Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SGIP1	84251	broad.mit.edu	37	1	67137639	67137639	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67137639C>A	uc001dcr.2	+	11	738	c.521C>A	c.(520-522)GCA>GAA	p.A174E	SGIP1_uc010opd.1_5'UTR|SGIP1_uc001dcs.2_5'UTR|SGIP1_uc001dct.2_5'UTR|uc010ope.1_Intron|SGIP1_uc009wat.2_5'UTR	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	174					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						GAAGAAGTGGCAAGACCCAGG	0.378													3	77	---	---	---	---	PASS
PGLYRP3	114771	broad.mit.edu	37	1	153283175	153283175	+	5'UTR	SNP	C	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153283175C>T	uc001fbn.1	-	1						NM_052891	NP_443123	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3 precursor						defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGAGTGTGGACGGCAGCCCTG	0.552													6	174	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228528530	228528530	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228528530G>A	uc009xez.1	+	72	17682	c.17638G>A	c.(17638-17640)GTG>ATG	p.V5880M	OBSCN_uc001hsn.2_Missense_Mutation_p.V5880M|OBSCN_uc001hsr.1_Missense_Mutation_p.V509M	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5880					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CAAGCTGCACGTGTCCCTCAT	0.672													4	9	---	---	---	---	PASS
DARS	1615	broad.mit.edu	37	2	136743143	136743143	+	5'UTR	SNP	G	C	C	rs2278682	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136743143G>C	uc002tux.1	-	1					DARS_uc010fnj.1_5'UTR	NM_001349	NP_001340	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase						aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	TCCCGACCCTGGGGTCTCAGC	0.687													7	6	---	---	---	---	PASS
NOP58	51602	broad.mit.edu	37	2	203157538	203157538	+	Silent	SNP	A	G	G	rs16839032	byFrequency	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203157538A>G	uc002uzb.2	+	9	969	c.819A>G	c.(817-819)GAA>GAG	p.E273E	SNORD11_uc002uzd.1_5'Flank	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog	273	Nop.				cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						AGCTCTATGAATATCTACAAA	0.368													6	313	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235951819	235951819	+	Silent	SNP	A	G	G	rs3795962	byFrequency	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235951819A>G	uc002vvp.2	+	4	2799	c.2406A>G	c.(2404-2406)CTA>CTG	p.L802L	SH3BP4_uc010fym.2_Intron|SH3BP4_uc002vvq.2_Silent_p.L802L	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	802					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CGTCCGTCCTAGAAAAGCTGA	0.587													3	65	---	---	---	---	PASS
PDCD1	5133	broad.mit.edu	37	2	242794939	242794939	+	Silent	SNP	G	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242794939G>T	uc002wcq.3	-	2	338	c.270C>A	c.(268-270)GGC>GGA	p.G90G	PDCD1_uc010fzs.2_Silent_p.G21G|PDCD1_uc010fzt.2_Intron	NM_005018	NP_005009	Q15116	PDCD1_HUMAN	programmed cell death 1 precursor	90	Ig-like V-type.|Extracellular (Potential).				apoptosis|humoral immune response|multicellular organismal development|T cell costimulation	integral to membrane	protein tyrosine phosphatase activity|signal transducer activity			ovary(1)	1		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0219)		GGCAGTCCTGGCCGGGCTGGC	0.647													5	44	---	---	---	---	PASS
CCDC71	64925	broad.mit.edu	37	3	49201589	49201589	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49201589C>T	uc003cwg.3	-	2	191	c.53G>A	c.(52-54)CGC>CAC	p.R18H		NM_022903	NP_075054	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	18										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CGTGGAGATGCGCGACCAGGA	0.572													5	97	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142030258	142030258	+	3'UTR	SNP	A	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142030258A>T	uc003eus.2	-	42					XRN1_uc010huu.2_3'UTR|XRN1_uc003eut.2_3'UTR|XRN1_uc003euu.2_3'UTR	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						ATATTATTTTAAAATAGTACA	0.209													4	40	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505838	195505838	+	Missense_Mutation	SNP	G	C	C	rs59101491		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505838G>C	uc011bto.1	-	3	12689	c.12229C>G	c.(12229-12231)CAC>GAC	p.H4077D	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.597													2	5	---	---	---	---	PASS
PAK2	5062	broad.mit.edu	37	3	196509544	196509544	+	Silent	SNP	T	C	C	rs79361419		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196509544T>C	uc003fwy.3	+	2	349	c.27T>C	c.(25-27)GAT>GAC	p.D9D		NM_002577	NP_002568	Q13177	PAK2_HUMAN	p21-activated kinase 2	9					axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AACTGGAAGATAAGCCTCCAG	0.423													7	349	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46995366	46995366	+	Missense_Mutation	SNP	G	T	T	rs2229940	byFrequency	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46995366G>T	uc003gxg.2	-	1	215	c.76C>A	c.(76-78)CTG>ATG	p.L26M		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	26					gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CAAACCGCCAGGCACAGGAAG	0.607													6	221	---	---	---	---	PASS
GUSBP1	728411	broad.mit.edu	37	5	21497235	21497235	+	3'UTR	SNP	C	T	T	rs141635554	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21497235C>T	uc010iub.2	+	6					GUSBP1_uc011cnn.1_RNA|GUSBP1_uc003jgh.3_Intron	NR_027028				SubName: Full=Putative uncharacterized protein GUSBL2;												0						AGTTTGAGAACTGGTGTAAGA	0.488													4	58	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140235694	140235694	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140235694G>A	uc003lhx.2	+	1	61	c.61G>A	c.(61-63)GCA>ACA	p.A21T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.A21T|PCDHA10_uc011dad.1_Missense_Mutation_p.A21T	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	21					homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTCTCCTCGCAGCCTGGGA	0.597													7	58	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140720213	140720213	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140720213G>A	uc003ljk.1	+	1	1860	c.1675G>A	c.(1675-1677)GCG>ACG	p.A559T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.A559T	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	559	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGACAACGCGCCCGAGAT	0.622													14	278	---	---	---	---	PASS
PIP5K1P1	206426	broad.mit.edu	37	6	7988181	7988181	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7988181A>C	uc003mxx.3	+	1	1847	c.1412A>C	c.(1411-1413)TAC>TCC	p.Y471S	TXNDC5_uc003mxw.2_Intron	NR_027712				RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase type-1 alpha;          Short=PtdIns(4)P-5-kinase alpha;          Short=PIP5KIalpha;          EC=2.7.1.68; AltName: Full=Phosphatidylinositol-4-phosphate 5-kinase type I alpha; AltName: Full=68 kDa type I phosphatidylinositol-4-phosphate 5-kinase alpha;												0						TGCATTACTTACCAGCCATTG	0.473													10	27	---	---	---	---	PASS
