Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NPHP4	261734	broad.mit.edu	37	1	5926507	5926507	+	Silent	SNP	T	C	C	rs555164	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5926507T>C	uc001alq.1	-	26	3836	c.3570A>G	c.(3568-3570)GAA>GAG	p.E1190E	NPHP4_uc001alr.1_Silent_p.E132E	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	1190					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TGTCCCGTGGTTCCCCGGGGC	0.562													5	4	---	---	---	---	PASS
FAM131C	348487	broad.mit.edu	37	1	16361925	16361925	+	Silent	SNP	G	A	A	rs146790110		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16361925G>A	uc010obz.1	-	7	781	c.591C>T	c.(589-591)AGC>AGT	p.S197S	CLCNKB_uc001axw.3_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	197											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		CGCTGGGAAGGCTGTCCTGAA	0.647													2	3	---	---	---	---	PASS
FAM131C	348487	broad.mit.edu	37	1	16385178	16385178	+	Silent	SNP	G	A	A	rs80297394		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16385178G>A	uc001axz.3	-	7	787	c.597C>T	c.(595-597)CCC>CCT	p.P199P	FAM131C_uc010obz.1_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	199											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGGCCGCTGGGAAGGCTGT	0.647													5	8	---	---	---	---	PASS
ESPNP	284729	broad.mit.edu	37	1	17026504	17026504	+	Silent	SNP	G	A	A	rs146166916	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17026504G>A	uc001azn.1	-	7	1182	c.1068C>T	c.(1066-1068)TGC>TGT	p.C356C		NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						CGTGGCCGTCGCAGGAGCTCG	0.711													5	7	---	---	---	---	PASS
JAK1	3716	broad.mit.edu	37	1	65310466	65310466	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65310466C>T	uc001dbu.1	-	16	2471	c.2222G>A	c.(2221-2223)GGC>GAC	p.G741D	JAK1_uc009wam.1_Missense_Mutation_p.G729D|JAK1_uc009wal.1_5'UTR	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	741	Protein kinase 1.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		AATGGGGATGCCGGGGTCACT	0.587			Mis		ALL								23	41	---	---	---	---	PASS
SLC16A1	6566	broad.mit.edu	37	1	113466733	113466733	+	Intron	SNP	G	A	A	rs144957900	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113466733G>A	uc001ecx.2	-						SLC16A1_uc001ecy.2_Intron|SLC16A1_uc001ecz.2_Intron|AFARP1_uc001eda.1_RNA	NM_003051	NP_003042	P53985	MOT1_HUMAN	solute carrier family 16, member 1						blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	integral to membrane|membrane fraction|plasma membrane	mevalonate transmembrane transporter activity|protein binding|secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Pyruvic acid(DB00119)	CCTGCAGGCCGCGTATGGCGC	0.622													16	34	---	---	---	---	PASS
SPRR2D	6703	broad.mit.edu	37	1	153112913	153112913	+	Intron	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153112913C>T	uc009wnz.2	-						SPRR2A_uc001fbf.2_Intron|SPRR2C_uc001fbj.2_RNA			P22532	SPR2D_HUMAN	Homo sapiens cDNA FLJ76407 complete cds, highly similar to Homo sapiens small proline-rich protein 2D (SPRR2D), mRNA.						keratinization	cornified envelope|cytoplasm					0	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCTGTGGAACGAGGTGAGCC	0.532													35	79	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158585065	158585065	+	Silent	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158585065G>A	uc001fst.1	-	48	6928	c.6729C>T	c.(6727-6729)GAC>GAT	p.D2243D		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2243	Spectrin 21.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGTAGAGCTGGTCCCACTGCT	0.542													87	233	---	---	---	---	PASS
MAPKAPK2	9261	broad.mit.edu	37	1	206906142	206906142	+	3'UTR	SNP	C	T	T	rs143218260	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206906142C>T	uc001hem.1	+	10					MAPKAPK2_uc001hel.1_3'UTR	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated						activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			AGAGACAGAACTGTCCACATC	0.562													5	16	---	---	---	---	PASS
YWHAQ	10971	broad.mit.edu	37	2	9725321	9725321	+	3'UTR	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9725321G>A	uc002qzw.2	-	5					YWHAQ_uc002qzx.2_3'UTR	NM_006826	NP_006817	P27348	1433T_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase						negative regulation of transcription, DNA-dependent	centrosome|nucleus	protein N-terminus binding			breast(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		ACACATGAATGGGTTTCTTTG	0.388													3	49	---	---	---	---	PASS
CCDC121	79635	broad.mit.edu	37	2	27850383	27850383	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27850383T>C	uc002rle.2	-	2	465	c.284A>G	c.(283-285)AAT>AGT	p.N95S	ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_Missense_Mutation_p.N259S|CCDC121_uc002rld.2_Missense_Mutation_p.N257S|GPN1_uc010ezf.2_5'Flank|GPN1_uc010yma.1_5'Flank|GPN1_uc010ymb.1_5'Flank|GPN1_uc010ymc.1_5'Flank|GPN1_uc010ymd.1_5'Flank|GPN1_uc010yme.1_5'Flank|GPN1_uc010ezg.1_5'Flank	NM_024584	NP_078860	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121 isoform 3	95											0	Acute lymphoblastic leukemia(172;0.155)					GGATTGGATATTTTCCTTTTG	0.393													158	322	---	---	---	---	PASS
RGPD5	84220	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127775G>C	uc002ths.1	-	23	5355	c.5278C>G	c.(5278-5280)CCT>GCT	p.P1760A	RGPD8_uc010fkk.1_Missense_Mutation_p.P1620A	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform	1760					intracellular transport	cytoplasm	binding				0						GAACGGGAAGGATTTTCTTCC	0.308													4	51	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182376434	182376434	+	Silent	SNP	T	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182376434T>C	uc002unu.2	+	17	2617	c.1854T>C	c.(1852-1854)TTT>TTC	p.F618F	ITGA4_uc010frj.1_Silent_p.F100F	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	618	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	AGATAAACTTTGCAAGGTTTT	0.303													63	180	---	---	---	---	PASS
