c.68C>T	c.(67-69)TCA>TTA	p.S23L	CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	23					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						CTCTGAGGCTGATGAAGGCTG	0.507													32	174	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37299569	37299569	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37299569C>T	uc003jku.1	-	31	3781	c.3663G>A	c.(3661-3663)TGG>TGA	p.W1221*	NUP155_uc003jkt.1_Nonsense_Mutation_p.W1162*|NUP155_uc010iuz.1_Nonsense_Mutation_p.W1157*	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	1221					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGATATCTTGCCAAAGTGTCT	0.383													88	137	---	---	---	---	PASS
TTC33	23548	broad.mit.edu	37	5	40716430	40716430	+	Silent	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40716430T>C	uc003jma.2	-	5	754	c.606A>G	c.(604-606)CCA>CCG	p.P202P	TTC33_uc011cpm.1_Silent_p.P94P|TTC33_uc010ivg.2_3'UTR	NM_012382	NP_036514	Q6PID6	TTC33_HUMAN	tetratricopeptide repeat domain 33	202							binding			ovary(1)	1						AGTCATAGTCTGGAATTGACT	0.413													54	154	---	---	---	---	PASS
MRPS30	10884	broad.mit.edu	37	5	44815150	44815150	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44815150G>A	uc003joh.2	+	5	1204	c.1166G>A	c.(1165-1167)CGT>CAT	p.R389H		NM_016640	NP_057724	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	389					apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)					AATAACCCTCGTAAAAATATA	0.363													26	100	---	---	---	---	PASS
DIAPH1	1729	broad.mit.edu	37	5	140953560	140953560	+	Silent	SNP	A	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140953560A>G	uc003llb.3	-	16	1998	c.1857T>C	c.(1855-1857)CCT>CCC	p.P619P	DIAPH1_uc003llc.3_Silent_p.P610P|DIAPH1_uc010jgc.1_Silent_p.P58P	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1	619	FH1.				regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGCAAaggaggtggaggag	0.438													2	2	---	---	---	---	PASS
IRF4	3662	broad.mit.edu	37	6	393380	393380	+	Intron	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:393380C>T	uc003msz.3	+						IRF4_uc010jne.1_Intron|IRF4_uc003mta.3_Intron|IRF4_uc003mtb.3_Intron	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4						interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		TCTCCGGCCTCGGGAgccggc	0.562			T	IGH@	MM 								3	7	---	---	---	---	PASS
PBX2	5089	broad.mit.edu	37	6	32154671	32154671	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32154671G>A	uc003oav.1	-	7	1303	c.1032C>T	c.(1030-1032)GGC>GGT	p.G344G	AGER_uc003oar.2_5'Flank|AGER_uc011dpm.1_5'Flank|AGER_uc011dpn.1_5'Flank|AGER_uc003oal.1_5'Flank|AGER_uc010jtv.1_5'Flank|AGER_uc011dpo.1_5'Flank|AGER_uc003oam.1_5'Flank|AGER_uc003oan.1_5'Flank|AGER_uc003oap.1_5'Flank|AGER_uc003oat.1_5'Flank|AGER_uc003oao.1_5'Flank|AGER_uc003oaq.1_5'Flank|AGER_uc010jtw.1_5'Flank|AGER_uc003oas.1_5'Flank|AGER_uc003oau.1_5'Flank|AGER_uc011dpp.1_5'Flank|AGER_uc011dpq.1_5'Flank|AGER_uc011dpr.1_5'Flank|AGER_uc011dps.1_5'Flank	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	344							transcription factor binding			ovary(1)	1						TGAAAGAGCCGCCAGAGCCTT	0.527													37	35	---	---	---	---	PASS
ENPP5	59084	broad.mit.edu	37	6	46133223	46133223	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46133223C>T	uc003oxz.1	-	3	1115	c.907G>A	c.(907-909)GAA>AAA	p.E303K	ENPP5_uc003oya.1_Missense_Mutation_p.E303K|ENPP5_uc011dvz.1_Missense_Mutation_p.E209K|ENPP5_uc010jzc.1_Missense_Mutation_p.E303K	NM_021572	NP_067547	Q9UJA9	ENPP5_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	303						extracellular region|integral to membrane	hydrolase activity				0						TGCCACCTTTCTGGAACGTCT	0.398													68	107	---	---	---	---	PASS
IL17A	3605	broad.mit.edu	37	6	52052553	52052553	+	Silent	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52052553C>G	uc003pak.1	+	2	225	c.180C>G	c.(178-180)CCC>CCG	p.P60P		NM_002190	NP_002181	Q16552	IL17_HUMAN	interleukin 17A precursor	60					apoptosis|cell-cell signaling|fibroblast activation|immune response|inflammatory response|positive regulation of interleukin-23 production|positive regulation of osteoclast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein glycosylation	extracellular space	cytokine activity				0	Lung NSC(77;0.116)					ATACCAATCCCAAAAGGTCCT	0.453													76	164	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82924550	82924550	+	Intron	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82924550G>C	uc003pjl.1	-						IBTK_uc011dyv.1_Intron|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Intron|IBTK_uc003pjm.2_Intron	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		ATAAAGGCTAGAAAGAAGACA	0.323													25	108	---	---	---	---	PASS
POU3F2	5454	broad.mit.edu	37	6	99282855	99282855	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99282855G>C	uc003ppe.2	+	1	276	c.106G>C	c.(106-108)GAA>CAA	p.E36Q		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	36					positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GGGCTACCGCGAAGCGCAGAG	0.682													11	36	---	---	---	---	PASS
RFPL4B	442247	broad.mit.edu	37	6	112671180	112671180	+	Silent	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112671180C>G	uc003pvx.1	+	3	582	c.270C>G	c.(268-270)CTC>CTG	p.L90L		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	90	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		GGGAGGAGCTCCGGCATTTTC	0.527													27	66	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129419420	129419420	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129419420C>T	uc003qbn.2	+	4	604	c.499C>T	c.(499-501)CAG>TAG	p.Q167*	LAMA2_uc003qbo.2_Nonsense_Mutation_p.Q167*	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	167	Laminin N-terminal.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CAAGCCCTGGCAGTATCATGC	0.502													40	119	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495894	134495894	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495894T>A	uc003qen.3	-	1	141	c.52A>T	c.(52-54)AGG>TGG	p.R18W	SGK1_uc003qeo.3_Intron|SGK1_uc011ect.1_5'UTR|SGK1_uc011ecu.1_Missense_Mutation_p.R18W|SGK1_uc011ecv.1_Intron|SGK1_uc011ecw.1_Intron	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	18	Necessary for localization to the cytoplasm.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ACCATGCCCCTCATCCTGGAG	0.542													76	232	---	---	---	---	PASS
HBS1L	10767	broad.mit.edu	37	6	135287503	135287503	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135287503G>A	uc003qez.2	-	17	2214	c.2007C>T	c.(2005-2007)TAC>TAT	p.Y669Y	HBS1L_uc003qey.2_Silent_p.Y505Y|HBS1L_uc011ecy.1_Silent_p.Y393Y|HBS1L_uc011ecz.1_Silent_p.Y505Y|HBS1L_uc011eda.1_Silent_p.Y627Y	NM_006620	NP_006611	Q9Y450	HBS1L_HUMAN	Hsp70 subfamily B suppressor 1-like protein	669					signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		TAGAACCACCGTAACGTAGCA	0.378													45	100	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136597388	136597388	+	Silent	SNP	A	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136597388A>T	uc003qgx.1	-	5	1528	c.1275T>A	c.(1273-1275)ACT>ACA	p.T425T	BCLAF1_uc003qgw.1_Intron|BCLAF1_uc003qgy.1_Silent_p.T423T|BCLAF1_uc011edc.1_Intron|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Silent_p.T423T	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	425					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GGTGAGATGCAGTAGCAAAAC	0.403													70	379	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152472735	152472735	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152472735C>T	uc010kiw.2	-	135	25005	c.24403G>A	c.(24403-24405)GAA>AAA	p.E8135K	SYNE1_uc010kiv.2_Missense_Mutation_p.E2659K|SYNE1_uc003qos.3_Missense_Mutation_p.E2659K|SYNE1_uc003qot.3_Missense_Mutation_p.E8064K|SYNE1_uc003qou.3_Missense_Mutation_p.E8135K|SYNE1_uc003qop.3_Missense_Mutation_p.E297K|SYNE1_uc011eez.1_Missense_Mutation_p.E337K|SYNE1_uc003qoq.3_Missense_Mutation_p.E337K|SYNE1_uc003qor.3_Missense_Mutation_p.E1035K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8135	Spectrin 30.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAAAAATGTTCAATATTAGTG	0.413										HNSCC(10;0.0054)			10	45	---	---	---	---	PASS
TFB1M	51106	broad.mit.edu	37	6	155635542	155635542	+	Silent	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155635542G>C	uc003qqj.3	-	1	85	c.21C>G	c.(19-21)CTC>CTG	p.L7L	TFB1M_uc003qqk.2_RNA	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		GGCAAGTGCTGAGTTTTCCGG	0.552													27	85	---	---	---	---	PASS
MICALL2	79778	broad.mit.edu	37	7	1487280	1487280	+	Silent	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1487280T>C	uc003skj.3	-	4	603	c.456A>G	c.(454-456)CTA>CTG	p.L152L		NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1	152						cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCTGGAGATAGTGGAGGCT	0.677													9	9	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6189578	6189578	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6189578G>A	uc011jwo.1	+	13	1874	c.1751G>A	c.(1750-1752)CGC>CAC	p.R584H	USP42_uc010kth.1_Missense_Mutation_p.R517H|USP42_uc011jwp.1_Missense_Mutation_p.R584H|USP42_uc011jwq.1_Missense_Mutation_p.R391H|USP42_uc011jwr.1_Missense_Mutation_p.R429H	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	584					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGATCCCCCGCAGTGAATCC	0.527													24	53	---	---	---	---	PASS
CHN2	1124	broad.mit.edu	37	7	29552256	29552256	+	Missense_Mutation	SNP	C	A	A	rs34971642	byFrequency	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29552256C>A	uc003szz.2	+	13	1749	c.1312C>A	c.(1312-1314)CCC>ACC	p.P438T	CHN2_uc011jzs.1_Missense_Mutation_p.P513T|CHN2_uc010kva.2_3'UTR|CHN2_uc010kvb.2_RNA|CHN2_uc010kvc.2_Missense_Mutation_p.P403T|CHN2_uc011jzt.1_Missense_Mutation_p.P451T|CHN2_uc010kvd.2_Missense_Mutation_p.P294T|CHN2_uc011jzu.1_Missense_Mutation_p.P423T|CHN2_uc010kvg.2_Missense_Mutation_p.P256T|CHN2_uc010kvh.2_Missense_Mutation_p.P198T|CHN2_uc010kvi.2_Missense_Mutation_p.P230T|CHN2_uc010kve.2_3'UTR|CHN2_uc003taa.2_Missense_Mutation_p.P302T|CHN2_uc010kvf.2_Missense_Mutation_p.P244T|CHN2_uc010kvj.2_Missense_Mutation_p.P211T|CHN2_uc010kvk.2_Missense_Mutation_p.P113T|CHN2_uc010kvl.2_RNA|CHN2_uc010kvm.2_Missense_Mutation_p.P257T|CHN2_uc011jzv.1_Missense_Mutation_p.P231T	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2	438	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						TCTGATGAGGCCCCCTGAGGA	0.423													34	110	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	32109912	32109912	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32109912G>A	uc003tcm.1	-	1	563	c.94C>T	c.(94-96)CGC>TGC	p.R32C	PDE1C_uc003tcn.1_Missense_Mutation_p.R32C|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Missense_Mutation_p.R32C|PDE1C_uc003tcs.2_Missense_Mutation_p.R32C	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	32					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TACAGCCCGCGGAGCCGAAGC	0.507													6	196	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33195308	33195308	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33195308G>T	uc003tdn.1	+	4	835	c.322G>T	c.(322-324)GTC>TTC	p.V108F	BBS9_uc003tdo.1_Missense_Mutation_p.V108F|BBS9_uc003tdp.1_Missense_Mutation_p.V108F|BBS9_uc003tdq.1_Missense_Mutation_p.V108F|BBS9_uc010kwn.1_RNA|BBS9_uc011kan.1_Missense_Mutation_p.V108F|BBS9_uc011kao.1_5'Flank	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	108					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			TGTCTACTCTGTCTCAGGTAA	0.318									Bardet-Biedl_syndrome				8	28	---	---	---	---	PASS
ASL	435	broad.mit.edu	37	7	65557572	65557572	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65557572C>A	uc003tuo.2	+	16	1283	c.1172C>A	c.(1171-1173)TCC>TAC	p.S391Y	ASL_uc003tup.2_Missense_Mutation_p.S391Y|ASL_uc003tur.2_Missense_Mutation_p.S365Y|ASL_uc003tuq.2_Missense_Mutation_p.S371Y	NM_000048	NP_000039	P04424	ARLY_HUMAN	argininosuccinate lyase isoform 1	391					arginine biosynthetic process via ornithine|arginine catabolic process|urea cycle	cytosol	argininosuccinate lyase activity			breast(2)	2					L-Arginine(DB00125)	CACGAGGCCTCCGGGAAAGCT	0.637													81	192	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77885613	77885613	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77885613G>A	uc003ugx.2	-	10	1948	c.1694C>T	c.(1693-1695)CCG>CTG	p.P565L	MAGI2_uc003ugy.2_Missense_Mutation_p.P565L|MAGI2_uc010ldx.1_Missense_Mutation_p.P174L|MAGI2_uc010ldy.1_Missense_Mutation_p.P174L|MAGI2_uc011kgr.1_Missense_Mutation_p.P397L|MAGI2_uc011kgs.1_Missense_Mutation_p.P402L	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	565						cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGAATGAGGCGGCCGATCTGT	0.507													36	70	---	---	---	---	PASS