HIST1H4H	8365	broad.mit.edu	37	6	26285739	26285739	+	5'Flank	SNP	T	G	G			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26285739T>G	uc003nhm.2	-						HIST1H4H_uc003nhl.1_RNA	NM_003543	NP_003534	P62805	H4_HUMAN	histone cluster 1, H4h						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						ACTAAGCAACTTCTAAAACCA	0.483										HNSCC(76;0.23)			3	91	---	---	---	---	PASS
HLA-H	3136	broad.mit.edu	37	6	29856977	29856977	+	3'UTR	SNP	T	G	G	rs116665472	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29856977T>G	uc010jro.2	+	3					HLA-G_uc011dmb.1_Intron|HLA-H_uc003nod.2_Intron					SubName: Full=cDNA FLJ52667, highly similar to HLA class I histocompatibility antigen, alpha chain H;												0						GTCCAGGCTGTTGTCTGGGTT	0.547													6	12	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143089660	143089660	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143089660G>A	uc003qjd.2	-	6	5944	c.5201C>T	c.(5200-5202)GCG>GTG	p.A1734V		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1734					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TAAAAAGGACGCATCAGGTTT	0.398													11	216	---	---	---	---	PASS
MTHFD1L	25902	broad.mit.edu	37	6	151358137	151358137	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151358137C>G	uc003qob.2	+	26	2999	c.2731C>G	c.(2731-2733)CAC>GAC	p.H911D	MTHFD1L_uc011een.1_RNA|MTHFD1L_uc011eeo.1_Missense_Mutation_p.H912D|MTHFD1L_uc003qoc.2_Missense_Mutation_p.H859D	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+	911	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		GGCAAAGACCCACCTTTCTCT	0.448													5	155	---	---	---	---	PASS
ANKMY2	57037	broad.mit.edu	37	7	16676046	16676046	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16676046G>C	uc003sti.2	-	2	302	c.102C>G	c.(100-102)AGC>AGG	p.S34R	ANKMY2_uc010ktz.2_RNA	NM_020319	NP_064715	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	34						cilium	zinc ion binding			central_nervous_system(1)	1	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GAACATTCTTGCTGGATAATA	0.289													3	65	---	---	---	---	PASS
C7orf44	55744	broad.mit.edu	37	7	43678997	43678997	+	3'UTR	SNP	T	C	C	rs1044039	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43678997T>C	uc003tin.1	-	6					C7orf44_uc003til.2_Intron|C7orf44_uc003tii.2_Intron|C7orf44_uc003tij.2_Intron|C7orf44_uc010kxu.1_Intron|C7orf44_uc003tik.2_Intron|C7orf44_uc003tim.1_Intron|C7orf44_uc003tio.1_3'UTR|C7orf44_uc003tiq.1_3'UTR|C7orf44_uc003tip.1_3'UTR	NM_018224	NP_060694	Q9GZY4	CG044_HUMAN	hypothetical protein LOC55744							integral to membrane				ovary(1)	1						AAATAGCATTTGTTGTGCCCA	0.358													7	4	---	---	---	---	PASS
DPY19L2P2	349152	broad.mit.edu	37	7	102825947	102825947	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102825947A>G	uc003vbh.3	-	20	3239	c.1048T>C	c.(1048-1050)TGT>CGT	p.C350R	DPY19L2P2_uc003vbg.3_RNA|DPY19L2P2_uc010lit.2_RNA	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						ACAGCTTGACACTTGCCATTG	0.373													5	117	---	---	---	---	PASS
MFHAS1	9258	broad.mit.edu	37	8	8749969	8749969	+	Silent	SNP	C	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8749969C>A	uc003wsj.1	-	1	1163	c.600G>T	c.(598-600)CTG>CTT	p.L200L		NM_004225	NP_004216	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified	200	LRR 6.										0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CCAGCTGCAGCAGCTGCCGGG	0.672													3	22	---	---	---	---	PASS
ZFAT	57623	broad.mit.edu	37	8	135621025	135621025	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135621025G>T	uc003yup.2	-	5	907	c.732C>A	c.(730-732)TAC>TAA	p.Y244*	ZFAT_uc003yun.2_Nonsense_Mutation_p.Y232*|ZFAT_uc003yuo.2_Nonsense_Mutation_p.Y232*|ZFAT_uc010meh.2_Nonsense_Mutation_p.Y232*|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Nonsense_Mutation_p.Y232*|ZFAT_uc010mej.2_Nonsense_Mutation_p.Y182*|ZFAT_uc003yur.2_Nonsense_Mutation_p.Y232*	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	244					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CGTATTCCTGGTAGCCTCTCC	0.512													9	165	---	---	---	---	PASS
C9orf131	138724	broad.mit.edu	37	9	35042438	35042438	+	Nonsense_Mutation	SNP	C	T	T	rs144687989		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35042438C>T	uc003zvw.2	+	1	216	c.187C>T	c.(187-189)CGA>TGA	p.R63*	C9orf131_uc003zvu.2_Nonsense_Mutation_p.R15*|C9orf131_uc003zvv.2_Intron|C9orf131_uc003zvx.2_Intron	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	63											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			TGGGAGGTTGCGACAGCTTCA	0.532													3	92	---	---	---	---	PASS
FAM75A6	389730	broad.mit.edu	37	9	43624506	43624506	+	3'UTR	SNP	A	G	G	rs79588809	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43624506A>G	uc011lrb.1	-	4						NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730							integral to membrane					0						ACCCTCTTATAAATAAAAAAC	0.383													4	5	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													12	163	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	429977	429977	+	Silent	SNP	G	A	A	rs10904083	byFrequency	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:429977G>A	uc001ifp.2	-	16	1956	c.1866C>T	c.(1864-1866)GGC>GGT	p.G622G	DIP2C_uc009xhj.1_Silent_p.G318G	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	622			G -> S (in a colorectal cancer sample; somatic mutation).			nucleus	catalytic activity|transcription factor binding	p.G622S(1)		breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AGGGGTTCGCGCCGTCCGCCA	0.517													3	57	---	---	---	---	PASS
WDR37	22884	broad.mit.edu	37	10	1151170	1151170	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1151170T>C	uc001igf.1	+	11	1239	c.1066T>C	c.(1066-1068)TCC>CCC	p.S356P	WDR37_uc009xhm.1_Missense_Mutation_p.S357P|WDR37_uc009xhn.1_RNA|WDR37_uc001igg.1_RNA	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	356	WD 4.										0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CAGGGACCCCTCCATCCACTC	0.552													6	35	---	---	---	---	PASS
DHTKD1	55526	broad.mit.edu	37	10	12143062	12143062	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12143062G>A	uc001ild.3	+	10	1877	c.1778G>A	c.(1777-1779)GGC>GAC	p.G593D		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain	593					glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			CGTCTAAGTGGCCAAGATGTT	0.408													16	349	---	---	---	---	PASS
