Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CALML6	163688	broad.mit.edu	37	1	1848280	1848280	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1848280G>A	uc001aih.1	+	4	797	c.343G>A	c.(343-345)GCA>ACA	p.A115T		NM_138705	NP_619650	Q8TD86	CALL6_HUMAN	calmodulin-like 6	115	EF-hand 3.					cytoplasm|nucleus	calcium ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.94e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.83e-23)|GBM - Glioblastoma multiforme(42;3.23e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		GCTGAGGGCGGCATTCCGTGT	0.597													4	205	---	---	---	---	PASS
ZBTB17	7709	broad.mit.edu	37	1	16274882	16274882	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16274882C>A	uc001axl.3	-	3	348	c.109G>T	c.(109-111)GCT>TCT	p.A37S	ZBTB17_uc010obq.1_Intron|ZBTB17_uc010obr.1_Missense_Mutation_p.A37S|ZBTB17_uc010obs.1_5'UTR|ZBTB17_uc010obt.1_Missense_Mutation_p.A37S|ZBTB17_uc010obu.1_Intron|ZBTB17_uc009vom.1_Missense_Mutation_p.A37S|ZBTB17_uc010obv.1_Missense_Mutation_p.A37S|ZBTB17_uc009von.1_Missense_Mutation_p.A40S	NM_003443	NP_003434	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	37	BTB.				negative regulation of cell cycle	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		GCTTTATGAGCCTTAAAGTGA	0.572													7	106	---	---	---	---	PASS
ATXN7L2	127002	broad.mit.edu	37	1	110032537	110032537	+	Intron	SNP	T	C	C			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110032537T>C	uc001dxr.2	+						ATXN7L2_uc001dxs.2_5'UTR|ATXN7L2_uc001dxt.2_5'Flank	NM_153340	NP_699171	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2											ovary(2)	2		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		CTGGCATCCCTTTTGGCCCTT	0.622													3	255	---	---	---	---	PASS
HIST2H2BF	440689	broad.mit.edu	37	1	149783718	149783718	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149783718C>T	uc001esr.2	-	1	211	c.161G>A	c.(160-162)GGC>GAC	p.G54D	HIST2H2BF_uc010pbj.1_Missense_Mutation_p.G54D|HIST2H2BF_uc010pbk.1_Missense_Mutation_p.G54D	NM_001024599	NP_001019770	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf isoform a	54					nucleosome assembly	nucleosome|nucleus	DNA binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)					GGACGAGATGCCGGTGTCGGG	0.597													6	351	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152328411	152328411	+	Silent	SNP	A	G	G	rs6679449	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152328411A>G	uc001ezw.3	-	3	1924	c.1851T>C	c.(1849-1851)AGT>AGC	p.S617S	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	617	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGGCCATAACTAGACTGAC	0.517													6	541	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097555	167097555	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097555G>T	uc001geb.1	+	5	3187	c.3187G>T	c.(3187-3189)GCC>TCC	p.A1063S		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1063					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						CCCAAATTGGGCCAGGTCCAG	0.552													5	78	---	---	---	---	PASS
MRPS14	63931	broad.mit.edu	37	1	174987689	174987689	+	Silent	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174987689G>T	uc001gkk.2	-	2	86	c.69C>A	c.(67-69)GGC>GGA	p.G23G	MRPS14_uc009wwr.2_Silent_p.G8G	NM_022100	NP_071383	O60783	RT14_HUMAN	mitochondrial ribosomal protein S14	23					translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0						TTCGAACTTGGCCTGAAGCTG	0.458													9	130	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177199242	177199242	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177199242G>A	uc001glf.2	+	2	542	c.230G>A	c.(229-231)CGG>CAG	p.R77Q		NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	77						extracellular region		p.R77R(1)		skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						TTCATGGAGCGGTACCGCCAG	0.617													5	149	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289													4	21	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207169502	207169502	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207169502G>T	uc002vbp.2	+	5	500	c.250G>T	c.(250-252)GAT>TAT	p.D84Y		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	84							nucleic acid binding|zinc ion binding			ovary(3)	3						GCATTTGGATGATGCTTTTTC	0.418													4	121	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108344813	108344813	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108344813A>G	uc003dxd.2	+	7	1000	c.578A>G	c.(577-579)AAG>AGG	p.K193R	DZIP3_uc003dxf.1_Missense_Mutation_p.K193R|DZIP3_uc011bhm.1_Intron|DZIP3_uc003dxe.1_Missense_Mutation_p.K193R	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	193					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TGTGCTCAAAAGAGGTAAGGA	0.358													3	306	---	---	---	---	PASS
CD200R1L	344807	broad.mit.edu	37	3	112546284	112546284	+	Silent	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112546284G>A	uc003dzi.1	-	3	586	c.360C>T	c.(358-360)GAC>GAT	p.D120D	CD200R1L_uc011bhw.1_Silent_p.D99D|CD200R1L_uc010hqf.1_Silent_p.D99D	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2	120	Ig-like V-type.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)	1						TGTAATACCCGTCATGAGTGG	0.463													7	268	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69696502	69696502	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69696502G>T	uc003hee.2	+	6	1517	c.1492G>T	c.(1492-1494)GCT>TCT	p.A498S	UGT2B10_uc011cam.1_Missense_Mutation_p.A414S	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GTTCCTGCTGGCTTGTGTGGC	0.443													13	245	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69870669	69870669	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69870669C>A	uc011cao.1	-	9	1517	c.1381G>T	c.(1381-1383)GCT>TCT	p.A461S	UGT2B10_uc011can.1_Missense_Mutation_p.A377S			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GCCACACAGGCCAGCAGGAAC	0.448													11	214	---	---	---	---	PASS
C5orf33	133686	broad.mit.edu	37	5	36225709	36225709	+	Silent	SNP	C	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36225709C>A	uc003jkf.3	-	4	495	c.495G>T	c.(493-495)CTG>CTT	p.L165L	C5orf33_uc010iux.2_Silent_p.L2L|C5orf33_uc003jkg.3_Silent_p.L2L|C5orf33_uc011cov.1_Silent_p.L2L	NM_001085411	NP_001078880	Q4G0N4	NAKD1_HUMAN	hypothetical protein LOC133686 isoform 1	165							NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCGCTGCCAGCAGCATTGTGC	0.358													4	222	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82849208	82849208	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82849208G>A	uc003kii.3	+	11	9875	c.9519G>A	c.(9517-9519)TGG>TGA	p.W3173*	VCAN_uc003kij.3_Nonsense_Mutation_p.W2186*|VCAN_uc010jau.2_Nonsense_Mutation_p.W1419*|VCAN_uc003kik.3_Nonsense_Mutation_p.W432*|VCAN_uc003kil.3_Nonsense_Mutation_p.W1837*	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3173					cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ACTATGGCTGGCACAAATTCC	0.502													4	116	---	---	---	---	PASS