AGFG1	3267	broad.mit.edu	37	2	228389506	228389506	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228389506A>C	uc002vpc.2	+	5	819	c.569A>C	c.(568-570)CAG>CCG	p.Q190P	AGFG1_uc002vpd.2_Missense_Mutation_p.Q190P|AGFG1_uc002vpe.2_Missense_Mutation_p.Q190P|AGFG1_uc002vpf.2_Missense_Mutation_p.Q190P	NM_004504	NP_004495	P52594	AGFG1_HUMAN	HIV-1 Rev binding protein isoform 2	190					cell differentiation|mRNA export from nucleus|multicellular organismal development|regulation of ARF GTPase activity|spermatogenesis	cytoplasmic membrane-bounded vesicle|Golgi apparatus|nuclear pore	ARF GTPase activator activity|DNA binding|protein binding|RNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4						TCTCAAGGGCAGCAGCAGGAG	0.423													57	194	---	---	---	---	PASS
VGLL4	9686	broad.mit.edu	37	3	11744501	11744501	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11744501G>A	uc003bwf.2	-	2	374	c.8C>T	c.(7-9)ACG>ATG	p.T3M	VGLL4_uc003bwg.2_Translation_Start_Site	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b	3					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ATCCAATGGCGTCTCCATTCC	0.368													11	44	---	---	---	---	PASS
AMIGO3	386724	broad.mit.edu	37	3	49755885	49755885	+	Silent	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49755885G>A	uc003cxj.2	-	1	1354	c.1014C>T	c.(1012-1014)GCC>GCT	p.A338A	RNF123_uc003cxh.2_Intron|RNF123_uc003cxi.2_Intron	NM_198722	NP_942015	Q86WK7	AMGO3_HUMAN	adhesion molecule with Ig-like domain 3	338	Extracellular (Potential).|Ig-like C2-type.				heterophilic cell-cell adhesion	integral to membrane				pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CGTTGCCTATGGCCAAGCTGC	0.667													9	34	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	112005630	112005630	+	Silent	SNP	T	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112005630T>C	uc003dyu.2	-	2	231	c.9A>G	c.(7-9)GGA>GGG	p.G3G	SLC9A10_uc011bhu.1_5'UTR|SLC9A10_uc010hqc.2_Silent_p.G3G	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	3					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						CCTTAAATATTCCAGCCATGT	0.353													10	30	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125591185	125591185	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125591185G>A	uc003ifg.3	-	3	3513	c.3247C>T	c.(3247-3249)CGT>TGT	p.R1083C	ANKRD50_uc011cgo.1_Missense_Mutation_p.R904C|ANKRD50_uc010inw.2_Missense_Mutation_p.R1083C	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1083	ANK 19.									central_nervous_system(1)	1						GCTGCAACACGCATAGCAGTG	0.418													5	136	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34826505	34826505	+	Nonsense_Mutation	SNP	C	G	G			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34826505C>G	uc003jir.2	+	16	2916	c.2720C>G	c.(2719-2721)TCA>TGA	p.S907*	RAI14_uc010iur.2_Nonsense_Mutation_p.S878*|RAI14_uc011coj.1_Nonsense_Mutation_p.S907*|RAI14_uc003jis.2_Nonsense_Mutation_p.S910*|RAI14_uc003jit.2_Nonsense_Mutation_p.S907*|RAI14_uc011cok.1_Nonsense_Mutation_p.S899*	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	907	Potential.					cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					CTCTCCTACTCAACAAGCTCA	0.512													28	67	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262494	45262494	+	Silent	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262494C>T	uc003jok.2	-	8	2227	c.2202G>A	c.(2200-2202)CCG>CCA	p.P734P		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	734	Gln-rich.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						cctgctgctgcggctgctgtt	0.443													6	13	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101813486	101813486	+	Silent	SNP	G	A	A	rs145273103		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101813486G>A	uc003knn.2	-	3	868	c.696C>T	c.(694-696)TTC>TTT	p.F232F	SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Silent_p.F232F|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	232	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GCCCAAGGATGAAGAAAGACA	0.383													77	206	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128957923	128957923	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128957923A>C	uc003kvb.1	+	10	1634	c.1634A>C	c.(1633-1635)AAT>ACT	p.N545T	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	545	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTACAAACAAATCCGCAGAGT	0.428													28	70	---	---	---	---	PASS
GMDS	2762	broad.mit.edu	37	6	1624710	1624710	+	Silent	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1624710G>A	uc003mtq.2	-	10	1243	c.1053C>T	c.(1051-1053)TTC>TTT	p.F351F		NM_001500	NP_001491	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	351					'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		TACTCACATCGAAAGCGACCC	0.667													3	24	---	---	---	---	PASS
HIST1H4K	8362	broad.mit.edu	37	6	27799301	27799301	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27799301G>C	uc003njr.2	-	1	5	c.5C>G	c.(4-6)TCT>TGT	p.S2C		NM_003541	NP_003532	P62805	H4_HUMAN	histone cluster 1, H4k	2					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0						GCCGCGGCCAGACATGACGAG	0.592													16	68	---	---	---	---	PASS
HCRTR2	3062	broad.mit.edu	37	6	55147206	55147206	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55147206G>A	uc003pcl.2	+	7	1604	c.1289G>A	c.(1288-1290)AGC>AAC	p.S430N	HCRTR2_uc010jzv.2_RNA	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	430	Cytoplasmic (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACTAGCATAAGCACACTCCCA	0.408													11	25	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170667419	170667419	+	Intron	SNP	C	G	G			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170667419C>G	uc003qxp.2	+						FAM120B_uc003qxo.1_Intron|FAM120B_uc011ehd.1_Intron|FAM120B_uc010kla.1_RNA	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B						cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		ACAGACGTGACCAGTTAGTTG	0.478													11	16	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567282	5567282	+	3'UTR	SNP	C	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567282C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		caaaacaaaacaaaaaaaaca	0.378													7	67	---	---	---	---	PASS