C10orf76	79591	broad.mit.edu	37	10	103607246	103607246	+	3'UTR	SNP	G	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103607246G>T	uc009xwy.1	-	26					C10orf76_uc009xwx.1_RNA	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TGATCCTCATGGGTAAGGGCA	0.587													4	58	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43513626	43513626	+	Silent	SNP	C	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43513626C>T	uc001mxi.2	+	23	3221	c.3207C>T	c.(3205-3207)GAC>GAT	p.D1069D	TTC17_uc010rfj.1_Silent_p.D1069D|TTC17_uc001mxl.2_Silent_p.D125D|TTC17_uc001mxm.2_Silent_p.D50D	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	1069	TPR 5.						binding			ovary(5)	5						TCTGGAATGACGCCGTCATAG	0.517													14	393	---	---	---	---	PASS
HCFC2	29915	broad.mit.edu	37	12	104487295	104487295	+	Silent	SNP	T	G	G	rs138874026		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104487295T>G	uc001tkj.3	+	10	1519	c.1416T>G	c.(1414-1416)GCT>GCG	p.A472A	HCFC2_uc009zul.2_RNA	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	472					regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						CATCAAATGCTTCTAATCATA	0.333													8	197	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28459227	28459227	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28459227C>T	uc001zbj.2	-	41	6656	c.6550G>A	c.(6550-6552)GAA>AAA	p.E2184K		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2184					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCCACCCCTTCGGAAGGCCTT	0.542													4	134	---	---	---	---	PASS
CILP	8483	broad.mit.edu	37	15	65489559	65489559	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65489559C>T	uc002aon.2	-	9	3246	c.3065G>A	c.(3064-3066)CGC>CAC	p.R1022H		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	1022					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						CACCAGGGTGCGGTCCACACG	0.592													5	77	---	---	---	---	PASS
GOLGA6A	342096	broad.mit.edu	37	15	74368264	74368264	+	Silent	SNP	C	T	T	rs139692895	byFrequency	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74368264C>T	uc002axa.1	-	8	668	c.627G>A	c.(625-627)GCG>GCA	p.A209A		NM_001038640	NP_001033729	Q9NYA3	GOG6A_HUMAN	golgi autoantigen, golgin subfamily a, 6	209	Potential.										0						CGTTCAGCAGCGCCCGCTCCT	0.587													4	99	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	83014106	83014106	+	Silent	SNP	T	C	C			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83014106T>C	uc010uny.1	-	6	539	c.441A>G	c.(439-441)GTA>GTG	p.V147V	GOLGA6L10_uc010unt.1_RNA|uc002bhl.2_Intron|uc002bhm.2_Intron|GOLGA6L10_uc002bia.1_5'Flank	NM_198181	NP_937824	A6NI86	GG6LA_HUMAN	golgi autoantigen, golgin subfamily a, 6D-like	159	Potential.										0						GTAGCTGCTCTACCTTAGATG	0.498													3	2	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85055802	85055802	+	RNA	SNP	C	A	A	rs1727704		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85055802C>A	uc002bkm.2	-	6		c.758G>T				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						GCCTCTCCTCCTGTTCACGTA	0.552													2	3	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31332891	31332891	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31332891G>A	uc002ebq.2	+	16	2043	c.1945G>A	c.(1945-1947)GGA>AGA	p.G649R	ITGAM_uc002ebr.2_Missense_Mutation_p.G650R|ITGAM_uc010cam.1_Intron|ITGAM_uc010can.2_Missense_Mutation_p.G55R|ITGAM_uc002ebs.1_Missense_Mutation_p.G55R	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	649	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						CAAGGAAGCCGGAGAGGTCAG	0.517													16	304	---	---	---	---	PASS
DHX38	9785	broad.mit.edu	37	16	72130068	72130068	+	Silent	SNP	C	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72130068C>T	uc002fcb.2	+	2	367	c.12C>T	c.(10-12)ACC>ACT	p.T4T	TXNL4B_uc010cgl.2_5'Flank|TXNL4B_uc002fca.2_5'Flank|TXNL4B_uc010vmn.1_5'Flank|TXNL4B_uc010vmo.1_5'Flank|DHX38_uc010vmp.1_Silent_p.T4T|DHX38_uc010cgn.1_5'Flank	NM_014003	NP_054722	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	4					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1		Ovarian(137;0.125)				TGGGGGACACCAGTGAGGATG	0.498													5	149	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74445808	74445808	+	Intron	SNP	T	C	C	rs146209466	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74445808T>C	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron|CLEC18B_uc010vmu.1_3'UTR|CLEC18B_uc010vmv.1_Intron	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region	sugar binding				0						GGGTcaggagtgagctggtca	0.294													4	33	---	---	---	---	PASS
SGSM2	9905	broad.mit.edu	37	17	2267466	2267466	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2267466G>T	uc002fun.3	+	8	1096	c.921G>T	c.(919-921)GAG>GAT	p.E307D	SGSM2_uc002fum.3_Missense_Mutation_p.E307D|SGSM2_uc010vqw.1_Missense_Mutation_p.E307D|SGSM2_uc002fuo.2_5'Flank	NM_001098509	NP_001091979	O43147	SGSM2_HUMAN	RUN and TBC1 domain containing 1 isoform 2	307						intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		GGGACTCCGAGCTGGAAAAGA	0.617													3	83	---	---	---	---	PASS
STAT3	6774	broad.mit.edu	37	17	40476777	40476777	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40476777G>A	uc002hzl.1	-	17	1792	c.1552C>T	c.(1552-1554)CGA>TGA	p.R518*	STAT3_uc002hzk.1_Nonsense_Mutation_p.R518*|STAT3_uc002hzm.1_Nonsense_Mutation_p.R518*|STAT3_uc010wgh.1_Nonsense_Mutation_p.R420*|STAT3_uc002hzn.1_Nonsense_Mutation_p.R518*	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	518					cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CTCAGTCCTCGCTTGGTGGTG	0.547									Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				5	114	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76471408	76471408	+	5'Flank	SNP	G	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76471408G>A	uc002jvs.2	-											Homo sapiens mRNA for DNAH17 variant protein, partial cds.											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TCTGAAACACGTCAAGCCCGC	0.607													5	168	---	---	---	---	PASS
MADCAM1	8174	broad.mit.edu	37	19	501738	501738	+	Missense_Mutation	SNP	C	A	A	rs1063736	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:501738C>A	uc002los.2	+	4	747	c.737C>A	c.(736-738)CCG>CAG	p.P246Q	MADCAM1_uc002lot.2_Intron|MADCAM1_uc010drq.2_Intron	NM_130760	NP_570116	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion	246	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Extracellular (Potential).|3.|Mucin-like.				cell adhesion|immune response|regulation of immune response|signal transduction	integral to membrane|membrane fraction|plasma membrane					0		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCACCTCCCCGGAGTCTCCC	0.682													3	14	---	---	---	---	PASS
