Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CCNL2	81669	broad.mit.edu	37	1	1333666	1333666	+	Silent	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1333666G>A	uc001afi.2	-	3	452	c.420C>T	c.(418-420)CGC>CGT	p.R140R	CCNL2_uc001afg.1_5'UTR|CCNL2_uc001afh.2_Silent_p.R140R|CCNL2_uc001afj.2_Silent_p.R140R|CCNL2_uc001afk.2_Silent_p.R140R|LOC148413_uc001afm.2_5'Flank|LOC148413_uc001afn.1_5'Flank|LOC148413_uc009vkc.1_5'Flank|LOC148413_uc009vkd.2_5'Flank	NM_030937	NP_112199	Q96S94	CCNL2_HUMAN	cyclin L2 isoform A	140	Cyclin-like 1.				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nuclear speck	protein kinase binding			ovary(2)|central_nervous_system(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		CGTCCCGTATGCGTCTTGGGG	0.502													51	195	---	---	---	---	PASS
C1orf86	199990	broad.mit.edu	37	1	2116261	2116261	+	3'UTR	SNP	G	C	C			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2116261G>C	uc001aix.1	-	8					PRKCZ_uc001aiq.2_Intron|PRKCZ_uc001air.2_Intron|PRKCZ_uc010nyw.1_Intron|PRKCZ_uc001ais.2_Intron|PRKCZ_uc009vla.2_Intron|PRKCZ_uc010nyx.1_Intron|PRKCZ_uc001ait.2_Intron|uc009vlc.1_5'Flank|C1orf86_uc001aiv.1_RNA|C1orf86_uc001aiw.1_RNA			Q6NZ36	CA086_HUMAN	SubName: Full=cDNA FLJ46112 fis, clone TESTI2035962;												0	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		CATCTCTCCAGTGGGCGTTGG	0.667													3	10	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8420609	8420609	+	Silent	SNP	T	G	G			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8420609T>G	uc001ape.2	-	19	3768	c.2958A>C	c.(2956-2958)CCA>CCC	p.P986P	RERE_uc001apf.2_Silent_p.P986P|RERE_uc010nzx.1_Silent_p.P718P|RERE_uc001apd.2_Silent_p.P432P	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	986	Pro-rich.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTTGCAGGGGTGGGGGGTGAG	0.706													6	31	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16918514	16918514	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918514C>A	uc009vos.1	-	7	891	c.3G>T	c.(1-3)ATG>ATT	p.M1I	NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	1						cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CTGATACCACCATGCTGACGT	0.483													33	696	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144829052	144829052	+	Intron	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144829052C>T	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|uc001elr.3_RNA			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CCACGTATCTCTGGGTAGCTA	0.443													4	9	---	---	---	---	PASS
ZBTB7B	51043	broad.mit.edu	37	1	154988948	154988948	+	Silent	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154988948C>A	uc001fgk.3	+	4	1565	c.1407C>A	c.(1405-1407)CCC>CCA	p.P469P	ZBTB7B_uc009wpa.2_Silent_p.P469P|ZBTB7B_uc001fgj.3_Silent_p.P503P|ZBTB7B_uc010peq.1_Silent_p.P503P|ZBTB7B_uc001fgl.3_Silent_p.P469P	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	469					cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATGCACCACCCCACTACCCAC	0.652													3	56	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160276964	160276964	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160276964G>A	uc009wti.2	-	14	1685	c.1291C>T	c.(1291-1293)CGG>TGG	p.R431W	COPA_uc001fvv.3_Missense_Mutation_p.R431W|COPA_uc009wtj.1_Missense_Mutation_p.R377W	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	431					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAATGCATCCGATCTAGGACA	0.478													7	297	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243354360	243354360	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243354360G>T	uc001hzs.2	-	8	1476	c.1068C>A	c.(1066-1068)AGC>AGA	p.S356R	CEP170_uc001hzt.2_Missense_Mutation_p.S356R|CEP170_uc001hzu.2_Missense_Mutation_p.S356R	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	356						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			CACTTTTAATGCTTTTAGAAT	0.378													3	41	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164467945	164467945	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164467945C>T	uc002uck.1	-	3	708	c.397G>A	c.(397-399)GCT>ACT	p.A133T		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	133						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						CTGACTCCAGCTTTGCTGGCA	0.498													80	230	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202626025	202626025	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202626025C>A	uc002uyo.2	-	4	1048	c.692G>T	c.(691-693)CGA>CTA	p.R231L	ALS2_uc002uyp.3_Missense_Mutation_p.R231L|ALS2_uc002uyq.2_Missense_Mutation_p.R231L|ALS2_uc002uyr.2_Missense_Mutation_p.R231L	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	231					cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						CTGGTTGCATCGTTCTGGGAC	0.498													5	121	---	---	---	---	PASS
GPC1	2817	broad.mit.edu	37	2	241404317	241404317	+	Silent	SNP	C	T	T	rs2229458	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241404317C>T	uc002vyw.3	+	6	1280	c.1059C>T	c.(1057-1059)CCC>CCT	p.P353P		NM_002081	NP_002072	P35052	GPC1_HUMAN	glypican 1 precursor	353					axon guidance	anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		CCCAGGGCCCCGGGCCTGAGG	0.701													3	2	---	---	---	---	PASS
ANO7	50636	broad.mit.edu	37	2	242138766	242138766	+	Silent	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242138766C>T	uc002wax.2	+	5	610	c.507C>T	c.(505-507)TAC>TAT	p.Y169Y		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	169	Cytoplasmic (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						CAGTGCACTACGCCCTCCTCA	0.637													17	74	---	---	---	---	PASS
ZNF197	10168	broad.mit.edu	37	3	44672664	44672664	+	Silent	SNP	G	A	A	rs150727145	byFrequency	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44672664G>A	uc003cnm.2	+	3	707	c.501G>A	c.(499-501)CCG>CCA	p.P167P	ZNF197_uc003cnn.2_Silent_p.P167P|ZNF197_uc003cno.2_RNA|ZNF197_uc003cnp.2_Silent_p.P167P	NM_006991	NP_008922	O14709	ZN197_HUMAN	zinc finger protein 197 isoform 1	167					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AAATTTGCCCGCATCCTCCTA	0.527													4	179	---	---	---	---	PASS
LRRC2	79442	broad.mit.edu	37	3	46592966	46592966	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46592966G>A	uc010hji.2	-	2	480	c.116C>T	c.(115-117)GCC>GTC	p.A39V	LRRC2_uc003cpu.3_Missense_Mutation_p.A39V	NM_024512	NP_078788	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	39										ovary(1)	1		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		CTTCTCCAAGGCGCTCTTCTC	0.468													4	164	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51413195	51413195	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51413195G>A	uc011bds.1	+	51	5452	c.5429G>A	c.(5428-5430)CGA>CAA	p.R1810Q		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1810						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AATTTCCAGCGAGCCCTGTTC	0.527													6	220	---	---	---	---	PASS