H2AFV	94239	broad.mit.edu	37	7	44874131	44874131	+	Missense_Mutation	SNP	A	G	G	rs114398265	byFrequency	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44874131A>G	uc003tma.2	-	5	511	c.356T>C	c.(355-357)ATT>ACT	p.I119T	H2AFV_uc003tlz.2_Intron|H2AFV_uc011kca.1_5'Flank|H2AFV_uc003tmb.2_Missense_Mutation_p.I81T|H2AFV_uc003tmc.2_3'UTR|H2AFV_uc003tmd.2_Missense_Mutation_p.I93T	NM_012412	NP_036544	Q71UI9	H2AV_HUMAN	H2A histone family, member V isoform 1	119					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CTTCTTTCCAATCAGAGATTT	0.368													4	112	---	---	---	---	PASS
COPS6	10980	broad.mit.edu	37	7	99686977	99686977	+	Silent	SNP	C	G	G			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99686977C>G	uc003usu.2	+	2	172	c.141C>G	c.(139-141)GTC>GTG	p.V47V	COPS6_uc011kjf.1_Silent_p.V47V	NM_006833	NP_006824	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	47	MPN.				cullin deneddylation|interspecies interaction between organisms	cytoplasm|signalosome	protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			ATCCCCTTGTCATTCTCAACA	0.592													75	191	---	---	---	---	PASS
LRCH4	4034	broad.mit.edu	37	7	100172836	100172836	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100172836G>A	uc003uvj.2	-	18	1999	c.1946C>T	c.(1945-1947)GCC>GTC	p.A649V	uc003uvh.2_5'Flank|LRCH4_uc010lgz.2_RNA|LRCH4_uc003uvi.2_RNA|LRCH4_uc011kjw.1_3'UTR	NM_002319	NP_002310	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH)	649	CH.				nervous system development	PML body	protein binding			large_intestine(1)|ovary(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGGCGGTAGGGCCTTGCCCCC	0.697													5	13	---	---	---	---	PASS
PRSS1	5644	broad.mit.edu	37	7	142458651	142458651	+	Intron	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142458651G>A	uc003wak.2	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Missense_Mutation_p.G71D|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein						digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			CTGAGGTTGGGTAAGATGGAT	0.577									Hereditary_Pancreatitis				20	25	---	---	---	---	PASS
NKX3-1	4824	broad.mit.edu	37	8	23538909	23538909	+	Missense_Mutation	SNP	T	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23538909T>C	uc011kzx.1	-	2	578	c.530A>G	c.(529-531)TAT>TGT	p.Y177C	NKX3-1_uc003xdv.1_Intron	NM_006167	NP_006158	Q99801	NKX31_HUMAN	NK3 homeobox 1	177	Homeobox.				negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding				0		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		CTTAGTCTTATAGCGTCTGTT	0.582													80	250	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413981	68413981	+	RNA	SNP	G	T	T	rs71184958		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413981G>T	uc004aex.2	+	1		c.536G>T								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		GGATGGGAGAGCCCCAGTTTC	0.652													2	1	---	---	---	---	PASS
ALDOB	229	broad.mit.edu	37	9	104192139	104192139	+	Silent	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104192139G>A	uc004bbk.2	-	3	304	c.222C>T	c.(220-222)ATC>ATT	p.I74I		NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	74			I -> T (in HFI; affects proper folding).		fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				TCACACCCCCGATGCTCTGGT	0.532													94	247	---	---	---	---	PASS
FIBCD1	84929	broad.mit.edu	37	9	133799131	133799131	+	Silent	SNP	C	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133799131C>A	uc004bzz.2	-	4	1094	c.849G>T	c.(847-849)ACG>ACT	p.T283T	FIBCD1_uc011mcc.1_Silent_p.T283T	NM_032843	NP_116232	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	283	Fibrinogen C-terminal.|Extracellular (Potential).				signal transduction	extracellular space|integral to membrane	chitin binding|metal ion binding|receptor binding				0	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		GGACACTCACCGTCCAGCCGC	0.682													9	16	---	---	---	---	PASS
TUBB8	347688	broad.mit.edu	37	10	93555	93555	+	Silent	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93555C>T	uc001ifi.2	-	4	777	c.777G>A	c.(775-777)CCG>CCA	p.P259P	TUBB8_uc009xhe.2_Silent_p.P222P|TUBB8_uc010pzs.1_Silent_p.P187P	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 isoform 1	259					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GCCGGGGAAACGGGACCATGT	0.637													3	37	---	---	---	---	PASS
DDIT4	54541	broad.mit.edu	37	10	74035041	74035041	+	3'UTR	SNP	T	A	A	rs1053639	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74035041T>A	uc001jsx.1	+	3						NM_019058	NP_061931	Q9NX09	DDIT4_HUMAN	RTP801						apoptosis					pancreas(1)	1						GACTGATTCCTGTGGTTGGAA	0.557											OREG0020262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	7	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87628819	87628819	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87628819C>T	uc001kdl.1	-	6	1000	c.899G>A	c.(898-900)CGC>CAC	p.R300H	GRID1_uc009xsu.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	300	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GGAGGAGATGCGGTGGTTGTT	0.567										Multiple Myeloma(13;0.14)			41	55	---	---	---	---	PASS
KRTAP5-5	439915	broad.mit.edu	37	11	1651251	1651251	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651251G>A	uc001lty.2	+	1	219	c.181G>A	c.(181-183)GGC>AGC	p.G61S		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	61						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		atgtggctccggctgCTGTGT	0.303													13	37	---	---	---	---	PASS