FUT5	2527	broad.mit.edu	37	19	5867748	5867748	+	5'UTR	SNP	G	T	T	rs778971	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5867748G>T	uc002mdo.3	-	2					FUT5_uc010duo.2_5'UTR	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5						L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						GGTCAGAGTAGCTGGGAAGAG	0.567													4	84	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533087	41533087	+	Intron	SNP	T	C	C	rs10426686	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533087T>C	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CAGAGCCTCCTTGACGGCATC	0.647													8	109	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51022639	51022639	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51022639G>T	uc002pss.2	-	3	468	c.331C>A	c.(331-333)CAC>AAC	p.H111N		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	111	Extracellular (Potential).|LRR 2.					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		ATCTCCAGGTGCCGCAGGTGC	0.607													8	38	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55147987	55147987	+	Missense_Mutation	SNP	G	C	C	rs41308744		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55147987G>C	uc002qgj.2	+	15	2030	c.1690G>C	c.(1690-1692)GAG>CAG	p.E564Q	LILRB1_uc010erp.1_3'UTR|LILRB1_uc002qgl.2_Missense_Mutation_p.E565Q|LILRB1_uc002qgk.2_Missense_Mutation_p.E565Q|LILRB1_uc002qgm.2_Missense_Mutation_p.E566Q|LILRB1_uc010erq.2_Missense_Mutation_p.E548Q|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	564	Cytoplasmic (Potential).|ITIM motif 2.				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		GACGTATGCCGAGGTGAAACA	0.577										HNSCC(37;0.09)			3	93	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1585397	1585397	+	Intron	SNP	T	C	C	rs148754551	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1585397T>C	uc010gai.2	-						SIRPB1_uc002wfk.3_Intron|SIRPB1_uc002wfl.3_Missense_Mutation_p.T248A	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1						cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						CCTCGGATGGTCTCAGACAAG	0.627													15	45	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29633915	29633915	+	Intron	SNP	C	T	T	rs78740969	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633915C>T	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						AATTGAAAGCCGACAGATACT	0.274													18	74	---	---	---	---	PASS
CCT8	10694	broad.mit.edu	37	21	30439985	30439985	+	Silent	SNP	A	G	G			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30439985A>G	uc002ynb.2	-	4	372	c.273T>C	c.(271-273)CAT>CAC	p.H91H	CCT8_uc011acp.1_Silent_p.H72H|CCT8_uc002yna.2_Silent_p.H40H|CCT8_uc002ync.2_Silent_p.H91H|CCT8_uc010glm.2_Silent_p.H91H|CCT8_uc011acq.1_Silent_p.H18H	NM_006585	NP_006576	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	91					'de novo' posttranslational protein folding	aggresome|cytosol|intermediate filament cytoskeleton|microtubule organizing center	ATP binding|ATPase activity, coupled|unfolded protein binding				0						GCTCTTGCATATGAGAAGCCA	0.393													5	169	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42523636	42523636	+	Missense_Mutation	SNP	C	A	A	rs3915951		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42523636C>A	uc003bce.2	-	7	1076	c.986G>T	c.(985-987)CGC>CTC	p.R329L	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Missense_Mutation_p.R23L|CYP2D6_uc003bcf.2_Missense_Mutation_p.R278L	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	329							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						TTGGACACGGCCTGGACAGAC	0.602													4	80	---	---	---	---	PASS
MAGEB3	4114	broad.mit.edu	37	X	30254361	30254361	+	Missense_Mutation	SNP	G	A	A	rs2071308	byFrequency	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30254361G>A	uc004dca.1	+	5	1057	c.320G>A	c.(319-321)CGC>CAC	p.R107H		NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	107											0						GTGCAGTCTCGCACAGACCCT	0.393													4	77	---	---	---	---	PASS
UTS2	10911	broad.mit.edu	37	1	7912945	7912945	+	Intron	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7912945delA	uc001aor.2	-						UTS2_uc001aoq.2_Intron|UTS2_uc001aos.2_Intron	NM_006786	NP_006777	O95399	UTS2_HUMAN	urotensin 2 isoform b preproprotein						muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		ACATAAGGGGAAAAAAAAAAT	0.378													186	7	---	---	---	---	
CELA2A	63036	broad.mit.edu	37	1	15783097	15783097	+	5'Flank	DEL	A	-	-	rs34325326		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15783097delA	uc001awk.2	+							NM_033440	NP_254275	P08217	CEL2A_HUMAN	elastase 2A preproprotein						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						AGGAAATGGGAAAAAAAAAAT	0.383													3	5	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57571058	57571059	+	Intron	DEL	GT	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57571058_57571059delGT	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						CCAgtgtgtggtgtgtgtgtgt	0.396													4	2	---	---	---	---	
COL24A1	255631	broad.mit.edu	37	1	86377125	86377125	+	Intron	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86377125delA	uc001dlj.2	-						COL24A1_uc001dli.2_Intron|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CCCTTTTAGGAAAAAAAAATA	0.328													243	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	99474094	99474094	+	Intron	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99474094delA	uc001dsd.1	+											Homo sapiens cDNA FLJ38225 fis, clone FCBBF2003528.																		AACAGCAACTAAAAAAAAAAA	0.353													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154686484	154686487	+	Intron	DEL	TGTG	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154686484_154686487delTGTG	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			gtgtggtgtttgtgtgtggtgtgt	0.113													4	2	---	---	---	---	
CD247	919	broad.mit.edu	37	1	167400667	167400675	+	3'UTR	DEL	ACCTGCACC	-	-	rs34484379		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167400667_167400675delACCTGCACC	uc001gei.3	-	8					CD247_uc001gej.3_3'UTR	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			AGACAGGTCTACCTGCACCACCGGCAAAC	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	15299927	15299928	+	IGR	INS	-	CA	CA			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15299927_15299928insCA								FAM84A (508994 upstream) : NBAS (7104 downstream)																							acacacgcgtgcacacacacac	0.005													4	2	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37260027	37260028	+	Intron	INS	-	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37260027_37260028insT	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				Gttttgttttgttttttttttt	0.094													5	4	---	---	---	---	
MTIF2	4528	broad.mit.edu	37	2	55481486	55481487	+	Intron	INS	-	ATA	ATA	rs10678751		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55481486_55481487insATA	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1						CTCCTATACATATGACAGACTA	0.347													6	5	---	---	---	---	
