Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P9	11223	broad.mit.edu	37	1	17085908	17085908	+	Intron	SNP	C	G	G	rs1805293	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085908C>G	uc010ock.1	-						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						AGCAGGCGCTCCACTCAGCCC	0.701													3	15	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17271879	17271879	+	Intron	SNP	A	G	G	rs2781605	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17271879A>G	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_5'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCTGGTCCCCAGCCCAGCATC	0.552													3	8	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17271891	17271891	+	Intron	SNP	C	T	T	rs2781606	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17271891C>T	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_5'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCCAGCATCTCGCTGGCTACA	0.587													3	7	---	---	---	---	PASS
S100PBP	64766	broad.mit.edu	37	1	33291705	33291705	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33291705T>C	uc001bvz.2	+	3	282	c.5T>C	c.(4-6)ATG>ACG	p.M2T	S100PBP_uc001bwa.1_Missense_Mutation_p.M2T|S100PBP_uc001bwb.1_Missense_Mutation_p.M2T|S100PBP_uc001bwc.2_Missense_Mutation_p.M2T|S100PBP_uc001bwd.2_RNA	NM_022753	NP_073590	Q96BU1	S1PBP_HUMAN	S100P binding protein isoform a	2						nucleus	calcium-dependent protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CCAGAAATGATGTGCTCACGG	0.428													48	106	---	---	---	---	PASS
NT5C1A	84618	broad.mit.edu	37	1	40126776	40126776	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40126776G>T	uc001cdq.1	-	5	716	c.716C>A	c.(715-717)GCC>GAC	p.A239D		NM_032526	NP_115915	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	239					purine base metabolic process|purine nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GTTCTCGTGGGCCTTCTCATG	0.637													10	251	---	---	---	---	PASS
YBX1	4904	broad.mit.edu	37	1	43161928	43161928	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43161928C>T	uc001chs.2	+	4	494	c.323C>T	c.(322-324)ACT>ATT	p.T108I		NM_004559	NP_004550	P67809	YBOX1_HUMAN	nuclease sensitive element binding protein 1	108	CSD.				CRD-mediated mRNA stabilization|negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|positive regulation of cell division|transcription from RNA polymerase II promoter	CRD-mediated mRNA stability complex|extracellular region|histone pre-mRNA 3'end processing complex|nucleoplasm|stress granule|U12-type spliceosomal complex	double-stranded DNA binding|protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(4)|upper_aerodigestive_tract(1)	5	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GATGGAGAGACTGTGGAGTTT	0.393													4	171	---	---	---	---	PASS
DMAP1	55929	broad.mit.edu	37	1	44686333	44686333	+	3'UTR	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44686333C>A	uc001clq.1	+	11					DMAP1_uc001clr.1_3'UTR|DMAP1_uc001cls.1_3'UTR|DMAP1_uc010oku.1_3'UTR	NM_001034024	NP_001029196	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1						DNA methylation|histone H2A acetylation|histone H4 acetylation|negative regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex	DNA binding|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					GTAAATAGAGCTGCTGAGTTG	0.577											OREG0013438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	33	---	---	---	---	PASS
C1orf177	163747	broad.mit.edu	37	1	55280637	55280637	+	Silent	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55280637C>T	uc001cyb.3	+	8	1029	c.975C>T	c.(973-975)CCC>CCT	p.P325P	C1orf177_uc001cya.3_Silent_p.P325P	NM_001110533	NP_001104003	Q3ZCV2	CA177_HUMAN	hypothetical protein LOC163747 isoform 2	325											0						AATGCAAACCCGTCAACCAGC	0.547													41	140	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113636959	113636959	+	Splice_Site	SNP	A	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113636959A>T	uc001edf.1	+	5	714	c.516_splice	c.e5-2	p.L172_splice	LRIG2_uc009wgn.1_Splice_Site_p.L69_splice	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGTTTATTTTAGGAATTTAAG	0.289													4	80	---	---	---	---	PASS
PBXIP1	57326	broad.mit.edu	37	1	154918697	154918697	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154918697G>A	uc001ffr.2	-	10	1512	c.1453C>T	c.(1453-1455)CGG>TGG	p.R485W	PBXIP1_uc001ffs.2_Missense_Mutation_p.R456W|PBXIP1_uc010pep.1_Missense_Mutation_p.R330W	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein	485	Nuclear localization signal (Potential).				cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity			large_intestine(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCAGCCTTCCGGTCTCTCTGC	0.552													17	546	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181762828	181762828	+	Intron	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181762828G>A	uc001gow.2	+						CACNA1E_uc009wxs.2_Intron|CACNA1E_uc009wxt.2_Missense_Mutation_p.V1202M	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						ATTAAAAAGCGTGCAGCCCTC	0.517													6	27	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15468434	15468434	+	Silent	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15468434C>T	uc002rcc.1	-	37	4376	c.4350G>A	c.(4348-4350)GGG>GGA	p.G1450G	NBAS_uc010exl.1_Silent_p.G522G|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1450										ovary(2)|liver(1)|skin(1)	4						CACATTTTTGCCCCTaaaaag	0.209													5	303	---	---	---	---	PASS
WDR43	23160	broad.mit.edu	37	2	29148007	29148007	+	Silent	SNP	T	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29148007T>G	uc002rmo.2	+	8	1106	c.1074T>G	c.(1072-1074)ACT>ACG	p.T358T	SNORD53_uc002rmq.1_5'Flank	NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	358						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TTCAGCCTACTATTGAGCGAG	0.413													12	39	---	---	---	---	PASS
XPO1	7514	broad.mit.edu	37	2	61705850	61705850	+	3'UTR	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61705850G>A	uc002sbj.2	-	25					XPO1_uc010fcl.2_3'UTR|XPO1_uc010ypn.1_3'UTR|XPO1_uc002sbk.2_3'UTR|XPO1_uc002sbg.2_3'UTR|XPO1_uc002sbh.2_3'UTR	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1						intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			GCCACTAGGTGACATTTTAAT	0.323													8	10	---	---	---	---	PASS
ARID5A	10865	broad.mit.edu	37	2	97216909	97216909	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97216909G>A	uc002swe.2	+	7	744	c.644G>A	c.(643-645)AGC>AAC	p.S215N	ARID5A_uc010yuq.1_Missense_Mutation_p.S163N|ARID5A_uc002swf.2_Missense_Mutation_p.S51N|ARID5A_uc002swg.2_Missense_Mutation_p.S163N	NM_212481	NP_997646	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A	215					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding				0						CCCAGGAACAGCACAGAACAG	0.587													4	155	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109382170	109382170	+	Silent	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109382170A>G	uc002tem.3	+	20	5301	c.5175A>G	c.(5173-5175)GAA>GAG	p.E1725E		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1725	RanBP2-type 7.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						CTAAGAAGGAAGGACAGTGGG	0.418													7	241	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164466420	164466420	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164466420C>A	uc002uck.1	-	3	2233	c.1922G>T	c.(1921-1923)CGG>CTG	p.R641L		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	641						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						GAAGTACCTCCGAAGGGATTC	0.433													4	236	---	---	---	---	PASS
PTH2R	5746	broad.mit.edu	37	2	209292995	209292995	+	Nonsense_Mutation	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209292995G>T	uc002vdb.2	+	2	358	c.145G>T	c.(145-147)GAA>TAA	p.E49*	PTH2R_uc010zjb.1_Nonsense_Mutation_p.E60*	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor	49	Extracellular (Potential).					integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		AGTACAATGTGAACTCAACAT	0.413													3	43	---	---	---	---	PASS
IKZF2	22807	broad.mit.edu	37	2	213886796	213886796	+	Silent	SNP	C	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213886796C>G	uc002vem.2	-	6	802	c.633G>C	c.(631-633)CTG>CTC	p.L211L	IKZF2_uc010fuu.2_Silent_p.L66L|IKZF2_uc002vej.2_Silent_p.L158L|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Silent_p.L185L|IKZF2_uc002vel.2_Silent_p.L132L|IKZF2_uc010fuw.2_5'UTR|IKZF2_uc010fux.2_5'UTR|IKZF2_uc010fuy.2_Intron|IKZF2_uc002ven.2_Silent_p.L185L	NM_016260	NP_057344	Q9UKS7	IKZF2_HUMAN	helios isoform 1	211	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		TGTGCTCCTCCAGTGAACTGC	0.507													6	122	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216236934	216236934	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216236934C>A	uc002vfa.2	-	40	6678	c.6412G>T	c.(6412-6414)GGG>TGG	p.G2138W	FN1_uc002vfb.2_Missense_Mutation_p.G1957W|FN1_uc002vfc.2_Missense_Mutation_p.G1932W|FN1_uc002vfd.2_Missense_Mutation_p.G2113W|FN1_uc002vfe.2_Missense_Mutation_p.G2047W|FN1_uc002vff.2_Missense_Mutation_p.G2022W|FN1_uc002vfg.2_Missense_Mutation_p.G1957W|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Missense_Mutation_p.G2138W|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_Missense_Mutation_p.G332W|FN1_uc010zjp.1_Missense_Mutation_p.G675W|FN1_uc002vfk.1_Intron|FN1_uc010fva.1_Intron|FN1_uc010fvb.1_Intron|FN1_uc010fvc.1_Intron|FN1_uc010fvd.1_Missense_Mutation_p.G229W	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	2047	Connecting strand 3 (CS-3) (V region).				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATTTGTTGCCCAACACTGGGT	0.532													4	145	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38949466	38949466	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38949466C>A	uc011ays.1	-	10	1646	c.1447G>T	c.(1447-1449)GAT>TAT	p.D483Y		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	483					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	TCATCAGAATCTGACCCAGGA	0.398													4	224	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140123402	140123402	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140123402C>T	uc003etn.2	+	4	621	c.431C>T	c.(430-432)GCC>GTC	p.A144V	CLSTN2_uc003etm.2_Missense_Mutation_p.A144V	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	144	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GGTCCCAGGGCCGTGGTCCAT	0.547										HNSCC(16;0.037)			21	91	---	---	---	---	PASS