CD36	948	broad.mit.edu	37	7	80290394	80290394	+	Silent	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80290394C>A	uc003uhc.2	+	8	981	c.297C>A	c.(295-297)GCC>GCA	p.A99A	CD36_uc003uhd.3_Silent_p.A99A|CD36_uc011kgv.1_Silent_p.A23A|CD36_uc003uhe.3_Silent_p.A99A|CD36_uc003uhf.3_Silent_p.A99A|CD36_uc003uhg.3_Silent_p.A99A|CD36_uc003uhh.3_Silent_p.A99A	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen	99	Required for interaction with thrombospondins, THBS1 and THBS2.|Extracellular (Potential).				cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						GTTTTCTAGCCAAGGAAAATG	0.368													63	97	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107800802	107800802	+	Intron	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107800802T>C	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron|NRCAM_uc003vfa.2_Intron|NRCAM_uc011kmj.1_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						TCTTTCTTTCTTACCTGGATA	0.338													28	79	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	121081106	121081106	+	IGR	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121081106C>G								FAM3C (44684 upstream) : PTPRZ1 (432053 downstream)																							TTCTTGCCCCCCACCCTGAAG	0.627													32	108	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131853302	131853302	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131853302C>A	uc003vra.3	-	22	4276	c.4047G>T	c.(4045-4047)GAG>GAT	p.E1349D		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1349	Cytoplasmic (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TCAGGCCTTTCTCCACACGCT	0.612													37	45	---	---	---	---	PASS
CNOT4	4850	broad.mit.edu	37	7	135080421	135080421	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135080421G>A	uc003vsv.1	-	9	1401	c.1094C>T	c.(1093-1095)CCT>CTT	p.P365L	CNOT4_uc003vss.2_Missense_Mutation_p.P362L|CNOT4_uc011kpz.1_Missense_Mutation_p.P362L|CNOT4_uc003vst.2_Missense_Mutation_p.P365L|CNOT4_uc003vsu.1_Missense_Mutation_p.P362L|CNOT4_uc011kpy.1_Missense_Mutation_p.P365L	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	365					nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0						TGGTGCTGTAGGCCAGTCACT	0.458													136	155	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138593849	138593849	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138593849G>A	uc011kql.1	-	5	3213	c.3164C>T	c.(3163-3165)CCG>CTG	p.P1055L	KIAA1549_uc003vuk.3_Missense_Mutation_p.P1005L|KIAA1549_uc011kqj.1_Missense_Mutation_p.P1055L	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1055						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						ATCCACACTCGGAGGCACAAA	0.433			O	BRAF	pilocytic astrocytoma								20	11	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146829535	146829535	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146829535G>A	uc003weu.1	+	8	1798	c.1282G>A	c.(1282-1284)GAA>AAA	p.E428K		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	428	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGACCTCACTGAAAGCAAAGT	0.438										HNSCC(39;0.1)			33	141	---	---	---	---	PASS
CUL1	8454	broad.mit.edu	37	7	148463729	148463729	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148463729G>A	uc010lpg.2	+	8	1392	c.866G>A	c.(865-867)AGG>AAG	p.R289K	CUL1_uc003wey.2_Missense_Mutation_p.R289K|CUL1_uc003wez.2_Missense_Mutation_p.R179K	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	289					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GAATTAGCAAGGAAATGTGAA	0.388													69	72	---	---	---	---	PASS
AGAP3	116988	broad.mit.edu	37	7	150813909	150813909	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150813909C>T	uc003wjg.1	+	2	364	c.361C>T	c.(361-363)CTG>TTG	p.L121L	AGAP3_uc003wje.1_5'UTR|AGAP3_uc003wjf.1_Silent_p.L121L|AGAP3_uc010lpy.1_Silent_p.L121L|AGAP3_uc003wjh.1_Silent_p.L301L	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	85	Small GTPase-like.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						GGAGTGGACGCTGAGCCGCTC	0.687													99	137	---	---	---	---	PASS
UBE3C	9690	broad.mit.edu	37	7	157013451	157013451	+	Silent	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157013451G>T	uc010lqs.2	+	15	2295	c.1983G>T	c.(1981-1983)CCG>CCT	p.P661P	UBE3C_uc003wni.3_5'UTR	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	661					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GGATAGGCCCGCTGCAGTCCA	0.433													63	75	---	---	---	---	PASS
DLGAP2	9228	broad.mit.edu	37	8	1497519	1497519	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1497519C>A	uc003wpl.2	+	2	757	c.660C>A	c.(658-660)GAC>GAA	p.D220E	DLGAP2_uc003wpm.2_Missense_Mutation_p.D220E	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	299					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GGAGCTCGGACGACAACCTGG	0.692													73	54	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2910062	2910062	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2910062C>G	uc011kwk.1	-	50	7975	c.7585G>C	c.(7585-7587)GAA>CAA	p.E2529Q	CSMD1_uc011kwj.1_Missense_Mutation_p.E1858Q|CSMD1_uc010lrg.2_Missense_Mutation_p.E597Q	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2529	Extracellular (Potential).|Sushi 15.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGGCTGGATTCAAGCTTGAAG	0.512													6	14	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43147713	43147713	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43147713G>A	uc003xpz.1	+	1	129	c.86G>A	c.(85-87)TGC>TAC	p.C29Y	POTEA_uc003xqa.1_Missense_Mutation_p.C29Y	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	29	Cys-rich.									ovary(1)	1						AAGTGGTGCTGCTGCTGCTTC	0.587													61	48	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72936124	72936124	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72936124C>G	uc003xza.2	-	26	3249	c.3074G>C	c.(3073-3075)TGC>TCC	p.C1025S	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	1025	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TTCCCCAGTGCAAAATAAAAA	0.294													8	31	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72987580	72987580	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72987580T>C	uc003xza.2	-	1	240	c.65A>G	c.(64-66)TAT>TGT	p.Y22C		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	22	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	CACATCCTCATAGACAACGCC	0.642													59	251	---	---	---	---	PASS
STAU2	27067	broad.mit.edu	37	8	74585361	74585361	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74585361G>A	uc003xzm.2	-	6	627	c.391C>T	c.(391-393)CGG>TGG	p.R131W	STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Missense_Mutation_p.R99W|STAU2_uc011lfh.1_Missense_Mutation_p.R27W|STAU2_uc003xzo.2_Missense_Mutation_p.R131W|STAU2_uc003xzp.2_Missense_Mutation_p.R99W|STAU2_uc011lfi.1_Missense_Mutation_p.R93W|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Missense_Mutation_p.R99W|STAU2_uc010lzl.1_Intron|STAU2_uc003xzs.2_Missense_Mutation_p.R99W|STAU2_uc003xzr.2_Missense_Mutation_p.R93W	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	131	DRBM 2.				transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			TACATGCCCCGAAAGTTGTAA	0.363													18	103	---	---	---	---	PASS
OSGIN2	734	broad.mit.edu	37	8	90936800	90936800	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90936800G>A	uc003yeg.2	+	6	904	c.558G>A	c.(556-558)ATG>ATA	p.M186I	OSGIN2_uc003yeh.2_Missense_Mutation_p.M230I	NM_004337	NP_004328	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family	186					germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TAAAAGTCATGGGTCTTCAGA	0.343													93	140	---	---	---	---	PASS
PTDSS1	9791	broad.mit.edu	37	8	97321829	97321829	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97321829G>C	uc003yht.1	+	9	1154	c.1052G>C	c.(1051-1053)GGA>GCA	p.G351A	PTDSS1_uc003yhu.1_Missense_Mutation_p.G205A	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	351					phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	AAGCGCGTAGGAACACAATGC	0.428													18	95	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	105257246	105257246	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105257246C>G	uc003yls.2	+	24	3732	c.3491C>G	c.(3490-3492)TCT>TGT	p.S1164C	RIMS2_uc003ylp.2_Missense_Mutation_p.S1146C|RIMS2_uc003ylw.2_Missense_Mutation_p.S1153C|RIMS2_uc003ylq.2_Missense_Mutation_p.S960C|RIMS2_uc003ylr.2_Missense_Mutation_p.S985C	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1208					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGCCGAGAGTCTACAGATGGT	0.507										HNSCC(12;0.0054)			196	150	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110476933	110476933	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110476933G>T	uc003yne.2	+	49	7976	c.7872G>T	c.(7870-7872)ATG>ATT	p.M2624I		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2624	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGTTTGGAATGTGGATCTTTG	0.403										HNSCC(38;0.096)			251	302	---	---	---	---	PASS
ZC3H3	23144	broad.mit.edu	37	8	144522215	144522215	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144522215G>A	uc003yyd.2	-	11	2840	c.2811C>T	c.(2809-2811)GAC>GAT	p.D937D		NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	937					mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GCCTACCTGAGTCCTTGGTGA	0.716													8	10	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144943414	144943414	+	Silent	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144943414G>C	uc003zaa.1	-	1	4021	c.4008C>G	c.(4006-4008)CTC>CTG	p.L1336L		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1336	Plectin 23.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCACAGAGAGAGGGAGGCCC	0.687													38	167	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144944503	144944503	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144944503G>C	uc003zaa.1	-	1	2932	c.2919C>G	c.(2917-2919)ATC>ATG	p.I973M		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	973	Plectin 18.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GAGGGTCCATGATGGTTCCGG	0.701													7	19	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145663860	145663860	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145663860C>T	uc011llg.1	-	13	1662	c.1647G>A	c.(1645-1647)GTG>GTA	p.V549V	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	549	ANK 1.				cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCACCTGCCTCACAAGGTCCT	0.517													38	149	---	---	---	---	PASS
KANK1	23189	broad.mit.edu	37	9	712577	712577	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:712577G>A	uc003zgl.1	+	7	2460	c.1811G>A	c.(1810-1812)AGC>AAC	p.S604N	KANK1_uc003zgm.2_Missense_Mutation_p.S604N|KANK1_uc003zgn.1_Missense_Mutation_p.S604N|KANK1_uc003zgo.1_Missense_Mutation_p.S604N|KANK1_uc003zgp.1_Missense_Mutation_p.S604N|KANK1_uc003zgq.2_Missense_Mutation_p.S446N|KANK1_uc003zgr.1_Missense_Mutation_p.S446N|KANK1_uc003zgs.1_Missense_Mutation_p.S446N	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a	604					negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GAAACAGGCAGCAACACAGAG	0.498													48	222	---	---	---	---	PASS
AKNA	80709	broad.mit.edu	37	9	117113193	117113193	+	Missense_Mutation	SNP	G	A	A	rs139913868	byFrequency	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117113193G>A	uc004biq.3	-	14	3302	c.3167C>T	c.(3166-3168)CCC>CTC	p.P1056L	AKNA_uc004bin.3_Missense_Mutation_p.P303L|AKNA_uc004bio.3_Missense_Mutation_p.P516L|AKNA_uc004bip.3_Missense_Mutation_p.P975L|AKNA_uc004bir.3_Missense_Mutation_p.P1056L|AKNA_uc004bis.3_Missense_Mutation_p.P1056L|AKNA_uc010mve.2_Missense_Mutation_p.P937L|AKNA_uc004bit.1_RNA	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1056					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						TGGTCCACAGGGTAGAGGCGC	0.587													125	81	---	---	---	---	PASS