EPB41L4A	64097	broad.mit.edu	37	5	111598235	111598235	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111598235C>T	uc003kpv.1	-	7	872	c.598G>A	c.(598-600)GCC>ACC	p.A200T		NM_022140	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte protein band 4.1-like 4	200	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		AGGGATTTGGCAGTCCTCAAG	0.408													4	242	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140181572	140181572	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140181572G>A	uc003lhf.2	+	1	790	c.790G>A	c.(790-792)GTT>ATT	p.V264I	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.V264I	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	264	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGGTGACCGTTAACGCCAC	0.418													4	133	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140208009	140208009	+	Missense_Mutation	SNP	C	A	A	rs138737999	byFrequency	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140208009C>A	uc003lho.2	+	1	360	c.333C>A	c.(331-333)GAC>GAA	p.D111E	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.D111E|PCDHA6_uc011dab.1_Missense_Mutation_p.D111E	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	111	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATCGTGGACAGGCCGCTGC	0.557													6	301	---	---	---	---	PASS
MUC21	394263	broad.mit.edu	37	6	30954434	30954434	+	Missense_Mutation	SNP	A	G	G	rs9262337		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30954434A>G	uc003nsh.2	+	2	733	c.482A>G	c.(481-483)GAG>GGG	p.E161G	MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor	161	Ser-rich.|28 X 15 AA approximate tandem repeats.|9.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|skin(1)	2						ACCTCCAGTGAGGCCAGCACA	0.617													4	204	---	---	---	---	PASS
TCF19	6941	broad.mit.edu	37	6	31127393	31127393	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31127393G>T	uc003nss.2	+	2	671	c.147G>T	c.(145-147)GAG>GAT	p.E49D	CCHCR1_uc011dne.1_5'Flank|CCHCR1_uc003nsq.3_5'Flank|CCHCR1_uc003nsp.3_5'Flank|CCHCR1_uc003nsr.3_5'Flank|CCHCR1_uc010jsk.1_5'Flank|TCF19_uc003nst.2_Missense_Mutation_p.E49D	NM_001077511	NP_001070979	Q9Y242	TCF19_HUMAN	transcription factor 19	49	FHA.				cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCCAGCAGGAGCCTGGCCTCA	0.662													3	46	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43400462	43400462	+	Silent	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43400462C>T	uc003ouy.1	+	3	959	c.744C>T	c.(742-744)TGC>TGT	p.C248C	ABCC10_uc003ouz.1_Silent_p.C205C	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	248						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			AGGACATTTGCCGCCTCCCCC	0.642													3	58	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43543733	43543733	+	5'UTR	SNP	C	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43543733C>A	uc003ovp.2	-	1					POLH_uc010jyu.2_5'Flank|POLH_uc011dvl.1_5'Flank|POLH_uc003ovq.3_5'Flank	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			GGAGGAGGAGCGTTAGCAGCA	0.627													2	5	---	---	---	---	PASS
HOXA3	3200	broad.mit.edu	37	7	27147490	27147490	+	3'UTR	SNP	T	G	G			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27147490T>G	uc011jzl.1	-	3					HOXA3_uc011jzk.1_3'UTR|HOXA3_uc003syk.2_3'UTR	NM_030661	NP_109377	O43365	HXA3_HUMAN	homeobox A3 isoform a						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						agaaaaaaGGTGGGTGGGGGG	0.493													5	77	---	---	---	---	PASS
DPY19L2P1	554236	broad.mit.edu	37	7	35189821	35189821	+	5'UTR	SNP	A	G	G			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35189821A>G	uc003teq.1	-	7					DPY19L2P1_uc003tep.1_5'Flank|DPY19L2P1_uc010kwz.1_RNA					RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						GCTTTCTAGAAAACAAACCTC	0.308													3	45	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72413243	72413243	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72413243A>C	uc003twk.2	+	11	2711	c.2711A>C	c.(2710-2712)CAC>CCC	p.H904P	POM121_uc003twj.2_Missense_Mutation_p.H639P|POM121_uc010lam.1_Missense_Mutation_p.H639P	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	904	Thr-rich.|Pore side (Potential).			H -> P (in Ref. 3; BAB14097).	carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				CAGTCCCTGCACACTGCCGTG	0.647													5	161	---	---	---	---	PASS
ZNF212	7988	broad.mit.edu	37	7	148947631	148947631	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148947631G>A	uc003wfp.2	+	2	502	c.406G>A	c.(406-408)GCC>ACC	p.A136T		NM_012256	NP_036388	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	136					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			CAAGGGGGAGGCCCCCAAGGT	0.557													14	212	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62370926	62370926	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62370926C>T	uc003xuh.2	+	5	1126	c.802C>T	c.(802-804)CCC>TCC	p.P268S	CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Intron	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	268	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						TGAATTTTTGCCCTCTGAATT	0.413													4	288	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	428369	428369	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:428369C>A	uc003zgf.2	+	35	4458	c.4346C>A	c.(4345-4347)TCG>TAG	p.S1449*	DOCK8_uc010mgu.2_Nonsense_Mutation_p.S751*|DOCK8_uc010mgv.2_Nonsense_Mutation_p.S1349*|DOCK8_uc003zgk.2_Nonsense_Mutation_p.S907*	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1449	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CAGGCGAGCTCGGCTCTGGAC	0.502													4	123	---	---	---	---	PASS
TOR2A	27433	broad.mit.edu	37	9	130495419	130495419	+	Intron	SNP	C	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130495419C>A	uc004brs.3	-						TOR2A_uc004brt.3_Intron|TOR2A_uc004brw.3_3'UTR|TOR2A_uc011maj.1_3'UTR|TOR2A_uc004bru.3_Intron|TOR2A_uc004brv.3_Intron|TOR2A_uc004brx.1_Intron	NM_001085347	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A isoform a						chaperone mediated protein folding requiring cofactor	endoplasmic reticulum|extracellular region	ATP binding|nucleoside-triphosphatase activity				0						AACTTCTTGACCTGGCAGGGC	0.279													4	62	---	---	---	---	PASS
TPRN	286262	broad.mit.edu	37	9	140093678	140093678	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140093678G>A	uc004clt.2	-	1	1303	c.1303C>T	c.(1303-1305)CGG>TGG	p.R435W	TPRN_uc004clu.2_Missense_Mutation_p.R435W	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 2	496					sensory perception of sound	stereocilium					0						TTGCTGCCCCGGGGCTGAAGC	0.682													3	110	---	---	---	---	PASS