IGF2BP2	10644	broad.mit.edu	37	3	185542687	185542687	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185542687T>C	uc003fpo.2	-	1	141	c.62A>G	c.(61-63)CAG>CGG	p.Q21R	IGF2BP2_uc003fpp.2_Missense_Mutation_p.Q21R|IGF2BP2_uc003fpq.2_Missense_Mutation_p.Q20R	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding	21	RRM 1.				anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CCCAAAGAGCTGCCGGAGGTC	0.622													3	14	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195481125	195481125	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195481125G>T	uc011bto.1	-	20	15363	c.14903C>A	c.(14902-14904)GCC>GAC	p.A4968D	MUC4_uc010hzq.2_5'Flank|MUC4_uc003fuz.2_Missense_Mutation_p.A694D|MUC4_uc003fva.2_Missense_Mutation_p.A576D|MUC4_uc003fvb.2_Missense_Mutation_p.A612D|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Missense_Mutation_p.A612D|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Missense_Mutation_p.A576D|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Missense_Mutation_p.A660D|MUC4_uc011bti.1_Missense_Mutation_p.A660D|MUC4_uc011btj.1_Missense_Mutation_p.A837D|MUC4_uc011btk.1_Missense_Mutation_p.A576D|MUC4_uc011btl.1_Missense_Mutation_p.A605D|MUC4_uc011btm.1_Missense_Mutation_p.A785D|MUC4_uc011btn.1_Missense_Mutation_p.A576D|MUC4_uc003fvo.2_Missense_Mutation_p.A860D|MUC4_uc003fvp.2_Missense_Mutation_p.A809D	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1853					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGAGGGCAGGCCTCGCAGCC	0.677													16	178	---	---	---	---	PASS
SLC2A9	56606	broad.mit.edu	37	4	9828095	9828095	+	Silent	SNP	T	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9828095T>G	uc003gmc.2	-	12	1610	c.1549A>C	c.(1549-1551)AGG>CGG	p.R517R	SLC2A9_uc003gmd.2_Silent_p.R488R	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein	517	Cytoplasmic (Potential).				glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3						GCTTTGTTCCTTTTGGAAAAT	0.428													6	316	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	74043162	74043162	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74043162C>A	uc003hgp.2	-	2	599	c.482G>T	c.(481-483)GGT>GTT	p.G161V	ANKRD17_uc003hgo.2_Missense_Mutation_p.G48V|ANKRD17_uc003hgq.2_Missense_Mutation_p.G161V|ANKRD17_uc003hgr.2_Missense_Mutation_p.G161V	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	161					interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAGGTCTGCACCATCAGCAGT	0.413													8	231	---	---	---	---	PASS
BMP2K	55589	broad.mit.edu	37	4	79747250	79747250	+	Silent	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79747250C>A	uc003hlk.2	+	2	404	c.238C>A	c.(238-240)CGA>AGA	p.R80R	BMP2K_uc010ijl.1_RNA|BMP2K_uc003hlj.2_Silent_p.R80R	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	80	Protein kinase.					nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						TGCATTGAAGCGAATGTATGT	0.363													4	238	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90872798	90872798	+	Missense_Mutation	SNP	G	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90872798G>C	uc003hst.2	+	7	3232	c.3161G>C	c.(3160-3162)GGC>GCC	p.G1054A	MMRN1_uc010iku.2_Missense_Mutation_p.G357A|MMRN1_uc011cds.1_Missense_Mutation_p.G796A	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	1054	EGF-like.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CAAAATGGGGGCACGTGCATA	0.423													31	81	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79026181	79026181	+	Silent	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79026181C>T	uc003kgc.2	+	2	1665	c.1593C>T	c.(1591-1593)ATC>ATT	p.I531I		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	531	Glu-rich.					perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAGAAGAGATCGTAGAACTTG	0.418													83	156	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82808055	82808055	+	Silent	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82808055C>T	uc003kii.3	+	6	1238	c.882C>T	c.(880-882)TGC>TGT	p.C294C	VCAN_uc003kij.3_Silent_p.C294C|VCAN_uc010jau.2_Silent_p.C294C|VCAN_uc003kik.3_Silent_p.C294C|VCAN_uc003kih.3_Silent_p.C294C	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	294	Link 2.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		TTGACCAGTGCGATTACGGGT	0.602													9	81	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140237390	140237390	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140237390C>T	uc003lhx.2	+	1	1757	c.1757C>T	c.(1756-1758)GCG>GTG	p.A586V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Missense_Mutation_p.A586V	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	586	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGGTGGTTGCGGGTCACGTG	0.657													13	28	---	---	---	---	PASS
ITK	3702	broad.mit.edu	37	5	156670752	156670752	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156670752C>T	uc003lwo.1	+	12	1262	c.1180C>T	c.(1180-1182)CGG>TGG	p.R394W		NM_005546	NP_005537	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	394	Protein kinase.				cellular defense response|intracellular signal transduction|T cell receptor signaling pathway	cytosol|plasma membrane	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(12)|ovary(8)|skin(4)|stomach(1)|central_nervous_system(1)	26	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAAAACCATTCGGGAAGGGGC	0.498			T	SYK	peripheral T-cell lymphoma								65	126	---	---	---	---	PASS
RIOK1	83732	broad.mit.edu	37	6	7405482	7405482	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7405482A>G	uc003mxn.2	+	12	1271	c.1097A>G	c.(1096-1098)GAT>GGT	p.D366G	RIOK1_uc003mxo.2_Missense_Mutation_p.D125G	NM_031480	NP_113668	Q9BRS2	RIOK1_HUMAN	RIO kinase 1 isoform 1	366	Protein kinase.						ATP binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|skin(1)	4	Ovarian(93;0.0418)					CTTCTGACAGATTTCTTTATG	0.363													32	79	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29910980	29910980	+	Intron	SNP	C	T	T	rs111625446	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29910980C>T	uc003nol.2	+						HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_Intron|HLA-A_uc010jrq.2_5'UTR|HLA-A_uc003nok.2_5'UTR|HLA-A_uc003non.2_Intron|HLA-A_uc003noo.2_Intron|HLA-A_uc010jrr.2_Intron|HLA-A_uc003nom.2_5'UTR|HLA-A_uc010klp.2_Intron|HLA-A_uc011dmc.1_5'UTR|HLA-A_uc011dmd.1_5'Flank	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GGCCAAAAATCCCCCCGGGTT	0.667									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			3	4	---	---	---	---	PASS
HLA-DQB2	3120	broad.mit.edu	37	6	32726626	32726626	+	Splice_Site	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32726626C>T	uc003oby.3	-	3	729	c.646_splice	c.e3+1	p.R216_splice	HLA-DQB2_uc003obz.2_Splice_Site_p.R216_splice	NR_003937		Q5SR06	Q5SR06_HUMAN	SubName: Full=Major histocompatibility complex, class II, DQ beta 2; SubName: Full=Putative uncharacterized protein ENSP00000372579;						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	integral to membrane|MHC class II protein complex					0						TTTCCCCTTACGCCACTCCAC	0.562													23	66	---	---	---	---	PASS
TRAF3IP2	10758	broad.mit.edu	37	6	111912533	111912533	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111912533G>T	uc011ebc.1	-	3	1372	c.757C>A	c.(757-759)CCC>ACC	p.P253T	TRAF3IP2_uc003pvg.2_Missense_Mutation_p.P253T|TRAF3IP2_uc003pvf.2_Missense_Mutation_p.P253T|TRAF3IP2_uc010kdw.2_Missense_Mutation_p.P253T|TRAF3IP2_uc010kdx.2_Missense_Mutation_p.P253T	NM_147686	NP_679211	O43734	CIKS_HUMAN	TRAF3 interacting protein 2 isoform 2	262					intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular				ovary(2)|central_nervous_system(1)	3		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		GAAAGATTGGGAGGCAGCATC	0.537													31	48	---	---	---	---	PASS
NPC1L1	29881	broad.mit.edu	37	7	44561339	44561339	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44561339A>C	uc003tlb.2	-	12	2981	c.2925T>G	c.(2923-2925)AAT>AAG	p.N975K	NPC1L1_uc003tlc.2_Missense_Mutation_p.N975K|NPC1L1_uc011kbw.1_Missense_Mutation_p.N929K|NPC1L1_uc003tla.2_5'Flank	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	975	Cytoplasmic (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	ACTTGTCCTTATTGGGGCCAG	0.577													3	110	---	---	---	---	PASS