CIZ1	25792	broad.mit.edu	37	9	130931780	130931780	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130931780G>A	uc004btt.2	-	13	2213	c.2050C>T	c.(2050-2052)CGA>TGA	p.R684*	CIZ1_uc004btr.2_Nonsense_Mutation_p.R656*|CIZ1_uc004bts.2_Nonsense_Mutation_p.R655*|CIZ1_uc011maq.1_Nonsense_Mutation_p.R623*|CIZ1_uc004btu.2_Nonsense_Mutation_p.R604*|CIZ1_uc011mar.1_Nonsense_Mutation_p.R583*|CIZ1_uc011mas.1_Nonsense_Mutation_p.R740*|CIZ1_uc004btw.2_Nonsense_Mutation_p.R628*|CIZ1_uc004btv.2_Nonsense_Mutation_p.R684*	NM_001131016	NP_001124488	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1 isoform	684						nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4						CAGAAGGGTCGCAAGGATTGT	0.567													60	31	---	---	---	---	PASS
MED22	6837	broad.mit.edu	37	9	136208458	136208458	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136208458G>A	uc004cdc.2	-	5	734	c.500C>T	c.(499-501)TCG>TTG	p.S167L	MED22_uc004cdd.2_3'UTR	NM_133640	NP_598395	Q15528	MED22_HUMAN	mediator complex subunit 22 isoform b	167					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|mediator complex|soluble fraction	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		CAGAGGGGCCGAGAGGCCATC	0.657													16	45	---	---	---	---	PASS
ANAPC2	29882	broad.mit.edu	37	9	140076197	140076197	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140076197C>T	uc004clr.1	-	7	1477	c.1404G>A	c.(1402-1404)CAG>CAA	p.Q468Q	ANAPC2_uc004clq.1_Silent_p.Q324Q	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2	468					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		CCTCACTGTCCTGGCCTGTCT	0.647													30	16	---	---	---	---	PASS
PNPLA7	375775	broad.mit.edu	37	9	140396107	140396107	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140396107C>T	uc004cnf.2	-	14	1808	c.1471G>A	c.(1471-1473)GAC>AAC	p.D491N	C9orf167_uc011mew.1_Intron|PNPLA7_uc011mfa.1_Intron|PNPLA7_uc010ncj.1_Missense_Mutation_p.D516N	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	491	cNMP 2.				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		CTCACCTGGTCTCCCTGCCTT	0.622													11	35	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1313259	1313259	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1313259G>A	uc009xhq.2	-	4	1457	c.1083C>T	c.(1081-1083)TTC>TTT	p.F361F		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	361					mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TGGAGTCTGCGAATTCCTGAA	0.612													14	38	---	---	---	---	PASS
PHYH	5264	broad.mit.edu	37	10	13330438	13330438	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13330438G>T	uc001imf.2	-	6	688	c.600C>A	c.(598-600)AGC>AGA	p.S200R	PHYH_uc001ime.2_Missense_Mutation_p.S100R|PHYH_uc001img.2_Missense_Mutation_p.S183R	NM_006214	NP_006205	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase isoform a precursor	200					fatty acid alpha-oxidation|nervous system development	peroxisomal matrix	electron carrier activity|L-ascorbic acid binding|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|phytanoyl-CoA dioxygenase activity|protein binding				0		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	CGTTGTTCCGGCTGATGTGCT	0.627													41	99	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33199223	33199223	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33199223C>T	uc001iws.3	-	14	2228	c.2092G>A	c.(2092-2094)GAC>AAC	p.D698N	ITGB1_uc001iwp.3_Missense_Mutation_p.D698N|ITGB1_uc001iwq.3_Missense_Mutation_p.D698N|ITGB1_uc001iwr.3_Missense_Mutation_p.D698N|ITGB1_uc001iwt.3_Missense_Mutation_p.D698N|ITGB1_uc001iwu.1_Missense_Mutation_p.D698N	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	698	Extracellular (Potential).				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				AACCAACAGTCGTCAACATCC	0.433													15	31	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	67680201	67680201	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67680201T>A	uc009xpn.1	-	18	2698	c.2575A>T	c.(2575-2577)ATT>TTT	p.I859F	CTNNA3_uc001jmw.2_Missense_Mutation_p.I859F	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	859					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						TCTCTTTTAATCAAGGGTTTT	0.473													56	163	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68040305	68040305	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68040305C>T	uc009xpn.1	-	13	1930	c.1807G>A	c.(1807-1809)GAT>AAT	p.D603N	CTNNA3_uc001jmw.2_Missense_Mutation_p.D603N	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	603					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						AATTGATTATCATCCAACACA	0.338													20	70	---	---	---	---	PASS
DLG5	9231	broad.mit.edu	37	10	79588710	79588710	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79588710G>T	uc001jzk.2	-	13	2289	c.2219C>A	c.(2218-2220)GCT>GAT	p.A740D	DLG5_uc001jzj.2_Missense_Mutation_p.A495D|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Missense_Mutation_p.A344D	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	740	PDZ 2.				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CACAGCGGCAGCATACACTCC	0.617													13	39	---	---	---	---	PASS
C10orf58	84293	broad.mit.edu	37	10	82185670	82185670	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82185670G>A	uc001kcc.3	+	4	479	c.319G>A	c.(319-321)GTC>ATC	p.V107I	C10orf58_uc001kcd.3_Missense_Mutation_p.V96I|C10orf58_uc001kce.3_Missense_Mutation_p.V107I|C10orf58_uc001kcf.3_Missense_Mutation_p.V107I	NM_032333	NP_115709	Q9BRX8	CJ058_HUMAN	hypothetical protein LOC84293 precursor	107						extracellular region					0			Colorectal(32;0.229)			CCAGCTGGGCGTCCCCCTCTA	0.517													12	153	---	---	---	---	PASS
RBP4	5950	broad.mit.edu	37	10	95361474	95361474	+	5'Flank	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95361474C>T	uc001kit.2	-							NM_006744	NP_006735	P02753	RET4_HUMAN	retinol-binding protein 4, plasma precursor						cardiac muscle tissue development|embryonic organ morphogenesis|embryonic retina morphogenesis in camera-type eye|embryonic skeletal system development|female genitalia morphogenesis|gluconeogenesis|glucose homeostasis|heart trabecula formation|lung development|maintenance of gastrointestinal epithelium|negative regulation of cardiac muscle cell proliferation|positive regulation of immunoglobulin secretion|positive regulation of insulin secretion|response to retinoic acid|retinol metabolic process|urinary bladder development|uterus development|vagina development	extracellular space	protein binding|retinal binding|retinol binding				0		Colorectal(252;0.122)			Vitamin A(DB00162)	AATAATTCATCCAAGTAGTTT	0.453													15	22	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	116887419	116887419	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116887419G>A	uc001lcg.2	+	4	940	c.554G>A	c.(553-555)GGC>GAC	p.G185D	ATRNL1_uc001lce.2_RNA|ATRNL1_uc001lcf.2_Missense_Mutation_p.G185D|ATRNL1_uc009xyq.2_Missense_Mutation_p.G185D	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	185	CUB.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ACTACATCTGGCTATGCACTG	0.313													5	16	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127760061	127760061	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127760061G>A	uc001ljk.2	-	12	1730	c.1317C>T	c.(1315-1317)GAC>GAT	p.D439D	ADAM12_uc010qul.1_Silent_p.D390D|ADAM12_uc001ljm.2_Silent_p.D439D|ADAM12_uc001ljn.2_Silent_p.D436D|ADAM12_uc001ljl.3_Silent_p.D436D	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	439	Extracellular (Potential).|Disintegrin.				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GCTCCCCACAGTCACACTCCT	0.512													89	249	---	---	---	---	PASS
RBMXL2	27288	broad.mit.edu	37	11	7111037	7111037	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7111037G>A	uc001mfc.2	+	1	873	c.686G>A	c.(685-687)CGG>CAG	p.R229Q		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	229	Arg/Gly/Pro-rich.					nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGCGAACCCCGGGGTTTTGCC	0.701													11	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30930511	30930511	+	RNA	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30930511T>C	uc001mss.1	-	7		c.1003A>G			uc009yjk.1_Silent_p.E748E|uc009yjj.1_5'Flank					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		CAATGTTTTCTTCTTTAATCA	0.323													17	35	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595392	55595392	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595392G>C	uc001nhy.1	+	1	698	c.698G>C	c.(697-699)AGC>ACC	p.S233T		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TCTGCAGAGAGCAGGCACAAA	0.493										HNSCC(27;0.073)			7	226	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944170	55944170	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944170T>G	uc010rjb.1	+	1	77	c.77T>G	c.(76-78)GTG>GGG	p.V26G		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	26	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					CTAAAAGCTGTGCTTTTTGTG	0.388													91	245	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468176	56468176	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468176G>A	uc010rjn.1	+	1	313	c.313G>A	c.(313-315)GGG>AGG	p.G105R		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	105	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTTCTCTGCAGGGCTGGCCTA	0.527													19	214	---	---	---	---	PASS
OR5B12	390191	broad.mit.edu	37	11	58207516	58207516	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58207516G>C	uc010rkh.1	-	1	109	c.109C>G	c.(109-111)CTG>GTG	p.L37V		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TTCCCAACCAGAGTGATGAGG	0.483													49	108	---	---	---	---	PASS
EEF1G	1937	broad.mit.edu	37	11	62339045	62339045	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62339045G>A	uc001ntm.1	-	4	491	c.345C>T	c.(343-345)TTC>TTT	p.F115F	EEF1G_uc010rlw.1_Silent_p.F165F|EEF1G_uc001ntn.1_5'UTR	NM_001404	NP_001395	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1	115	GST C-terminal.				response to virus	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						CCAAGGTGGGGAACACCCAGG	0.587													4	9	---	---	---	---	PASS
EEF1G	1937	broad.mit.edu	37	11	62340129	62340129	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62340129G>C	uc001ntm.1	-	2	244	c.98C>G	c.(97-99)TCC>TGC	p.S33C	EEF1G_uc010rlw.1_Missense_Mutation_p.S83C|EEF1G_uc001ntn.1_5'UTR	NM_001404	NP_001395	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1	33	GST N-terminal.				response to virus	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						GGGTGGTGCGGAGAGCACGCG	0.567													65	153	---	---	---	---	PASS
CABP2	51475	broad.mit.edu	37	11	67287587	67287587	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67287587G>T	uc001omc.1	-	5	526	c.424C>A	c.(424-426)CCC>ACC	p.P142T	CABP2_uc001omd.1_Missense_Mutation_p.P85T|CABP2_uc001ome.1_Missense_Mutation_p.P148T	NM_016366	NP_057450	Q9NPB3	CABP2_HUMAN	calcium binding protein 2 isoform 1	142	EF-hand 2.				signal transduction	Golgi apparatus|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1						AGCAGCTTGGGGCCCATCAGC	0.672													16	48	---	---	---	---	PASS
GDPD4	220032	broad.mit.edu	37	11	76956540	76956540	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76956540G>T	uc001oyf.2	-	11	1123	c.872C>A	c.(871-873)CCA>CAA	p.P291Q		NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain	291	GDPD.|Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						ATTGTAAAATGGCCTGAGCTA	0.378													25	69	---	---	---	---	PASS
ACSM4	341392	broad.mit.edu	37	12	7477188	7477188	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7477188C>T	uc001qsx.1	+	11	1530	c.1530C>T	c.(1528-1530)CGC>CGT	p.R510R		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	510					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						ATCAAATCCGCGGAGAGGTAG	0.428													15	107	---	---	---	---	PASS
AICDA	57379	broad.mit.edu	37	12	8758043	8758043	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8758043G>A	uc001qur.2	-	3	274	c.195C>T	c.(193-195)ATC>ATT	p.I65I	AICDA_uc001qup.1_Silent_p.I60I|AICDA_uc001quq.1_Silent_p.I60I|AICDA_uc009zgd.1_Intron	NM_020661	NP_065712	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	65					B cell differentiation|DNA demethylation|mRNA processing|negative regulation of methylation-dependent chromatin silencing	cytoplasm	cytidine deaminase activity|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung SC(5;0.184)					CCCAGTCCGAGATGTAGCGGA	0.582									Immune_Deficiency_with_Hyper-IgM				23	159	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9000285	9000285	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9000285C>A	uc001quz.3	+	15	1922	c.1824C>A	c.(1822-1824)AGC>AGA	p.S608R	A2ML1_uc001qva.1_Missense_Mutation_p.S188R|A2ML1_uc010sgm.1_Missense_Mutation_p.S108R	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	452						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						GAGAGCTGAGCAACCGCTCTG	0.557													136	271	---	---	---	---	PASS