AKR1C1	1645	broad.mit.edu	37	10	4995058	4995058	+	5'UTR	SNP	T	C	C	rs1132228		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4995058T>C	uc001iho.2	+	5					AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	TCACTAACTGTTGGAACTGAT	0.483													2	4	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24880837	24880837	+	Silent	SNP	A	G	G			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24880837A>G	uc001isb.2	-	22	4468	c.3981T>C	c.(3979-3981)ATT>ATC	p.I1327I	ARHGAP21_uc010qdb.1_RNA	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1326	Rho-GAP.				signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						GCGTTTCTACAATCTTGTACT	0.453													7	251	---	---	---	---	PASS
LOC441666	441666	broad.mit.edu	37	10	42832015	42832015	+	RNA	SNP	A	C	C			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42832015A>C	uc010qey.1	-	3		c.1960T>G				NR_024380				Homo sapiens noncoding mRNA sequence.												0						TATGTACATTAAGGTCTAAAG	0.343													2	5	---	---	---	---	PASS
HNRNPA3P1	10151	broad.mit.edu	37	10	44285478	44285478	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44285478C>T	uc010qfe.1	-	1	388	c.358G>A	c.(358-360)GGT>AGT	p.G120S		NR_002726				SubName: Full=cDNA FLJ52659, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=cDNA, FLJ79333, highly similar to Heterogeneous nuclear ribonucleoprotein A3; SubName: Full=Heterogeneous nuclear ribonucleoprotein A3, isoform CRA_a;												0						AGATGGGCACCAGGCTTCACA	0.418													3	134	---	---	---	---	PASS
PNLIPRP2	5408	broad.mit.edu	37	10	118394422	118394422	+	Silent	SNP	T	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118394422T>A	uc001lcq.2	+	11	914	c.891T>A	c.(889-891)CCT>CCA	p.P297P	PNLIPRP2_uc009xyu.1_RNA|PNLIPRP2_uc009xyv.1_RNA	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2	296					galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		TCCTCAACCCTGATGGCTTCC	0.517													3	91	---	---	---	---	PASS
INS-IGF2	723961	broad.mit.edu	37	11	2182081	2182081	+	Silent	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2182081G>A	uc001lvm.2	-	2	180	c.121C>T	c.(121-123)CTA>TTA	p.L41L	INS-IGF2_uc001lvi.2_RNA|INS_uc001lvn.1_Silent_p.L41L|INS_uc001lvo.1_Silent_p.L41L|INS_uc009ydg.1_Silent_p.L41L	NM_001042376	NP_001035835	Q1WM24	Q1WM24_HUMAN	insulin- insulin-like growth factor 2	41					glucose metabolic process	extracellular region	hormone activity				0		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.0832)|Lung(200;0.156)		CCGCACACTAGGTAGAGAGCT	0.662													4	91	---	---	---	---	PASS
ESRRA	2101	broad.mit.edu	37	11	64083442	64083442	+	3'UTR	SNP	A	G	G			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64083442A>G	uc001nzq.1	+	7					ESRRA_uc001nzr.1_3'UTR|ESRRA_uc001nzs.1_3'UTR|PRDX5_uc001nzu.2_5'Flank|PRDX5_uc001nzv.2_5'Flank|PRDX5_uc001nzw.2_5'Flank|PRDX5_uc001nzx.2_5'Flank	NM_004451	NP_004442	P11474	ERR1_HUMAN	estrogen-related receptor alpha						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein domain specific binding|sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0						GGACTGAGGCAAGGGGTGGGA	0.637													4	92	---	---	---	---	PASS
LOC645332	645332	broad.mit.edu	37	11	67560706	67560706	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67560706G>A	uc001omt.3	-	4	391	c.368C>T	c.(367-369)ACG>ATG	p.T123M	LOC645332_uc001omu.3_Missense_Mutation_p.T73M	NR_024249				SubName: Full=cDNA FLJ57700, weakly similar to Protein FAM86A;												0						AGTGCTCTTCGTAGGGAAACA	0.507													6	152	---	---	---	---	PASS
ANKRD49	54851	broad.mit.edu	37	11	94231847	94231847	+	3'UTR	SNP	G	A	A	rs1046654	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94231847G>A	uc001pew.2	+	3					ANKRD49_uc001pex.2_3'UTR|ANKRD49_uc001pey.2_RNA	NM_017704	NP_060174	Q8WVL7	ANR49_HUMAN	fetal globin inducing factor						positive regulation of transcription, DNA-dependent					central_nervous_system(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCCTGACTTTGATGTCAAAAT	0.274													7	7	---	---	---	---	PASS
MMP3	4314	broad.mit.edu	37	11	102709910	102709910	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102709910G>A	uc001phj.1	-	7	1065	c.1000C>T	c.(1000-1002)CCA>TCA	p.P334S		NM_002422	NP_002413	P08254	MMP3_HUMAN	matrix metalloproteinase 3 preproprotein	334	Hemopexin-like 1.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			lung(1)|kidney(1)	2		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)|Simvastatin(DB00641)	GGAAGAGATGGCCAAAATGAA	0.353													4	203	---	---	---	---	PASS
OR4D5	219875	broad.mit.edu	37	11	123810566	123810566	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123810566G>T	uc001pzk.1	+	1	243	c.243G>T	c.(241-243)ATG>ATT	p.M81I		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	81	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CACCTAGGATGCTGGTTGACT	0.483													4	240	---	---	---	---	PASS
PUS3	83480	broad.mit.edu	37	11	125766044	125766044	+	Missense_Mutation	SNP	C	A	A	rs549990	byFrequency	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125766044C>A	uc001qcy.2	-	2	234	c.136G>T	c.(136-138)GCA>TCA	p.A46S	HYLS1_uc009zbv.2_Intron|HYLS1_uc001qcx.3_Intron	NM_031307	NP_112597	Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	46						nucleus	RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		CCAGCTCCTGCTGAATTTTCT	0.448													5	510	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40631791	40631791	+	Silent	SNP	T	C	C	rs10878245	byFrequency	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40631791T>C	uc001rmg.3	+	5	578	c.457T>C	c.(457-459)TTG>CTG	p.L153L		NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	153					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTTGCTGATATTGGATGAAGA	0.303													3	203	---	---	---	---	PASS
BLOC1S1	2647	broad.mit.edu	37	12	56113258	56113258	+	3'UTR	SNP	T	C	C			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56113258T>C	uc009zny.1	+	3					BLOC1S1_uc001shi.2_Intron|BLOC1S1_uc001shj.3_Intron|RDH5_uc010spt.1_5'Flank|RDH5_uc010spu.1_5'Flank|RDH5_uc001shk.2_5'Flank|RDH5_uc001shl.2_5'Flank			P78537	BL1S1_HUMAN	RecName: Full=Biogenesis of lysosome-related organelles complex 1 subunit 1;          Short=BLOC-1 subunit 1; AltName: Full=GCN5-like protein 1; AltName: Full=Protein RT14;						cellular membrane organization|melanosome organization|platelet dense granule organization|post-Golgi vesicle-mediated transport	BLOC-1 complex|lysosomal membrane	protein binding				0						ATTCCTGGGCTCCCACCTCCT	0.527													10	80	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64803798	64803798	+	5'UTR	SNP	A	C	C	rs11175383	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64803798A>C	uc001ssb.2	+	2					XPOT_uc009zqm.1_5'UTR	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		CCAGAAAACTACAAGTATAAC	0.373													4	167	---	---	---	---	PASS