FLJ10213	55096	broad.mit.edu	37	3	73111759	73111759	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73111759C>T	uc003dpj.2	+	1	950	c.527C>T	c.(526-528)GCC>GTC	p.A176V	PPP4R2_uc003dph.1_Intron|PPP4R2_uc003dpi.1_Intron	NM_018029	NP_060499	Q6P2I7	EBLN2_HUMAN	hypothetical protein LOC55096	176				A -> G (in Ref. 1; AAK83528).			protein binding				0		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;3.9e-05)|BRCA - Breast invasive adenocarcinoma(55;7.72e-05)|LUSC - Lung squamous cell carcinoma(21;0.00156)|Lung(16;0.00487)|KIRC - Kidney renal clear cell carcinoma(39;0.012)|Kidney(39;0.0139)		AACTTTATTGCCCTTGAGAAG	0.463													4	131	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77147227	77147227	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77147227G>A	uc003dpy.3	+	2	767	c.124G>A	c.(124-126)GTC>ATC	p.V42I	ROBO2_uc003dpz.2_Missense_Mutation_p.V42I|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.V42I	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	42	Ig-like C2-type 1.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CGATGTCATCGTCTCTAAGGG	0.547													12	36	---	---	---	---	PASS
OCIAD1	54940	broad.mit.edu	37	4	48851971	48851971	+	Silent	SNP	T	C	C			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48851971T>C	uc003gyo.2	+	6	506	c.249T>C	c.(247-249)TGT>TGC	p.C83C	OCIAD1_uc011bzk.1_RNA|OCIAD1_uc003gyr.2_Silent_p.C83C|OCIAD1_uc003gyp.2_Silent_p.C83C|OCIAD1_uc003gys.2_Silent_p.C83C|OCIAD1_uc003gyq.2_Silent_p.C83C|OCIAD1_uc010igk.2_Silent_p.C88C	NM_017830	NP_060300	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1 isoform 1	83	OCIA.					endosome	protein binding				0						AAGTTGCTTGTATCATGGGAT	0.318													39	128	---	---	---	---	PASS
HMGCR	3156	broad.mit.edu	37	5	74646121	74646121	+	Silent	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74646121G>A	uc003kdp.2	+	8	858	c.702G>A	c.(700-702)CAG>CAA	p.Q234Q	HMGCR_uc011cst.1_Silent_p.Q254Q|HMGCR_uc003kdq.2_Silent_p.Q234Q|HMGCR_uc010izn.1_Intron	NM_000859	NP_000850	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-Coenzyme A reductase	234					cholesterol biosynthetic process|coenzyme A metabolic process|germ cell migration|gonad development|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal membrane	hydroxymethylglutaryl-CoA reductase (NADPH) activity|NADP binding			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Cerivastatin(DB00439)|Fluvastatin(DB01095)|Lovastatin(DB00227)|NADH(DB00157)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	CAATTTGGCAGCTCAGCCATT	0.413													3	101	---	---	---	---	PASS
C5orf56	441108	broad.mit.edu	37	5	131822410	131822410	+	3'UTR	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131822410C>A	uc010jds.1	+	4					IRF1_uc003kxd.2_Intron|IRF1_uc003kxa.2_Intron|IRF1_uc003kxb.2_Intron|IRF1_uc010jdt.1_Intron			Q8N8D9	CE056_HUMAN	Homo sapiens full length insert cDNA clone ZA99C08.												0						TAGGCCCAGGCCCACCTTAGC	0.572													9	131	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140725403	140725403	+	Silent	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140725403C>T	uc003ljm.1	+	1	1803	c.1803C>T	c.(1801-1803)AAC>AAT	p.N601N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.N361N|PCDHGA3_uc011dap.1_Silent_p.N601N	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	601	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCCAGAACGCCTGGCTGT	0.697													11	39	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140735373	140735373	+	Silent	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140735373C>T	uc003ljq.1	+	1	606	c.606C>T	c.(604-606)CGC>CGT	p.R202R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.R202R	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	202	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTAGATCGCGAGGAAGAGG	0.552													6	21	---	---	---	---	PASS
KCTD16	57528	broad.mit.edu	37	5	143586927	143586927	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143586927G>A	uc003lnm.1	+	3	1279	c.650G>A	c.(649-651)CGA>CAA	p.R217Q	KCTD16_uc003lnn.1_Missense_Mutation_p.R217Q	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	217						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity	p.R217G(1)		large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GACCCTGATCGAGCCCCAGAA	0.453													6	141	---	---	---	---	PASS
CYP21A2	1589	broad.mit.edu	37	6	32008267	32008267	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32008267C>T	uc003nze.1	+	8	1142	c.1024C>T	c.(1024-1026)CGG>TGG	p.R342W	CYP21A2_uc003nzf.1_Missense_Mutation_p.R312W	NM_000500	NP_000491	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A,	341			R -> W (in AH3; non-classic form; mild).|R -> P (in AH3; simple virilizing form).		glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						GGACCGTGCACGGCTGCCCTT	0.667													7	36	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101166013	101166013	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101166013C>A	uc003pqk.2	-	12	2346	c.2017G>T	c.(2017-2019)GAT>TAT	p.D673Y	ASCC3_uc011eai.1_Missense_Mutation_p.D575Y|ASCC3_uc003pql.2_Missense_Mutation_p.D673Y	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	673					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AAACGGCCATCAAAGAAGAAA	0.343													44	117	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142250753	142250753	+	Intron	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142250753C>T	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011kse.1_Intron|uc011ksf.1_RNA					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		GTACAGCAGACGCCAACGTGA	0.502													5	222	---	---	---	---	PASS
DLGAP2	9228	broad.mit.edu	37	8	1497834	1497834	+	Silent	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1497834G>A	uc003wpl.2	+	2	1072	c.975G>A	c.(973-975)CCG>CCA	p.P325P	DLGAP2_uc003wpm.2_Silent_p.P325P	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	404					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCCTGAGGCCGTGCCACTACC	0.567													4	4	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2910129	2910129	+	Silent	SNP	T	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2910129T>A	uc011kwk.1	-	50	7908	c.7518A>T	c.(7516-7518)TCA>TCT	p.S2506S	CSMD1_uc011kwj.1_Silent_p.S1835S|CSMD1_uc010lrg.2_Silent_p.S574S	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2506	Extracellular (Potential).|Sushi 15.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCCCGGTAAATGAACCGTTTC	0.428													7	27	---	---	---	---	PASS
RBPMS	11030	broad.mit.edu	37	8	30407063	30407063	+	Intron	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30407063C>A	uc003xic.1	+						RBPMS_uc003xid.1_Missense_Mutation_p.P192Q|RBPMS_uc003xie.1_Intron|RBPMS_uc003xif.1_Intron	NM_006867	NP_006858	Q93062	RBPMS_HUMAN	RNA-binding protein with multiple splicing						positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|nucleus	nucleotide binding|poly(A) RNA binding|protein binding|transcription coactivator activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)		TTGAGCGCTCCGTCTCCTGAT	0.542													24	101	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41572581	41572581	+	Silent	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41572581G>A	uc003xok.2	-	15	1698	c.1614C>T	c.(1612-1614)ACC>ACT	p.T538T	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Silent_p.T538T|ANK1_uc003xoj.2_Silent_p.T538T|ANK1_uc003xol.2_Silent_p.T538T|ANK1_uc003xom.2_Silent_p.T571T	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	538	89 kDa domain.|ANK 16.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CGTGCAGAGGGGTAAATCCTT	0.627													22	91	---	---	---	---	PASS