CSDA	8531	broad.mit.edu	37	12	10875467	10875467	+	Missense_Mutation	SNP	C	G	G	rs148187553	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10875467C>G	uc001qyt.2	-	1	487	c.244G>C	c.(244-246)GCG>CCG	p.A82P	CSDA_uc001qyu.2_Missense_Mutation_p.A82P	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a	82					negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					TTTTTCTCCGCGTCTTCGCTG	0.393													9	18	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21349929	21349929	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21349929G>A	uc001req.3	+	8	881	c.777G>A	c.(775-777)TGG>TGA	p.W259*		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	259	Helical; Name=6; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	GAGCTTGGTGGCTTAATTTCC	0.348													74	140	---	---	---	---	PASS
FMNL3	91010	broad.mit.edu	37	12	50048058	50048058	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50048058C>A	uc001ruv.1	-	11	1222	c.988G>T	c.(988-990)GTG>TTG	p.V330L	FMNL3_uc001ruw.1_Missense_Mutation_p.V279L|FMNL3_uc001rut.1_5'Flank|FMNL3_uc001ruu.1_Missense_Mutation_p.V180L	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1	330	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						GAGTGCACCACGATGTTGATG	0.577													37	59	---	---	---	---	PASS
NR4A1	3164	broad.mit.edu	37	12	52450830	52450830	+	Intron	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52450830C>T	uc001rzs.2	+						NR4A1_uc010sno.1_Intron|NR4A1_uc001rzt.2_Intron|NR4A1_uc009zmc.2_Intron	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CCCACTGGACCGTCTTCCTAG	0.423													6	23	---	---	---	---	PASS
FRS2	10818	broad.mit.edu	37	12	69968110	69968110	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69968110T>C	uc001suy.2	+	10	1412	c.902T>C	c.(901-903)GTT>GCT	p.V301A	FRS2_uc001suz.2_Missense_Mutation_p.V301A|FRS2_uc009zrj.2_Missense_Mutation_p.V301A|FRS2_uc009zrk.2_Missense_Mutation_p.V301A	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	301					activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity			prostate(1)|kidney(1)	2	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GCACCCTCTGTTAACAAACTG	0.468													47	185	---	---	---	---	PASS
KCNC2	3747	broad.mit.edu	37	12	75437012	75437012	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75437012T>G	uc001sxg.1	-	5	2334	c.1790A>C	c.(1789-1791)AAA>ACA	p.K597T	KCNC2_uc009zry.2_Intron|KCNC2_uc001sxe.2_Intron|KCNC2_uc001sxf.2_Intron|KCNC2_uc010stw.1_Missense_Mutation_p.K542T	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	597	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						GCTTCGGGATTTTTCATATCC	0.428													26	70	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101595999	101595999	+	Intron	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101595999G>T	uc001thz.3	-							NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),						apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						AGAATCTAGGGGGGAGAAAGA	0.333													14	38	---	---	---	---	PASS
FICD	11153	broad.mit.edu	37	12	108910749	108910749	+	5'UTR	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108910749G>C	uc001tmx.1	+	2						NM_007076	NP_009007	Q9BVA6	FICD_HUMAN	Huntingtin interacting protein E						negative regulation of Rho GTPase activity	integral to membrane	binding|protein adenylyltransferase activity				0						CCTGAGTCCAGATGATGCTCA	0.582													35	143	---	---	---	---	PASS
RAD9B	144715	broad.mit.edu	37	12	110950672	110950672	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110950672G>C	uc001trf.3	+	5	615	c.477G>C	c.(475-477)ATG>ATC	p.M159I	RAD9B_uc001trg.3_Missense_Mutation_p.M159I|RAD9B_uc010sya.1_Intron|RAD9B_uc001tre.3_Missense_Mutation_p.M87I|RAD9B_uc001trd.3_Missense_Mutation_p.M1I	NM_152442	NP_689655	Q6WBX8	RAD9B_HUMAN	RAD9 homolog B	156					cell cycle checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding			pancreas(1)|skin(1)	2						ATACGCTAATGATTCAACCAA	0.333											OREG0022115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	9	---	---	---	---	PASS
SRRM4	84530	broad.mit.edu	37	12	119419763	119419763	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119419763C>A	uc001txa.1	+	1	368	c.76C>A	c.(76-78)CCC>ACC	p.P26T		NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein	26					cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						GGTGGCCACCCCCCGTCCCGA	0.597													7	26	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124163771	124163771	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124163771C>T	uc001ufp.2	+	5	627	c.499C>T	c.(499-501)CCC>TCC	p.P167S	TCTN2_uc009zya.2_Missense_Mutation_p.P166S	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	167	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		GGTGTATCAGCCCCTTGGCCC	0.438													103	339	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124352116	124352116	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124352116A>T	uc001uft.3	+	41	6941	c.6916A>T	c.(6916-6918)AAG>TAG	p.K2306*		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2306					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGAAAAGCTGAAGACAATAGT	0.398													31	31	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133360905	133360905	+	Intron	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133360905G>A	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TAAGGGCCAAGATGGAACGGG	0.617													14	172	---	---	---	---	PASS
C13orf26	122046	broad.mit.edu	37	13	31543082	31543082	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31543082A>G	uc001uti.2	+	6	726	c.707A>G	c.(706-708)TAC>TGC	p.Y236C		NM_152325	NP_689538	Q8N6G2	CM026_HUMAN	hypothetical protein LOC122046	236										ovary(2)|skin(1)	3		Lung SC(185;0.0281)		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)		CAGACCACATACCAAAGTGAC	0.443													121	93	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41507906	41507906	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41507906C>A	uc001uxs.2	-	9	1888	c.1515G>T	c.(1513-1515)CAG>CAT	p.Q505H	ELF1_uc010tfc.1_Missense_Mutation_p.Q481H|ELF1_uc010acd.2_Missense_Mutation_p.Q398H	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	505					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TAAGGACCTGCTGAACCTGGG	0.507													146	108	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61988090	61988090	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61988090G>C	uc001vid.3	-	2	506	c.142C>G	c.(142-144)CTG>GTG	p.L48V	PCDH20_uc010thj.1_Missense_Mutation_p.L48V	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	21					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		AGGAAAAACAGAAACAGATGC	0.577													12	44	---	---	---	---	PASS
DOCK9	23348	broad.mit.edu	37	13	99508182	99508182	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99508182C>G	uc001vnt.2	-	34	3859	c.3804G>C	c.(3802-3804)AGG>AGC	p.R1268S	DOCK9_uc001vnw.2_Missense_Mutation_p.R1267S|DOCK9_uc001vnv.1_RNA|DOCK9_uc010tir.1_Missense_Mutation_p.R1268S|DOCK9_uc010tip.1_5'Flank|DOCK9_uc010tiq.1_Missense_Mutation_p.R246S|DOCK9_uc010afu.1_3'UTR	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a	1268					blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCTCACTATTCCTTTCTGGAA	0.398													6	274	---	---	---	---	PASS
ARGLU1	55082	broad.mit.edu	37	13	107209491	107209491	+	Intron	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107209491G>A	uc001vqk.3	-						ARGLU1_uc010age.1_3'UTR	NM_018011	NP_060481	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1												0	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TAAAGGGGAGGATATGTTAAG	0.343													29	126	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92091159	92091159	+	Intron	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92091159C>A	uc001xzs.1	-						CATSPERB_uc010aub.1_Intron	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TATTATTATACCTACCTTGTG	0.294													3	67	---	---	---	---	PASS
SNRPN	6638	broad.mit.edu	37	15	25222054	25222054	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25222054G>A	uc001ywp.1	+	10	1188	c.298G>A	c.(298-300)GCT>ACT	p.A100T	SNRPN_uc001ywq.1_Missense_Mutation_p.A100T|SNRPN_uc001ywr.1_Missense_Mutation_p.A100T|SNRPN_uc001yws.1_Missense_Mutation_p.A100T|SNRPN_uc001ywt.1_Missense_Mutation_p.A100T|SNRPN_uc001ywv.1_Missense_Mutation_p.A103T|SNRPN_uc001yww.1_Missense_Mutation_p.A100T|SNRPN_uc001ywx.1_Missense_Mutation_p.A100T|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	100					RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		ACTTGCTGGAGCTGCTGGAGG	0.517									Prader-Willi_syndrome				56	119	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41817271	41817271	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41817271C>T	uc001zod.2	-	15	2117	c.1993G>A	c.(1993-1995)GAG>AAG	p.E665K	RPAP1_uc001zoc.2_5'Flank	NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	665						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCAGCTTCCTCTGGGGGCAAG	0.617													42	51	---	---	---	---	PASS
GOLGA6A	342096	broad.mit.edu	37	15	74365125	74365125	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74365125G>A	uc002axa.1	-	13	1500	c.1459C>T	c.(1459-1461)CAG>TAG	p.Q487*		NM_001038640	NP_001033729	Q9NYA3	GOG6A_HUMAN	golgi autoantigen, golgin subfamily a, 6	487	Potential.										0						GTCTCTAGCTGTTGGTTCTGG	0.612													42	230	---	---	---	---	PASS
PDE8A	5151	broad.mit.edu	37	15	85619972	85619972	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85619972G>C	uc002blh.2	+	5	689	c.500G>C	c.(499-501)AGA>ACA	p.R167T	PDE8A_uc002bli.2_Missense_Mutation_p.R167T|PDE8A_uc010bnc.2_5'UTR|PDE8A_uc010bnd.2_5'UTR|PDE8A_uc002blj.2_5'UTR|PDE8A_uc002blk.2_5'UTR	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	167					cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			AGGGTGGATAGAGAAGAGTTG	0.289													15	156	---	---	---	---	PASS
OR4F6	390648	broad.mit.edu	37	15	102346255	102346255	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102346255G>C	uc010utr.1	+	1	333	c.333G>C	c.(331-333)GAG>GAC	p.E111D		NM_001005326	NP_001005326	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F,	111	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GGGGAACTGAGATGGTGCTGC	0.458													20	507	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1510444	1510444	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1510444C>T	uc002clv.2	-	6	679	c.569G>A	c.(568-570)GGC>GAC	p.G190D	CLCN7_uc002clw.2_Missense_Mutation_p.G166D	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	190	Helical; (By similarity).					integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				AATCACAGAGCCCACGAGCAC	0.597													54	93	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2153650	2153650	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2153650C>A	uc002cos.1	-	23	8617	c.8408G>T	c.(8407-8409)GGC>GTC	p.G2803V	PKD1_uc002cot.1_Missense_Mutation_p.G2803V|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2803	Extracellular (Potential).|REJ.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GAAGTGGCAGCCAGGCCCTGG	0.667													36	75	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9892311	9892311	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9892311C>T	uc002czo.3	-	11	2727	c.2179G>A	c.(2179-2181)GCT>ACT	p.A727T	GRIN2A_uc010uym.1_Missense_Mutation_p.A727T|GRIN2A_uc010uyn.1_Missense_Mutation_p.A570T|GRIN2A_uc002czr.3_Missense_Mutation_p.A727T	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	727	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TAGATGAAAGCGTCCAGCTTC	0.572													19	52	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24895442	24895442	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24895442G>C	uc002dmu.2	+	8	886	c.654G>C	c.(652-654)TTG>TTC	p.L218F	SLC5A11_uc002dms.2_Missense_Mutation_p.L154F|SLC5A11_uc010vcd.1_Missense_Mutation_p.L183F|SLC5A11_uc002dmt.2_Missense_Mutation_p.L154F|SLC5A11_uc010vce.1_Missense_Mutation_p.L148F|SLC5A11_uc010bxt.2_Missense_Mutation_p.L154F	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	218	Helical; (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		CGCTCACCTTGATGGGCTACA	0.592													117	301	---	---	---	---	PASS