ARFGAP2	84364	broad.mit.edu	37	11	47198145	47198145	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47198145C>T	uc001ndt.2	-	2	128	c.113G>A	c.(112-114)AGC>AAC	p.S38N	ARFGAP2_uc010rha.1_5'Flank|ARFGAP2_uc010rhb.1_Missense_Mutation_p.S38N|ARFGAP2_uc001ndu.2_Missense_Mutation_p.S38N|ARFGAP2_uc010rhc.1_5'UTR|ARFGAP2_uc010rhd.1_Missense_Mutation_p.S38N|ARFGAP2_uc001ndv.1_Missense_Mutation_p.S38N	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating	38	C4-type.|Arf-GAP.				protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						GTACGTGATGCTGGCCCAACT	0.632													3	57	---	---	---	---	PASS
IGHMBP2	3508	broad.mit.edu	37	11	68682435	68682435	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68682435C>T	uc001ook.1	+	6	958	c.856C>T	c.(856-858)CGG>TGG	p.R286W	IGHMBP2_uc001ooj.1_RNA	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	286	Leu-rich.				cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GGTTTTAGCGCGGAGCGACAG	0.597													37	135	---	---	---	---	PASS
WNT11	7481	broad.mit.edu	37	11	75907610	75907610	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75907610G>T	uc001oxe.2	-	2	359	c.236C>A	c.(235-237)GCC>GAC	p.A79D	WNT11_uc001oxf.1_Missense_Mutation_p.A79D	NM_004626	NP_004617	O96014	WNT11_HUMAN	wingless-type MMTV integration site family,	79					adrenal gland development|anterior/posterior pattern formation|artery morphogenesis|axis specification|bone mineralization|cellular response to retinoic acid|cloacal septation|embryonic skeletal system development|endoderm development|lung-associated mesenchyme development|mesonephric duct development|negative regulation of apoptosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell migration|negative regulation of transcription, DNA-dependent|neuroendocrine cell differentiation|neuron differentiation|osteoblast differentiation|outflow tract morphogenesis|palate development|positive regulation of cell migration|positive regulation of protein kinase C signaling cascade|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor-beta2 production|protein localization at cell surface|protein phosphorylation|tight junction assembly|ureteric bud morphogenesis|ventricular septum morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|protein kinase activator activity|Ras GTPase activator activity|transcription regulatory region DNA binding			lung(1)|skin(1)	2						CCGGCGACAGGCCTTCATGAC	0.637													11	149	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120348296	120348296	+	Intron	SNP	G	A	A	rs116572009	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120348296G>A	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_3'UTR|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		AATGCTggccggatgtggtgg	0.204			T	MLL	AML								3	29	---	---	---	---	PASS
ATP2A2	488	broad.mit.edu	37	12	110765384	110765384	+	Silent	SNP	T	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110765384T>A	uc001tqk.3	+	8	1220	c.657T>A	c.(655-657)GCT>GCA	p.A219A	ATP2A2_uc001tql.3_Silent_p.A219A|ATP2A2_uc010sxy.1_Silent_p.A192A	NM_170665	NP_733765	P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, slow twitch 2 isoform	219	Cytoplasmic (By similarity).				ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding			ovary(3)|skin(1)	4						CTGGGAAAGCTATGGGAGTGG	0.468													100	239	---	---	---	---	PASS
EEF1DP3	196549	broad.mit.edu	37	13	32527029	32527029	+	RNA	SNP	C	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32527029C>A	uc001utu.2	+	4		c.787C>A			EEF1DP3_uc010tdv.1_Intron|uc001utv.2_RNA					Homo sapiens similar to hypothetical protein FLJ20897, mRNA (cDNA clone IMAGE:5267252).												0						TGCCCGGCCACTGGGCCACAG	0.642													10	19	---	---	---	---	PASS
NOVA1	4857	broad.mit.edu	37	14	26917506	26917506	+	Missense_Mutation	SNP	T	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26917506T>A	uc001wpy.2	-	5	1501	c.1183A>T	c.(1183-1185)ACC>TCC	p.T395S	NOVA1_uc001wpz.2_Missense_Mutation_p.T371S|NOVA1_uc001wqa.2_Missense_Mutation_p.T273S	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	398	Ala-rich.				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		TATCCATTGGTTGCAGCAGTA	0.522													13	36	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71485847	71485847	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71485847G>A	uc001xmo.2	+	12	3564	c.3118G>A	c.(3118-3120)GTC>ATC	p.V1040I	PCNX_uc010are.1_Missense_Mutation_p.V929I|PCNX_uc010arf.1_5'UTR	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1040	Helical; (Potential).					integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GTTCTGCCTCGTCATAGCCAG	0.423													98	210	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100341319	100341319	+	RNA	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100341319C>T	uc010urx.1	-	3		c.328G>A			C15orf51_uc010ury.1_RNA|uc002bvp.2_5'Flank|C15orf51_uc010urz.1_RNA|C15orf51_uc010bow.2_RNA	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						TTTCCATTTGCCGCTCCAGCT	0.582													4	68	---	---	---	---	PASS
NTAN1	123803	broad.mit.edu	37	16	15131825	15131825	+	3'UTR	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15131825C>T	uc002ddd.2	-	10					PDXDC1_uc002ddc.2_Intron|NTAN1_uc010uzo.1_3'UTR	NM_173474	NP_775745	Q96AB6	NTAN1_HUMAN	N-terminal Asn amidase							cytoplasm					0						GATCTGGATTCGTGCCAGCCC	0.433													28	54	---	---	---	---	PASS
SEH1L	81929	broad.mit.edu	37	18	12955467	12955467	+	Silent	SNP	T	C	C	rs144783239	byFrequency	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12955467T>C	uc002krr.2	+	3	306	c.168T>C	c.(166-168)CAT>CAC	p.H56H	SEH1L_uc002krq.2_Silent_p.H56H	NM_031216	NP_112493	Q96EE3	SEH1_HUMAN	sec13-like protein isoform 2	56	WD 2.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|carbohydrate metabolic process|cell division|glucose transport|mitotic metaphase plate congression|mitotic prometaphase|mRNA transport|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex					0						CCCAGACACATAGTGGATCTG	0.398													5	181	---	---	---	---	PASS