CPA6	57094	broad.mit.edu	37	8	68334629	68334629	+	3'UTR	SNP	A	G	G			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68334629A>G	uc003xxq.3	-	11					CPA6_uc003xxr.3_3'UTR	NM_020361	NP_065094	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TAAAGTCCATAGACATGTTCA	0.413													8	29	---	---	---	---	PASS
MTAP	4507	broad.mit.edu	37	9	22029562	22029562	+	3'UTR	SNP	G	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22029562G>T	uc003zpi.1	+	5					CDKN2BAS_uc010miw.1_RNA|CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_RNA	NM_002451	NP_002442	Q13126	MTAP_HUMAN	5'-methylthioadenosine phosphorylase						nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)	GTTAGGGTGTGGTATGTGCCA	0.478													6	219	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66500937	66500937	+	RNA	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66500937C>T	uc004aed.1	+	3		c.1030C>T								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						AAGAGCGCCGCGGAGCGCCTG	0.607													3	26	---	---	---	---	PASS
LOC442421	442421	broad.mit.edu	37	9	66500939	66500939	+	RNA	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66500939G>A	uc004aed.1	+	3		c.1032G>A								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						GAGCGCCGCGGAGCGCCTGAA	0.602													3	28	---	---	---	---	PASS
MAMDC4	158056	broad.mit.edu	37	9	139751941	139751941	+	Silent	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139751941C>T	uc004cjs.2	+	18	2279	c.2229C>T	c.(2227-2229)TTC>TTT	p.F743F	MAMDC4_uc011mej.1_Silent_p.F80F	NM_206920	NP_996803	Q6UXC1	AEGP_HUMAN	apical early endosomal glycoprotein precursor	822	MAM 5.|Extracellular (Potential).				protein transport	integral to membrane				breast(4)|upper_aerodigestive_tract(2)|central_nervous_system(1)	7	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ACTGCGGCTTCTCCCCTGGAG	0.657													5	78	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7205712	7205712	+	3'UTR	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7205712G>A	uc009xio.1	-	21					SFMBT2_uc001ijn.1_3'UTR|SFMBT2_uc010qay.1_3'UTR	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						GCAATAATGGGCCACCTCCCG	0.502													3	88	---	---	---	---	PASS
CELF2	10659	broad.mit.edu	37	10	11330491	11330491	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11330491G>A	uc001iki.3	+	9	1023	c.931G>A	c.(931-933)GCC>ACC	p.A311T	CELF2_uc010qbi.1_Missense_Mutation_p.A83T|CELF2_uc010qbj.1_Missense_Mutation_p.A311T|CELF2_uc001ikk.2_Missense_Mutation_p.A318T|CELF2_uc001ikl.3_Missense_Mutation_p.A318T|CELF2_uc010qbk.1_RNA|CELF2_uc010qbl.1_Missense_Mutation_p.A287T|CELF2_uc010qbm.1_Missense_Mutation_p.A83T|CELF2_uc001iko.3_Missense_Mutation_p.A287T|CELF2_uc001ikp.3_Missense_Mutation_p.A287T|CELF2_uc010qbn.1_Missense_Mutation_p.A295T|CELF2_uc010qbo.1_Missense_Mutation_p.A200T|CELF2_uc010qbp.1_Missense_Mutation_p.A83T	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2	311	Ala-rich.				mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						CACGAGCAGCGCCCTGGGAGC	0.637													10	45	---	---	---	---	PASS
GHITM	27069	broad.mit.edu	37	10	85904774	85904774	+	Splice_Site	SNP	T	C	C			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85904774T>C	uc001kcs.1	+	5	687	c.483_splice	c.e5+2	p.V161_splice	GHITM_uc010qma.1_Splice_Site_p.V92_splice|GHITM_uc010qmb.1_Splice_Site_p.V91_splice	NM_014394	NP_055209	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein						apoptosis	integral to membrane|mitochondrial inner membrane					0						TCTTGGGTGGTAAGTCAGCTG	0.368													3	176	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55594892	55594892	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55594892G>T	uc001nhy.1	+	1	198	c.198G>T	c.(196-198)TTG>TTT	p.L66F		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	66	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TCAGCCACTTGTCCTTTGTAG	0.473										HNSCC(27;0.073)			6	486	---	---	---	---	PASS
OR8J1	219477	broad.mit.edu	37	11	56128312	56128312	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56128312C>T	uc010rjh.1	+	1	590	c.590C>T	c.(589-591)ACA>ATA	p.T197I		NM_001005205	NP_001005205	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J,	197	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					TTACCAGAAACAGTTGTCTTT	0.294													50	140	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64109490	64109490	+	Silent	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64109490C>A	uc001nzy.2	+	8	744	c.700C>A	c.(700-702)CGA>AGA	p.R234R	CCDC88B_uc009ypo.1_Silent_p.R231R|CCDC88B_uc001nzz.1_5'Flank	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	234					microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						GCTGCTGGAGCGAGAACCCCT	0.632													3	46	---	---	---	---	PASS
SLC22A20	440044	broad.mit.edu	37	11	64981472	64981472	+	Silent	SNP	G	C	C	rs239258	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64981472G>C	uc010roc.1	+	1	126	c.123G>C	c.(121-123)ACG>ACC	p.T41T	SLC22A20_uc010rob.1_Silent_p.T41T	NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20	41	Helical; (Potential).				ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						AGAACTTCACGGCCGCTGTCC	0.687													2	3	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31242218	31242218	+	Intron	SNP	A	G	G	rs4081648		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242218A>G	uc001rjt.1	+						DDX11_uc010sjw.1_3'UTR|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CCCCTCCCTGACCTGGCCGGC	0.597										Multiple Myeloma(12;0.14)			3	13	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31242232	31242232	+	Intron	SNP	G	T	T	rs4081649		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242232G>T	uc001rjt.1	+						DDX11_uc010sjw.1_3'UTR|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GGCCGGCCCAGCACTGGAAGG	0.592										Multiple Myeloma(12;0.14)			6	10	---	---	---	---	PASS
BICD1	636	broad.mit.edu	37	12	32530602	32530602	+	3'UTR	SNP	G	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32530602G>T	uc001rku.2	+	10					BICD1_uc001rkv.2_3'UTR|BICD1_uc010skd.1_RNA	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TGGAAGTTTTGTAGCCACACA	0.512													6	78	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68050894	68050894	+	Silent	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68050894C>A	uc001str.3	+	3	609	c.207C>A	c.(205-207)GGC>GGA	p.G69G	DYRK2_uc001sts.3_5'UTR	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	69					apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		AGATTGGCGGCAGTAAGCACA	0.473													3	90	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101764854	101764854	+	Silent	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101764854C>T	uc001tia.1	+	51	6862	c.6706C>T	c.(6706-6708)CTG>TTG	p.L2236L		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	2236					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						ATCAAGAAAGCTGTTGGTCCC	0.448													56	218	---	---	---	---	PASS
WASF3	10810	broad.mit.edu	37	13	27256797	27256797	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27256797C>T	uc001uqv.2	+	9	1262	c.1037C>T	c.(1036-1038)CCG>CTG	p.P346L	WASF3_uc001uqw.2_Missense_Mutation_p.P343L	NM_006646	NP_006637	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	346	Poly-Pro.				actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CCACCTCCTCCGCCACCTCCT	0.572													105	238	---	---	---	---	PASS