CLN3	1201	broad.mit.edu	37	16	28493970	28493970	+	Missense_Mutation	SNP	G	A	A	rs113041302		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28493970G>A	uc002dpo.2	-	10	1137	c.814C>T	c.(814-816)CGG>TGG	p.R272W	uc010vct.1_Intron|CLN3_uc002dpl.2_Missense_Mutation_p.R194W|CLN3_uc010vcu.1_Missense_Mutation_p.R172W|CLN3_uc002dpn.2_Missense_Mutation_p.R173W|CLN3_uc002dpm.2_Missense_Mutation_p.R218W|CLN3_uc010vcv.1_Missense_Mutation_p.R248W|CLN3_uc010byd.2_Missense_Mutation_p.R272W|CLN3_uc002dpp.2_Missense_Mutation_p.R272W|CLN3_uc002dpt.1_Missense_Mutation_p.R172W|CLN3_uc002dpq.1_Missense_Mutation_p.R224W|CLN3_uc010bye.1_Missense_Mutation_p.R272W|CLN3_uc002dpr.1_RNA|CLN3_uc010byf.1_RNA|CLN3_uc002dps.1_Missense_Mutation_p.R145W|CLN3_uc002dpu.1_Missense_Mutation_p.R170W|CLN3_uc002dpw.1_Missense_Mutation_p.R119W|CLN3_uc010vcw.1_Missense_Mutation_p.R218W|CLN3_uc002dqa.2_Missense_Mutation_p.R323W|CLN3_uc010vcx.1_Missense_Mutation_p.R172W|CLN3_uc002dpx.1_Missense_Mutation_p.R149W|CLN3_uc002dpy.1_Missense_Mutation_p.R116W	NM_000086	NP_000077	Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	272					amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding				0						CACCTTTCCCGAAGGGAGAGG	0.562													55	96	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30748643	30748643	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30748643C>T	uc002dze.1	+	34	7667	c.7282C>T	c.(7282-7284)CGC>TGC	p.R2428C	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.R2223C	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2428	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CACACCACCCCGCTGCAGTCC	0.413													21	67	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31089490	31089490	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31089490G>A	uc002eap.2	+	2	2134	c.1845G>A	c.(1843-1845)AGG>AGA	p.R615R		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	615					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						CACCTCCTAGGGCCTTTGCCT	0.547													28	53	---	---	---	---	PASS
MMP2	4313	broad.mit.edu	37	16	55516925	55516925	+	Silent	SNP	A	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55516925A>C	uc002ehz.3	+	2	569	c.258A>C	c.(256-258)ACA>ACC	p.T86T	MMP2_uc010vhd.1_Silent_p.T10T|MMP2_uc010ccc.2_Silent_p.T36T	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a	86					angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	TGCCCCAGACAGGTGATCTTG	0.537													64	171	---	---	---	---	PASS
KATNB1	10300	broad.mit.edu	37	16	57787893	57787893	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57787893C>A	uc002eml.1	+	13	1588	c.1214C>A	c.(1213-1215)GCA>GAA	p.A405E		NM_005886	NP_005877	Q9BVA0	KTNB1_HUMAN	katanin p80 subunit B 1	405	Interaction with PAFAH1B1 (By similarity).				cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity				0		all_neural(199;0.223)				CCCTTCCCTGCACCCCCAGAG	0.662													37	65	---	---	---	---	PASS
CHST6	4166	broad.mit.edu	37	16	75512862	75512862	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75512862C>T	uc002fef.2	-	3	1045	c.865G>A	c.(865-867)GCC>ACC	p.A289T	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.A289T	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	289	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						CCAGTGAAGGCGTAGAGCGCA	0.657													45	104	---	---	---	---	PASS
ZBTB4	57659	broad.mit.edu	37	17	7365286	7365286	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7365286C>T	uc002ghc.3	-	4	3265	c.3015G>A	c.(3013-3015)GAG>GAA	p.E1005E	ZBTB4_uc002ghd.3_Silent_p.E1005E	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	1005					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		TCTGGGTTCTCTCAACCCCTG	0.622													7	155	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577105	7577105	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577105G>C	uc002gim.2	-	8	1027	c.833C>G	c.(832-834)CCT>CGT	p.P278R	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.P278R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P146R|TP53_uc010cng.1_Missense_Mutation_p.P146R|TP53_uc002gii.1_Missense_Mutation_p.P146R|TP53_uc010cnh.1_Missense_Mutation_p.P278R|TP53_uc010cni.1_Missense_Mutation_p.P278R|TP53_uc002gij.2_Missense_Mutation_p.P278R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	278	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P278L(52)|p.P278S(48)|p.P278R(26)|p.P278T(21)|p.P278A(17)|p.P278H(11)|p.0?(7)|p.P278fs*67(5)|p.P278F(3)|p.P278fs*28(2)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.V274_P278del(1)|p.P278P(1)|p.C277_P278insXXXXXXX(1)|p.F270_D281del12(1)|p.P278_G279insXXXXX(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTCTCTCCCAGGACAGGCACA	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			61	35	---	---	---	---	PASS
NTN1	9423	broad.mit.edu	37	17	8926324	8926324	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8926324C>T	uc002glw.3	+	2	741	c.634C>T	c.(634-636)CCG>TCG	p.P212S		NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor	212	Laminin N-terminal.				apoptosis|axon guidance		protein binding				0						CGACATGCGCCCGCTCTCGGG	0.697													6	23	---	---	---	---	PASS
TTC19	54902	broad.mit.edu	37	17	15928468	15928468	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15928468G>A	uc002gph.1	+	8	1195	c.1177G>A	c.(1177-1179)GGA>AGA	p.G393R	TTC19_uc010cox.1_RNA|TTC19_uc002gpk.3_Missense_Mutation_p.G35R|TTC19_uc002gpj.2_Missense_Mutation_p.G35R	NM_017775	NP_060245	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19	272					cell cycle|cytokinesis|mitochondrial respiratory chain complex III assembly	centrosome|midbody|mitochondrial inner membrane	protein binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		AGAAATACAAGGAGAAAGACA	0.448													3	65	---	---	---	---	PASS
ATAD5	79915	broad.mit.edu	37	17	29192760	29192760	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29192760C>T	uc002hfs.1	+	11	3521	c.3175C>T	c.(3175-3177)CAA>TAA	p.Q1059*	ATAD5_uc002hft.1_Nonsense_Mutation_p.Q956*	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1059					response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGAAAAGTATCAACCTCAGAC	0.294													8	56	---	---	---	---	PASS
ATAD5	79915	broad.mit.edu	37	17	29192766	29192766	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29192766C>T	uc002hfs.1	+	11	3527	c.3181C>T	c.(3181-3183)CAG>TAG	p.Q1061*	ATAD5_uc002hft.1_Nonsense_Mutation_p.Q958*	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1061					response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GTATCAACCTCAGACTGCCAG	0.299													7	57	---	---	---	---	PASS
ATAD5	79915	broad.mit.edu	37	17	29192774	29192774	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29192774C>T	uc002hfs.1	+	11	3535	c.3189C>T	c.(3187-3189)GCC>GCT	p.A1063A	ATAD5_uc002hft.1_Silent_p.A960A	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1063					response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				CTCAGACTGCCAGTGAACTTA	0.303													6	57	---	---	---	---	PASS
LRRC46	90506	broad.mit.edu	37	17	45913745	45913745	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45913745C>A	uc002ima.2	+	7	755	c.499C>A	c.(499-501)CAG>AAG	p.Q167K	LRRC46_uc002imb.2_Missense_Mutation_p.Q120K	NM_033413	NP_219481	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	167	LRRCT.									ovary(1)	1						CCTGGACGGGCAGCCTGTGGT	0.607													46	80	---	---	---	---	PASS
MSI2	124540	broad.mit.edu	37	17	55693391	55693391	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55693391G>A	uc002iuz.1	+	9	771	c.598G>A	c.(598-600)GCC>ACC	p.A200T	MSI2_uc010wnm.1_Missense_Mutation_p.A178T|MSI2_uc002iva.2_Missense_Mutation_p.A196T	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a	200						cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		AAGAGGCCGGGCCCGGGGACT	0.488			T	HOXA9	CML								83	253	---	---	---	---	PASS
TMEM49	81671	broad.mit.edu	37	17	57816265	57816265	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57816265C>G	uc002ixu.3	+	5	644	c.371C>G	c.(370-372)TCT>TGT	p.S124C	TMEM49_uc010wog.1_5'UTR|TMEM49_uc010woh.1_Missense_Mutation_p.S124C|TMEM49_uc010woi.1_Missense_Mutation_p.S27C|TMEM49_uc010woj.1_Intron	NM_030938	NP_112200	Q96GC9	VMP1_HUMAN	transmembrane protein 49	124	Helical; (Potential).				autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)			ATTTTGTCTTCTGTTGGGCTT	0.353													72	167	---	---	---	---	PASS
CA4	762	broad.mit.edu	37	17	58233923	58233923	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58233923C>G	uc002iym.3	+	3	209	c.115C>G	c.(115-117)CCA>GCA	p.P39A	CA4_uc010wou.1_RNA	NM_000717	NP_000708	P22748	CAH4_HUMAN	carbonic anhydrase IV precursor	39					bicarbonate transport|one-carbon metabolic process	anchored to external side of plasma membrane|apical plasma membrane|brush border membrane|ER-Golgi intermediate compartment|membrane fraction|perinuclear region of cytoplasm|rough endoplasmic reticulum|secretory granule membrane|trans-Golgi network|transport vesicle membrane	carbonate dehydratase activity|protein binding|zinc ion binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	CTGCTCAGTGCCAGTCAAGTG	0.592													50	135	---	---	---	---	PASS
MARCH10	162333	broad.mit.edu	37	17	60865910	60865910	+	Silent	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60865910G>C	uc010ddr.2	-	3	379	c.141C>G	c.(139-141)CGC>CGG	p.R47R	MARCH10_uc002jag.3_Silent_p.R47R|MARCH10_uc010dds.2_Silent_p.R47R|MARCH10_uc002jah.2_Silent_p.R47R	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	47							ligase activity|zinc ion binding				0						AAAACTGATCGCGTTTCTTCT	0.443													58	121	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80887328	80887328	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80887328C>T	uc002kfz.2	+	32	3073	c.2943C>T	c.(2941-2943)CAC>CAT	p.H981H	TBCD_uc002kfy.1_Silent_p.H981H|TBCD_uc002kgb.1_Silent_p.H306H|TBCD_uc002kgc.2_Silent_p.H126H|TBCD_uc002kgd.2_Translation_Start_Site	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	981					'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			ACCGCTACCACGTCCTGCTGG	0.672													16	50	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43219741	43219741	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43219741C>G	uc010dnj.2	+	8	1195	c.874C>G	c.(874-876)CAG>GAG	p.Q292E	SLC14A2_uc002lbb.2_Missense_Mutation_p.Q292E|SLC14A2_uc002lbe.2_Missense_Mutation_p.Q292E	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	292						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						TGGGGTCGGCCAGGTGTATGG	0.527													157	209	---	---	---	---	PASS
SMAD2	4087	broad.mit.edu	37	18	45371772	45371772	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45371772G>C	uc002lcy.2	-	10	1467	c.1219C>G	c.(1219-1221)CAG>GAG	p.Q407E	SMAD2_uc002lcz.2_Missense_Mutation_p.Q407E|SMAD2_uc010xdc.1_Missense_Mutation_p.Q377E|SMAD2_uc010xdd.1_Missense_Mutation_p.Q377E	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	407	MH2.				anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5						CTAGTTAGCTGATAGACGGCT	0.393													58	164	---	---	---	---	PASS
MEX3C	51320	broad.mit.edu	37	18	48703446	48703446	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48703446C>T	uc002lfc.3	-	2	1255	c.1255G>A	c.(1255-1257)GGC>AGC	p.G419S		NM_016626	NP_057710	Q5U5Q3	MEX3C_HUMAN	ring finger and KH domain containing 2	419						cytoplasm|nucleus	RNA binding|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCAAGAGTGCCACCTTCAAAG	0.428													36	136	---	---	---	---	PASS
UHRF1	29128	broad.mit.edu	37	19	4950865	4950865	+	Intron	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4950865C>G	uc002mbo.2	+						UHRF1_uc010xik.1_Intron|UHRF1_uc010duf.2_Intron|UHRF1_uc002mbp.2_Intron	NM_001048201	NP_001041666	Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains						cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TGCCCGCTCTCTGCAGGTTGT	0.632													66	93	---	---	---	---	PASS