OLFM2	93145	broad.mit.edu	37	19	9965490	9965490	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9965490C>T	uc002mmp.2	-	6	765	c.737G>A	c.(736-738)CGT>CAT	p.R246H	OLFM2_uc002mmo.2_Missense_Mutation_p.R168H	NM_058164	NP_477512	O95897	NOE2_HUMAN	olfactomedin 2 precursor	246	Olfactomedin-like.					extracellular region				large_intestine(1)|skin(1)	2						TCCCAGGGTACGGAACTCCAG	0.612													6	23	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39965233	39965233	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39965233A>C	uc002olo.3	+	28	3078	c.2899A>C	c.(2899-2901)ACG>CCG	p.T967P	SUPT5H_uc002olp.3_Missense_Mutation_p.T967P|SUPT5H_uc002olq.3_Missense_Mutation_p.T963P|SUPT5H_uc002oln.3_Missense_Mutation_p.T967P|SUPT5H_uc002olr.3_Missense_Mutation_p.T967P|SUPT5H_uc002ols.1_Missense_Mutation_p.T590P	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a	967	Pro-rich.				cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CAACCCACACACGCCAGGCTC	0.607											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	61	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39965235	39965235	+	Silent	SNP	G	T	T	rs138311423		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39965235G>T	uc002olo.3	+	28	3080	c.2901G>T	c.(2899-2901)ACG>ACT	p.T967T	SUPT5H_uc002olp.3_Silent_p.T967T|SUPT5H_uc002olq.3_Silent_p.T963T|SUPT5H_uc002oln.3_Silent_p.T967T|SUPT5H_uc002olr.3_Silent_p.T967T|SUPT5H_uc002ols.1_Silent_p.T590T	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a	967	Pro-rich.				cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ACCCACACACGCCAGGCTCAG	0.607											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	61	---	---	---	---	PASS
ZNF528	84436	broad.mit.edu	37	19	52919410	52919410	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52919410G>T	uc002pzh.2	+	7	1731	c.1305G>T	c.(1303-1305)AAG>AAT	p.K435N	ZNF528_uc002pzi.2_Missense_Mutation_p.K202N	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	435					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		CTGATGAGAAGCCTTACAAAT	0.383													37	114	---	---	---	---	PASS
C21orf81	391267	broad.mit.edu	37	21	15352131	15352131	+	RNA	SNP	G	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15352131G>C	uc002yji.2	-	1		c.635C>G			C21orf81_uc002yjj.3_RNA	NR_027270				Homo sapiens C21orf81 protein (C21orf81) mRNA, complete cds.												0						CTGCAGTTCCGAGTACCGGAT	0.632													7	15	---	---	---	---	PASS
NF2	4771	broad.mit.edu	37	22	30035110	30035110	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30035110C>T	uc003age.3	+	3	715	c.272C>T	c.(271-273)CCA>CTA	p.P91L	NF2_uc003afy.3_Missense_Mutation_p.P91L|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Missense_Mutation_p.P91L|NF2_uc003agb.3_Missense_Mutation_p.P14L|NF2_uc003agc.3_Missense_Mutation_p.P53L|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Missense_Mutation_p.P91L|NF2_uc003aga.3_Missense_Mutation_p.P49L|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Missense_Mutation_p.P91L|NF2_uc003agk.3_Missense_Mutation_p.P53L	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1	91	FERM.				actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.H84_F100del(1)|p.V86_Q111>E(1)|p.P91fs*32(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						AAGGAAGAACCAGTCACCTTT	0.423			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				35	88	---	---	---	---	PASS
C22orf28	51493	broad.mit.edu	37	22	32794016	32794016	+	Silent	SNP	A	G	G			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32794016A>G	uc003amm.2	-	7	857	c.726T>C	c.(724-726)GCT>GCC	p.A242A	C22orf28_uc011ama.1_RNA	NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493	242					cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						TTTTTTTAGCAGCATACTCAT	0.458													45	136	---	---	---	---	PASS
XRCC6	2547	broad.mit.edu	37	22	42059704	42059704	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42059704C>T	uc003bao.1	+	13	1785	c.1715C>T	c.(1714-1716)ACG>ATG	p.T572M	XRCC6_uc003bap.1_Missense_Mutation_p.T531M|XRCC6_uc011apc.1_Missense_Mutation_p.T522M|XRCC6_uc003baq.1_3'UTR|XRCC6_uc003bar.1_Missense_Mutation_p.T572M|XRCC6_uc003bas.1_Missense_Mutation_p.T522M	NM_001469	NP_001460	P12956	XRCC6_HUMAN	ATP-dependent DNA helicase II, 70 kDa subunit	572					DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding			skin(2)|ovary(1)|lung(1)|kidney(1)	5						AGCAAGGGTACGCTGGGCAAG	0.562								Direct_reversal_of_damage|NHEJ					33	128	---	---	---	---	PASS
ZNF182	7569	broad.mit.edu	37	X	47837103	47837103	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47837103G>T	uc004dir.2	-	7	729	c.383C>A	c.(382-384)ACA>AAA	p.T128K	ZNF182_uc004dis.2_Missense_Mutation_p.T109K|ZNF182_uc004dit.2_Missense_Mutation_p.T128K|ZNF182_uc011mlu.1_Missense_Mutation_p.T108K	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	128					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						GGTGATAATTGTTTTCTTGTC	0.388													6	63	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71264668	71264668	+	Intron	SNP	T	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71264668T>C	uc011mqa.1	+						RPS26P11_uc004eai.2_RNA	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2												0	Renal(35;0.156)					TCGTGAAGCCTGCAAGGACCG	0.517													4	62	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71264689	71264689	+	Intron	SNP	C	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71264689C>T	uc011mqa.1	+						RPS26P11_uc004eai.2_RNA	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2												0	Renal(35;0.156)					AACACCCCCACCCCGATTTAG	0.507													5	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6709	6709	+	5'UTR	SNP	G	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6709G>A	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		AGAACCATTTGGATACATAGG	0.393													2	1	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19455704	19455704	+	Intron	DEL	A	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19455704delA	uc001bbi.2	-						UBR4_uc001bbk.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTCCAGCATTAAAAAAAAAAG	0.423													4	5	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21299378	21299378	+	Intron	DEL	A	-	-	rs76449388		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21299378delA	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AGGGAAGAATAAAAAAAAAAA	0.284													4	3	---	---	---	---	