TNFAIP2	7127	broad.mit.edu	37	14	103599852	103599852	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103599852C>A	uc001ymm.1	+	9	1830	c.1699C>A	c.(1699-1701)CAC>AAC	p.H567N	TNFAIP2_uc010awo.1_Intron|TNFAIP2_uc010txz.1_Missense_Mutation_p.H236N|TNFAIP2_uc010tya.1_Missense_Mutation_p.H50N	NM_006291	NP_006282	Q03169	TNAP2_HUMAN	tumor necrosis factor, alpha-induced protein 2	567					angiogenesis|cell differentiation	extracellular space				central_nervous_system(1)	1		Melanoma(154;0.155)	Epithelial(46;0.191)			CTGCACCCAGCACGTAAGCCG	0.627													3	50	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105415557	105415557	+	Silent	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105415557G>A	uc010axc.1	-	7	6351	c.6231C>T	c.(6229-6231)CCC>CCT	p.P2077P	AHNAK2_uc001ypx.2_Silent_p.P1977P	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2077						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCTTCAAACTGGGCATCTCCA	0.612													2	2	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49329843	49329843	+	Missense_Mutation	SNP	T	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49329843T>A	uc001zxe.1	-	2	282	c.148A>T	c.(148-150)ATT>TTT	p.I50F	SECISBP2L_uc001zxd.1_Missense_Mutation_p.I50F|SECISBP2L_uc010bep.1_5'UTR|SECISBP2L_uc010beq.1_Missense_Mutation_p.I50F	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	50										breast(1)|skin(1)	2						TAGCTGGGAATTGGAGTTGGT	0.398													34	82	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50190384	50190384	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50190384A>G	uc001zxu.2	-	22	2496	c.2354T>C	c.(2353-2355)GTA>GCA	p.V785A	ATP8B4_uc010ber.2_Missense_Mutation_p.V658A|ATP8B4_uc010ufd.1_Missense_Mutation_p.V595A|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxv.1_Missense_Mutation_p.V83A	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	785	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GCAGCAAATTACAGTCTTACA	0.423													4	154	---	---	---	---	PASS
EME2	197342	broad.mit.edu	37	16	1826310	1826310	+	3'UTR	SNP	A	C	C			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1826310A>C	uc010brw.1	+	8						NM_001010865	NP_001010865	A4GXA9	EME2_HUMAN	essential meiotic endonuclease 1 homolog 2						DNA recombination|DNA repair	nucleus	DNA binding|endonuclease activity			lung(1)|central_nervous_system(1)|pancreas(1)	3						GTGGGGGAGGACCCCCAGCCA	0.642								Direct_reversal_of_damage|Homologous_recombination					5	9	---	---	---	---	PASS
EIF3CL	728689	broad.mit.edu	37	16	28734242	28734242	+	5'UTR	SNP	G	A	A	rs143319913	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28734242G>A	uc002dqv.3	+	1					uc010vct.1_Intron|EIF3CL_uc010byi.2_Intron|EIF3CL_uc002dqs.3_Intron|EIF3C_uc002dqt.3_Intron|EIF3CL_uc010vcy.1_Intron|EIF3CL_uc010byj.2_Intron|EIF3C_uc002dqu.3_Intron	NM_003752	NP_003743	B5ME19	B5ME19_HUMAN	eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	translation initiation factor activity				0						gattcctgacgtcaagtgatc	0.174													3	7	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76592650	76592650	+	3'UTR	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76592650C>T	uc002feu.1	+	26					CNTNAP4_uc002fev.1_3'UTR|CNTNAP4_uc010chb.1_3'UTR|CNTNAP4_uc002fex.1_3'UTR	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						AATGGAAAAACGAATGCTCTT	0.428													6	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161902	90161902	+	3'UTR	SNP	A	G	G	rs6500471	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161902A>G	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		ATATGTTCCAAGACCCTAAAA	0.537													8	54	---	---	---	---	PASS
LOC220594	220594	broad.mit.edu	37	17	18416592	18416592	+	RNA	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18416592G>A	uc010cqe.2	-	5		c.2759C>T			LOC220594_uc010cqf.2_RNA|LOC220594_uc002gty.2_RNA	NR_003554				Homo sapiens mRNA for TL132.												0						CAGCCAGAGTGGTAGCTTTAC	0.428													13	54	---	---	---	---	PASS
FAM83G	644815	broad.mit.edu	37	17	18874710	18874710	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18874710G>A	uc002guw.2	-	6	2601	c.2434C>T	c.(2434-2436)CGG>TGG	p.R812W	SLC5A10_uc002gur.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN	hypothetical protein LOC644815	812										ovary(1)|central_nervous_system(1)	2						TGAGCCCTCCGTTTAGAATCC	0.622													14	69	---	---	---	---	PASS
GGNBP2	79893	broad.mit.edu	37	17	34942072	34942072	+	Intron	SNP	C	T	T	rs873944	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34942072C>T	uc002hnb.2	+						GGNBP2_uc002hna.2_3'UTR|GGNBP2_uc002hnc.1_Intron	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TTGACAAAAACGAAAAATGGT	0.214													8	7	---	---	---	---	PASS
CDK5RAP3	80279	broad.mit.edu	37	17	46053334	46053334	+	Silent	SNP	A	G	G			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46053334A>G	uc002imr.2	+	8	837	c.753A>G	c.(751-753)GAA>GAG	p.E251E	CDK5RAP3_uc010wlc.1_Silent_p.E271E|CDK5RAP3_uc002imq.1_Silent_p.E26E|CDK5RAP3_uc002imu.2_Silent_p.E95E|CDK5RAP3_uc002ims.2_Silent_p.E164E|CDK5RAP3_uc002imv.2_Silent_p.E95E|CDK5RAP3_uc002imw.2_Silent_p.E95E|CDK5RAP3_uc002imx.2_Silent_p.E26E	NM_176096	NP_788276	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding				0						CTGTGGTGGAACGACCCCACC	0.602													3	95	---	---	---	---	PASS
LPO	4025	broad.mit.edu	37	17	56345181	56345181	+	Silent	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56345181C>T	uc002ivt.2	+	13	2281	c.1965C>T	c.(1963-1965)AAC>AAT	p.N655N	LPO_uc010wns.1_Silent_p.N596N|LPO_uc010dcp.2_Silent_p.N572N|LPO_uc010dcq.2_Silent_p.N326N|LPO_uc010dcr.2_Silent_p.N218N	NM_006151	NP_006142	P22079	PERL_HUMAN	lactoperoxidase isoform 1 preproprotein	655					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|breast(1)	2						TCTTCACGAACGAGCAGAAGG	0.577													19	83	---	---	---	---	PASS
PRAM1	84106	broad.mit.edu	37	19	8564163	8564163	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8564163C>T	uc002mkd.2	-	2	549	c.529G>A	c.(529-531)GCC>ACC	p.A177T	PRAM1_uc002mkc.2_Missense_Mutation_p.A177T	NM_032152	NP_115528	Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	225	Pro-rich.						lipid binding|protein binding				0						GGGGGTCTGGCGGGGTGACTG	0.697													5	21	---	---	---	---	PASS
LYL1	4066	broad.mit.edu	37	19	13211896	13211896	+	Silent	SNP	T	G	G			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13211896T>G	uc002mwi.2	-	2	451	c.90A>C	c.(88-90)CCA>CCC	p.P30P		NM_005583	NP_005574	P12980	LYL1_HUMAN	lymphoblastic leukemia derived sequence 1	30					B cell differentiation|blood vessel maturation|definitive hemopoiesis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			GCTTAGGGGGTGGGGCAGGCG	0.706			T	TRB@	T-ALL								3	8	---	---	---	---	PASS
POLD1	5424	broad.mit.edu	37	19	50902196	50902196	+	Missense_Mutation	SNP	C	T	T	rs3218772	byFrequency	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50902196C>T	uc002psb.3	+	2	144	c.88C>T	c.(88-90)CGG>TGG	p.R30W	POLD1_uc002psc.3_Missense_Mutation_p.R30W|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Missense_Mutation_p.R30W	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	30					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		TGATGCACCTCGGCCATCCCA	0.662								DNA_polymerases_(catalytic_subunits)					10	7	---	---	---	---	PASS