B3GNT4	79369	broad.mit.edu	37	12	122690955	122690955	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122690955G>A	uc001ubx.2	+	3	375	c.157G>A	c.(157-159)GCC>ACC	p.A53T	B3GNT4_uc001uby.2_Missense_Mutation_p.A28T	NM_030765	NP_110392	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal	53	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		GAGGAAGGCGGCCAAGCCCGC	0.662													4	130	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103514446	103514446	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103514446G>A	uc001vpw.2	+	8	1390	c.947G>A	c.(946-948)GGC>GAC	p.G316D	ERCC5_uc001vpu.1_Missense_Mutation_p.G770D|ERCC5_uc010tjb.1_Missense_Mutation_p.G316D|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.G148D	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	316					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AAAATGCACGGCATGTCTTTT	0.418			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				5	430	---	---	---	---	PASS
SYT16	83851	broad.mit.edu	37	14	62463129	62463129	+	Missense_Mutation	SNP	G	A	A	rs17099370	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62463129G>A	uc001xfu.1	+	1	589	c.392G>A	c.(391-393)CGC>CAC	p.R131H	SYT16_uc010tsd.1_Missense_Mutation_p.R131H	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	131										central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		AGTGATGACCGCAAGTTACCA	0.502													5	339	---	---	---	---	PASS
EML5	161436	broad.mit.edu	37	14	89083083	89083083	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89083083C>T	uc001xxg.2	-	42	5969	c.5783G>A	c.(5782-5784)TGT>TAT	p.C1928Y	EML5_uc001xxf.2_Missense_Mutation_p.C715Y|EML5_uc001xxd.2_Missense_Mutation_p.C93Y|EML5_uc001xxe.2_Missense_Mutation_p.C277Y	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	1920	WD 28.					cytoplasm|microtubule				ovary(3)	3						TTTTTCTGGACATGGGAAGTC	0.348													4	49	---	---	---	---	PASS
YY1	7528	broad.mit.edu	37	14	100728720	100728720	+	Silent	SNP	A	G	G	rs74784003	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100728720A>G	uc001ygy.1	+	2	1239	c.759A>G	c.(757-759)GAA>GAG	p.E253E		NM_003403	NP_003394	P25490	TYY1_HUMAN	YY1 transcription factor	253					cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding				0		Melanoma(154;0.152)				ATTATTCAGAATATATGACAG	0.383													10	188	---	---	---	---	PASS
GOLGA8DP	100132979	broad.mit.edu	37	15	22709152	22709152	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22709152G>T	uc010axw.2	-	11	1245	c.347C>A	c.(346-348)GCG>GAG	p.A116E	GOLGA8DP_uc010axx.2_Missense_Mutation_p.A116E|uc010tzw.1_5'Flank	NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E												0						GGCCTGGAGCGCTCCTGCCAC	0.607													3	49	---	---	---	---	PASS
WHAMML1	339005	broad.mit.edu	37	15	23205108	23205108	+	RNA	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23205108C>T	uc001yvg.2	-	2		c.687G>A			WHAMML1_uc010ayc.2_RNA|WHAMML1_uc010ayd.2_RNA|WHAMML1_uc010aye.1_RNA	NR_003521				Homo sapiens mRNA; cDNA DKFZp313L2232 (from clone DKFZp313L2232).												0						GTGGTTGCCACGGTAACTAAT	0.393													3	30	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23812105	23812105	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23812105G>T	uc001ywh.3	+	1	1652	c.1176G>T	c.(1174-1176)AAG>AAT	p.K392N	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.K392N	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	392						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AGCAATACAAGGAGGCAATGA	0.502													7	144	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	28948349	28948349	+	5'Flank	SNP	T	C	C			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28948349T>C	uc001zcd.2	+											DQ593033																		CCACTGGCTCTCAGAAGGGGT	0.567													2	6	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	84946652	84946652	+	RNA	SNP	A	C	C	rs67387936	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84946652A>C	uc002bke.1	-	1		c.566T>G								Homo sapiens cDNA FLJ34196 fis, clone FCBBF3019437.																		CGGCCCTCTAAGGTGGAGCAG	0.498													6	2	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85053142	85053142	+	RNA	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85053142C>T	uc002bkm.2	-	9		c.1905G>A			uc002bkl.1_5'Flank	NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						TTTTTCAATTCCTTGACCCGC	0.393													5	19	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2354107	2354107	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2354107C>T	uc002cpy.1	-	12	2042	c.1330G>A	c.(1330-1332)GAC>AAC	p.D444N	ABCA3_uc010bsk.1_Missense_Mutation_p.D386N|ABCA3_uc010bsl.1_Missense_Mutation_p.D444N	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	444					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				AAGTCGTCGTCCACGTTGACG	0.632													5	240	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52478215	52478215	+	Silent	SNP	C	T	T	rs3743797	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52478215C>T	uc002egw.2	-	6	1131	c.960G>A	c.(958-960)GCG>GCA	p.A320A	TOX3_uc010vgt.1_Silent_p.A315A|TOX3_uc010vgu.1_Silent_p.A320A	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	320	HMG box.				apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						CCCTGTATGCCGCCAGGGCCT	0.463													3	4	---	---	---	---	PASS
DHX38	9785	broad.mit.edu	37	16	72139184	72139184	+	Silent	SNP	C	A	A	rs2074626	byFrequency	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72139184C>A	uc002fcb.2	+	17	2671	c.2316C>A	c.(2314-2316)GCC>GCA	p.A772A	DHX38_uc010vmp.1_Intron	NM_014003	NP_054722	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	772	Helicase C-terminal.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1		Ovarian(137;0.125)				ACGCGCCTGCCCTGGCTGTGC	0.577													4	104	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74411912	74411912	+	Missense_Mutation	SNP	G	A	A	rs62055194		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74411912G>A	uc010vmt.1	+	1	42	c.41G>A	c.(40-42)GGA>GAA	p.G14E						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		CTCCTGCTGGGATTTATCAGC	0.582													4	17	---	---	---	---	PASS
SLFN13	146857	broad.mit.edu	37	17	33769199	33769199	+	Silent	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33769199G>A	uc002hjk.1	-	3	1635	c.1305C>T	c.(1303-1305)TCC>TCT	p.S435S	SLFN13_uc010wch.1_Silent_p.S435S|SLFN13_uc002hjl.2_Silent_p.S435S|SLFN13_uc010ctt.2_Silent_p.S117S|SLFN13_uc002hjm.2_Silent_p.S104S	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	435						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CAATTCCCTGGGAGAAAGGTC	0.488													4	130	---	---	---	---	PASS