IL12RB2	3595	broad.mit.edu	37	1	67787193	67787194	+	Intron	INS	-	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67787193_67787194insT	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						GATGGAGTTAATTTTACCCTGT	0.322													35	15	---	---	---	---	
OTUD7B	56957	broad.mit.edu	37	1	149921365	149921365	+	Intron	DEL	T	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149921365delT	uc001etn.2	-							NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CTCCCAACCCTTTTTTTTTTT	0.358													4	2	---	---	---	---	
CDC42SE1	56882	broad.mit.edu	37	1	151027766	151027768	+	Intron	DEL	AAC	-	-	rs142658599		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151027766_151027768delAAC	uc001ewo.2	-						CDC42SE1_uc001ewp.2_Intron	NM_001038707	NP_001033796	Q9NRR8	C42S1_HUMAN	CDC42 small effector 1						phagocytosis|regulation of cell shape|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase inhibitor activity				0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCAAAGCTGGAACAACAAAAGCA	0.473													3	6	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203802746	203802747	+	Intron	INS	-	TTTTTT	TTTTTT	rs59117283		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203802746_203802747insTTTTTT	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATAGGTTTGGGTTTTTTTTTTT	0.257													6	4	---	---	---	---	
MIA3	375056	broad.mit.edu	37	1	222806144	222806145	+	Intron	INS	-	T	T			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222806144_222806145insT	uc001hnl.2	+						MIA3_uc009xea.1_Intron	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3						exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		CAATGCAGTTCTTTTTTTTGAT	0.297													4	3	---	---	---	---	
NID1	4811	broad.mit.edu	37	1	236148493	236148493	+	Intron	DEL	A	-	-	rs35290130		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236148493delA	uc001hxo.2	-						NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_Intron	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)	actctgtctcaaaaaaaaaaa	0.139													4	4	---	---	---	---	
ERO1LB	56605	broad.mit.edu	37	1	236399897	236399901	+	Intron	DEL	AAGAG	-	-	rs72007838		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236399897_236399901delAAGAG	uc001hxt.2	-						ERO1LB_uc010pxt.1_Intron	NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CAAATTCCTTAAGAGAAGAAAAAAC	0.332													3	4	---	---	---	---	
ZNF512	84450	broad.mit.edu	37	2	27824511	27824512	+	Intron	INS	-	TTTTG	TTTTG	rs143396334	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27824511_27824512insTTTTG	uc002rla.2	+						ZNF512_uc010ylv.1_Intron|ZNF512_uc010ylw.1_Intron|ZNF512_uc002rlb.2_Intron|ZNF512_uc010ylx.1_Intron|ZNF512_uc002rlc.2_Intron|ZNF512_uc010yly.1_Intron|ZNF512_uc010ylz.1_Intron	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					tggctaattttttttgttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45224046	45224047	+	IGR	DEL	AA	-	-	rs34239087		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45224046_45224047delAA								SIX3 (51656 upstream) : SIX2 (8278 downstream)																							TTATTTGTTTAAAAAAAAAAAA	0.223													4	2	---	---	---	---	
WIPF1	7456	broad.mit.edu	37	2	175439682	175439682	+	Intron	DEL	A	-	-	rs68082019		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175439682delA	uc002uiy.2	-						uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Intron|WIPF1_uc010fqt.1_Intron|WIPF1_uc002ujc.1_Intron|WIPF1_uc002uiz.2_Intron|WIPF1_uc002ujb.1_Intron|WIPF1_uc010zep.1_Intron	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1						actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2						TTAGAAAAGTAAAAAAAAAAA	0.403													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201967218	201967218	+	IGR	DEL	G	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201967218delG								NDUFB3 (16747 upstream) : CFLAR (13598 downstream)																							aaaaaaaaaagaaTTTGTTCT	0.229													6	4	---	---	---	---	
PASK	23178	broad.mit.edu	37	2	242075147	242075148	+	Intron	INS	-	C	C	rs140491962	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242075147_242075148insC	uc002wao.1	-						PASK_uc010zol.1_Intron|PASK_uc010zom.1_Intron|PASK_uc010fzl.1_Intron|PASK_uc010zon.1_Intron|PASK_uc002wap.2_5'Flank|PASK_uc002waq.2_Intron	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase						regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GAAAACAGTCACCCCCTACTCC	0.550													7	4	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47129455	47129458	+	Intron	DEL	AAAC	-	-	rs66851205		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47129455_47129458delAAAC	uc003cqs.2	-						SETD2_uc003cqv.2_Intron	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		gaccccatctaaacaaacaaacaa	0.078			N|F|S|Mis		clear cell renal carcinoma								3	4	---	---	---	---	
PRKAR2A	5576	broad.mit.edu	37	3	48794052	48794052	+	Intron	DEL	A	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48794052delA	uc010hki.1	-						PRKAR2A_uc003cux.1_Intron|PRKAR2A_uc003cuy.1_Intron	NM_004157	NP_004148	P13861	KAP2_HUMAN	cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		TAGGAAAAGGAAAAAAAAAAG	0.204													4	2	---	---	---	---	