SLC25A13	10165	broad.mit.edu	37	7	95750981	95750981	+	Silent	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95750981A>G	uc003uof.3	-	17	2018	c.1827T>C	c.(1825-1827)ATT>ATC	p.I609I	SLC25A13_uc003uog.3_Silent_p.I610I|SLC25A13_uc011kik.1_Silent_p.I501I	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2	609					ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	CTCCAAAATCAATGTAGAACC	0.413													79	244	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100684772	100684772	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100684772A>G	uc003uxp.1	+	3	10128	c.10075A>G	c.(10075-10077)ACC>GCC	p.T3359A	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3359	Extracellular (Potential).|54.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TGAGGCTAGCACCCTTTCCAC	0.488													123	436	---	---	---	---	PASS
PRSS1	5644	broad.mit.edu	37	7	142458719	142458719	+	Intron	SNP	G	A	A	rs146805541	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142458719G>A	uc003wak.2	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_Missense_Mutation_p.V94M|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein						digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			AGAGCAGAGAGTGAACACAAG	0.527									Hereditary_Pancreatitis				3	15	---	---	---	---	PASS
TNFRSF10A	8797	broad.mit.edu	37	8	23056931	23056931	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23056931C>A	uc003xda.2	-	8	927	c.862G>T	c.(862-864)GGG>TGG	p.G288W		NM_003844	NP_003835	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily,	288	Cytoplasmic (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors		caspase activator activity|death receptor activity|TRAIL binding|transcription factor binding			central_nervous_system(3)|ovary(2)|skin(1)	6		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		GCCCCAGGCCCTCGTAGGAGA	0.602													4	90	---	---	---	---	PASS
EXT1	2131	broad.mit.edu	37	8	118812096	118812096	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118812096G>T	uc003yok.1	-	11	2869	c.2096C>A	c.(2095-2097)GCC>GAC	p.A699D		NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1	699	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CTGTCGCTGGGCAAAGTGGTC	0.527			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				3	112	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121976298	121976298	+	Missense_Mutation	SNP	G	A	A	rs148052034	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121976298G>A	uc004bkc.2	-	6	1277	c.821C>T	c.(820-822)CCG>CTG	p.P274L	DBC1_uc004bkd.2_Missense_Mutation_p.P274L	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	274					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GTTGCACTGCGGAAACTCCTC	0.547													34	113	---	---	---	---	PASS
KLF6	1316	broad.mit.edu	37	10	3827277	3827277	+	5'UTR	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3827277G>T	uc001iha.2	-	1					KLF6_uc010qaj.1_5'UTR|KLF6_uc010qak.1_RNA|KLF6_uc010qal.1_5'UTR|KLF6_uc001ihb.2_5'UTR	NM_001300	NP_001291	Q99612	KLF6_HUMAN	Kruppel-like factor 6 isoform A						B cell differentiation	nucleus	zinc ion binding			central_nervous_system(3)|lung(1)	4				Colorectal(1;0.238)		GGAGCCGAAAGTCTCCCCGGA	0.706													2	7	---	---	---	---	PASS
CACNB2	783	broad.mit.edu	37	10	18828621	18828621	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18828621G>A	uc001ipr.2	+	14	2011	c.1951G>A	c.(1951-1953)GAG>AAG	p.E651K	CACNB2_uc009xjz.1_Missense_Mutation_p.E401K|CACNB2_uc001ips.2_Missense_Mutation_p.E627K|CACNB2_uc001ipt.2_Missense_Mutation_p.E613K|CACNB2_uc001ipu.2_Missense_Mutation_p.E623K|CACNB2_uc001ipv.2_Missense_Mutation_p.E599K|CACNB2_uc009xka.1_Missense_Mutation_p.E585K|CACNB2_uc001ipw.2_Missense_Mutation_p.E558K|CACNB2_uc001ipx.2_Missense_Mutation_p.E596K|CACNB2_uc001ipz.2_Missense_Mutation_p.E573K|CACNB2_uc001ipy.2_Missense_Mutation_p.E597K|CACNB2_uc010qco.1_Missense_Mutation_p.E565K|CACNB2_uc001iqa.2_Missense_Mutation_p.E603K|NSUN6_uc001iqb.2_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2	651					axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TGAGGCTGGGGAGTGGAACAG	0.423													9	120	---	---	---	---	PASS
SNCG	6623	broad.mit.edu	37	10	88718334	88718334	+	5'UTR	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88718334G>T	uc001keb.2	+	1					MMRN2_uc001kea.2_5'Flank|MMRN2_uc010qmn.1_5'Flank|MMRN2_uc009xtb.2_5'Flank	NM_003087	NP_003078	O76070	SYUG_HUMAN	synuclein, gamma (breast cancer-specific protein							microtubule organizing center|perinuclear region of cytoplasm|spindle	protein binding				0						ATATTTCATCGGCGTCAATAG	0.572													2	4	---	---	---	---	PASS
PNLIPRP1	5407	broad.mit.edu	37	10	118357365	118357365	+	Silent	SNP	C	T	T	rs113515929	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118357365C>T	uc001lco.1	+	7	618	c.600C>T	c.(598-600)TTC>TTT	p.F200F	PNLIPRP1_uc001lcp.2_Silent_p.F200F|PNLIPRP1_uc009xys.1_RNA	NM_006229	NP_006220	P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1 precursor	200					lipid metabolic process		calcium ion binding|triglyceride lipase activity			ovary(1)|breast(1)	2				all cancers(201;0.0161)		AAGCAAGTTTCGAGAGTACTC	0.458													43	119	---	---	---	---	PASS
TMEM9B	56674	broad.mit.edu	37	11	8969885	8969885	+	Silent	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8969885C>T	uc001mhe.1	-	5	708	c.579G>A	c.(577-579)CGG>CGA	p.R193R	TMEM9B_uc001mhf.1_Silent_p.R119R|TMEM9B_uc010rbt.1_Silent_p.R119R	NM_020644	NP_065695	Q9NQ34	TMM9B_HUMAN	TMEM9 domain family, member B precursor	193					positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity				0				Epithelial(150;4.39e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0237)		GGACAACATGCCGGTCAAAGA	0.488													4	235	---	---	---	---	PASS
OR5I1	10798	broad.mit.edu	37	11	55703643	55703643	+	Missense_Mutation	SNP	G	T	T	rs144543203		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55703643G>T	uc010ris.1	-	1	234	c.234C>A	c.(232-234)GAC>GAA	p.D78E		NM_006637	NP_006628	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I,	78	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TGGGAACAATGTCTGAGAAAT	0.383													4	104	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108031665	108031665	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108031665C>T	uc001pjz.3	-	17	4250	c.4148G>A	c.(4147-4149)CGT>CAT	p.R1383H	NPAT_uc010rvv.1_Missense_Mutation_p.R439H	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	1383					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ACTAGAAGGACGAGAGTTTCG	0.333													28	89	---	---	---	---	PASS
OR8D2	283160	broad.mit.edu	37	11	124190086	124190086	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124190086G>T	uc010sah.1	-	1	8	c.8C>A	c.(7-9)ACT>AAT	p.T3N		NM_001002918	NP_001002918	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D,	3	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)|central_nervous_system(1)|pancreas(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		ATGGTTTGAAGTAGCCATGTC	0.408													10	111	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124756546	124756546	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124756546C>T	uc001qbg.2	-	16	2748	c.2608G>A	c.(2608-2610)GAG>AAG	p.E870K	ROBO4_uc010sas.1_Missense_Mutation_p.E725K|ROBO4_uc001qbh.2_3'UTR|ROBO4_uc001qbi.2_Missense_Mutation_p.E428K	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	870					angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		AAGGAGCCCTCGCTGGGGGTG	0.667													14	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92920	92920	+	Missense_Mutation	SNP	C	G	G	rs145563795	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92920C>G	uc010sdi.1	-	1	99	c.71G>C	c.(70-72)AGT>ACT	p.S24T	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		ACTCACAAGACTGTGATCCAA	0.622													4	13	---	---	---	---	PASS
ATP2B1	490	broad.mit.edu	37	12	90020309	90020309	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90020309T>C	uc001tbh.2	-	7	1232	c.1051A>G	c.(1051-1053)AAA>GAA	p.K351E	ATP2B1_uc001tbg.2_Missense_Mutation_p.K351E|ATP2B1_uc001tbf.2_Missense_Mutation_p.K21E	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	351	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						AAATTTGCTTTCTTTTTATCT	0.373													21	190	---	---	---	---	PASS
GNPTAB	79158	broad.mit.edu	37	12	102158763	102158763	+	Silent	SNP	T	C	C	rs10778148	byFrequency	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102158763T>C	uc001tit.2	-	13	2111	c.1932A>G	c.(1930-1932)ACA>ACG	p.T644T		NM_024312	NP_077288	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase	644					cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)|skin(1)	2						CCTTCTGGGCTGTAGAATTCA	0.403													6	350	---	---	---	---	PASS