LIMS1	3987	broad.mit.edu	37	2	109297018	109297021	+	Intron	DEL	AAAG	-	-	rs59337195		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109297018_109297021delAAAG	uc002teg.2	+						LIMS1_uc002tef.2_Intron|LIMS1_uc002teh.2_Intron|LIMS1_uc002tei.2_Intron|LIMS1_uc002tej.2_Intron|LIMS1_uc002tek.3_Intron	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						aaaaaaaaaaaaaGGTTCTTGAGA	0.230													14	13	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142359212	142359213	+	Intron	INS	-	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142359212_142359213insT	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		tccttccttcctttttttttcc	0.094										TSP Lung(27;0.18)			4	2	---	---	---	---	
ATIC	471	broad.mit.edu	37	2	216196855	216196868	+	Intron	DEL	GTGTGTGTGTGTGT	-	-	rs72447420		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216196855_216196868delGTGTGTGTGTGTGT	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	tcctccagtcgtgtgtgtgtgtgtgtgtgtgtgt	0.000			T	ALK	ALCL								4	2	---	---	---	---	
ATIC	471	broad.mit.edu	37	2	216203877	216203877	+	Intron	DEL	A	-	-	rs79489036		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216203877delA	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)	AAATGGGATCATGTCTTCCAT	0.313			T	ALK	ALCL								1	6	---	---	---	---	
ARPC2	10109	broad.mit.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219118832delA	uc002vhd.2	+	11					ARPC2_uc002vhe.2_3'UTR|ARPC2_uc002vhf.2_3'UTR	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368													4	2	---	---	---	---	
SPHKAP	80309	broad.mit.edu	37	2	229046023	229046024	+	Intron	INS	-	G	G			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229046023_229046024insG	uc002vpq.2	-						SPHKAP_uc002vpp.2_Intron|SPHKAP_uc010zlx.1_Intron	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein							cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GCCTTAGAGGCGGGCACGGGGC	0.668													4	2	---	---	---	---	
WDR48	57599	broad.mit.edu	37	3	39127345	39127346	+	Intron	INS	-	TATATT	TATATT	rs149016112	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39127345_39127346insTATATT	uc003cit.2	+						WDR48_uc011ayt.1_Intron|WDR48_uc011ayu.1_Intron|WDR48_uc011ayv.1_Intron|WDR48_uc003ciu.2_Intron	NM_020839	NP_065890	Q8TAF3	WDR48_HUMAN	WD repeat domain 48						interspecies interaction between organisms|protein deubiquitination	lysosome|nucleus	protein binding			ovary(1)|breast(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		ATAAAATACTCtatattcagat	0.193													4	2	---	---	---	---	
FHIT	2272	broad.mit.edu	37	3	59884169	59884170	+	Intron	DEL	TG	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59884169_59884170delTG	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		tgtgtatgtttgtgtgtgtgtg	0.104			T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				4	2	---	---	---	---	
ITGB5	3693	broad.mit.edu	37	3	124567639	124567639	+	Intron	DEL	T	-	-	rs11330035		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124567639delT	uc003eho.2	-							NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		ttttattttattttttttgag	0.199													2	4	---	---	---	---	
IQCG	84223	broad.mit.edu	37	3	197671126	197671126	+	Intron	DEL	T	-	-	rs74574846		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197671126delT	uc003fyo.2	-						IQCG_uc003fyp.2_Intron|IQCG_uc003fyq.3_Intron	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CAACTTACTCttttttttttt	0.189													4	2	---	---	---	---	
MAN2B2	23324	broad.mit.edu	37	4	6615488	6615490	+	Intron	DEL	AAG	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6615488_6615490delAAG	uc003gjf.1	+						MAN2B2_uc003gje.1_Intron|MAN2B2_uc011bwf.1_Intron	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2						mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						gggaaaagaaaagaagagaggga	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	82324118	82324121	+	IGR	DEL	GGAA	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82324118_82324121delGGAA								PRKG2 (187900 upstream) : RASGEF1B (24098 downstream)																							aaggaaggagggaaggaaggaagg	0.201													4	2	---	---	---	---	
PRMT10	90826	broad.mit.edu	37	4	148578918	148578918	+	Intron	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148578918delA	uc003ilc.2	-						PRMT10_uc003ilb.2_Intron|PRMT10_uc003ild.2_Intron	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10							cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						GCAAGAGGTTAAAAAAAAAAA	0.378													78	9	---	---	---	---	
PRKAA1	5562	broad.mit.edu	37	5	40764789	40764789	+	Intron	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40764789delA	uc003jmc.2	-						PRKAA1_uc003jmb.2_Intron	NM_006251	NP_006242	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic						activation of MAPK activity|cell cycle arrest|cholesterol biosynthetic process|fatty acid biosynthetic process|insulin receptor signaling pathway|negative regulation of glucosylceramide biosynthetic process|positive regulation of anti-apoptosis|positive regulation of cholesterol biosynthetic process|regulation of fatty acid oxidation|response to hypoxia	cytosol	ATP binding|cAMP-dependent protein kinase activity|metal ion binding|protein binding			breast(1)	1					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	ATTCTTCTATAAAACATTTTA	0.318													155	11	---	---	---	---	
C5orf34	375444	broad.mit.edu	37	5	43492107	43492108	+	Intron	DEL	AA	-	-	rs34983529		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43492107_43492108delAA	uc003jnz.1	-							NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444											breast(1)	1	Lung NSC(6;2.07e-05)					actctgtctcaaaaaaaaaaaa	0.144													3	3	---	---	---	---	
DDX4	54514	broad.mit.edu	37	5	55055879	55055879	+	Intron	DEL	T	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55055879delT	uc003jqg.3	+						DDX4_uc010ivz.2_Intron|DDX4_uc003jqh.3_Intron	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform						multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				CATGTAGCCATTTTTTTTTTT	0.318													12	9	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131306105	131306105	+	Intron	DEL	T	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131306105delT	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Intron|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc003kvw.1_Intron|ACSL6_uc010jdn.1_Intron	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGAAGTGCTAttttttttttt	0.259													4	2	---	---	---	---	
SNAP91	9892	broad.mit.edu	37	6	84366385	84366386	+	Intron	INS	-	AAG	AAG	rs145969366	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84366385_84366386insAAG	uc011dze.1	-						SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron|SNAP91_uc011dzf.1_Intron	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		tattgcCCACCAAGTGAGACAA	0.238													9	4	---	---	---	---	