MORC3	23515	broad.mit.edu	37	21	37716975	37716975	+	Silent	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37716975C>A	uc002yvi.2	+	7	931	c.855C>A	c.(853-855)ATC>ATA	p.I285I		NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	285					cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						TTGCCTACATCGAACGTGATG	0.383													3	135	---	---	---	---	PASS
ABCG1	9619	broad.mit.edu	37	21	43702403	43702403	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43702403C>A	uc002zaq.2	+	6	714	c.608C>A	c.(607-609)GCG>GAG	p.A203E	ABCG1_uc002zan.2_Missense_Mutation_p.A205E|ABCG1_uc002zam.2_Missense_Mutation_p.A181E|ABCG1_uc002zao.2_Missense_Mutation_p.A200E|ABCG1_uc002zap.2_Missense_Mutation_p.A203E|ABCG1_uc002zar.2_Missense_Mutation_p.A214E|ABCG1_uc011aev.1_Missense_Mutation_p.A214E	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1	203	Cytoplasmic (Potential).|ABC transporter.				amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	ATACTGACAGCGCTGGGCTTG	0.637													5	80	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25144942	25144942	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25144942C>A	uc003abd.1	-	12	1798	c.1381G>T	c.(1381-1383)GAT>TAT	p.D461Y	PIWIL3_uc011ajx.1_Missense_Mutation_p.D352Y|PIWIL3_uc011ajy.1_Missense_Mutation_p.D352Y|PIWIL3_uc010gut.1_Missense_Mutation_p.D461Y	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	461					cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						AAATTGGTATCAAATTTCAAA	0.348													46	137	---	---	---	---	PASS
ASPHD2	57168	broad.mit.edu	37	22	26830386	26830386	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26830386G>A	uc003acg.2	+	2	1202	c.805G>A	c.(805-807)GCG>ACG	p.A269T		NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	269	Lumenal (Potential).				peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						TTTTGGGAACGCGTGCATCTC	0.547													51	206	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38119902	38119902	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38119902A>G	uc003atr.2	+	7	1610	c.1339A>G	c.(1339-1341)ACA>GCA	p.T447A	TRIOBP_uc003atu.2_Missense_Mutation_p.T275A|TRIOBP_uc003atq.1_Missense_Mutation_p.T447A|TRIOBP_uc003ats.1_Missense_Mutation_p.T275A	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	447					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CAGTAGAGCTACACGAGACAA	0.587													4	84	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50054016	50054016	+	Silent	SNP	A	G	G			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50054016A>G	uc004dox.3	+	6	3145	c.2847A>G	c.(2845-2847)TTA>TTG	p.L949L	CCNB3_uc004doy.2_Silent_p.L949L|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	949					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					AGGAGCCATTAGCCTTACAAG	0.483													3	98	---	---	---	---	PASS
GRHL3	57822	broad.mit.edu	37	1	24671564	24671564	+	Intron	DEL	C	-	-	rs11352138		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24671564delC	uc001biy.2	+						GRHL3_uc001bix.2_Intron|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CACACCTGTGCCCCCTCTACA	0.672													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120612224	120612226	+	5'UTR	DEL	GCC	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612224_120612226delGCC	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGCCGCCTCAGCCGCCGCCCGAA	0.695			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				6	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145368208	145368213	+	Intron	DEL	TCTCTG	-	-	rs72354261		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145368208_145368213delTCTCTG	uc001end.3	+						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GGTCACTTTCtctctgtctctgtctc	0.320													4	4	---	---	---	---	
KDM5B	10765	broad.mit.edu	37	1	202701186	202701186	+	Intron	DEL	C	-	-	rs72750651	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202701186delC	uc001gyf.2	-						KDM5B_uc009xag.2_Intron|KDM5B_uc001gyg.1_Intron	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B						negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						AAAAAAAAAACAACTTGATTT	0.373													4	2	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766800	206766801	+	Intron	DEL	GA	-	-	rs71570017		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766800_206766801delGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			AAACTAAATGgagagagagaga	0.198													6	3	---	---	---	---	
C1orf31	388753	broad.mit.edu	37	1	234519320	234519321	+	Intron	DEL	AC	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234519320_234519321delAC	uc001hwc.2	+						C1orf31_uc001hwb.2_Intron	NM_001012985	NP_001013003	Q5JTJ3	CA031_HUMAN	hypothetical protein LOC388753							mitochondrion	cytochrome-c oxidase activity				0	Ovarian(103;0.0339)	all_cancers(173;0.241)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			GTTACAGCTGacacacacacac	0.124													4	2	---	---	---	---	
DNAJC5G	285126	broad.mit.edu	37	2	27502885	27502885	+	Intron	DEL	A	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27502885delA	uc002rjl.1	+						TRIM54_uc002rjn.2_5'Flank|TRIM54_uc002rjo.2_5'Flank|DNAJC5G_uc010yli.1_Intron|DNAJC5G_uc002rjm.1_Intron	NM_173650	NP_775921	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5						protein folding	membrane	heat shock protein binding|unfolded protein binding			skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTCCCCCCCAAATGAACTTT	0.279											OREG0014517	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	33	10	---	---	---	---	
UGT1A5	54579	broad.mit.edu	37	2	234678111	234678112	+	Intron	DEL	GT	-	-	rs34036745		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234678111_234678112delGT	uc002vuw.2	+						UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Intron|UGT1A1_uc002vvb.2_Intron	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5						xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		attcatatgcgtgtgtgtgtgt	0.223													43	7	---	---	---	---	
C3orf18	51161	broad.mit.edu	37	3	50599335	50599336	+	Intron	INS	-	T	T	rs35405680		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50599335_50599336insT	uc003das.2	-						C3orf18_uc003dar.2_Intron|C3orf18_uc011bdr.1_Intron|C3orf18_uc010hlo.2_Intron|C3orf18_uc010hlp.2_Intron|C3orf18_uc003dat.2_Intron	NM_016210	NP_057294	Q9UK00	CC018_HUMAN	hypothetical protein LOC51161							integral to membrane				pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.0175)|Kidney(197;0.0207)		CTTCATGCCtcttttttttttt	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	84741480	84741480	+	Intron	DEL	A	-	-	rs140144338		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84741480delA	uc003dqi.2	-											Homo sapiens cDNA clone IMAGE:4824471.																		CCTGTCCCAGAAAAAAAAAAA	0.388													8	5	---	---	---	---	