UBC	7316	broad.mit.edu	37	12	125396377	125396377	+	Silent	SNP	A	G	G	rs16918544	byFrequency	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125396377A>G	uc001ugs.3	-	2	2389	c.1941T>C	c.(1939-1941)GAT>GAC	p.D647D	UBC_uc001ugr.2_RNA|UBC_uc001ugu.1_Silent_p.D571D|UBC_uc001ugt.2_Silent_p.D495D|UBC_uc001ugv.2_Silent_p.D115D	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	647	Ubiquitin-like 9.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		ACCTCTGCTGATCAGGAGGGA	0.527													7	484	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33252986	33252986	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33252986A>G	uc010abf.2	+	10	1135	c.977A>G	c.(976-978)CAT>CGT	p.H326R	PDS5B_uc001uuo.2_Missense_Mutation_p.H326R|PDS5B_uc010abg.2_RNA|PDS5B_uc010teb.1_Missense_Mutation_p.H28R	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	326				H -> N (in Ref. 8; AAH39256).	cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AATGATATCCATGTACCAATC	0.333													17	84	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21871248	21871248	+	Silent	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21871248A>G	uc001was.1	-	18	2899	c.2805T>C	c.(2803-2805)CTT>CTC	p.L935L	CHD8_uc001war.1_Silent_p.L831L|CHD8_uc001wav.1_Silent_p.L377L	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1214	Helicase C-terminal.				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GATTAATACCAAGTCCACCAG	0.483													3	89	---	---	---	---	PASS
MIR329-2	574409	broad.mit.edu	37	14	101493478	101493478	+	RNA	SNP	T	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101493478T>A	hsa-mir-329-2|MI0001726	+			c.42T>A			MIR494_hsa-mir-494|MI0003134_5'Flank|uc010txm.1_5'Flank|hsa-mir-1193|MI0014205_5'Flank																	0						TGTTTCTTTATTGAGGACGAA	0.478													5	276	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	29084045	29084045	+	RNA	SNP	T	G	G	rs75345913	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29084045T>G	uc001zcj.2	+	3		c.396T>G								Homo sapiens, Similar to hect domain and RLD 2, clone IMAGE:4581928, mRNA.																		TTATTCGTATTTTTTGGTAAC	0.229													3	11	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42602622	42602622	+	Silent	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42602622G>A	uc001zpi.2	+	9	1178	c.864G>A	c.(862-864)TCG>TCA	p.S288S	GANC_uc001zph.2_Silent_p.S288S|GANC_uc001zpj.1_Silent_p.S27S	NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	288					carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		TGAATGCCTCGGAAACACTGG	0.418													36	70	---	---	---	---	PASS
CPEB1	64506	broad.mit.edu	37	15	83240325	83240325	+	Intron	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83240325C>T	uc002bit.2	-						CPEB1_uc002biq.2_Intron|CPEB1_uc002bir.2_Intron|CPEB1_uc002bis.2_5'UTR|CPEB1_uc010uod.1_Intron|CPEB1_uc010uoe.1_Intron|CPEB1_uc002biu.2_Intron|CPEB1_uc010uof.1_Intron|CPEB1_uc002biv.2_Intron	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			GAGTTAAGGGCTGTTTTCCCC	0.468													20	64	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100333090	100333090	+	RNA	SNP	T	C	C	rs115410867	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100333090T>C	uc010urx.1	-	5		c.1102A>G			C15orf51_uc010ury.1_RNA	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						GCCATTCTTTTGCTGGGCTTG	0.478													5	196	---	---	---	---	PASS
TPSB2	64499	broad.mit.edu	37	16	1278478	1278478	+	3'UTR	SNP	T	C	C	rs11548897	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1278478T>C	uc002cky.2	-	7					TPSB2_uc010brk.1_Intron|TPSB2_uc002ckx.2_3'UTR	NM_024164	NP_077078	P20231	TRYB2_HUMAN	tryptase beta 2 precursor						proteolysis	extracellular region	protein binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				GGAAGGGTCCTCAGGACAGGG	0.697													3	6	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24373178	24373178	+	Silent	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24373178C>T	uc002dmf.2	+	4	2142	c.942C>T	c.(940-942)CCC>CCT	p.P314P		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	314					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		GCACCACGCCCGTCTGAACTG	0.552													27	72	---	---	---	---	PASS
ZKSCAN2	342357	broad.mit.edu	37	16	25251248	25251248	+	Silent	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25251248G>T	uc002dod.3	-	7	3200	c.2793C>A	c.(2791-2793)ACC>ACA	p.T931T	ZKSCAN2_uc010vcl.1_Silent_p.T727T	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	931	C2H2-type 6.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		CCCGATGTTTGGTAAGAACAG	0.463													4	195	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70065826	70065826	+	Intron	SNP	T	C	C	rs3169319	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70065826T>C	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						GATCCAAACATAGTGTTACAG	0.453													3	167	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													3	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268158	70268158	+	RNA	SNP	A	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268158A>C	uc010cfp.1	-	3		c.257T>G								Homo sapiens cDNA, FLJ98908.																		TTCTTCATTAAAACAGCTACT	0.333													3	10	---	---	---	---	PASS
OSGIN1	29948	broad.mit.edu	37	16	83998851	83998851	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83998851T>C	uc002fha.2	+	7	1305	c.922T>C	c.(922-924)TTC>CTC	p.F308L	OSGIN1_uc002fhb.2_Missense_Mutation_p.F225L|OSGIN1_uc002fhc.2_Missense_Mutation_p.F225L	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	308					cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						GGTGAGCGGCTTCCTGACCAG	0.692													21	69	---	---	---	---	PASS
VPS53	55275	broad.mit.edu	37	17	465950	465950	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:465950T>C	uc002frn.2	-	14	1496	c.1349A>G	c.(1348-1350)GAT>GGT	p.D450G	VPS53_uc002frk.2_5'UTR|VPS53_uc010cjo.1_Missense_Mutation_p.D450G|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.D421G|VPS53_uc002fro.2_Missense_Mutation_p.D252G|VPS53_uc010cjp.1_Missense_Mutation_p.D173G	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2	450					protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		GGCTTTGAAATCAGCCACAAA	0.478													9	53	---	---	---	---	PASS
FXR2	9513	broad.mit.edu	37	17	7495581	7495581	+	Silent	SNP	T	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7495581T>C	uc002gia.1	-	16	2144	c.1917A>G	c.(1915-1917)TCA>TCG	p.S639S	MPDU1_uc010vuc.1_Intron|SOX15_uc002ghy.1_5'Flank|SOX15_uc002ghz.1_5'Flank	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related	639						cytosolic large ribosomal subunit	protein binding|RNA binding				0				READ - Rectum adenocarcinoma(115;0.17)		CCTTCTGTCCTGAAAGAGAGT	0.507													3	144	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	A	A	rs28934574		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577094G>A	uc002gim.2	-	8	1038	c.844C>T	c.(844-846)CGG>TGG	p.R282W	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R282W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R150W|TP53_uc010cng.1_Missense_Mutation_p.R150W|TP53_uc002gii.1_Missense_Mutation_p.R150W|TP53_uc010cnh.1_Missense_Mutation_p.R282W|TP53_uc010cni.1_Missense_Mutation_p.R282W|TP53_uc002gij.2_Missense_Mutation_p.R282W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGTGCGCCGGTCTCTCCCA	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			24	38	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904125	21904125	+	RNA	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904125G>A	uc002gza.2	+	1		c.64G>A				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						ggagtcgcaaggggccgagca	0.000													3	63	---	---	---	---	PASS
KRT40	125115	broad.mit.edu	37	17	39135205	39135205	+	Silent	SNP	A	G	G	rs8064910	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39135205A>G	uc010cxh.1	-	8	1208	c.1047T>C	c.(1045-1047)TGT>TGC	p.C349C	KRT40_uc002hvq.1_RNA	NM_182497	NP_872303	Q6A162	K1C40_HUMAN	type I hair keratin KA36	349	Rod.|Coil 2.			C -> R (in Ref. 1; CAH10353).		intermediate filament	structural molecule activity				0		Breast(137;0.00043)				TATCGATCAGACACTGAATTT	0.527													4	222	---	---	---	---	PASS
STAT5B	6777	broad.mit.edu	37	17	40362212	40362212	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40362212G>A	uc002hzh.2	-	15	2052	c.1883C>T	c.(1882-1884)ACC>ATC	p.T628I		NM_012448	NP_036580	P51692	STA5B_HUMAN	signal transducer and activator of transcription	628	SH2.				2-oxoglutarate metabolic process|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|fatty acid metabolic process|isoleucine metabolic process|JAK-STAT cascade involved in growth hormone signaling pathway|oxaloacetate metabolic process|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cytosol|nucleoplasm	calcium ion binding|glucocorticoid receptor binding|sequence-specific DNA binding transcription factor activity			ovary(3)|lung(2)|skin(1)	6		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	CCAAGCAATGGTGATGCCGCC	0.428													3	86	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	45128671	45128671	+	5'Flank	SNP	T	G	G	rs1056072	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45128671T>G	uc010wkl.1	-						uc010wkm.1_RNA					Homo sapiens cDNA FLJ38031 fis, clone CTONG2013348.																		GCTCACAAAATAAGTTCCAGG	0.308													4	170	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	45128812	45128812	+	5'Flank	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45128812C>T	uc010wkl.1	-						uc010wkm.1_RNA					Homo sapiens cDNA FLJ38031 fis, clone CTONG2013348.																		AGTCCTGTTTCTGTGTGGATT	0.373													4	66	---	---	---	---	PASS