ZPBP2	124626	broad.mit.edu	37	17	38028691	38028691	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38028691T>C	uc002hte.2	+	5	728	c.575T>C	c.(574-576)GTT>GCT	p.V192A	ZPBP2_uc002htf.2_Missense_Mutation_p.V170A	NM_199321	NP_955353	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2 isoform 2	192					binding of sperm to zona pellucida	extracellular region				ovary(1)	1	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGCCATTCTGTTGAAATTCCA	0.303													3	126	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	39296600	39296600	+	RNA	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39296600C>T	uc010cxk.1	-	1		c.104G>A								Homo sapiens partial mRNA for keratin associated protein 4.6 (KRTAP4.6 gene).																		GCACTGGGGTCTGCAGCAGCT	0.567													3	47	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43587569	43587569	+	Intron	SNP	G	C	C	rs149697015	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43587569G>C	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						aactccgtctgaaaagaaaag	0.144													5	57	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48263705	48263705	+	Silent	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48263705G>A	uc002iqm.2	-	49	4104	c.3978C>T	c.(3976-3978)TTC>TTT	p.F1326F		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	1326	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	TGCTCTCGCCGAACCAGACAT	0.572			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						5	204	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76794507	76794507	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76794507G>A	uc002jvz.1	-	20	3692	c.3367C>T	c.(3367-3369)CGC>TGC	p.R1123C	USP36_uc002jwa.1_Missense_Mutation_p.R1123C|USP36_uc002jvy.1_Missense_Mutation_p.R183C	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1121					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CACAGTCAGCGGCGATAGCTG	0.403													35	105	---	---	---	---	PASS
C19orf2	8725	broad.mit.edu	37	19	30505869	30505869	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30505869G>A	uc002nsr.2	+	11	1531	c.1501G>A	c.(1501-1503)GCA>ACA	p.A501T	C19orf2_uc002nsq.2_Intron|C19orf2_uc002nss.2_Missense_Mutation_p.A461T|C19orf2_uc002nst.2_Missense_Mutation_p.A425T	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a	501					protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)		TGCTCATCCCGCACTACCCAC	0.418													4	270	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55147219	55147219	+	Intron	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55147219C>T	uc002qgj.2	+						LILRB1_uc010erp.1_Silent_p.L218L|LILRB1_uc002qgl.2_Intron|LILRB1_uc002qgk.2_Intron|LILRB1_uc002qgm.2_Intron|LILRB1_uc010erq.2_Intron|LILRB1_uc010err.2_Intron	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,						regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CTCACTCTCTCCTGCTGTCCT	0.647										HNSCC(37;0.09)			3	27	---	---	---	---	PASS
NFATC2	4773	broad.mit.edu	37	20	50071158	50071158	+	Silent	SNP	G	A	A	rs146686251	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50071158G>A	uc002xwd.2	-	6	1996	c.1776C>T	c.(1774-1776)GGC>GGT	p.G592G	NFATC2_uc002xwc.2_Silent_p.G592G|NFATC2_uc010zyv.1_Silent_p.G373G|NFATC2_uc010zyw.1_Silent_p.G373G|NFATC2_uc010zyx.1_Silent_p.G572G|NFATC2_uc010zyy.1_Silent_p.G373G|NFATC2_uc010zyz.1_Silent_p.G373G|NFATC2_uc002xwe.2_Silent_p.G572G|hsa-mir-3194|MI0014239_5'Flank	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	592					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					TTTGCTGGCCGCCATAGACCA	0.502													4	223	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	C	C	rs78981100		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61444637G>C	uc002ydj.2	+	7	1705	c.1670G>C	c.(1669-1671)AGC>ACC	p.S557T	OGFR_uc002ydk.2_Missense_Mutation_p.S540T|OGFR_uc002ydl.2_Missense_Mutation_p.S505T|uc011aam.1_Intron	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].|3.				regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746													3	7	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25016296	25016296	+	Silent	SNP	G	A	A	rs4049844	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016296G>A	uc003aan.1	+	8	871	c.384G>A	c.(382-384)GGG>GGA	p.G128G	GGT1_uc003aas.1_Silent_p.G128G|GGT1_uc003aat.1_Silent_p.G128G|GGT1_uc003aau.1_Silent_p.G128G|GGT1_uc003aav.1_Silent_p.G128G|GGT1_uc003aaw.1_Silent_p.G128G|GGT1_uc003aax.1_Silent_p.G128G	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	128	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	TCTCCCCAGGGGGGCTGTCGG	0.642													5	35	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32481008	32481008	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32481008G>A	uc003amc.2	+	9	1239	c.1007G>A	c.(1006-1008)CGC>CAC	p.R336H	SLC5A1_uc011alz.1_Missense_Mutation_p.R209H	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	336	Extracellular (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						ATGATCAGCCGCATTCTGTAC	0.483													4	244	---	---	---	---	PASS
H1F0	3005	broad.mit.edu	37	22	38202050	38202050	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38202050C>T	uc003aty.2	+	1	937	c.499C>T	c.(499-501)CCG>TCG	p.P167S	GCAT_uc003atz.2_5'Flank|GCAT_uc003aua.1_5'Flank	NM_005318	NP_005309	P07305	H10_HUMAN	H1 histone family, member 0	167					DNA fragmentation involved in apoptotic nuclear change|nucleosome assembly	actin cytoskeleton|Golgi apparatus|nucleoplasm|nucleosome	DNA binding				0	Melanoma(58;0.045)					CAAAGCCAAGCCGGTCAAGGC	0.522													3	39	---	---	---	---	PASS
SFRS17A	8227	broad.mit.edu	37	X	1712960	1712960	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1712960G>A	uc004cqa.2	+	2	801	c.605G>A	c.(604-606)CGC>CAC	p.R202H	SFRS17A_uc010ncx.1_Missense_Mutation_p.R202H|SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_5'Flank	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	202	RRM.				B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATGACGGGCCGCAACTTCCAC	0.607													4	180	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37027228	37027228	+	Missense_Mutation	SNP	G	C	C	rs113759376		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37027228G>C	uc004ddl.1	+	1	759	c.745G>C	c.(745-747)GAG>CAG	p.E249Q		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	249										ovary(3)	3						TCTCCGCCCAGAGCCTCCCAA	0.612													4	65	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54224913	54224913	+	Silent	SNP	C	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54224913C>A	uc004dtd.1	-	23	5515	c.5076G>T	c.(5074-5076)GGG>GGT	p.G1692G	WNK3_uc004dtc.1_Silent_p.G1749G|uc004dtb.1_5'Flank	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	1692					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GTACTGGATACCCCGCCCCCG	0.502													8	46	---	---	---	---	PASS
ACRC	93953	broad.mit.edu	37	X	70823595	70823595	+	Silent	SNP	G	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70823595G>A	uc004eae.2	+	8	969	c.468G>A	c.(466-468)TCG>TCA	p.S156S	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	156	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)					GTGATGATTCGGAAGCTCCTG	0.483													4	260	---	---	---	---	PASS
SLC25A5	292	broad.mit.edu	37	X	118605099	118605099	+	3'UTR	SNP	C	A	A	rs78501953	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118605099C>A	uc004erh.3	+	4					LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2						chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)	TTGACAGACTCCTGGCTGTCA	0.363													7	37	---	---	---	---	PASS