GDF15	9518	broad.mit.edu	37	19	18497103	18497103	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18497103C>T	uc002niv.2	+	1	136	c.104C>T	c.(103-105)GCG>GTG	p.A35V	hsa-mir-3189|MI0014233_5'Flank	NM_004864	NP_004855	Q99988	GDF15_HUMAN	growth differentiation factor 15	35					cell-cell signaling|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			central_nervous_system(1)	1						CTGGCCGAGGCGAGCCGCGCA	0.637													17	46	---	---	---	---	PASS
DPY19L3	147991	broad.mit.edu	37	19	32945841	32945841	+	Intron	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32945841C>G	uc002ntg.2	+						DPY19L3_uc002nth.1_Intron|DPY19L3_uc002nti.1_Intron	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3							integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					CTTTTAATTTCTAGAAAAATC	0.269													6	17	---	---	---	---	PASS
CEACAM20	125931	broad.mit.edu	37	19	45017314	45017314	+	Silent	SNP	G	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45017314G>A	uc010ejn.1	-	7	1360	c.1344C>T	c.(1342-1344)ATC>ATT	p.I448I	CEACAM20_uc010ejo.1_Silent_p.I448I|CEACAM20_uc010ejp.1_Silent_p.I355I|CEACAM20_uc010ejq.1_Silent_p.I355I	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	448	Extracellular (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				CAATACCAGCGATGGCCCCTG	0.567											OREG0025538	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	32	---	---	---	---	PASS
RUVBL2	10856	broad.mit.edu	37	19	49507558	49507558	+	Silent	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49507558C>T	uc002plr.1	+	4	161	c.148C>T	c.(148-150)CTG>TTG	p.L50L	RUVBL2_uc002plq.1_Silent_p.L5L|RUVBL2_uc010yab.1_Silent_p.L50L|RUVBL2_uc002pls.1_RNA|RUVBL2_uc010emn.1_Silent_p.L5L|RUVBL2_uc010yac.1_Silent_p.L5L	NM_006666	NP_006657	Q9Y230	RUVB2_HUMAN	RuvB-like 2	50					cellular response to UV|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|protein folding|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|membrane|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|ATP-dependent DNA helicase activity|damaged DNA binding|identical protein binding|unfolded protein binding				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		GGTGGGTCAGCTGGCGGCACG	0.632													5	71	---	---	---	---	PASS
ZNF836	162962	broad.mit.edu	37	19	52659421	52659421	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52659421T>A	uc010ydi.1	-	5	1889	c.1515A>T	c.(1513-1515)AAA>AAT	p.K505N	ZNF836_uc010ydj.1_Missense_Mutation_p.K505N	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	505	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTTTAAAGGCTTTACCACATT	0.403													6	60	---	---	---	---	PASS
ZNF468	90333	broad.mit.edu	37	19	53345176	53345176	+	Missense_Mutation	SNP	C	A	A	rs61732713	byFrequency	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53345176C>A	uc002qaf.2	-	4	522	c.371G>T	c.(370-372)GGC>GTC	p.G124V	ZNF468_uc002qae.2_Missense_Mutation_p.G71V	NM_001008801	NP_001008801	Q5VIY5	ZN468_HUMAN	zinc finger protein ZNF468 isoform 2	124					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0358)		ATCATGTTGGCCTGTACTACC	0.433													149	194	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3677923	3677923	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3677923T>A	uc002wja.2	-	9	2189	c.2189A>T	c.(2188-2190)AAC>ATC	p.N730I	SIGLEC1_uc002wiz.3_Missense_Mutation_p.N730I	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	730	Ig-like C2-type 7.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CCGGCTCACGTTGCAAGTCAA	0.617													45	91	---	---	---	---	PASS
C20orf29	55317	broad.mit.edu	37	20	3804819	3804819	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3804819C>G	uc002wjs.1	+	3	656	c.478C>G	c.(478-480)CTG>GTG	p.L160V	C20orf29_uc002wjt.2_Missense_Mutation_p.L84V|C20orf29_uc002wju.1_Missense_Mutation_p.L160V	NM_018347	NP_060817	Q9NUS5	CT029_HUMAN	hypothetical protein LOC55317	160					double-strand break repair via homologous recombination		protein binding			skin(1)	1						CACCAGCCTTCTGCTGCGGGC	0.632													39	53	---	---	---	---	PASS
EDEM2	55741	broad.mit.edu	37	20	33703374	33703374	+	Silent	SNP	T	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33703374T>A	uc002xbo.2	-	11	1699	c.1599A>T	c.(1597-1599)ACA>ACT	p.T533T	EDEM2_uc010zus.1_Silent_p.T312T|EDEM2_uc002xbq.2_Silent_p.T496T|EDEM2_uc010zut.1_Silent_p.T492T|EDEM2_uc002xbp.2_Silent_p.T381T|EDEM2_uc002xbn.2_Silent_p.T381T|EDEM2_uc002xbr.2_RNA|EDEM2_uc010zuu.1_Silent_p.T257T	NM_018217	NP_060687	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like	533					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GTGAGAAGAGTGTTCCTGGCC	0.522													252	521	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35443741	35443741	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35443741C>T	uc002xgd.1	-	5	1717	c.1390G>A	c.(1390-1392)GAG>AAG	p.E464K	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	464											0		Myeloproliferative disorder(115;0.00874)				CTGGGGCCCTCGCTGTTGTCG	0.632													20	46	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35444170	35444170	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35444170C>T	uc002xgd.1	-	5	1288	c.961G>A	c.(961-963)GAG>AAG	p.E321K	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	321											0		Myeloproliferative disorder(115;0.00874)				CAACTGTCCTCCGACAGCGCC	0.637													7	7	---	---	---	---	PASS
KIAA1755	85449	broad.mit.edu	37	20	36845707	36845707	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36845707C>T	uc002xhy.1	-	13	3121	c.2849G>A	c.(2848-2850)CGG>CAG	p.R950Q	KIAA1755_uc002xhv.1_5'UTR|KIAA1755_uc002xhw.1_Missense_Mutation_p.R5Q|KIAA1755_uc002xhx.1_Missense_Mutation_p.R228Q	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449	950										ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)				CGTGCGTTGCCGCTCGGCCGC	0.667													10	10	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37535686	37535686	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37535686A>G	uc002xje.2	+	8	1076	c.887A>G	c.(886-888)GAG>GGG	p.E296G	PPP1R16B_uc010ggc.2_Missense_Mutation_p.E254G	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	296					regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TCCATGGATGAGATGCCAATA	0.458													46	134	---	---	---	---	PASS
ZMYND8	23613	broad.mit.edu	37	20	45927462	45927462	+	Intron	SNP	C	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45927462C>G	uc002xta.1	-						ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron|ZMYND8_uc002xth.2_Nonstop_Mutation_p.*155S	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			ATTCATTCATCAGGAACTAAC	0.418													4	20	---	---	---	---	PASS
C20orf107	388799	broad.mit.edu	37	20	55108599	55108599	+	Intron	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55108599G>T	uc010zzh.1	+						C20orf107_uc002xxz.2_Missense_Mutation_p.V68L	NM_001013646	NP_001013668	Q5JX69	CT107_HUMAN	hypothetical protein LOC388799 precursor							integral to membrane					0			Colorectal(105;0.202)			GTTTGCTGTTGTGCCGTTTGT	0.478													73	214	---	---	---	---	PASS
TLR7	51284	broad.mit.edu	37	X	12904872	12904872	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12904872C>A	uc004cvc.2	+	3	1384	c.1245C>A	c.(1243-1245)AGC>AGA	p.S415R		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	415	Extracellular (Potential).|LRR 14.				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	CTAACCTCAGCATGTTTAAAC	0.328													31	34	---	---	---	---	PASS
MAGEB1	4112	broad.mit.edu	37	X	30268617	30268617	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30268617C>T	uc004dcc.2	+	4	327	c.7C>T	c.(7-9)CGG>TGG	p.R3W	MAGEB1_uc004dcd.2_Missense_Mutation_p.R3W|MAGEB1_uc004dce.2_Missense_Mutation_p.R3W	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	3											0						CATCATGCCTCGGGGTCAGAA	0.557													16	4	---	---	---	---	PASS
ZCCHC12	170261	broad.mit.edu	37	X	117960244	117960244	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117960244G>T	uc004equ.2	+	4	1510	c.1037G>T	c.(1036-1038)CGC>CTC	p.R346L		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	346	CCHC-type.				regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1						CACACAATCCGCTGTTCGTAT	0.493													93	51	---	---	---	---	PASS
ENSA	2029	broad.mit.edu	37	1	150595354	150595355	+	Intron	INS	-	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150595354_150595355insA	uc001eve.2	-						ENSA_uc001evd.2_Intron|ENSA_uc001evb.2_Intron|ENSA_uc001evc.2_Intron	NM_004436	NP_004427	O43768	ENSA_HUMAN	endosulfine alpha isoform 3						cell division|G2/M transition of mitotic cell cycle|mitosis|response to nutrient|transport	cytoplasm	ion channel inhibitor activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity|receptor binding			central_nervous_system(1)	1	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;9.85e-23)|all cancers(9;5.06e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.67e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000701)|LUSC - Lung squamous cell carcinoma(543;0.171)			GAACACAGAAGAAAAAAAAAAA	0.510													2	5	---	---	---	---	
RASSF5	83593	broad.mit.edu	37	1	206677880	206677881	+	5'Flank	DEL	GT	-	-	rs112162046		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206677880_206677881delGT	uc001hed.2	+						RASSF5_uc001hec.1_5'Flank|RASSF5_uc001hee.2_5'Flank	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TTCATGTGGGgtgtgtgtgtgt	0.386													4	3	---	---	---	---	
NENF	29937	broad.mit.edu	37	1	212617908	212617911	+	Intron	DEL	TGTA	-	-	rs10590281		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212617908_212617911delTGTA	uc001hjd.2	+						NENF_uc010ptf.1_Intron	NM_013349	NP_037481	Q9UMX5	NENF_HUMAN	neuron derived neurotrophic factor precursor							extracellular space	heme binding				0				all cancers(67;0.00967)|OV - Ovarian serous cystadenocarcinoma(81;0.0108)|GBM - Glioblastoma multiforme(131;0.0325)|Epithelial(68;0.132)		tgtgtgtgtgtgtATCTGGGCAAG	0.162													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60795836	60795837	+	IGR	INS	-	TG	TG	rs140705455	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60795836_60795837insTG								BCL11A (15203 upstream) : PAPOLG (187546 downstream)																							TATCTAGGATTtgtgtgtgtgt	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95528084	95528084	+	IGR	DEL	T	-	-	rs11332663		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95528084delT								ANKRD20B (5264 upstream) : TEKT4 (9148 downstream)																							GTGGGTACTGTTAAGATTTAA	0.552													6	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95593797	95593809	+	Intron	DEL	GTGAGAACAGAAG	-	-	rs112157703		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95593797_95593809delGTGAGAACAGAAG	uc002stv.1	-											Homo sapiens cDNA FLJ44118 fis, clone TESTI4047069.																		ACTACAGAATGTGAGAACAGAAGGTCTAACCGT	0.418													4	2	---	---	---	---	
COL3A1	1281	broad.mit.edu	37	2	189860721	189860727	+	Intron	DEL	ACAGGAA	-	-	rs41263747	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189860721_189860727delACAGGAA	uc002uqj.1	+							NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	TACTTTATAGACAGGAAAAAAGATGTG	0.295													13	6	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175086361	175086362	+	Intron	INS	-	GT	GT	rs2862045	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175086361_175086362insGT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		Ggtgtgtgtgagtgtgtgtgtg	0.158													5	3	---	---	---	---	
ZNF639	51193	broad.mit.edu	37	3	179047698	179047705	+	Intron	DEL	TTTTTTTT	-	-	rs72000562		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179047698_179047705delTTTTTTTT	uc003fjq.1	+						ZNF639_uc003fjr.1_Intron	NM_016331	NP_057415	Q9UID6	ZN639_HUMAN	zinc finger protein 639						initiation of viral infection|negative regulation by host of viral transcription|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of cell growth|positive regulation of transcription, DNA-dependent	nucleus	protein self-association|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TTAACTAttctttttttttttttttttt	0.115													4	2	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179119234	179119236	+	Intron	DEL	AAT	-	-	rs74384746		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179119234_179119236delAAT	uc003fjv.3	-						GNB4_uc003fju.3_Intron	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TCAGttaaaaaataataataatt	0.271													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180854429	180854430	+	IGR	DEL	CA	-	-	rs149807210		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180854429_180854430delCA								DNAJC19 (146899 upstream) : SOX2OT (427079 downstream)																							aagactccttcacacacacaca	0.104													4	5	---	---	---	---	