GGA3	23163	broad.mit.edu	37	17	73235138	73235138	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73235138C>T	uc002jni.1	-	15	1816	c.1807G>A	c.(1807-1809)GAT>AAT	p.D603N	GGA3_uc002jnj.1_Missense_Mutation_p.D570N|GGA3_uc010wrw.1_Missense_Mutation_p.D481N|GGA3_uc002jnk.1_Missense_Mutation_p.D531N|GGA3_uc010wrx.1_Missense_Mutation_p.D481N|GGA3_uc010wry.1_Missense_Mutation_p.D531N	NM_138619	NP_619525	Q9NZ52	GGA3_HUMAN	ADP-ribosylation factor binding protein 3	603	GAE.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|breast(1)	2			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			CCGTTTTTATCGTAGGCTGTC	0.592											OREG0024729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	27	---	---	---	---	PASS
TRIM65	201292	broad.mit.edu	37	17	73887232	73887232	+	Silent	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73887232C>T	uc002jpx.2	-	6	1218	c.1182G>A	c.(1180-1182)TCG>TCA	p.S394S		NM_173547	NP_775818	Q6PJ69	TRI65_HUMAN	tripartite motif-containing 65	394	B30.2/SPRY.					intracellular	zinc ion binding				0			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCAGTGTCACCGAGTGGTCTG	0.692													4	88	---	---	---	---	PASS
GIPC3	126326	broad.mit.edu	37	19	3589510	3589510	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3589510C>A	uc002lyd.3	+	4	689	c.662C>A	c.(661-663)ACC>AAC	p.T221N		NM_133261	NP_573568	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	221										breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAGGGAGACCCTGCGGCTT	0.393													10	81	---	---	---	---	PASS
SAFB2	9667	broad.mit.edu	37	19	5598870	5598870	+	Silent	SNP	G	A	A	rs149716077		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5598870G>A	uc002mcd.2	-	13	1928	c.1716C>T	c.(1714-1716)GTC>GTT	p.V572V		NM_014649	NP_055464	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	572					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		TATCCATCACGACCGTCCGCT	0.507													30	75	---	---	---	---	PASS
ACSBG2	81616	broad.mit.edu	37	19	6190823	6190823	+	Intron	SNP	T	C	C	rs35121049		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6190823T>C	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron|uc002mej.1_RNA	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						cacacatacatacacacacac	0.348													4	5	---	---	---	---	PASS
CLEC4M	10332	broad.mit.edu	37	19	7830869	7830869	+	Missense_Mutation	SNP	G	A	A	rs28413926	byFrequency	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7830869G>A	uc002mih.2	+	5	609	c.491G>A	c.(490-492)CGG>CAG	p.R164Q	CLEC4M_uc010xjv.1_Missense_Mutation_p.R159Q|CLEC4M_uc002mhy.2_Missense_Mutation_p.R131Q|CLEC4M_uc010xjw.1_Missense_Mutation_p.G166E|CLEC4M_uc010dvt.2_Intron|CLEC4M_uc010dvs.2_Missense_Mutation_p.R163Q|CLEC4M_uc010xjx.1_Missense_Mutation_p.R136Q|CLEC4M_uc002mhz.2_Intron|CLEC4M_uc002mic.2_Missense_Mutation_p.R159Q|CLEC4M_uc002mia.2_Intron	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	164	Extracellular (Probable).|7 X approximate tandem repeats.|3.				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						GAGCTGACCCGGCTGAAGGCT	0.582													8	143	---	---	---	---	PASS
OR7G3	390883	broad.mit.edu	37	19	9237435	9237435	+	Silent	SNP	A	G	G	rs10407484	byFrequency	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9237435A>G	uc010xkl.1	-	1	192	c.192T>C	c.(190-192)TCT>TCC	p.S64S		NM_001001958	NP_001001958	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AGGACAGGATAGAGAGGAGGA	0.552													3	189	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19338359	19338359	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19338359C>G	uc002nlz.2	+	8	2029	c.1930C>G	c.(1930-1932)CTA>GTA	p.L644V	NCAN_uc010ecc.1_Missense_Mutation_p.L208V	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	644					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			AGAGTGGATGCTACCACACCC	0.637													7	76	---	---	---	---	PASS
ZNF181	339318	broad.mit.edu	37	19	35232275	35232275	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35232275T>C	uc002nvu.3	+	4	1452	c.989T>C	c.(988-990)TTT>TCT	p.F330S	ZNF181_uc010xsa.1_Missense_Mutation_p.F329S|ZNF181_uc010xsb.1_Missense_Mutation_p.F329S|ZNF181_uc010xsc.1_Missense_Mutation_p.F265S	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	330	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GGAAAGTCTTTTAGTCGTGTG	0.398													3	168	---	---	---	---	PASS
ZNF181	339318	broad.mit.edu	37	19	35232279	35232279	+	Missense_Mutation	SNP	T	G	G	rs150124360		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35232279T>G	uc002nvu.3	+	4	1456	c.993T>G	c.(991-993)AGT>AGG	p.S331R	ZNF181_uc010xsa.1_Missense_Mutation_p.S330R|ZNF181_uc010xsb.1_Missense_Mutation_p.S330R|ZNF181_uc010xsc.1_Missense_Mutation_p.S266R	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	331	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			AGTCTTTTAGTCGTGTGTCCC	0.403													3	169	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533115	41533115	+	Intron	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533115C>T	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CACAGCACCACGACCCGCCGG	0.642													19	82	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891217	44891217	+	Missense_Mutation	SNP	T	C	C	rs144198432	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891217T>C	uc002ozd.3	-	4	1277	c.1190A>G	c.(1189-1191)GAG>GGG	p.E397G	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Missense_Mutation_p.E404G	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	397					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						GTAGGGCTTCTCTCCAGTGTG	0.483													5	123	---	---	---	---	PASS
TRAPPC6A	79090	broad.mit.edu	37	19	45668125	45668125	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45668125G>A	uc002paw.2	-	3	275	c.256C>T	c.(256-258)CGC>TGC	p.R86C	TRAPPC6A_uc002pav.2_Missense_Mutation_p.R100C			O75865	TPC6A_HUMAN	SubName: Full=TRAPPC6Adelta29-42; SubName: Full=Trafficking protein particle complex 6A, isoform CRA_a;	86					vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus	guanylate cyclase activity|heme binding				0		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00872)|GBM - Glioblastoma multiforme(486;0.233)		TGATTGGTGCGCAGGCTGTCC	0.647													4	158	---	---	---	---	PASS
NOP56	10528	broad.mit.edu	37	20	2633296	2633296	+	5'UTR	SNP	G	C	C	rs6138678	byFrequency	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2633296G>C	uc002wgh.2	+	1					NOP56_uc010zpy.1_RNA|MIR1292_hsa-mir-1292|MI0006433_5'Flank|NOP56_uc002wgi.2_5'Flank|SNORD110_uc002wgj.2_5'Flank|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A						rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						CCGAACCCGGGAGCTGGCGCC	0.687													3	2	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43851631	43851631	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43851631C>A	uc010ggz.2	+	2	1415	c.1358C>A	c.(1357-1359)CCT>CAT	p.P453H	SEMG2_uc002xnk.2_Missense_Mutation_p.P453H|SEMG2_uc002xnl.2_Intron	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	453	Repeat-rich region.|4 X 60 AA tandem repeats, type I.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				GTAACAATTCCTAGTCAAGAT	0.393													5	127	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47864642	47864642	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47864642A>G	uc002xui.2	-	14	5166	c.4919T>C	c.(4918-4920)CTA>CCA	p.L1640P		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1640							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AATCTCTTCTAGCCGCTGTTT	0.507													42	82	---	---	---	---	PASS
H1F0	3005	broad.mit.edu	37	22	38201489	38201489	+	5'UTR	SNP	C	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38201489C>T	uc003aty.2	+	1					GCAT_uc003atz.2_5'Flank|GCAT_uc003aua.1_5'Flank	NM_005318	NP_005309	P07305	H10_HUMAN	H1 histone family, member 0						DNA fragmentation involved in apoptotic nuclear change|nucleosome assembly	actin cytoskeleton|Golgi apparatus|nucleoplasm|nucleosome	DNA binding				0	Melanoma(58;0.045)					AGGCTTTGCTCAGCCTCCGAC	0.667													12	20	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50546788	50546788	+	Intron	SNP	G	C	C	rs138215	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50546788G>C	uc003bjj.2	+						MOV10L1_uc003bjk.3_Intron|MOV10L1_uc011arp.1_Intron|MOV10L1_uc010han.2_Missense_Mutation_p.K202N	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1						germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GAAAAATAAAGCTTTGTCATG	0.478													6	7	---	---	---	---	PASS
SHOX	6473	broad.mit.edu	37	X	601572	601572	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:601572G>A	uc004cph.1	+	4	1194	c.503G>A	c.(502-504)CGG>CAG	p.R168Q	SHOX_uc004cpi.2_Missense_Mutation_p.R168Q	NM_000451	NP_000442	O15266	SHOX_HUMAN	short stature homeobox isoform SHOXa	168	Homeobox.		R -> W (in LMD).		skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTCCAGAACCGGAGAGCCAAG	0.592													45	137	---	---	---	---	PASS
ZBED1	9189	broad.mit.edu	37	X	2407936	2407936	+	Silent	SNP	G	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2407936G>A	uc004cqg.2	-	2	1026	c.825C>T	c.(823-825)ATC>ATT	p.I275I	DHRSX_uc004cqf.3_Intron|ZBED1_uc004cqh.1_Silent_p.I275I	NM_004729	NP_004720	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	275						nuclear chromosome	DNA binding|metal ion binding|protein dimerization activity|transposase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACGCCTTCACGATGTCCTTGC	0.627													72	189	---	---	---	---	PASS