ROBO2	6092	broad.mit.edu	37	3	77459838	77459838	+	Intron	DEL	T	-	-	rs143772782	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77459838delT	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		cctcctcctcttcctcctcct	0.000													6	3	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	158980372	158980373	+	Frame_Shift_Ins	INS	-	G	G			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158980372_158980373insG	uc003fcq.1	+	4	296_297	c.191_192insG	c.(190-192)CAGfs	p.Q64fs	SCHIP1_uc003fcr.1_5'UTR|IQCJ_uc003fco.2_Frame_Shift_Ins_p.Q64fs|IQCJ_uc010hvy.1_Frame_Shift_Ins_p.Q37fs|IQCJ_uc003fcp.1_Frame_Shift_Ins_p.Q64fs	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1	Error:Variant_position_missing_in_Q9P0W5_after_alignment						cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			CTGCAGCGGCAGGAGCCCCTGG	0.540													250	7	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85730855	85730856	+	Intron	INS	-	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85730855_85730856insA	uc003hpd.2	-						WDFY3_uc003hpf.2_3'UTR	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GCTTCCATGCTAAAAAAAAAAA	0.287													4	2	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCTTAAGAAGtttgtttttgtttttgtttttg	0.222													8	4	---	---	---	---	
CCDC125	202243	broad.mit.edu	37	5	68602471	68602471	+	Intron	DEL	T	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68602471delT	uc003jvv.1	-						CCDC125_uc003jvx.1_Intron|CCDC125_uc003jvy.1_Intron|CCDC125_uc003jvw.2_Intron	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125							cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		gccTATGCTATTTTTTTTCTT	0.139													4	2	---	---	---	---	
C6orf62	81688	broad.mit.edu	37	6	24714845	24714846	+	Intron	INS	-	T	T	rs141439611	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24714845_24714846insT	uc003nel.2	-							NM_030939	NP_112201	Q9GZU0	CF062_HUMAN	hypothetical protein LOC81688							intracellular					0						AGCTCATGATGTAAttttttat	0.124													4	3	---	---	---	---	
KIAA0240	23506	broad.mit.edu	37	6	42790381	42790382	+	Intron	INS	-	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42790381_42790382insA	uc003osn.1	+						KIAA0240_uc003osm.1_Intron|KIAA0240_uc011duw.1_Intron|KIAA0240_uc003oso.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			AAAACAAGATTAAAAAAAAAAA	0.233													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134747253	134747253	+	IGR	DEL	T	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134747253delT								SGK1 (108057 upstream) : ALDH8A1 (491276 downstream)																							ccttccttccttccttccttc	0.035													4	2	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157524929	157524938	+	Intron	DEL	CTTTCGTTAA	-	-	rs141875347	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157524929_157524938delCTTTCGTTAA	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TTTTCTTACTCTTTCGTTAACTTTCGTTCT	0.376													370	112	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61822074	61822074	+	IGR	DEL	C	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61822074delC								None (None upstream) : LOC643955 (929598 downstream)																							AAGGACCTCACCCAGCAGGAG	0.637													12	6	---	---	---	---	
LOC493754	493754	broad.mit.edu	37	7	66013785	66013786	+	Intron	DEL	AA	-	-	rs67360155		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66013785_66013786delAA	uc010lac.1	-						LOC493754_uc010lad.2_Intron|LOC493754_uc011kdx.1_Intron					Homo sapiens cDNA FLJ14309 fis, clone PLACE3000221.												0						actccatctcaaaaaaaaaaaa	0.153													4	2	---	---	---	---	
SEMA3D	223117	broad.mit.edu	37	7	84669974	84669974	+	Intron	DEL	T	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84669974delT	uc003uic.2	-						SEMA3D_uc010led.2_Intron|SEMA3D_uc003uib.2_Intron	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						ATTAAAAGCATTTTGTTGAAC	0.294													47	16	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111474750	111474750	+	Intron	DEL	A	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111474750delA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCCCTAAGTTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144138674	144138674	+	IGR	DEL	T	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144138674delT								C8orf31 (2954 upstream) : LY6H (100658 downstream)																							attatttttattttttttttt	0.159													5	3	---	---	---	---	
CDC14B	8555	broad.mit.edu	37	9	99327506	99327506	+	Intron	DEL	T	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99327506delT	uc004awj.2	-						CDC14B_uc004awk.2_Intron|CDC14B_uc004awl.2_Intron|CDC14B_uc004awi.2_Intron	NM_033331	NP_201588	O60729	CC14B_HUMAN	CDC14 homolog B isoform 2						activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				TTTAGGGAGGTTTTTTTTTTT	0.294													3	3	---	---	---	---	
MBL1P	8512	broad.mit.edu	37	10	81680656	81680656	+	Intron	DEL	A	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81680656delA	uc001kbf.2	+						MBL1P_uc001kbg.1_RNA					Homo sapiens mannose-binding protein-A pseudogene (MBL1P1) mRNA sequence.												0						GCTTTTGGGGAAAAAAAAAAG	0.542													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112211015	112211016	+	IGR	INS	-	C	C	rs7089104	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112211015_112211016insC								SMNDC1 (146308 upstream) : DUSP5 (46609 downstream)																							aaaaaaaaaaaaaaaaaaaaCC	0.257													82	7	---	---	---	---	