SSU72	29101	broad.mit.edu	37	1	1510036	1510037	+	5'UTR	DEL	GC	-	-	rs70949599		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1510036_1510037delGC	uc001agd.2	-	1					SSU72_uc009vkg.1_5'UTR|SSU72_uc001age.1_5'UTR	NM_014188	NP_054907	Q9NP77	SSU72_HUMAN	Ssu72 RNA polymerase II CTD phosphatase homolog						mRNA processing	cytoplasm|nucleus	phosphoprotein phosphatase activity				0	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CCGGAAGCGGGCGACGCGAAAC	0.772													5	3	---	---	---	---	
BMP8A	353500	broad.mit.edu	37	1	39988318	39988319	+	Intron	INS	-	TTG	TTG	rs139401553	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39988318_39988319insTTG	uc001cdi.2	+						PPIEL_uc001cdj.1_Intron|PPIEL_uc001cdk.2_Intron	NM_181809	NP_861525	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8A precursor						cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGAAAGGGTTTTGTTGTTGTT	0.356													6	3	---	---	---	---	
HFM1	164045	broad.mit.edu	37	1	91740542	91740543	+	Intron	INS	-	T	T	rs11369914		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91740542_91740543insT	uc001doa.3	-						HFM1_uc009wdb.2_Intron|HFM1_uc010osu.1_Intron|HFM1_uc001dob.3_Intron|HFM1_uc010osv.1_Intron	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AAATGTTGGCAttttttttttt	0.198													6	3	---	---	---	---	
RNPEP	6051	broad.mit.edu	37	1	201957915	201957916	+	Intron	INS	-	G	G			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201957915_201957916insG	uc001gxd.2	+						RNPEP_uc001gxe.2_Intron|RNPEP_uc001gxf.2_Intron	NM_020216	NP_064601	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase						leukotriene biosynthetic process		epoxide hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		CCAGACTGGCTGGCGGAAAGGT	0.470													88	7	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128886972	128886972	+	Intron	DEL	T	-	-	rs67459781		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128886972delT	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						AAGACAGTGAttttttttttt	0.154													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187503358	187503359	+	Intron	INS	-	GT	GT	rs71946663		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187503358_187503359insGT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		ctcttttgagcgtgtgtgtgtg	0.000													4	2	---	---	---	---	
ATIC	471	broad.mit.edu	37	2	216203877	216203877	+	Intron	DEL	A	-	-	rs79489036		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216203877delA	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	AAATGGGATCATGTCTTCCAT	0.313			T	ALK	ALCL								1	5	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1443812	1443812	+	Intron	DEL	A	-	-	rs72185294		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1443812delA	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGCATTGGCCAAAAAAAAAAA	0.368													4	3	---	---	---	---	
CACNA1D	776	broad.mit.edu	37	3	53699666	53699667	+	Intron	INS	-	T	T	rs72426527		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53699666_53699667insT	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron|CACNA1D_uc003dgw.3_5'Flank	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	TCACAAACTTATTTTTTTTTGT	0.347													235	8	---	---	---	---	
ACTR8	93973	broad.mit.edu	37	3	53914074	53914075	+	Frame_Shift_Ins	INS	-	C	C	rs143689709	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53914074_53914075insC	uc003dhd.2	-	2	244_245	c.185_186insG	c.(184-186)CGAfs	p.R62fs	ACTR8_uc003dhb.2_5'Flank|ACTR8_uc003dhc.2_5'UTR	NM_022899	NP_075050	Q9H981	ARP8_HUMAN	actin-related protein 8	62					cell division|DNA recombination|DNA repair|mitosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex	protein binding			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TGTCTGTGGCTCGACCAATCCT	0.450													267	11	---	---	---	---	
CCDC80	151887	broad.mit.edu	37	3	112329033	112329034	+	Intron	INS	-	A	A	rs146699705		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112329033_112329034insA	uc003dzf.2	-						CCDC80_uc011bhv.1_Intron|CCDC80_uc003dzg.2_Intron|CCDC80_uc003dzh.1_Intron	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor											ovary(2)	2						TCTGTGCCCAGAAAAAAAAAAA	0.361													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	609854	609854	+	IGR	DEL	T	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:609854delT								PIGG (76535 upstream) : PDE6B (9509 downstream)																							tgttcttttattttttttttt	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7207157	7207158	+	IGR	INS	-	TCC	TCC			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7207157_7207158insTCC								PAPD7 (449996 upstream) : ADCY2 (189185 downstream)																							cctcccttccttttcttccttc	0.089													4	3	---	---	---	---	
C5orf42	65250	broad.mit.edu	37	5	37169834	37169834	+	Intron	DEL	T	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37169834delT	uc011cpa.1	-						C5orf42_uc011coy.1_Intron|C5orf42_uc003jks.2_Intron|C5orf42_uc011coz.1_Intron|C5orf42_uc003jkr.1_Intron	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GACATTATTAttttttttttt	0.129													5	3	---	---	---	---	
GLRA1	2741	broad.mit.edu	37	5	151228714	151228714	+	Intron	DEL	T	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151228714delT	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	tctttctttcttttcttttct	0.040													9	5	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	24875814	24875815	+	Intron	INS	-	G	G	rs2255337	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24875814_24875815insG	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron|FAM65B_uc003nep.2_Intron|FAM65B_uc011djt.1_Intron	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						GGGAGGAGGCCGGGGGGCGGTT	0.436													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57512916	57512917	+	Splice_Site	INS	-	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512916_57512917insT	uc003pdx.2	+	16	1839	c.1752_splice	c.e16+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttttcaattttttttgta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139383236	139383251	+	IGR	DEL	AAGGGAGAAAGGAAGC	-	-	rs12665587		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139383236_139383251delAAGGGAGAAAGGAAGC								C6orf115 (18797 upstream) : HECA (72998 downstream)																							gggagggaggaagggagaaaggaagcaaggaaggaa	0.009													3	3	---	---	---	---	
LRP11	84918	broad.mit.edu	37	6	150141532	150141533	+	3'UTR	INS	-	T	T	rs146009037	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150141532_150141533insT	uc003qng.2	-	7						NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein							integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		TCTAAGGAAACTTTTTTTACAA	0.262													4	3	---	---	---	---	