TBC1D14	57533	broad.mit.edu	37	4	6925986	6925990	+	Intron	DEL	AATCC	-	-	rs57881179		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6925986_6925990delAATCC	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						AGAAGCCCGGAATCCTGTGGGATTG	0.512													3	3	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20544479	20544486	+	Intron	DEL	GTGTGTGC	-	-	rs145387887	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20544479_20544486delGTGTGTGC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						gtgtgtgtgtgtgtgtgCGctataagat	0.115													4	2	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39929903	39929904	+	Intron	DEL	CA	-	-	rs71969631		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39929903_39929904delCA	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						CCAGACAGTTCACAGTCAACTT	0.337													4	5	---	---	---	---	
ANKRD17	26057	broad.mit.edu	37	4	73963152	73963152	+	Intron	DEL	T	-	-	rs55834843		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73963152delT	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATAGAGAGCCttttttttttt	0.134													4	2	---	---	---	---	
USO1	8615	broad.mit.edu	37	4	76726528	76726529	+	Intron	INS	-	C	C	rs11733253	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76726528_76726529insC	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTTTTTTTTTCCTTGGATCTC	0.223													4	2	---	---	---	---	
RRH	10692	broad.mit.edu	37	4	110749453	110749454	+	Intron	INS	-	T	T	rs151191651	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110749453_110749454insT	uc003hzv.2	+							NM_006583	NP_006574	O14718	OPSX_HUMAN	peropsin						phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		tgatgatactctatttctgggc	0.104													11	6	---	---	---	---	
MTRR	4552	broad.mit.edu	37	5	7869456	7869456	+	Intron	DEL	C	-	-	rs34828626		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7869456delC	uc003jed.2	+						FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jeb.2_5'Flank|FASTKD3_uc003jec.2_5'Flank|MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CCTTCGGCCTCCGGGGGTCGC	0.746													3	8	---	---	---	---	
AQPEP	206338	broad.mit.edu	37	5	115339265	115339266	+	Intron	INS	-	T	T	rs113845587		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115339265_115339266insT	uc003kro.2	+						AQPEP_uc003krp.2_Intron|AQPEP_uc003krq.2_Intron|AQPEP_uc003krr.2_Intron|AQPEP_uc003krs.2_Intron	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin						proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						TGTCTGTGTGGTttttttttgt	0.198													4	2	---	---	---	---	
GFRA3	2676	broad.mit.edu	37	5	137602877	137602878	+	Intron	DEL	CT	-	-	rs77554927		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137602877_137602878delCT	uc003lcn.2	-						GFRA3_uc003lco.2_Intron	NM_001496	NP_001487	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3 preproprotein						peripheral nervous system development	anchored to membrane|cytoplasm|extrinsic to membrane|intracellular membrane-bounded organelle	receptor binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ttcttttatgcttttttttttt	0.183													6	4	---	---	---	---	
RBM27	54439	broad.mit.edu	37	5	145638332	145638332	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145638332delT	uc003lnz.3	+						RBM27_uc003lny.2_Intron	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27						mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATATTTATAAttttttttttt	0.124													4	3	---	---	---	---	
PANK3	79646	broad.mit.edu	37	5	167990685	167990685	+	Intron	DEL	A	-	-	rs11336922		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167990685delA	uc003lzz.1	-						uc003maa.1_5'Flank|MIR103-1_hsa-mir-103-1|MI0000109_5'Flank	NM_024594	NP_078870	Q9H999	PANK3_HUMAN	pantothenate kinase 3						coenzyme A biosynthetic process	cytoplasm|nucleus	ATP binding|pantothenate kinase activity			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CTCAAAAATTAAAAAAAAAAA	0.279													4	5	---	---	---	---	
BTNL9	153579	broad.mit.edu	37	5	180486891	180486892	+	3'UTR	INS	-	G	G	rs151240170	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180486891_180486892insG	uc003mmt.2	+	11						NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor							integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGACTGGCCCCGGGGGGCCCCC	0.683													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	70294157	70294164	+	IGR	DEL	GAAGGAAG	-	-	rs70987475		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70294157_70294164delGAAGGAAG								BAI3 (194755 upstream) : LMBRD1 (91587 downstream)																							aagaaggaaagaaggaaggaaggaagga	0.139													4	3	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152786901	152786902	+	Intron	INS	-	AC	AC	rs10549697		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152786901_152786902insAC	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron|SYNE1_uc003qow.2_5'Flank|SYNE1_uc003qox.1_Intron|SYNE1_uc003qoz.2_Intron|SYNE1_uc003qoy.2_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAAGAacacatacacacacaca	0.297										HNSCC(10;0.0054)			4	2	---	---	---	---	
SUN1	23353	broad.mit.edu	37	7	892417	892418	+	Intron	DEL	TG	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:892417_892418delTG	uc011jvp.1	+						GET4_uc003sjj.1_Intron|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Intron|SUN1_uc011jvr.1_Intron|SUN1_uc003sji.2_Intron|SUN1_uc003sjk.2_5'UTR	NM_001130965	NP_001124437	O94901	SUN1_HUMAN	unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0						GTGGTGTACCTGTGTGTGTGTG	0.485													619	9	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38466773	38466774	+	Intron	INS	-	A	A	rs5883649		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38466773_38466774insA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron|AMPH_uc003tgw.1_Intron|AMPH_uc010kxl.1_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						AATAGGCTGACAAAAAAAAAAA	0.327													7	4	---	---	---	---	
VSTM2A	222008	broad.mit.edu	37	7	54614510	54614511	+	Intron	INS	-	CCCCTGGTCGCTCCCCTGT	CCCCTGGTCGCTCCCCTGT	rs140369297	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54614510_54614511insCCCCTGGTCGCTCCCCTGT	uc010kzf.2	+						VSTM2A_uc010kze.2_Intron|VSTM2A_uc003tqc.3_Intron	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2							extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			GGGTGGCCACGCCCCTGGTCGC	0.698													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	26537953	26537956	+	IGR	DEL	TTCC	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26537953_26537956delTTCC								DPYSL2 (22260 upstream) : ADRA1A (67711 downstream)																							ccttccttctttccttccttcctt	0.000													4	3	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38112713	38112713	+	Intron	DEL	A	-	-	rs150194338		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38112713delA	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc003xld.2_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			actccatctcaaaaaaaaaaa	0.144													3	3	---	---	---	---	
GDAP1	54332	broad.mit.edu	37	8	75275367	75275367	+	Intron	DEL	C	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75275367delC	uc003yah.2	+						GDAP1_uc011lfj.1_Intron|GDAP1_uc003yai.2_Intron	NM_018972	NP_061845	Q8TB36	GDAP1_HUMAN	ganglioside-induced differentiation-associated							cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			TCACCAAAAACGTTCTGTAAT	0.338													39	19	---	---	---	---	