AKD1	221264	broad.mit.edu	37	6	109818561	109818562	+	Intron	INS	-	CACTCT	CACTCT	rs113462985		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109818561_109818562insCACTCT	uc003ptn.2	-						AKD1_uc011eas.1_Intron	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						acacacacacacacactctctc	0.005													5	4	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6859772	6859773	+	Intron	INS	-	A	A	rs147091531	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6859772_6859773insA	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		AAAGTTCAAACTATCTACTTAA	0.257													8	4	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21721044	21721045	+	Intron	INS	-	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21721044_21721045insA	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						gactccatctcaaaaaaaaaaa	0.139									Kartagener_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38284515	38284520	+	Intron	DEL	GAAAAG	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38284515_38284520delGAAAAG	uc003tfu.3	-						uc003tfv.2_Intron					SubName: Full=TARP protein;																		agaaaaaaaagaaaagaaaaaaGACA	0.160													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64975077	64975078	+	IGR	INS	-	AGAC	AGAC			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975077_64975078insAGAC								ZNF92 (109080 upstream) : INTS4L2 (137699 downstream)																							AGTGCACCCGAAAACAAAGATG	0.455													6	3	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66772495	66772495	+	Intron	DEL	T	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66772495delT	uc003tvt.3	+						STAG3L4_uc010laj.2_Intron	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				GCTTGATTCCTTTTTTTTTTT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98043568	98043569	+	IGR	INS	-	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98043568_98043569insT								BAIAP2L1 (13141 upstream) : NPTX2 (203028 downstream)																							ttctttctctcttTTTTTTTTT	0.193													4	2	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													10	5	---	---	---	---	
DNAJB9	4189	broad.mit.edu	37	7	108213938	108213939	+	3'UTR	INS	-	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108213938_108213939insT	uc003vfn.2	+	3						NM_012328	NP_036460	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9						ER-associated protein catabolic process|protein folding	endoplasmic reticulum|nucleolus	heat shock protein binding|misfolded protein binding|unfolded protein binding				0						ATATTTAAGGGTTTTTTTTTTT	0.267													4	2	---	---	---	---	
MKLN1	4289	broad.mit.edu	37	7	130927793	130927794	+	Intron	INS	-	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130927793_130927794insA	uc011kpl.1	+							NM_001145354	NP_001138826	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					AAATTAAACAGAAAAAAAAAAG	0.371													76	7	---	---	---	---	
C8orf38	137682	broad.mit.edu	37	8	96047471	96047472	+	Intron	DEL	TT	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96047471_96047472delTT	uc003yhj.2	+						C8orf38_uc003yhe.1_Intron|C8orf38_uc003yhf.2_Intron|C8orf38_uc011lgs.1_Intron|C8orf38_uc003yhi.2_Intron|C8orf38_uc003yhk.2_Intron|C8orf38_uc003yhl.2_Intron	NM_152416	NP_689629	Q330K2	CH038_HUMAN	hypothetical protein LOC137682 precursor						biosynthetic process	mitochondrion	transferase activity				0	Breast(36;3.32e-06)					TAAAAATTACTTAAAGAATGAA	0.109													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	115503769	115503770	+	IGR	DEL	AC	-	-	rs34697555		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115503769_115503770delAC								None (None upstream) : TRPS1 (916955 downstream)																							taacacacatacacacacacac	0.000													4	2	---	---	---	---	
KIAA0196	9897	broad.mit.edu	37	8	126091345	126091346	+	Intron	DEL	TG	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126091345_126091346delTG	uc003yrt.2	-						KIAA0196_uc011lir.1_Intron	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin						cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			tgtatatatatgtgtgtgtgtg	0.198													5	4	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAGACCttttctttttttttt	0.139		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69787982	69787985	+	IGR	DEL	AACA	-	-	rs59524350		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69787982_69787985delAACA								LOC100133920 (123033 upstream) : FOXD4L5 (387724 downstream)																							AGATAGAGGTAACAAACTTAAATA	0.368													5	4	---	---	---	---	
CTSL1	1514	broad.mit.edu	37	9	90343456	90343457	+	Intron	INS	-	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90343456_90343457insT	uc004aph.2	+						CTSL1_uc004api.2_Intron|CTSL1_uc004apj.2_Intron|CTSL1_uc010mqh.2_Intron|CTSL1_uc004apk.2_Intron|CTSL1_uc004apl.2_Intron	NM_001912	NP_001903	P07711	CATL1_HUMAN	cathepsin L1 preproprotein						macrophage apoptosis|proteolysis	extracellular region|lysosome|nucleus	cysteine-type endopeptidase activity|histone binding			ovary(3)	3					Glucagon recombinant(DB00040)	AAGTCTTATTATTTTTTTTTTG	0.361													105	9	---	---	---	---	
LPPR1	54886	broad.mit.edu	37	9	104086507	104086507	+	3'UTR	DEL	T	-	-	rs148907009		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104086507delT	uc004bbb.2	+	8					LPPR1_uc011lvi.1_3'UTR|LPPR1_uc004bbc.2_3'UTR|LPPR1_uc010mtc.2_3'UTR	NM_207299	NP_997182	Q8TBJ4	LPPR1_HUMAN	plasticity related gene 3							integral to membrane	catalytic activity				0						CTTGCCCTGATTTTTTTTTTT	0.294													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467360	52467361	+	IGR	DEL	CA	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467360_52467361delCA								SGMS1 (82437 upstream) : ASAH2B (32335 downstream)																							AGCTGATATCcacacacacaca	0.342													9	5	---	---	---	---	
DLG5	9231	broad.mit.edu	37	10	79616211	79616212	+	Intron	INS	-	ACAC	ACAC	rs147454360	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79616211_79616212insACAC	uc001jzk.2	-						DLG5_uc001jzj.2_5'Flank|DLG5_uc009xru.1_Intron	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CAGTGGTAGGGacacacacaca	0.401													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													7	4	---	---	---	---	
KIF11	3832	broad.mit.edu	37	10	94388745	94388745	+	Intron	DEL	T	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94388745delT	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						TCCTTCAAGAttttttttttt	0.119													9	4	---	---	---	---	