DDB2	1643	broad.mit.edu	37	11	47251369	47251370	+	Intron	INS	-	T	T	rs11445579		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47251369_47251370insT	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Intron|DDB2_uc001neh.2_Intron	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						gatggctcttcttttttttttt	0.000			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59066135	59066136	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs36130299		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066135_59066136insGGAAGGAA								MPEG1 (85641 upstream) : OR5AN1 (65796 downstream)																							gatggacagatggaaggaagga	0.000													4	11	---	---	---	---	
LRP5	4041	broad.mit.edu	37	11	68131124	68131125	+	Intron	INS	-	A	A			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68131124_68131125insA	uc001ont.2	+						LRP5_uc009ysg.2_Intron	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						gactccatctcaaaaaaaaaaa	0.252													4	2	---	---	---	---	
GDPD5	81544	broad.mit.edu	37	11	75152348	75152349	+	Frame_Shift_Ins	INS	-	G	G			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75152348_75152349insG	uc001owo.3	-	15	1869_1870	c.1332_1333insC	c.(1330-1335)TACGCGfs	p.Y444fs	GDPD5_uc001owp.3_Frame_Shift_Ins_p.Y444fs|GDPD5_uc001own.3_Frame_Shift_Ins_p.Y199fs|GDPD5_uc009yuc.2_Frame_Shift_Ins_p.Y306fs|GDPD5_uc009yud.2_Frame_Shift_Ins_p.Y325fs	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain	444_445	Extracellular (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						TTCCAGGACGCGTAGTCCCTGT	0.629													80	20	---	---	---	---	
FMNL3	91010	broad.mit.edu	37	12	50041517	50041519	+	In_Frame_Del	DEL	GGG	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50041517_50041519delGGG	uc001ruv.1	-	23	2979_2981	c.2745_2747delCCC	c.(2743-2748)TTCCCA>TTA	p.915_916FP>L	FMNL3_uc001ruw.1_In_Frame_Del_p.864_865FP>L|FMNL3_uc001rut.1_In_Frame_Del_p.481_482FP>L|FMNL3_uc001ruu.1_In_Frame_Del_p.765_766FP>L	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1	915_916	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						GACAAATACTGGGAAGAATACAG	0.512													92	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69594093	69594102	+	IGR	DEL	AGAAAGAGAT	-	-	rs80081772		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594093_69594102delAGAAAGAGAT								CPM (237073 upstream) : CPSF6 (39215 downstream)																							ataagagataagaaagagataagagataag	0.024													3	6	---	---	---	---	
DDX52	11056	broad.mit.edu	37	17	35974149	35974149	+	3'UTR	DEL	A	-	-	rs143300381	by1000genomes	TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35974149delA	uc002hoi.1	-	15					DDX52_uc002hoh.1_3'UTR	NM_007010	NP_008941	Q9Y2R4	DDX52_HUMAN	ATP-dependent RNA helicase ROK1 isoform a							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|skin(1)	2		Breast(25;0.00637)|Ovarian(249;0.15)				tctctacaggaaaaaaaaaaG	0.169													4	2	---	---	---	---	
SLC4A1	6521	broad.mit.edu	37	17	42329098	42329099	+	Intron	INS	-	G	G			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42329098_42329099insG	uc002igf.3	-							NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member						bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		ctttttttttttttttttttgt	0.213													6	3	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11610673	11610674	+	IGR	INS	-	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610673_11610674insC								FAM38B (908694 upstream) : GNAL (78462 downstream)																							AAGACTGAAGACaaaaaaaaaa	0.302													6	4	---	---	---	---	
LMTK3	114783	broad.mit.edu	37	19	49002387	49002389	+	In_Frame_Del	DEL	CCT	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49002387_49002389delCCT	uc002pjk.2	-	12	2024_2026	c.2024_2026delAGG	c.(2023-2028)GAGGGC>GGC	p.E675del		NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		GGGGAGCTGCCCTCCTCCTCCTC	0.739													4	2	---	---	---	---	
NKX2-4	644524	broad.mit.edu	37	20	21377696	21377697	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21377696_21377697insC	uc010gcz.2	-	1	351_352	c.341_342insG	c.(340-342)GGCfs	p.G114fs		NM_033176	NP_149416	Q9H2Z4	NKX24_HUMAN	NK2 homeobox 4	114					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTTGCCCAGGCCGCCGTTGCA	0.624													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25900372	25900372	+	IGR	DEL	A	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25900372delA								FAM182B (51586 upstream) : LOC100134868 (90063 downstream)																							AGTTTGTCAGaaaaaaaaaaa	0.264													22	7	---	---	---	---	
C20orf70	140683	broad.mit.edu	37	20	31767238	31767238	+	Intron	DEL	A	-	-	rs77930653		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31767238delA	uc002wyo.1	+							NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor							extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2						tctgtctcagaaaaaaaaaaa	0.134													4	3	---	---	---	---	
SLC5A1	6523	broad.mit.edu	37	22	32495094	32495102	+	Intron	DEL	TATATATAT	-	-	rs67514288		TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32495094_32495102delTATATATAT	uc003amc.2	+						SLC5A1_uc011alz.1_Intron	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose						carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						aaaaaaaaaatatatatatatatatatat	0.167													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48305869	48305869	+	IGR	DEL	T	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48305869delT								SSX4 (53084 upstream) : SLC38A5 (11059 downstream)																							ATAATACCCATTTTTTTTCTG	0.353													5	3	---	---	---	---	
CD40LG	959	broad.mit.edu	37	X	135732733	135732733	+	Intron	DEL	A	-	-			TCGA-CH-5794-01A-11D-1576-08	TCGA-CH-5794-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135732733delA	uc004faa.2	+						CD40LG_uc010nsd.2_Intron|CD40LG_uc010nse.1_Intron	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand						anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)	TGTGGGGGTTAAAAAAAAAAA	0.289									Immune_Deficiency_with_Hyper-IgM				4	2	---	---	---	---	