CCDC22	28952	broad.mit.edu	37	X	49099406	49099406	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49099406C>A	uc004dnd.1	+	4	572	c.416C>A	c.(415-417)GCA>GAA	p.A139E	CCDC22_uc011mna.1_Missense_Mutation_p.A139E|CCDC22_uc004dnc.1_RNA	NM_014008	NP_054727	O60826	CCD22_HUMAN	coiled-coil domain containing 22	139										central_nervous_system(1)	1						GACCAGCTGGCACTGCCTTGG	0.587													4	5	---	---	---	---	PASS
MID2	11043	broad.mit.edu	37	X	107159358	107159358	+	Silent	SNP	A	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107159358A>G	uc004enl.2	+	6	1773	c.1200A>G	c.(1198-1200)ACA>ACG	p.T400T	MID2_uc004enk.2_Silent_p.T400T	NM_012216	NP_036348	Q9UJV3	TRIM1_HUMAN	midline 2 isoform 1	400	Fibronectin type-III.					centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1						ATTATTTAACAGGTGTGAAAA	0.254													3	196	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144337274	144337274	+	Silent	SNP	G	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337274G>T	uc004fcb.2	+	2	159	c.159G>T	c.(157-159)GCG>GCT	p.A53A		NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein	53											0	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTATTAGCGTTTTGCTACA	0.433													3	123	---	---	---	---	PASS
HPCAL4	51440	broad.mit.edu	37	1	40149991	40149992	+	Intron	DEL	CC	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40149991_40149992delCC	uc001cdr.2	-						HPCAL4_uc010oix.1_Intron	NM_016257	NP_057341	Q9UM19	HPCL4_HUMAN	hippocalcin-like protein 4						central nervous system development	intracellular	calcium ion binding			central_nervous_system(1)	1	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGCCTCGCCTCCCCTCCCACCC	0.757													5	3	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45323200	45323200	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45323200delA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					tgaaactccgaaaaaaaaaaa	0.000													5	4	---	---	---	---	
CNST	163882	broad.mit.edu	37	1	246797064	246797064	+	Intron	DEL	G	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246797064delG	uc001ibp.2	+						CNST_uc001ibo.3_Intron	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0						aaaaaaaaaagagagaaaCAT	0.124													4	2	---	---	---	---	
SNRNP27	11017	broad.mit.edu	37	2	70123808	70123809	+	Intron	INS	-	T	T	rs71397375		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70123808_70123809insT	uc002sfw.2	+						SNRNP27_uc002sfv.2_Intron|SNRNP27_uc002sfx.2_Intron	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa						mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						Gttttttttggttttttttttt	0.109													4	3	---	---	---	---	
ATG16L1	55054	broad.mit.edu	37	2	234199232	234199232	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234199232delA	uc002vty.2	+						ATG16L1_uc002vtx.1_Intron|ATG16L1_uc002vua.2_Intron|ATG16L1_uc002vub.2_Intron|ATG16L1_uc002vtz.2_Intron|ATG16L1_uc002vud.3_Intron	NM_030803	NP_110430	Q676U5	A16L1_HUMAN	APG16 autophagy 16-like isoform 1						autophagic vacuole assembly|protein homooligomerization|protein transport	autophagic vacuole|pre-autophagosomal structure membrane	protein binding				0		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		ggcaggtaagaaaaggcaaac	0.154													4	6	---	---	---	---	
EPHA3	2042	broad.mit.edu	37	3	89448278	89448278	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89448278delA	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		gactttgtctaaaaaaaaaaa	0.109										TSP Lung(6;0.00050)			6	3	---	---	---	---	
KIAA1524	57650	broad.mit.edu	37	3	108300478	108300479	+	Intron	INS	-	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108300478_108300479insA	uc003dxb.3	-						KIAA1524_uc003dxc.1_Intron|KIAA1524_uc010hpw.1_Intron	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen							cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						CTTTTACACGCAAAAAAAAAAA	0.243													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													5	3	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6925986	6925990	+	Intron	DEL	AATCC	-	-	rs57881179		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6925986_6925990delAATCC	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						AGAAGCCCGGAATCCTGTGGGATTG	0.512													3	3	---	---	---	---	
ALB	213	broad.mit.edu	37	4	74270303	74270303	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74270303delA	uc003hgs.3	+						ALB_uc003hgw.3_Intron|ALB_uc011cbe.1_Intron|ALB_uc003hgt.3_Intron|ALB_uc010iii.2_Intron|ALB_uc003hgu.3_Intron|ALB_uc003hgv.3_Intron|ALB_uc011cbf.1_5'Flank	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein						bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	CATCCTAGGTAAAAAAAAAAA	0.279													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	118496039	118496040	+	IGR	INS	-	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118496039_118496040insA								TRAM1L1 (489303 upstream) : NDST3 (458733 downstream)																							TCTTTTTTTTTAATGGGTTAGA	0.342													4	2	---	---	---	---	
SCLT1	132320	broad.mit.edu	37	4	129869491	129869491	+	Intron	DEL	A	-	-	rs145196324		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129869491delA	uc003igp.2	-						SCLT1_uc003ign.2_Intron|SCLT1_uc003igo.2_Intron|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						actccattgcaaaaaaaaaaa	0.124													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	154050679	154050681	+	IGR	DEL	CAC	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154050679_154050681delCAC								FHDC1 (149831 upstream) : TRIM2 (23589 downstream)																							ccaccaccatcaccaccatcacc	0.000													5	3	---	---	---	---	
IRF2	3660	broad.mit.edu	37	4	185340707	185340707	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185340707delG	uc003iwf.3	-	3	303	c.103delC	c.(103-105)CAGfs	p.Q35fs		NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2	35	IRF tryptophan pentad repeat.				blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		CAGGGGATCTGAAAAATCTTC	0.423													73	24	---	---	---	---	
GABRB2	2561	broad.mit.edu	37	5	160972444	160972444	+	Intron	DEL	A	-	-	rs150641635		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160972444delA	uc003lys.1	-						GABRB2_uc011deh.1_Intron|GABRB2_uc003lyr.1_Intron|GABRB2_uc003lyt.1_Intron|GABRB2_uc010jiu.1_Intron|GABRB2_uc011dei.1_Intron	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	tttttttgttaaaaaaaaaaa	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180699084	180699085	+	RNA	INS	-	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180699084_180699085insA	uc003mnq.2	+	3		c.448_449insA								Homo sapiens cDNA clone IMAGE:3910094, partial cds.																		GGCTTTCCATCAGAAAAAAAAA	0.411													4	2	---	---	---	---	
LOC100132354	100132354	broad.mit.edu	37	6	43872656	43872659	+	Intron	DEL	TTCC	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43872656_43872659delTTCC	uc011dvm.1	+							NR_024478				Homo sapiens cDNA FLJ38229 fis, clone FCBBF2004256.												0						Attccttcctttccttccttcctt	0.240													4	3	---	---	---	---	
IL17F	112744	broad.mit.edu	37	6	52109409	52109409	+	5'Flank	DEL	T	-	-	rs3215541		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52109409delT	uc003pam.1	-							NM_052872	NP_443104	Q96PD4	IL17F_HUMAN	interleukin 17F precursor						cartilage development|inflammatory response|lymphotoxin A biosynthetic process|negative regulation of angiogenesis|proteoglycan metabolic process|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|regulation of interleukin-2 biosynthetic process|regulation of interleukin-6 biosynthetic process|regulation of interleukin-8 biosynthetic process|regulation of transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|cytokine binding|protein homodimerization activity			ovary(1)	1	Lung NSC(77;0.116)					AATGCAGGGGTTTTTTTTTTT	0.418													5	4	---	---	---	---	
COL12A1	1303	broad.mit.edu	37	6	75855328	75855328	+	Intron	DEL	T	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75855328delT	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TGATGTTTTCTTTTTTttttt	0.144													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152860959	152860959	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152860959delA	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGCAACAGCTAGACCAACCAA	0.383										HNSCC(10;0.0054)			82	9	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	646958	646959	+	Intron	INS	-	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:646958_646959insT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		cccTTATGCTATTTTTTTTTTA	0.243													41	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55411210	55411211	+	IGR	INS	-	CTC	CTC	rs147930963	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55411210_55411211insCTC								EGFR (136180 upstream) : LANCL2 (21930 downstream)																							AAGAGGATGATATCTTTCCAAG	0.624													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	72832837	72832838	+	IGR	DEL	TC	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72832837_72832838delTC								FKBP6 (60196 upstream) : FZD9 (15271 downstream)																							tccctccctgtctctctctctc	0.153													4	2	---	---	---	---	