TAF5	6877	broad.mit.edu	37	10	105146731	105146732	+	Intron	INS	-	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105146731_105146732insA	uc001kwv.2	+						TAF5_uc010qqq.1_Intron	NM_006951	NP_008882	Q15542	TAF5_HUMAN	TBP-associated factor 5						histone acetylation|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|transcription factor TFIID complex|transcription factor TFTC complex	protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)	2		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		gacctcagcttaaaaaaaaaaa	0.193													3	3	---	---	---	---	
CCDC147	159686	broad.mit.edu	37	10	106158933	106158934	+	Intron	INS	-	GT	GT	rs146342555	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106158933_106158934insGT	uc001kyh.2	+							NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147											ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TTTCTTTATGAgtgtgtgtgtg	0.312													8	8	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													6	4	---	---	---	---	
SAA4	6291	broad.mit.edu	37	11	18253712	18253713	+	Intron	INS	-	AGCCCCTGCACCC	AGCCCCTGCACCC	rs143986842	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18253712_18253713insAGCCCCTGCACCC	uc001mny.2	-							NM_006512	NP_006503	P35542	SAA4_HUMAN	serum amyloid A4, constitutive precursor						acute-phase response	high-density lipoprotein particle					0						ttacaggtgtgagcccctgcac	0.208													7	4	---	---	---	---	
GPR137	56834	broad.mit.edu	37	11	64038448	64038449	+	Intron	INS	-	CT	CT	rs72297834		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64038448_64038449insCT	uc009ypj.1	+						BAD_uc001nzd.2_Intron|BAD_uc001nzc.2_Intron	NM_020155	NP_064540	Q96N19	G137A_HUMAN	G protein-coupled receptor 137							integral to membrane				central_nervous_system(1)	1						ATGCCCTGTGacacacacacac	0.327													3	3	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73765440	73765441	+	Intron	INS	-	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73765440_73765441insA	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					agatcttgttcaaaaaaaaaaa	0.198													4	2	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199648	120199655	+	Intron	DEL	TGTGTGTT	-	-	rs146684732	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199648_120199655delTGTGTGTT	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		tgtgtgtgtgtgtgtgtttgtgtatgtT	0.048													4	2	---	---	---	---	
ADAMTS20	80070	broad.mit.edu	37	12	43945219	43945220	+	Intron	DEL	CA	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43945219_43945220delCA	uc010skx.1	-							NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with							proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GATGCGCACGCACACACACACA	0.554													4	2	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66856582	66856582	+	Intron	DEL	A	-	-	rs66964947		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66856582delA	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		actccatctcaaaaaaaaaaa	0.204													5	3	---	---	---	---	
IL22	50616	broad.mit.edu	37	12	68646870	68646871	+	Intron	INS	-	A	A	rs34979529		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68646870_68646871insA	uc001sty.1	-						IL22_uc010stb.1_Intron	NM_020525	NP_065386	Q9GZX6	IL22_HUMAN	interleukin 22 precursor						acute-phase response	extracellular space	cytokine activity|interleukin-22 receptor binding				0		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)		AGAAGTTCAAGAAAAAAAAAAA	0.356													6	4	---	---	---	---	
GLT1D1	144423	broad.mit.edu	37	12	129359600	129359601	+	Intron	DEL	TG	-	-	rs62800960		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129359600_129359601delTG	uc010tbh.1	+						GLT1D1_uc001uhx.1_Intron|GLT1D1_uc001uhy.1_Intron	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1						biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		ACATAAATATtgtgtgtgtgtg	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	39764313	39764316	+	IGR	DEL	ACAC	-	-	rs67173515		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39764313_39764316delACAC								NHLRC3 (140071 upstream) : LHFP (152714 downstream)																							gcactactgaacacacacacacac	0.000													4	2	---	---	---	---	
WDHD1	11169	broad.mit.edu	37	14	55422594	55422595	+	Intron	INS	-	TTCAGA	TTCAGA	rs140324706	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55422594_55422595insTTCAGA	uc001xbm.1	-						WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Intron	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1							cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AAAAACTACACTTCAGATTCCA	0.168													4	2	---	---	---	---	
MAX	4149	broad.mit.edu	37	14	65544918	65544925	+	Intron	DEL	TTTATTTT	-	-	rs140790039	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65544918_65544925delTTTATTTT	uc001xif.1	-						MAX_uc001xic.1_Intron|MAX_uc001xie.1_Intron|MAX_uc010aql.1_Intron|MAX_uc001xig.1_Intron|MAX_uc001xih.1_Intron|MAX_uc001xii.1_Intron|MAX_uc001xij.1_Intron	NM_002382	NP_002373	P61244	MAX_HUMAN	MAX protein isoform a						transcription from RNA polymerase II promoter	cytoplasm|MLL1 complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(1)	1				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)		tatttatttatttatttttttatttttt	0.221													3	5	---	---	---	---	
ATXN3	4287	broad.mit.edu	37	14	92562986	92562986	+	Intron	DEL	G	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92562986delG	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron|ATXN3_uc010twl.1_Intron	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		aaaaaaaaaagaaaTGTGACT	0.199													206	7	---	---	---	---	
UBR7	55148	broad.mit.edu	37	14	93684757	93684758	+	Intron	INS	-	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93684757_93684758insA	uc001ybm.3	+						UBR7_uc001ybn.3_Intron|UBR7_uc010auq.2_Intron	NM_175748	NP_786924	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin								ubiquitin-protein ligase activity|zinc ion binding				0						actctgtctgtaaaaaaaaaaa	0.124													3	3	---	---	---	---	
ATG2B	55102	broad.mit.edu	37	14	96811382	96811383	+	Intron	INS	-	A	A			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96811382_96811383insA	uc001yfi.2	-							NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B											ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AACTAAGGTACAAAAAAAAAAA	0.307													4	2	---	---	---	---	
LCTL	197021	broad.mit.edu	37	15	66840638	66840638	+	3'UTR	DEL	T	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66840638delT	uc002aqc.2	-	13					LCTL_uc002aqd.3_3'UTR|LCTL_uc010bhw.2_3'UTR|ZWILCH_uc002aqb.2_Intron|ZWILCH_uc002aqa.2_Intron|ZWILCH_uc010bhv.2_Intron	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor						carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						attacaagtgttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	100328703	100328704	+	IGR	INS	-	CTTC	CTTC	rs56252855		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100328703_100328704insCTTC								LYSMD4 (55077 upstream) : C15orf51 (1657 downstream)																							tccctccctttcttccttcctt	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10922595	10922598	+	IGR	DEL	CACA	-	-	rs138186206		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10922595_10922598delCACA								FAM18A (9974 upstream) : CIITA (48457 downstream)																							TTCTCTCTTTcacacacacacaca	0.441													4	3	---	---	---	---	