CCDC146	57639	broad.mit.edu	37	7	76796901	76796901	+	Intron	DEL	A	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76796901delA	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GTTTATTTTTATTATTTTCCA	0.264													3	3	---	---	---	---	
STEAP2	261729	broad.mit.edu	37	7	89859612	89859613	+	Intron	INS	-	A	A	rs146827619	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89859612_89859613insA	uc003ujz.2	+						STEAP2_uc010len.2_Intron|STEAP2_uc003uka.2_Intron|STEAP2_uc003ukb.2_Intron|STEAP2_uc003ukc.2_Intron|STEAP2_uc003ukd.2_Intron	NM_152999	NP_694544	Q8NFT2	STEA2_HUMAN	six transmembrane epithelial antigen of the						electron transport chain|endocytosis|Golgi to plasma membrane transport|ion transport|iron ion homeostasis|regulated secretory pathway|response to hormone stimulus	cytosol|early endosome|endosome membrane|integral to Golgi membrane|plasma membrane|trans-Golgi network transport vesicle|vesicular fraction	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity|transporter activity			ovary(2)	2	all_hematologic(106;0.112)					TCTTAAAAGAGAAAAAAAAAAT	0.287													4	2	---	---	---	---	
CNPY4	245812	broad.mit.edu	37	7	99719672	99719673	+	Intron	INS	-	A	A	rs111511573		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99719672_99719673insA	uc003uto.2	+						TAF6_uc003uti.2_5'Flank|TAF6_uc003utk.2_5'Flank|TAF6_uc011kji.1_5'Flank|TAF6_uc003utj.2_5'Flank|TAF6_uc003utl.2_5'Flank|TAF6_uc003utm.2_5'Flank|TAF6_uc003utn.1_5'Flank	NM_152755	NP_689968	Q8N129	CNPY4_HUMAN	canopy 4 homolog precursor							extracellular region					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					gagtccgtctgaaaaaaaaaaa	0.000													6	4	---	---	---	---	
LAMB4	22798	broad.mit.edu	37	7	107744731	107744732	+	Intron	INS	-	A	A	rs142737442	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107744731_107744732insA	uc010ljo.1	-						LAMB4_uc003vey.2_Intron	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor						cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						GTTTCATTTTTAAAGTTAAACT	0.431													4	3	---	---	---	---	
C9orf11	54586	broad.mit.edu	37	9	27285131	27285132	+	Intron	DEL	CT	-	-	rs67807368		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27285131_27285132delCT	uc003zql.2	-						NCRNA00032_uc010mjd.1_5'Flank|C9orf11_uc011lnq.1_Intron	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1							acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		TTTTCTTTTCCttttttttttt	0.124													5	4	---	---	---	---	
TMEM2	23670	broad.mit.edu	37	9	74337571	74337571	+	Intron	DEL	A	-	-	rs72034909		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74337571delA	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AAGGTACTGTAAAAAAAAAAA	0.254													5	3	---	---	---	---	
PTF1A	256297	broad.mit.edu	37	10	23482992	23482994	+	3'UTR	DEL	GAT	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482992_23482994delGAT	uc001irp.2	+	2						NM_178161	NP_835455	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2						TGATGAAATAGATGATTTCtttt	0.246													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71193238	71193239	+	IGR	INS	-	AC	AC	rs139709581	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71193238_71193239insAC								TACR2 (16564 upstream) : TSPAN15 (17987 downstream)																							TATCTATATCTACACACACACA	0.262													2	4	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95066946	95066946	+	Intron	DEL	C	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95066946delC	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						gccagtagcacccccccgcca	0.005													4	2	---	---	---	---	
C10orf4	118924	broad.mit.edu	37	10	95445300	95445300	+	Intron	DEL	A	-	-	rs5787072		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95445300delA	uc001kiz.1	-						C10orf4_uc001kiv.1_Intron|C10orf4_uc001kja.1_Intron	NM_145246	NP_660289	Q70Z53	F10C1_HUMAN	FRA10AC1 protein							nucleus	protein binding				0		Colorectal(252;0.122)				TACTGTTACCAAAAAAAATCA	0.318													6	3	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73795753	73795753	+	Intron	DEL	A	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73795753delA	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					tctttaaactaaaAAAAAAAA	0.154													4	3	---	---	---	---	
NCAPD2	9918	broad.mit.edu	37	12	6640678	6640678	+	3'UTR	DEL	A	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6640678delA	uc001qoo.2	+	32					NCAPD2_uc010sfd.1_3'UTR|GAPDH_uc001qop.1_5'Flank|GAPDH_uc009zep.1_5'Flank|GAPDH_uc001qoq.1_5'Flank|GAPDH_uc001qor.1_5'Flank	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						TCTTTTTTTTAAAAAAAAAAA	0.214													4	2	---	---	---	---	
TPCN1	53373	broad.mit.edu	37	12	113704096	113704098	+	In_Frame_Del	DEL	CTG	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113704096_113704098delCTG	uc001tuw.2	+	4	646_648	c.349_351delCTG	c.(349-351)CTGdel	p.L122del	TPCN1_uc001tux.2_In_Frame_Del_p.L194del|TPCN1_uc010syt.1_In_Frame_Del_p.L54del	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	122	Helical; Name=S1 of repeat I; (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						GGCCACGGCCCTGCTGCTGCTGC	0.640													575	8	---	---	---	---	
SETD8	387893	broad.mit.edu	37	12	123889740	123889740	+	Intron	DEL	T	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123889740delT	uc001uew.2	+						SETD8_uc001uex.2_Intron	NM_020382	NP_065115	Q9NQR1	SETD8_HUMAN	SET domain-containing 8						cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		TGTTGTTGACttttttttttt	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19532388	19532389	+	IGR	INS	-	T	T	rs145833243	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19532388_19532389insT								LOC284232 (86279 upstream) : LOC348021 (50010 downstream)																							TTTTGGGAGCCTTTTTTTTTTG	0.545													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	98568329	98568332	+	IGR	DEL	GAAA	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98568329_98568332delGAAA								RAP2A (448078 upstream) : IPO5 (37597 downstream)																							aagaatgaatgaaagaaagaaaga	0.103													9	4	---	---	---	---	
BMP4	652	broad.mit.edu	37	14	54416601	54416602	+	3'UTR	DEL	CT	-	-	rs71810123		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54416601_54416602delCT	uc001xal.3	-	3					BMP4_uc010aoh.2_3'UTR|BMP4_uc001xao.3_3'UTR|BMP4_uc001xan.3_3'UTR	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein						activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						GGAttttttccttttttttttt	0.257													4	2	---	---	---	---	
SEL1L	6400	broad.mit.edu	37	14	81951795	81951796	+	Intron	INS	-	T	T	rs148050335		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81951795_81951796insT	uc010tvv.1	-							NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		aattttttttgttttttttttt	0.000													6	3	---	---	---	---	