SENP2	59343	broad.mit.edu	37	3	185347363	185347364	+	Intron	INS	-	A	A	rs34843707		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185347363_185347364insA	uc003fpn.2	+						SENP2_uc011brv.1_Intron|SENP2_uc011brw.1_Intron	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2						mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			gactccatctcaaaaaaaaaaa	0.119													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194439484	194439485	+	IGR	INS	-	TG	TG	rs58726372		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194439484_194439485insTG								FAM43A (29720 upstream) : C3orf21 (349530 downstream)																							GAGTTTTCAGTtgtgtgtgtgt	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194672739	194672740	+	IGR	INS	-	AGGA	AGGA			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194672739_194672740insAGGA								FAM43A (262975 upstream) : C3orf21 (116275 downstream)																							gggagggagtgaggaaggaagg	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194711961	194711963	+	IGR	DEL	CCA	-	-	rs72224251		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194711961_194711963delCCA								FAM43A (302197 upstream) : C3orf21 (77052 downstream)																							tcttcctcctccacttccttctc	0.000													5	7	---	---	---	---	
ZNF141	7700	broad.mit.edu	37	4	329075	329075	+	5'Flank	DEL	G	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:329075delG	uc003gaa.2	+						ZNF141_uc003fzz.2_5'Flank|ZNF141_uc003gab.2_5'Flank	NM_003441	NP_003432	Q15928	ZN141_HUMAN	zinc finger protein 141						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0						ATAGACCTGAGGCTAATCATG	0.517													4	2	---	---	---	---	
UGDH	7358	broad.mit.edu	37	4	39505927	39505928	+	Intron	INS	-	A	A			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39505927_39505928insA	uc003guk.1	-						UGDH_uc011byp.1_Intron|UGDH_uc003gul.1_Intron	NM_003359	NP_003350	O60701	UGDH_HUMAN	UDP-glucose dehydrogenase						glycosaminoglycan biosynthetic process|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	electron carrier activity|NAD binding|UDP-glucose 6-dehydrogenase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4					NADH(DB00157)	gactccatctcaaaaaaaaaaa	0.139													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4912875	4912882	+	IGR	DEL	GAAGGAAG	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4912875_4912882delGAAGGAAG								None (None upstream) : LOC340094 (121590 downstream)																							ggaaagaaatgaaggaaggaaggaagga	0.111													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141270157	141270172	+	IGR	DEL	CTTCCTTCCTTCCTTC	-	-	rs71830412		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141270157_141270172delCTTCCTTCCTTCCTTC								PCDH1 (12213 upstream) : KIAA0141 (33213 downstream)																							ggtaaattttcttccttccttccttccttccttcct	0.000													6	3	---	---	---	---	
C6orf106	64771	broad.mit.edu	37	6	34614822	34614823	+	Intron	INS	-	ACA	ACA	rs145923035	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34614822_34614823insACA	uc003ojr.2	-						C6orf106_uc003ojs.2_Intron	NM_024294	NP_077270	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106 isoform a											skin(2)|ovary(1)	3						AGTTCCTCAAGACAAGTATTTC	0.450													5	3	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38952246	38952247	+	Intron	INS	-	CA	CA	rs145656101	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38952246_38952247insCA	uc003ooe.1	+						DNAH8_uc003oog.1_3'UTR	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						gcacacacatgcacacacacac	0.203													4	2	---	---	---	---	
AIM1	202	broad.mit.edu	37	6	106966842	106966843	+	Intron	DEL	AT	-	-	rs9486376	byFrequency	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106966842_106966843delAT	uc003prh.2	+							NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1								sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ttaaaaaCACATGTGTGCGcac	0.109													4	4	---	---	---	---	
C7orf28A	51622	broad.mit.edu	37	7	5941116	5941116	+	Intron	DEL	A	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5941116delA	uc003spf.2	+							NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622							lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		actccatctcaaaaaaaaaaa	0.149													4	3	---	---	---	---	
SEPT7	989	broad.mit.edu	37	7	35942747	35942747	+	Frame_Shift_Del	DEL	A	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35942747delA	uc010kxc.2	+	12	1389	c.1196delA	c.(1195-1197)GAAfs	p.E399fs	SEPT7_uc011kat.1_Frame_Shift_Del_p.E398fs|SEPT7_uc011kau.1_Frame_Shift_Del_p.E363fs|SEPT7_uc011kav.1_Frame_Shift_Del_p.E346fs|SEPT7_uc003tey.2_Frame_Shift_Del_p.E247fs	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1	399	Potential.				cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						GAATTGGAGGAAAAACGTCGT	0.373													4	2	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44294369	44294375	+	Intron	DEL	ACCAACT	-	-	rs111901158		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44294369_44294375delACCAACT	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						catcaccaccaccaactaccaccatca	0.029													6	3	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51085963	51085968	+	Intron	DEL	TGGTGA	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51085963_51085968delTGGTGA	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron|COBL_uc003tpo.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					gtggtggtggtggtgatggtgatggt	0.175													7	7	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51111473	51111473	+	Intron	DEL	C	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51111473delC	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					AGTCTGTCGGCCCCGCTCTAA	0.498													22	12	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102197800	102197800	+	Intron	DEL	G	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102197800delG	uc011kkx.1	+						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron|POLR2J3_uc011kkw.1_Intron|SPDYE2_uc003vaa.1_Intron	NM_001031618	NP_001026789	Q495Y8	SPDE2_HUMAN	speedy homolog E2												0						ttttttttttgtgtgtgtgtg	0.254													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123180945	123180948	+	IGR	DEL	CACA	-	-	rs57037410		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123180945_123180948delCACA								IQUB (6227 upstream) : NDUFA5 (136 downstream)																							CATGCGCGTGcacacacacacaca	0.279													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123674369	123674370	+	Intron	INS	-	TCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCT	rs142512049	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123674369_123674370insTCCTTCCTTCCTTCCT	uc011koc.1	+						TMEM229A_uc011kob.1_5'Flank					Homo sapiens disrupted in Rett 1 mRNA sequence.																		ccctctttATCtccttccttcc	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143839580	143839582	+	IGR	DEL	TTC	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143839580_143839582delTTC								OR2A14 (12443 upstream) : CTAGE4 (40966 downstream)																							GTACATGCAATTCTTCTTCTAAG	0.532													116	65	---	---	---	---	
ATG9B	285973	broad.mit.edu	37	7	150719924	150719924	+	Intron	DEL	A	-	-	rs5888425		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150719924delA	uc011kvc.1	-						ATG9B_uc003wig.3_Intron	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	ATG9 autophagy related 9 homolog B						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane				ovary(1)	1	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		actctgtcttaaaaaaaaaaa	0.104													4	2	---	---	---	---	
FGL1	2267	broad.mit.edu	37	8	17739343	17739343	+	Intron	DEL	A	-	-	rs113353024		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17739343delA	uc003wxx.2	-						FGL1_uc003wxy.2_Intron|FGL1_uc003wxz.2_Intron|FGL1_uc003wya.2_Intron|FGL1_uc003wyb.2_Intron|FGL1_uc003wyc.2_Intron|FGL1_uc003wyd.2_Intron|FGL1_uc003wye.2_Intron|FGL1_uc003wyf.2_Intron	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor						signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		actccgcctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	65747646	65747647	+	IGR	DEL	TC	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65747646_65747647delTC								CYP7B1 (36298 upstream) : ARMC1 (767425 downstream)																							ttccttcctttctctctctctc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	95581669	95581670	+	IGR	DEL	GT	-	-	rs113075584		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95581669_95581670delGT								KIAA1429 (15981 upstream) : ESRP1 (71694 downstream)																							catctggctagtgtgtgtgtgt	0.000													2	4	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	121046503	121046504	+	Intron	INS	-	AC	AC	rs144178343	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121046503_121046504insAC	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCAAAGCATGTacacacacaca	0.347													4	5	---	---	---	---	
BAI1	575	broad.mit.edu	37	8	143601067	143601069	+	Intron	DEL	TGG	-	-	rs35152834		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143601067_143601069delTGG	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					gtgatggtgttggtggtgctggt	0.000													3	4	---	---	---	---	
EPPK1	83481	broad.mit.edu	37	8	144940080	144940081	+	Splice_Site	DEL	AC	-	-	rs35186960		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144940080_144940081delAC	uc003zaa.1	-	3	15358	c.15345_splice	c.e3-1			NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1							cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			aaaaaaaaaaacaaaaaaaaaa	0.342													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	15362230	15362230	+	IGR	DEL	T	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15362230delT								TTC39B (54986 upstream) : SNAPC3 (60552 downstream)																							TTCCCCTGTAttttttttttt	0.159													5	3	---	---	---	---	
TRIM14	9830	broad.mit.edu	37	9	100845460	100845468	+	Intron	DEL	CTTAGACAG	-	-	rs11793677		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100845460_100845468delCTTAGACAG	uc004ayd.2	-						TRIM14_uc004ayf.1_Intron	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha							cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)				CCACCTGCTCCTTAGACAGCAGATGTTTC	0.555													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104211297	104211301	+	IGR	DEL	AAAGA	-	-	rs150108645	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104211297_104211301delAAAGA								ALDOB (13235 upstream) : C9orf125 (26308 downstream)																							agcaagaaagaaagaaaagaaaaga	0.024													5	4	---	---	---	---	
TTF1	7270	broad.mit.edu	37	9	135273373	135273373	+	Intron	DEL	A	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135273373delA	uc004cbl.2	-						TTF1_uc011mcp.1_Intron|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase						negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		actccgtctcaaaaaaaaaaa	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102634083	102634084	+	IGR	DEL	AC	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102634083_102634084delAC								PAX2 (44386 upstream) : FAM178A (38242 downstream)																							GAGGATAGGAacacacacacac	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	120007963	120007964	+	IGR	INS	-	GGAA	GGAA	rs71500885		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120007963_120007964insGGAA								CASC2 (38304 upstream) : C10orf84 (60608 downstream)																							gggggagggagggagggaagga	0.005													6	3	---	---	---	---	