CD19	930	broad.mit.edu	37	16	28947053	28947053	+	Intron	DEL	T	-	-	rs35181893		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28947053delT	uc002drs.2	+						uc010vct.1_Intron|CD19_uc010byo.1_Intron	NM_001770	NP_001761	P15391	CD19_HUMAN	CD19 antigen precursor						cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity			ovary(2)|central_nervous_system(1)	3						CCTCTTGCAAttttttttttt	0.259													4	3	---	---	---	---	
TOP2A	7153	broad.mit.edu	37	17	38551558	38551558	+	Intron	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38551558delA	uc002huq.2	-							NM_001067	NP_001058	P11388	TOP2A_HUMAN	DNA topoisomerase II, alpha isozyme						apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	aaaaaaaaagaGGTCCAAGTA	0.174													7	4	---	---	---	---	
KRT9	3857	broad.mit.edu	37	17	39727346	39727346	+	Intron	DEL	T	-	-	rs77388119		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39727346delT	uc002hxe.3	-						JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9						intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				TCAGCTCACGTTAACCCAGGT	0.493													5	4	---	---	---	---	
SPOP	8405	broad.mit.edu	37	17	47696482	47696482	+	Intron	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47696482delA	uc010dbk.2	-						SPOP_uc002ipb.2_Intron|SPOP_uc002ipc.2_Intron|SPOP_uc002ipd.2_Intron|SPOP_uc002ipe.2_Intron|SPOP_uc002ipf.2_Intron|SPOP_uc002ipg.2_Intron	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein						mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						TGGGGTGGGGAAAAAAAAAGT	0.403										Prostate(2;0.17)			413	9	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56690560	56690561	+	Intron	INS	-	A	A	rs77849538		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56690560_56690561insA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					gactctgtctcaaaaaaaaaaa	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	35780892	35780892	+	IGR	DEL	G	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35780892delG								CELF4 (634892 upstream) : None (None downstream)																							CACCGCACCAGGGGAGCAGGA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57523906	57523907	+	IGR	DEL	AC	-	-	rs34424123		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57523906_57523907delAC								CCBE1 (159262 upstream) : PMAIP1 (43285 downstream)																							ATacacacatacacacacacac	0.183													5	3	---	---	---	---	
PQLC1	80148	broad.mit.edu	37	18	77679541	77679542	+	Intron	INS	-	A	A	rs7234258		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77679541_77679542insA	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		aaggtcagtggggagagacagg	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																							aaaaaaaaaacaaaaaaaaaa	0.348													5	3	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4199809	4199810	+	Intron	INS	-	A	A	rs140961038	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4199809_4199810insA	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GAGCCCCTGTCGGGGGCGTGGG	0.708													2	4	---	---	---	---	
ACSBG2	81616	broad.mit.edu	37	19	6156798	6156798	+	Intron	DEL	T	-	-	rs113271517		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6156798delT	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						TCAGCCTCCAttttttttttt	0.169													4	2	---	---	---	---	
ARRDC2	27106	broad.mit.edu	37	19	18111475	18111476	+	5'Flank	INS	-	GGAA	GGAA	rs141584055	by1000genomes	TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18111475_18111476insGGAA	uc002nhu.2	+							NM_001025604	NP_001020775	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 2											pancreas(1)	1						agaggaaggagggaaggaagga	0.223													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28388014	28388015	+	IGR	INS	-	T	T			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28388014_28388015insT								LOC148189 (103166 upstream) : None (None downstream)																							GGACTTCTCTGTTTTTTTTCCT	0.554													6	3	---	---	---	---	
CIC	23152	broad.mit.edu	37	19	42792902	42792902	+	Intron	DEL	T	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42792902delT	uc002otf.1	+							NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				TGGGTGGTGGTTTTTTTTTTT	0.542			T	DUX4	soft tissue sarcoma								4	2	---	---	---	---	
RPS5	6193	broad.mit.edu	37	19	58905673	58905674	+	Intron	DEL	TG	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58905673_58905674delTG	uc002qsn.2	+						RPS5_uc002qso.2_Intron	NM_001009	NP_001000	P46782	RS5_HUMAN	ribosomal protein S5						endocrine pancreas development|regulation of translational fidelity|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|structural constituent of ribosome				0		all_cancers(17;1.71e-22)|all_epithelial(17;1.69e-16)|Lung NSC(17;2.25e-06)|all_lung(17;9.97e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Breast(46;0.0194)|Ovarian(87;0.0443)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.171)|GBM - Glioblastoma multiforme(193;0.0323)|Lung(386;0.0543)|LUSC - Lung squamous cell carcinoma(496;0.176)		AACTTCAGCCTGTGTGTGTGTG	0.426													4	2	---	---	---	---	
EPB41L1	2036	broad.mit.edu	37	20	34776564	34776565	+	Intron	DEL	AG	-	-	rs56935240		TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34776564_34776565delAG	uc002xfb.2	+						EPB41L1_uc002xeu.2_Intron|EPB41L1_uc010zvo.1_Intron|EPB41L1_uc002xev.2_Intron|EPB41L1_uc002xew.2_Intron|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Intron	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					acacacacacagagagagagag	0.158													2	4	---	---	---	---	
RNF160	26046	broad.mit.edu	37	21	30339206	30339206	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30339206delT	uc002ymr.2	-	10	1758	c.1745delA	c.(1744-1746)AATfs	p.N582fs	RNF160_uc010gll.1_RNA	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	536							ligase activity|zinc ion binding				0						AACCTTACCATTTTTTTTTTT	0.378													132	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756431	44756431	+	IGR	DEL	A	-	-			TCGA-EJ-5506-01A-01D-1576-08	TCGA-EJ-5506-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756431delA								CRYAA (163518 upstream) : SIK1 (77967 downstream)																							caccaccaccaccaccatcac	0.000													4	2	---	---	---	---	