BAALC	79870	broad.mit.edu	37	8	104183511	104183512	+	Intron	INS	-	AGAG	AGAG	rs142506224	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104183511_104183512insAGAG	uc003yld.2	+						BAALC_uc003yle.2_Intron|uc003ylf.2_Intron|uc010mcb.1_Intron	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			aaaagaaagaaagagagaaGGA	0.084													4	2	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	710630	710630	+	Intron	DEL	C	-	-	rs68161748		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:710630delC	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		aaaaaaaaaacaaaaaaaaac	0.000													10	5	---	---	---	---	
DAPK1	1612	broad.mit.edu	37	9	90321801	90321802	+	Frame_Shift_Ins	INS	-	G	G	rs56169226		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90321801_90321802insG	uc004apc.2	+	26	3953_3954	c.3815_3816insG	c.(3814-3816)ATGfs	p.M1272fs	DAPK1_uc004apd.2_Frame_Shift_Ins_p.M1272fs|DAPK1_uc011ltg.1_Frame_Shift_Ins_p.M1206fs|DAPK1_uc011lth.1_Frame_Shift_Ins_p.M1009fs|DAPK1_uc004apg.2_Frame_Shift_Ins_p.M249fs	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1272					apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						ACCAACACCATGGGGGGGTACA	0.584									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				126	28	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	94984623	94984623	+	Intron	DEL	A	-	-	rs71511611		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94984623delA	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	actcagtctcaaaaaaaaaaa	0.090													11	5	---	---	---	---	
AGAP5	729092	broad.mit.edu	37	10	75436242	75436242	+	Intron	DEL	A	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75436242delA	uc009xri.2	-						AGAP5_uc001juu.3_Intron	NM_001144000	NP_001137472	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						agagtccatcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
CPN1	1369	broad.mit.edu	37	10	101816475	101816475	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101816475delT	uc001kql.2	-							NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor						proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		cttggctatcttttttttttt	0.000													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112654478	112654478	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112654478delT	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CACTGCAGTGTTTTTTTTTTT	0.279													3	4	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19735105	19735105	+	5'UTR	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19735105delT	uc010rdm.1	+	1					NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_5'UTR|LOC100126784_uc010rdl.1_3'UTR	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GACCTGGGGATTTTTTTTTTA	0.701													4	2	---	---	---	---	
UCP3	7352	broad.mit.edu	37	11	73712770	73712771	+	Intron	INS	-	A	A	rs146480062	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73712770_73712771insA	uc001our.2	-							NM_003356	NP_003347	P55916	UCP3_HUMAN	uncoupling protein 3 isoform UCP3L						mitochondrial transport|respiratory electron transport chain|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	binding			pancreas(1)	1	Breast(11;2.08e-05)					GTAAGGAAAAGAAAAAAAAACT	0.213													2	4	---	---	---	---	
EI24	9538	broad.mit.edu	37	11	125452221	125452222	+	Intron	INS	-	T	T	rs115034429	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125452221_125452222insT	uc001qca.2	+						EI24_uc001qcb.2_Intron|EI24_uc010sbd.1_Intron|EI24_uc009zbl.2_Intron|EI24_uc001qcc.2_Intron|EI24_uc010sbe.1_Intron|EI24_uc010sbf.1_Intron	NM_004879	NP_004870	O14681	EI24_HUMAN	etoposide induced 2.4 isoform 1						apoptosis|autophagy|induction of apoptosis|negative regulation of cell growth	endoplasmic reticulum membrane|integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		CTAATTATTTCTTTTTTTTTTT	0.351													3	3	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134086631	134086631	+	Intron	DEL	A	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134086631delA	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ACTTCGGATGAAAAAAAAAAG	0.443													4	2	---	---	---	---	
NCAPD2	9918	broad.mit.edu	37	12	6630750	6630751	+	Intron	INS	-	G	G	rs146599711	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6630750_6630751insG	uc001qoo.2	+						NCAPD2_uc009zen.1_Intron|NCAPD2_uc010sfd.1_Intron	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						actgctcaggagctgaagtgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31288835	31288836	+	Intron	INS	-	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31288835_31288836insA	uc010sjy.1	-											RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		GAAATATTAAGAATATTTTAGC	0.327													4	2	---	---	---	---	
LRRK2	120892	broad.mit.edu	37	12	40629553	40629554	+	Intron	INS	-	A	A	rs2131088	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40629553_40629554insA	uc001rmg.3	+							NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2						activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGATTCAAATTAAAAAAAAAGT	0.302													88	10	---	---	---	---	
NCKAP1L	3071	broad.mit.edu	37	12	54910235	54910235	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54910235delT	uc001sgc.3	+						NCKAP1L_uc010sox.1_Intron|NCKAP1L_uc010soy.1_Intron	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like						actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						ttttcttttcttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	72473148	72473149	+	IGR	INS	-	TTCCTTCCTTCCTTCC	TTCCTTCCTTCCTTCC	rs146632194		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72473148_72473149insTTCCTTCCTTCCTTCC								TPH2 (46927 upstream) : LOC283392 (183179 downstream)																							GTCTACTTCTTttccttccttc	0.163													4	2	---	---	---	---	
HVCN1	84329	broad.mit.edu	37	12	111120769	111120770	+	Intron	INS	-	A	A			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111120769_111120770insA	uc001trs.1	-						HVCN1_uc001trq.1_Intron|HVCN1_uc001trt.1_Intron|HVCN1_uc010syd.1_Intron	NM_032369	NP_115745	Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1						response to pH|response to zinc ion	integral to membrane	voltage-gated proton channel activity			skin(1)	1						aactccatctcaaaaaaaaaaa	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31374523	31374530	+	IGR	DEL	TTCCTTCC	-	-	rs66633179	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31374523_31374530delTTCCTTCC								ALOX5AP (35967 upstream) : C13orf33 (105782 downstream)																							ATTATttcctttccttccttccttcctt	0.188													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	105661432	105661433	+	IGR	DEL	GT	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105661432_105661433delGT								None (None upstream) : DAOA (456783 downstream)																							CTGTAAATACgtgtgtgtgtgt	0.124													4	2	---	---	---	---	
FNTB	2342	broad.mit.edu	37	14	65453494	65453494	+	5'Flank	DEL	G	-	-	rs3215788		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65453494delG	uc001xia.2	+						FNTB_uc010tsl.1_Intron|FNTB_uc010tsm.1_Intron|uc001xib.2_5'Flank	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TCTGCCCAATGGGGGGCGGCA	0.557											OREG0022738	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480465	98480470	+	IGR	DEL	TCTTTC	-	-	rs72290183		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480465_98480470delTCTTTC								C14orf64 (36004 upstream) : C14orf177 (697480 downstream)																							ttccttcctttctttctctttctttc	0.000													4	2	---	---	---	---	