NDUFA5	4698	broad.mit.edu	37	7	123197758	123197758	+	Intron	DEL	G	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123197758delG	uc003vks.2	-						NDUFA5_uc003vkr.2_5'Flank|NDUFA5_uc003vkt.1_Intron	NM_005000	NP_004991	Q16718	NDUA5_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)	CAACACCCGCGGGAAGTAGGG	0.597													46	9	---	---	---	---	
PODXL	5420	broad.mit.edu	37	7	131196372	131196372	+	Intron	DEL	T	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131196372delT	uc003vqw.3	-						PODXL_uc003vqx.3_Intron	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor						cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					TTTTTCTGTCTTTTTTTTTTC	0.274													4	2	---	---	---	---	
PARP12	64761	broad.mit.edu	37	7	139735680	139735681	+	Intron	INS	-	GGAGGG	GGAGGG	rs147062509	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139735680_139735681insGGAGGG	uc003vvl.1	-						PARP12_uc003vvk.1_Intron|PARP12_uc010lnf.1_Intron	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12							nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					gaagaggaggaggaagaggaag	0.000													4	2	---	---	---	---	
BLK	640	broad.mit.edu	37	8	11361876	11361877	+	Intron	INS	-	A	A	rs55809628		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11361876_11361877insA	uc003wty.2	+						BLK_uc003wtz.2_Intron|BLK_uc003wtx.2_Intron	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase						intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		aaggaaggaagaaagaaaagaa	0.109													4	2	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32474565	32474565	+	Intron	DEL	T	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32474565delT	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCTCCTAATATGCTTAAGGAC	0.388													18	12	---	---	---	---	
WISP1	8840	broad.mit.edu	37	8	134203164	134203164	+	5'Flank	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134203164delA	uc003yub.2	+						WISP1_uc003yuc.2_5'Flank|WISP1_uc010meb.2_5'Flank|WISP1_uc010mec.2_5'Flank|WISP1_uc010med.2_5'Flank	NM_003882	NP_003873	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1						cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GGGAAGAAAGAAAAAAAAAAA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	122796240	122796249	+	IGR	DEL	TGTGTGTGTG	-	-	rs2416748		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122796240_122796249delTGTGTGTGTG								DBC1 (664501 upstream) : MIR147 (211008 downstream)																							ctcacatatttgtgtgtgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
MAPKAP1	79109	broad.mit.edu	37	9	128305260	128305261	+	Intron	DEL	CA	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128305260_128305261delCA	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4						AGCCAGCCATCACACACACACA	0.436													184	8	---	---	---	---	
NEBL	10529	broad.mit.edu	37	10	21117694	21117695	+	Intron	INS	-	AG	AG	rs139794801	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21117694_21117695insAG	uc001iqi.2	-						NEBL_uc001iqj.2_Intron|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						CTTACACTCCCagagagagaga	0.238													8	4	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100995712	100995713	+	5'Flank	DEL	CT	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100995712_100995713delCT	uc001kpn.1	-						HPSE2_uc009xwc.1_5'Flank|HPSE2_uc001kpo.1_5'Flank|HPSE2_uc009xwd.1_5'Flank	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ctctctcccgctctctctctct	0.282													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112657654	112657654	+	Intron	DEL	T	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112657654delT	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		AGAGGCATGCTTTTTTTTTTT	0.264													9	4	---	---	---	---	
C10orf119	79892	broad.mit.edu	37	10	121602280	121602280	+	Intron	DEL	T	-	-	rs71935400		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121602280delT	uc001ler.2	-						C10orf119_uc001leq.1_Intron|C10orf119_uc001les.1_Intron	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119						cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		TGCATCCTCCttttttttttt	0.199													6	4	---	---	---	---	
OR4C6	219432	broad.mit.edu	37	11	55433602	55433603	+	3'UTR	INS	-	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433602_55433603insA	uc001nht.3	+	3						NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						ATGTATTTCCCAAAAGGAGAAG	0.376													44	18	---	---	---	---	
MTL5	9633	broad.mit.edu	37	11	68512769	68512769	+	Intron	DEL	A	-	-	rs71993839		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68512769delA	uc001ooc.2	-						MTL5_uc001ood.1_Intron|MTL5_uc009ysi.1_Intron	NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform						cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			ACCAAAGGGCaaaaaaaaaaa	0.353													4	3	---	---	---	---	
OAS3	4940	broad.mit.edu	37	12	113376543	113376544	+	Intron	INS	-	CAAAGGG	CAAAGGG	rs150451191	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113376543_113376544insCAAAGGG	uc001tug.2	+						OAS3_uc001tue.2_Intron|OAS3_uc001tuf.2_Intron	NM_006187	NP_006178	Q9Y6K5	OAS3_HUMAN	2'-5'oligoadenylate synthetase 3						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	microsome	ATP binding|nucleotidyltransferase activity|RNA binding			central_nervous_system(1)	1						CTTTATGTGTCCAAAGGGGAGT	0.594													3	3	---	---	---	---	
RNF17	56163	broad.mit.edu	37	13	25451475	25451476	+	Intron	INS	-	AC	AC	rs140599228	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25451475_25451476insAC	uc001upr.2	+						RNF17_uc010aab.2_Intron|RNF17_uc010tde.1_Intron|RNF17_uc001ups.2_Intron|RNF17_uc010aac.2_Intron|RNF17_uc010aad.2_Intron	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GCTTTATATATACATATAAAGC	0.272													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	108612305	108612306	+	IGR	INS	-	AC	AC	rs147227321	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108612305_108612306insAC								FAM155A (92845 upstream) : LIG4 (247488 downstream)																							CAGAAGcatatacacacacaca	0.203													3	3	---	---	---	---	
CDC16	8881	broad.mit.edu	37	13	115008973	115008974	+	Intron	INS	-	A	A	rs35430682		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115008973_115008974insA	uc001vuk.1	+						CDC16_uc001vul.1_Intron|CDC16_uc001vum.1_Intron|CDC16_uc001vun.1_Intron|CDC16_uc001vuo.1_Intron	NM_003903	NP_003894	Q13042	CDC16_HUMAN	anaphase-promoting complex, subunit 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cell proliferation|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	binding				0	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			CATAAGATTCCAAAAAAAAAAA	0.257													1	6	---	---	---	---	
TC2N	123036	broad.mit.edu	37	14	92265558	92265558	+	Intron	DEL	A	-	-	rs35831554		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92265558delA	uc001xzu.3	-						TC2N_uc001xzt.3_Intron|TC2N_uc010auc.2_Intron|TC2N_uc001xzv.3_Intron	NM_001128595	NP_001122067	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear							nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)		CAGGTAGTGGAAAAAAAAAAA	0.328													6	3	---	---	---	---	
SIN3A	25942	broad.mit.edu	37	15	75664693	75664693	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75664693delA	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						TTCTTAAAAGAAAAAAAAAAG	0.343													4	2	---	---	---	---	
IDH2	3418	broad.mit.edu	37	15	90631316	90631317	+	Intron	INS	-	TTTCT	TTTCT			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90631316_90631317insTTTCT	uc002box.2	-						IDH2_uc010uqb.1_Intron|IDH2_uc010uqc.1_Intron|IDH2_uc010bnu.2_Intron	NM_002168	NP_002159	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+),						2-oxoglutarate metabolic process|glyoxylate cycle|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding			haematopoietic_and_lymphoid_tissue(621)|central_nervous_system(80)|bone(7)|skin(3)	711	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			gctcgtggccatttcttttctt	0.010			M		GBM								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21831680	21831680	+	Intron	DEL	A	-	-	rs3830664		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21831680delA	uc002diq.3	+						RRN3P1_uc010vbl.1_5'Flank|RRN3P1_uc002djl.2_RNA					Homo sapiens cDNA FLJ59829 complete cds.																		CCCGACAAACAACGTGTGAAG	0.647													2	7	---	---	---	---	
USP31	57478	broad.mit.edu	37	16	23080918	23080918	+	Frame_Shift_Del	DEL	T	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23080918delT	uc002dll.2	-	16	2508	c.2508delA	c.(2506-2508)CCAfs	p.P836fs	USP31_uc002dlk.2_Frame_Shift_Del_p.P108fs|USP31_uc010vca.1_Frame_Shift_Del_p.P139fs|USP31_uc010bxm.2_Frame_Shift_Del_p.P124fs	NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	836	Ser-rich.				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		TTCTCACAAATGGTCGAGTTG	0.438													49	12	---	---	---	---	
ATXN2L	11273	broad.mit.edu	37	16	28845028	28845035	+	Intron	DEL	GATCAGGG	-	-	rs141681863		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28845028_28845035delGATCAGGG	uc002drc.2	+						uc010vct.1_Intron|ATXN2L_uc002drb.2_Intron|ATXN2L_uc002dqy.2_Intron|ATXN2L_uc002dra.2_Intron|ATXN2L_uc002dqz.2_Intron|ATXN2L_uc010vdb.1_Intron|ATXN2L_uc002dre.2_Intron|ATXN2L_uc002drf.2_Intron|ATXN2L_uc002drg.2_5'Flank	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A							membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AGGTTTGGGTGATCAGGGGATCAGGGAT	0.423													4	2	---	---	---	---	