SYT9	143425	broad.mit.edu	37	11	7473349	7473350	+	Intron	INS	-	AC	AC	rs142000557	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7473349_7473350insAC	uc001mfe.2	+						SYT9_uc009yfi.2_Intron|uc001mff.1_Intron|uc001mfg.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TTATATTTAAAacacacacaca	0.233													4	2	---	---	---	---	
FOLH1	2346	broad.mit.edu	37	11	49194804	49194804	+	Intron	DEL	C	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49194804delC	uc001ngy.2	-						FOLH1_uc001ngz.2_Intron|FOLH1_uc009yly.2_Intron|FOLH1_uc009ylz.2_Intron|FOLH1_uc009yma.2_Intron	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1						proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	AGTATTTTTACCAAACACATG	0.119													9	5	---	---	---	---	
GPR137	56834	broad.mit.edu	37	11	64038449	64038450	+	Intron	INS	-	TG	TG	rs74210965	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64038449_64038450insTG	uc009ypj.1	+						BAD_uc001nzd.2_Intron|BAD_uc001nzc.2_Intron	NM_020155	NP_064540	Q96N19	G137A_HUMAN	G protein-coupled receptor 137							integral to membrane				central_nervous_system(1)	1						TGCCCTGTGacacacacacaca	0.327													4	2	---	---	---	---	
M6PR	4074	broad.mit.edu	37	12	9095984	9095987	+	Intron	DEL	AAGG	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9095984_9095987delAAGG	uc001qvf.2	-							NM_002355	NP_002346	P20645	MPRD_HUMAN	cation-dependent mannose-6-phosphate receptor						endosome to lysosome transport|receptor-mediated endocytosis	cell surface|endosome|integral to plasma membrane|lysosomal membrane	mannose binding|mannose transmembrane transporter activity|transmembrane receptor activity				0		Hepatocellular(102;0.137)		BRCA - Breast invasive adenocarcinoma(232;0.0146)		TGTTCTGATAAAGGAAGGCATACT	0.422													86	54	---	---	---	---	
PUS7L	83448	broad.mit.edu	37	12	44130669	44130669	+	Intron	DEL	A	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44130669delA	uc001rnq.3	-						PUS7L_uc001rnr.3_Intron|PUS7L_uc001rns.3_Intron|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		CCCTGCTATTAAAAAAAAAAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	58590646	58590647	+	IGR	DEL	TG	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58590646_58590647delTG								XRCC6BP1 (239595 upstream) : LRIG3 (675291 downstream)																							gggaattctttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
RNFT2	84900	broad.mit.edu	37	12	117223054	117223055	+	Intron	INS	-	TGTGTGTG	TGTGTGTG	rs143568058	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117223054_117223055insTGTGTGTG	uc009zwn.2	+						RNFT2_uc001twb.3_Intron|RNFT2_uc001twa.3_Intron|RNFT2_uc001twc.3_Intron	NM_001109903	NP_001103373	Q96EX2	RNFT2_HUMAN	transmembrane protein 118 isoform 1							integral to membrane	zinc ion binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		TTACCTACTTCtgtgtgtgtgt	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	62390086	62390087	+	IGR	DEL	AC	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62390086_62390087delAC								PCDH20 (388007 upstream) : None (None downstream)																							atataggtatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	74993511	74993530	+	5'Flank	DEL	CCTCCCTTCCTTCCTTCCTT	-	-	rs60422012	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74993511_74993530delCCTCCCTTCCTTCCTTCCTT	uc001vjj.1	-											Homo sapiens cDNA FLJ35839 fis, clone TESTI2006659.																		tccctccctccctcccttccttccttccttcctttcttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80788383	80788384	+	IGR	INS	-	GT	GT	rs140223510	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80788383_80788384insGT								NDFIP2 (658178 upstream) : SPRY2 (121730 downstream)																							TTTAGgtatgcgtgtgtgtgtg	0.262													1	5	---	---	---	---	
JPH4	84502	broad.mit.edu	37	14	24043147	24043148	+	Intron	DEL	AC	-	-	rs35127620		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24043147_24043148delAC	uc001wkq.2	-						JPH4_uc010tnr.1_5'Flank|JPH4_uc001wkr.2_Intron	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN	junctophilin 4						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane				ovary(1)|pancreas(1)	2	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		TCTCTCTGTAacacacacacac	0.317													3	3	---	---	---	---	
FAM177A1	283635	broad.mit.edu	37	14	35515607	35515608	+	Intron	DEL	GG	-	-	rs112060457		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35515607_35515608delGG	uc001wsp.2	+						FAM177A1_uc001wsq.2_5'Flank	NM_001079519	NP_001072987	Q8N128	F177A_HUMAN	hypothetical protein LOC283635 isoform 2												0						GGCGGGCGCTGGGCGGGTGAGT	0.723													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	92292941	92292952	+	IGR	DEL	GGTAGAGGTGCA	-	-	rs114751368	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92292941_92292952delGGTAGAGGTGCA								SV2B (454293 upstream) : SLCO3A1 (103986 downstream)																							aggtggaggtggtagaggtgcaggtggtggtg	0.000													4	2	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919483	57919492	+	Intron	DEL	TTTCTTTCTT	-	-	rs3038253		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919483_57919492delTTTCTTTCTT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						tctctctctctttctttctttctttctttc	0.000													2	4	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1385975	1385976	+	Intron	INS	-	G	G			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1385975_1385976insG	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		cctcccctcccctcccgcactg	0.272													4	2	---	---	---	---	
RNF112	7732	broad.mit.edu	37	17	19314918	19314918	+	Intron	DEL	T	-	-	rs35694276		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19314918delT	uc010vyw.1	+						RNF112_uc010vyu.1_Intron|RNF112_uc010vyv.1_Intron|RNF112_uc010vyx.1_5'Flank	NM_007148	NP_009079	Q7Z5V9	Q7Z5V9_HUMAN	ring finger protein 112								GTP binding|GTPase activity|zinc ion binding			ovary(2)	2						GTTCTAAATCTTTTTTTTTTT	0.517													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46791071	46791072	+	IGR	INS	-	AA	AA	rs71369208		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46791071_46791072insAA								MIR196A1 (81150 upstream) : PRAC (8020 downstream)																							gactccttctcaaaaaaaaaaa	0.223													4	3	---	---	---	---	
IGF2BP1	10642	broad.mit.edu	37	17	47076718	47076719	+	Intron	INS	-	A	A	rs141190373	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47076718_47076719insA	uc002iom.2	+						IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding						CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						TTACAGCTTGTAAAAAAAAAAT	0.441													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11610675	11610675	+	IGR	DEL	A	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610675delA								FAM38B (908696 upstream) : GNAL (78461 downstream)																							GACTGAAGACaaaaaaaaaaa	0.303													4	2	---	---	---	---	
SPIRE1	56907	broad.mit.edu	37	18	12539587	12539588	+	Intron	DEL	CA	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12539587_12539588delCA	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0						cacacacacgcacacacacaca	0.000													4	2	---	---	---	---	
CXADRP3	440224	broad.mit.edu	37	18	14479164	14479164	+	RNA	DEL	C	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14479164delC	uc010xai.1	-	3		c.400delG				NR_024076				Homo sapiens cDNA clone IMAGE:30390722, containing frame-shift errors.												0						TAGGTAGTTTCCCCTTTGGCT	0.507													48	24	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1046580	1046580	+	Intron	DEL	G	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1046580delG	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGTCTGGTGGGGGGGGGGA	0.652													6	4	---	---	---	---	
C19orf24	55009	broad.mit.edu	37	19	1278612	1278618	+	Intron	DEL	CAGGGCC	-	-	rs5826728		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1278612_1278618delCAGGGCC	uc002lrw.3	+						C19orf24_uc002lrx.3_Intron	NM_017914	NP_060384	Q9BVV8	CS024_HUMAN	hypothetical protein LOC55009							cytoplasm|extracellular region part|integral to membrane					0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCAGTTGCACAGGGCCCAGGAGGCCG	0.696													6	3	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2585102	2585125	+	Intron	DEL	GAAGGAAGGAAAGAAGGTAGGAAT	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2585102_2585125delGAAGGAAGGAAAGAAGGTAGGAAT	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aagaaggaaggaaggaaggaaagaaggtaggaatgaaggaagga	0.000													4	3	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5225555	5225556	+	Intron	INS	-	G	G	rs144752962	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5225555_5225556insG	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		gaggcaggggcggggggggcca	0.252													9	4	---	---	---	---	
DLL3	10683	broad.mit.edu	37	19	39991061	39991061	+	Intron	DEL	C	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39991061delC	uc002olx.2	+						DLL3_uc010egq.2_Intron|DLL3_uc002olw.2_Intron	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			gtgagattctCCCCCCCCCCC	0.303													4	2	---	---	---	---	
ZCCHC3	85364	broad.mit.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	-	-	rs5839847		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:278688_278690delCGG	uc002wdf.2	+	1	485_487	c.461_463delCGG	c.(460-465)CCGGCG>CCG	p.A158del	ZCCHC3_uc002wdg.2_Intron	NM_033089	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	158	Poly-Ala.						nucleic acid binding|zinc ion binding				0		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.635													4	8	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60973128	60973133	+	Intron	DEL	GGTGGT	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60973128_60973133delGGTGGT	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			tggtggtgacggtggtggtggtggtg	0.000													4	2	---	---	---	---	
COL20A1	57642	broad.mit.edu	37	20	61923950	61923951	+	5'Flank	DEL	AG	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61923950_61923951delAG	uc011aau.1	+							NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CGGGTGGGACAGGGGCAGGGCC	0.688													3	4	---	---	---	---	
NOL12	79159	broad.mit.edu	37	22	38087485	38087504	+	3'UTR	DEL	CAGCTGCCTTTGCCTGGGGT	-	-	rs62236678		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38087485_38087504delCAGCTGCCTTTGCCTGGGGT	uc003atp.2	+	6					NOL12_uc003ato.1_Intron|TRIOBP_uc003atq.1_Intron	NM_024313	NP_077289	Q9UGY1	NOL12_HUMAN	nucleolar protein 12							nucleolus	rRNA binding				0	Melanoma(58;0.0574)					GGCCTGGGGCCAGCTGCCTTTGCCTGGGGTCAGCTGCCTT	0.623													4	2	---	---	---	---	
TAB1	10454	broad.mit.edu	37	22	39815792	39815792	+	Intron	DEL	A	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39815792delA	uc003axt.2	+						TAB1_uc003axr.2_Intron|TAB1_uc011aok.1_Intron|TAB1_uc003axu.1_Intron	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						accctgtctcaaaaaaaaaaa	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1680330	1680333	+	IGR	DEL	CTTC	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1680330_1680333delCTTC								P2RY8 (24293 upstream) : SFRS17A (30153 downstream)																							ttctttctttcttccttccttcct	0.000													7	4	---	---	---	---	
TMEM27	57393	broad.mit.edu	37	X	15648487	15648490	+	Intron	DEL	GAAG	-	-	rs148392312		TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15648487_15648490delGAAG	uc004cxc.1	-							NM_020665	NP_065716	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27 precursor						proteolysis	integral to membrane	metallopeptidase activity|peptidyl-dipeptidase activity			ovary(1)	1	Hepatocellular(33;0.183)					CCACAAgaaagaaggaaggaagga	0.260													3	3	---	---	---	---	
SH3KBP1	30011	broad.mit.edu	37	X	19724917	19724917	+	Intron	DEL	A	-	-			TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19724917delA	uc004czm.2	-						SH3KBP1_uc004czl.2_Intron	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						GTGAGTCTGTAGCAAGGCGTC	0.547													8	6	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652829	53652852	+	Intron	DEL	GCCGGGGCCGGGGCCGGGGCCGGT	-	-	rs78801842	by1000genomes	TCGA-66-2794-01A-01D-1267-08	TCGA-66-2794-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652829_53652852delGCCGGGGCCGGGGCCGGGGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggggccggggccggggccggtgccgggactg	0.219													4	29	---	---	---	---	