POTEB	339010	broad.mit.edu	37	15	22077310	22077310	+	Intron	DEL	A	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22077310delA	uc010tzr.1	-						POTEB_uc010tzq.1_Intron	NM_207355	NP_997238	Q6S5H4	POTEB_HUMAN	protein expressed in prostate, ovary, testis,												0						TTTTTTTTTTAAAAAGCATTA	0.239													3	3	---	---	---	---	
FAM96A	84191	broad.mit.edu	37	15	64367853	64367853	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64367853delT	uc002amt.1	-						FAM96A_uc002amu.1_Intron|FAM96A_uc010uin.1_Intron	NM_032231	NP_115607	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A						chromosome segregation						0						ATCCTGtttcttttttttttt	0.159													8	4	---	---	---	---	
OSTBETA	123264	broad.mit.edu	37	15	65344105	65344106	+	Intron	INS	-	AAAC	AAAC	rs140336932	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65344105_65344106insAAAC	uc002aog.2	+						OSTBETA_uc002aoh.2_Intron	NM_178859	NP_849190	Q86UW2	OSTB_HUMAN	organic solute transporter beta							integral to membrane|plasma membrane					0						CAAGCTGTTaaaaacaaacaaa	0.465													3	5	---	---	---	---	
PRSS21	10942	broad.mit.edu	37	16	2867531	2867531	+	Intron	DEL	A	-	-	rs111876704		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2867531delA	uc002crt.2	+						PRSS21_uc002crs.2_Intron|PRSS21_uc002crr.2_Intron	NM_006799	NP_006790	Q9Y6M0	TEST_HUMAN	testisin isoform 1						proteolysis	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	serine-type endopeptidase activity			ovary(1)|skin(1)	2						GAGGGGGTAGAGGGGGGCCTT	0.697													4	5	---	---	---	---	
CCDC64B	146439	broad.mit.edu	37	16	3078617	3078619	+	Intron	DEL	ATT	-	-	rs150643417		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3078617_3078619delATT	uc002ctf.3	-						CCDC64B_uc002cte.3_Intron	NM_001103175	NP_001096645	A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B												0						AGTGGGGATCATTATAACCCGTA	0.645													4	5	---	---	---	---	
ANKS3	124401	broad.mit.edu	37	16	4780286	4780289	+	Intron	DEL	CAGA	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4780286_4780289delCAGA	uc002cxj.1	-						ANKS3_uc002cxi.1_5'Flank|ANKS3_uc002cxk.2_Intron|ANKS3_uc002cxl.2_Intron|ANKS3_uc010uxs.1_Intron|ANKS3_uc002cxm.2_Intron	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain												0						GGGAGTAACTCAGACAAATTTATT	0.495													6	4	---	---	---	---	
RRN3	54700	broad.mit.edu	37	16	15164236	15164236	+	Intron	DEL	C	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15164236delC	uc002dde.2	-						PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzp.1_Intron|RRN3_uc010uzq.1_Intron	NM_018427	NP_060897	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor						regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm				ovary(1)	1						TTAAATAATACCCATGGGTAC	0.373													4	4	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	20996186	20996186	+	Intron	DEL	A	-	-	rs142384699		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20996186delA	uc010vbe.1	-						DNAH3_uc010vbd.1_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		gactgtctttaaaaaaaaaaT	0.254													4	2	---	---	---	---	
PLSCR3	57048	broad.mit.edu	37	17	7307102	7307103	+	Intron	DEL	CA	-	-	rs150135032	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7307102_7307103delCA	uc002ggr.1	-						PLSCR3_uc010cmg.1_Intron|C17orf61_uc002ggs.2_Intron	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				CGAGAAAGGGCACCCCCCCCCC	0.624													4	3	---	---	---	---	
MYH13	8735	broad.mit.edu	37	17	10267942	10267943	+	Intron	INS	-	AG	AG	rs143161675	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10267942_10267943insAG	uc002gmk.1	-							NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TCTATTAAAACGGGGCCAGATT	0.520													2	4	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	15943963	15943963	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15943963delT	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpl.2_Intron|NCOR1_uc002gpm.2_Intron|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AATGGAAGTAttttttttttt	0.209													6	3	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67210656	67210656	+	Intron	DEL	A	-	-	rs67751220		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67210656delA	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfb.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					actccgtctcaaaaaaaaaaa	0.114													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15165286	15165287	+	IGR	INS	-	C	C			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15165286_15165287insC								ANKRD30B (312549 upstream) : LOC644669 (148268 downstream)																							GGCGGCGGGGGCAAAAAGCAGC	0.658													6	3	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47501149	47501150	+	Intron	INS	-	CA	CA	rs146410387	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47501149_47501150insCA	uc002leb.2	-						MYO5B_uc002lec.1_Intron	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTCTCTCTcacacacacac	0.426													5	3	---	---	---	---	
OR1M1	125963	broad.mit.edu	37	19	9203785	9203786	+	5'Flank	INS	-	AT	AT	rs4804096	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9203785_9203786insAT	uc010xkj.1	+							NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						cacacacacacatatatatata	0.223													4	4	---	---	---	---	
ICAM5	7087	broad.mit.edu	37	19	10403104	10403105	+	Intron	INS	-	G	G	rs145394131	by1000genomes	TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10403104_10403105insG	uc002mnu.3	+						ICAM5_uc002mnv.3_Intron	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5 precursor						cell-cell adhesion	integral to plasma membrane				breast(3)	3			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			GCGTGGCCCGAGGGGCGGGGCA	0.703													4	4	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25554992	25554992	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25554992delT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CACCACCGTCTTTTTTTTTTT	0.423													5	3	---	---	---	---	
C20orf132	140699	broad.mit.edu	37	20	35788406	35788406	+	Intron	DEL	A	-	-	rs72278393		TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35788406delA	uc010zvu.1	-						C20orf132_uc002xgk.2_5'Flank|C20orf132_uc002xgm.2_Intron|C20orf132_uc002xgn.2_Intron	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)				tttttgaaacaaaaaaaaaaa	0.279													4	2	---	---	---	---	
USP9Y	8287	broad.mit.edu	37	Y	14971077	14971077	+	Intron	DEL	T	-	-			TCGA-EJ-5522-01A-01D-1576-08	TCGA-EJ-5522-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14971077delT	uc004fst.1	+						USP9Y_uc010nwu.1_Intron	NM_004654	NP_004645	O00507	USP9Y_HUMAN	ubiquitin specific protease 9, Y-linked						BMP signaling pathway|protein deubiquitination|spermatogenesis|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						TTGTAAGTTCTTTTTTTTTTT	0.269													4	2	---	---	---	---	