SPNS1	83985	broad.mit.edu	37	16	28992631	28992632	+	Intron	INS	-	G	G			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28992631_28992632insG	uc010vdi.1	+						uc010vct.1_Intron|SPNS1_uc002drx.2_Intron|SPNS1_uc002dsa.2_Intron|SPNS1_uc002drz.2_Intron|SPNS1_uc010byp.2_Intron|SPNS1_uc010byq.1_Intron	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1						lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						CCCTAGTGGCAGCCCCCTTCCC	0.342											OREG0023712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	9	---	---	---	---	
KIAA0174	9798	broad.mit.edu	37	16	71958915	71958915	+	Intron	DEL	T	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71958915delT	uc002fbj.1	+						KIAA0174_uc010cgh.1_Intron|KIAA0174_uc002fbk.1_Intron|KIAA0174_uc002fbm.1_Intron|KIAA0174_uc002fbl.1_Intron|KIAA0174_uc002fbn.1_Intron|KIAA0174_uc010cgi.1_Intron|KIAA0174_uc010cgj.1_Intron|KIAA0174_uc010vml.1_Intron			P53990	IST1_HUMAN	SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;						cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1						AGCTCAGTGAttttttttttt	0.204													3	3	---	---	---	---	
SMG6	23293	broad.mit.edu	37	17	2075773	2075774	+	Intron	INS	-	T	T	rs75172492		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2075773_2075774insT	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						GTCGAGAGGGCTTTTTTTTTTC	0.431													4	2	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36361522	36361522	+	Intron	DEL	A	-	-	rs67811849		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36361522delA	uc010wdn.1	-									Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		aactctacagaaaaaaaaaaa	0.035													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51607467	51607468	+	IGR	DEL	AC	-	-	rs142400404		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51607467_51607468delAC								None (None upstream) : KIF2B (292771 downstream)																							gtctctTAAAacacacacacac	0.134													7	4	---	---	---	---	
PTRH2	51651	broad.mit.edu	37	17	57774721	57774722	+	3'UTR	INS	-	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57774721_57774722insA	uc002ixt.2	-	2					PTRH2_uc002ixs.2_RNA	NM_016077	NP_057161	Q9Y3E5	PTH2_HUMAN	Bcl-2 inhibitor of transcription precursor						apoptosis|translation	mitochondrion	aminoacyl-tRNA hydrolase activity				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GTTGGGTGAAGAAATTCAGCTT	0.381													45	16	---	---	---	---	
ASPSCR1	79058	broad.mit.edu	37	17	79968423	79968424	+	Intron	INS	-	C	C	rs9896558		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79968423_79968424insC	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			aaaaaaaaaaaaaaaaCCAGCA	0.287			T	TFE3	alveolar soft part sarcoma								4	2	---	---	---	---	
ARHGAP28	79822	broad.mit.edu	37	18	6887429	6887430	+	Intron	INS	-	T	T	rs10651246		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6887429_6887430insT	uc010wzi.1	+						ARHGAP28_uc002knc.2_Intron|ARHGAP28_uc002knd.2_Intron|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Intron			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				TTGGTATCTTGttttttttttt	0.262													4	2	---	---	---	---	
AFG3L2	10939	broad.mit.edu	37	18	12351548	12351548	+	Intron	DEL	G	-	-	rs12960286		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12351548delG	uc002kqz.1	-							NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2						cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	AGTGttttttgtttttttttt	0.179													4	2	---	---	---	---	
ATCAY	85300	broad.mit.edu	37	19	3924772	3924772	+	3'UTR	DEL	T	-	-	rs11306255		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3924772delT	uc002lyy.3	+	13					ATCAY_uc010xhz.1_3'UTR|ATCAY_uc010dts.2_3'UTR	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin						transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		AAACATTGTATTTTTTTTTTT	0.502													2	4	---	---	---	---	
BCL3	602	broad.mit.edu	37	19	45262965	45262965	+	3'UTR	DEL	C	-	-	rs67518145		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45262965delC	uc010xxe.1	+	9						NM_005178	NP_005169	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3						DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|I-kappaB kinase/NF-kappaB cascade|maintenance of protein location in nucleus|negative regulation of apoptosis|negative regulation of interleukin-8 biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of translation|protein import into nucleus, translocation|regulation of DNA binding|regulation of NF-kappaB import into nucleus|response to UV-C|response to virus	Bcl3-Bcl10 complex|Bcl3/NF-kappaB2 complex|nucleus|perinuclear region of cytoplasm	protein binding, bridging|transcription factor binding			ovary(1)|lung(1)	2	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				TCTCACTCTGCCCCCCCCCCC	0.612			T	IGH@	CLL 								3	3	---	---	---	---	
NOP56	10528	broad.mit.edu	37	20	2638355	2638355	+	Intron	DEL	T	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2638355delT	uc002wgh.2	+						NOP56_uc010zpy.1_Intron|NOP56_uc002wgi.2_Intron|NOP56_uc002wgm.1_3'UTR	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A						rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						GTTTTTTAGGTTTTTTTTTTT	0.403													23	7	---	---	---	---	
NDRG3	57446	broad.mit.edu	37	20	35349930	35349931	+	Intron	INS	-	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35349930_35349931insA	uc002xfw.2	-						NDRG3_uc002xfx.2_Intron|NDRG3_uc010zvq.1_Intron|NDRG3_uc010zvr.1_Intron	NM_032013	NP_114402	Q9UGV2	NDRG3_HUMAN	N-myc downstream regulated gene 3 isoform a						cell differentiation|negative regulation of cell growth|spermatogenesis	cytoplasm				ovary(1)	1		Myeloproliferative disorder(115;0.00878)				gacaccgtctcaaaaaaaaaaa	0.094													4	2	---	---	---	---	
SLC13A3	64849	broad.mit.edu	37	20	45228896	45228897	+	Intron	INS	-	AAGGA	AAGGA	rs151135493	by1000genomes	TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45228896_45228897insAAGGA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	atggaggaaggaaggaaaggaa	0.025													4	2	---	---	---	---	
ADNP	23394	broad.mit.edu	37	20	49508203	49508204	+	Frame_Shift_Ins	INS	-	T	T	rs6096163		TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49508203_49508204insT	uc002xvt.1	-	5	3392_3393	c.3047_3048insA	c.(3046-3048)AAGfs	p.K1016fs	ADNP_uc002xvu.1_Frame_Shift_Ins_p.K1016fs	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector	1016						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						GCATGGTAGCCTTTTTTTTGGC	0.460													316	8	---	---	---	---	
C21orf91	54149	broad.mit.edu	37	21	19190307	19190307	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19190307delA	uc002yko.3	-						C21orf91_uc002ykq.3_Intron|C21orf91_uc002ykp.3_Intron	NM_001100420	NP_001093890	Q9NYK6	EURL_HUMAN	early undifferentiated retina and lens isoform											ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		AGGGGTCTTTAAAAAAAAAAG	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49466982	49466983	+	IGR	INS	-	A	A			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49466982_49466983insA								FAM19A5 (319240 upstream) : C22orf34 (341193 downstream)																							ttcttccttccttccttccttc	0.000													4	2	---	---	---	---	
TYMP	1890	broad.mit.edu	37	22	50966367	50966368	+	Intron	INS	-	T	T			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50966367_50966368insT	uc003bmb.3	-						SCO2_uc003bma.2_5'Flank|SCO2_uc003blz.3_5'Flank|TYMP_uc003bmc.3_Intron|TYMP_uc003bmd.3_Intron|TYMP_uc010hbd.2_Intron|TYMP_uc003bme.3_Intron|TYMP_uc003bmf.3_Intron|TYMP_uc011arz.1_Intron	NM_001113756	NP_001107228	P19971	TYPH_HUMAN	endothelial cell growth factor 1						angiogenesis|cell differentiation|chemotaxis|DNA replication|mitochondrial genome maintenance|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol	growth factor activity|platelet-derived growth factor receptor binding|pyrimidine-nucleoside phosphorylase activity|thymidine phosphorylase activity			ovary(1)	1		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Docetaxel(DB01248)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Sulfasalazine(DB00795)|Tamoxifen(DB00675)	ccacacgcggcttttttttttc	0.000													4	2	---	---	---	---	
THOC2	57187	broad.mit.edu	37	X	122753440	122753440	+	Intron	DEL	A	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122753440delA	uc004etu.2	-						THOC2_uc010nqt.1_Intron|THOC2_uc004etw.1_Intron	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						TATCAACAATAAAAAAAAACA	0.274													4	2	---	---	---	---	
PDZD4	57595	broad.mit.edu	37	X	153068717	153068718	+	3'UTR	DEL	CA	-	-			TCGA-EJ-5514-01A-01D-1576-08	TCGA-EJ-5514-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153068717_153068718delCA	uc004fiz.1	-	8					PDZD4_uc004fiy.1_3'UTR|PDZD4_uc004fix.2_3'UTR|PDZD4_uc004fja.1_3'UTR|PDZD4_uc011mze.1_3'UTR	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4							cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					cgcgcgcgcgcacacacacaca	0.510													6	3	---	---	---	---	