HHIPL1	84439	broad.mit.edu	37	14	100123118	100123118	+	Intron	DEL	G	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100123118delG	uc010avs.2	+						HHIPL1_uc001ygl.1_Intron	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				tctgcaaaaagaaaagaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	55838005	55838006	+	IGR	INS	-	ATAA	ATAA	rs147539801	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55838005_55838006insATAA								DYX1C1 (37573 upstream) : PYGO1 (215 downstream)																							AACATTTATTTATGTTTCTAAA	0.257													1	5	---	---	---	---	
GOLGA6L5	374650	broad.mit.edu	37	15	85056104	85056104	+	Intron	DEL	A	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85056104delA	uc002bkm.2	-							NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						CTGGATTCTCAAAAAAAAAAA	0.527													34	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33942128	33942129	+	IGR	INS	-	T	T	rs76660512	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33942128_33942129insT								None (None upstream) : MIR1826 (23379 downstream)																							TGGAAAAAATACCACTTGTTAC	0.267													4	2	---	---	---	---	
SMG6	23293	broad.mit.edu	37	17	2075774	2075774	+	Intron	DEL	T	-	-	rs75172492		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2075774delT	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						TCGAGAGGGCTTTTTTTTTTC	0.428													4	2	---	---	---	---	
ZFP3	124961	broad.mit.edu	37	17	4996471	4996472	+	3'UTR	DEL	TT	-	-	rs72184758		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4996471_4996472delTT	uc002gaq.2	+	2						NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GATGAGGCACtttttttttttt	0.203													4	2	---	---	---	---	
PFAS	5198	broad.mit.edu	37	17	8171691	8171691	+	Intron	DEL	A	-	-	rs76845148		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8171691delA	uc002gkr.2	+						PFAS_uc010vuv.1_Intron|PFAS_uc002gks.2_Intron	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase						'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	attccatctcaaaaaaaaaaa	0.065													5	3	---	---	---	---	
C17orf98	388381	broad.mit.edu	37	17	36993201	36993202	+	Intron	INS	-	A	A	rs113691927		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36993201_36993202insA	uc002hqv.2	-							NM_001080465	NP_001073934	A8MV24	CQ098_HUMAN	hypothetical protein LOC388381												0						gaccacgtctcaaaaaaaaaaa	0.223													4	2	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57741929	57741929	+	Intron	DEL	G	-	-	rs76363283		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57741929delG	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					aaaaaaaaaagaaaagaaaag	0.139			T	ALK|TFE3	ALCL|renal 								3	4	---	---	---	---	
POLI	11201	broad.mit.edu	37	18	51795958	51795960	+	In_Frame_Del	DEL	CGA	-	-	rs140689079		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51795958_51795960delCGA	uc002lfj.3	+	1	110_112	c.42_44delCGA	c.(40-45)GGCGAC>GGC	p.D17del	POLI_uc010xds.1_In_Frame_Del_p.D17del|POLI_uc002lfk.3_5'UTR|POLI_uc002lfl.1_5'Flank	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota	17					DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AAGGCGGCGGCGACGACGACGAG	0.729								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					3	3	---	---	---	---	
CALR3	125972	broad.mit.edu	37	19	16601574	16601575	+	Intron	INS	-	T	T	rs140035474		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16601574_16601575insT	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0						CTTCTATATAAttttttttttt	0.188													4	2	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16625243	16625243	+	Intron	DEL	G	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16625243delG	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						CCTGAGCGGTGGGGGGGGGGC	0.443													10	5	---	---	---	---	
HKR1	284459	broad.mit.edu	37	19	37852828	37852828	+	Intron	DEL	A	-	-	rs67608963		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37852828delA	uc002ogb.2	+						HKR1_uc002ofx.2_Intron|HKR1_uc002ofy.2_Intron|HKR1_uc002oga.2_Intron|HKR1_uc010xto.1_Intron|HKR1_uc002ogc.2_Intron|HKR1_uc010xtp.1_Intron|HKR1_uc002ogd.2_Intron	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aaaaaaaaacaaaaaaacaaa	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26113543	26113543	+	IGR	DEL	A	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26113543delA								C20orf191 (18866 upstream) : MIR663 (75279 downstream)																							TCTTTGCCTTAACAACATTAT	0.363													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9590549	9590550	+	IGR	INS	-	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9590549_9590550insA								None (None upstream) : None (None downstream)																							CCCTCaaatttaaaaaattata	0.322													12	6	---	---	---	---	
NCAM2	4685	broad.mit.edu	37	21	22782458	22782459	+	Intron	INS	-	A	A	rs112122491		TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22782458_22782459insA	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		gtctcaaaaagaaaaaaaaaaa	0.099													4	2	---	---	---	---	
RASL10A	10633	broad.mit.edu	37	22	29709663	29709664	+	Intron	INS	-	C	C	rs146834773	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29709663_29709664insC	uc003aff.2	-						RASL10A_uc003afg.2_3'UTR	NM_006477	NP_006468	Q92737	RSLAA_HUMAN	RAS-related on chromosome 22 isoform a						small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity				0						CAGAGACACCGCCCCCCCCGCC	0.653													4	3	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29763451	29763452	+	Intron	INS	-	T	T	rs4034938	by1000genomes	TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29763451_29763452insT	uc003afj.2	-						AP1B1_uc003afi.2_5'Flank|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						ATCTATCAACCTTTTttttttt	0.178													4	2	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31985765	31985768	+	Intron	DEL	TTTA	-	-			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31985765_31985768delTTTA	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TTTGTCCATCTTTATTTATTTATT	0.333													5	3	---	---	---	---	
RIBC2	26150	broad.mit.edu	37	22	45813915	45813916	+	Intron	INS	-	T	T			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45813915_45813916insT	uc011aqs.1	+							NM_015653	NP_056468	Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2												0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CAACCCTACAGTTTTTTTTTTT	0.396													3	3	---	---	---	---	
COL4A6	1288	broad.mit.edu	37	X	107415678	107415679	+	Intron	INS	-	A	A			TCGA-EJ-5503-01A-01D-1576-08	TCGA-EJ-5503-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107415678_107415679insA	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						AACATTAAAAGAAAAAAAAAAT	0.376									Alport_syndrome_with_Diffuse_Leiomyomatosis				177	8	---	---	---	---	
