Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
ARL3	403	broad.mit.edu	36	10	104435574	104435574	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:104435574C>A	uc001kwa.1	-	c.490G>T	c.(490-492)GAG>TAG	p.E164*		NM_004311	NP_004302	P36405	ARL3_HUMAN	ADP-ribosylation factor-like 3	164					cell cycle|cytokinesis|small GTPase mediated signal transduction	centrosome|cytoplasmic microtubule|Golgi membrane|midbody|nucleus|photoreceptor connecting cilium|spindle microtubule	GDP binding|GTP binding|metal ion binding|microtubule binding				0		Colorectal(252;0.122)		Epithelial(162;4.88e-09)|all cancers(201;1.29e-07)|BRCA - Breast invasive adenocarcinoma(275;0.22)										0.149254	9.893095	17.826799	10	57	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	104435574	104435574	952	10	C	A	A	32	32	ARL3	A	5	3
PTEN	5728	broad.mit.edu	36	10	89701879	89701879	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89701879C>T	uc001kfb.1	+	c.517C>T	c.(517-519)CGC>TGC	p.R173C		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	173	Phosphatase tensin-type.		R -> C (in endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3; retains ability to bind phospholipid membranes).|R -> P (loss of phosphatase activity towards Ins(1,3,4,5)P4).|R -> H (loss of phosphatase activity towards Ins(1,3,4,5)P4).		apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R173C(32)|p.V166fs*17(3)|p.G165fs*9(3)|p.R173fs*10(2)|p.Y27_N212>Y(2)|p.G165_K342del(1)|p.G165_*404del(1)|p.R172fs*5(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)			R173C(REH_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	31	p.R173C(REH-Tumor)|p.R173C(639V-Tumor)	264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.579235	337.55902	338.559209	106	77	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89701879	89701879	13192	10	C	T	T	27	27	PTEN	T	1	1
TMEM45B	120224	broad.mit.edu	36	11	129227748	129227748	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:129227748C>A	uc001qfe.1	+	c.161C>A	c.(160-162)ACT>AAT	p.T54N	TMEM45B_uc001qff.1_Missense_Mutation_p.T54N	NM_138788	NP_620143	Q96B21	TM45B_HUMAN	transmembrane protein 45B	54	Helical; (Potential).					integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)										0.173333	23.628134	31.188693	13	62	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129227748	129227748	16709	11	C	A	A	20	20	TMEM45B	A	3	3
SAC3D1	29901	broad.mit.edu	36	11	64568486	64568486	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64568486G>A	uc001ocl.1	+	c.788G>A	c.(787-789)CGT>CAT	p.R263H	SAC3D1_uc001ocm.1_Missense_Mutation_p.R263H	NM_013299	NP_037431			SAC3 domain containing 1												0														0.5	15.275391	15.275391	5	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64568486	64568486	14282	11	G	A	A	40	40	SAC3D1	A	1	1
RFX4	5992	broad.mit.edu	36	12	105627321	105627321	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:105627321G>A	uc001tlt.1	+	c.944G>A	c.(943-945)CGA>CAA	p.R315Q	RFX4_uc001tlr.1_Missense_Mutation_p.R306Q|RFX4_uc001tls.1_Missense_Mutation_p.R315Q|RFX4_uc001tlv.1_Missense_Mutation_p.R212Q	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c	306					transcription, DNA-dependent	nucleus	DNA binding				0														0.350962	208.704779	212.783759	73	135	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105627321	105627321	13737	12	G	A	A	37	37	RFX4	A	1	1
RPH3A	22895	broad.mit.edu	36	12	111792131	111792131	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:111792131C>T	uc001ttz.1	+	c.700C>T	c.(700-702)CGC>TGC	p.R234C	RPH3A_uc001tty.1_Missense_Mutation_p.R230C|RPH3A_uc009zwe.1_Missense_Mutation_p.R230C|RPH3A_uc001tua.1_5'UTR	NM_014954	NP_055769	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 2	234	Pro-rich.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(302;0.00453)										0.5	21.525855	21.525855	7	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111792131	111792131	14030	12	C	T	T	27	27	RPH3A	T	1	1
RFC5	5985	broad.mit.edu	36	12	116953431	116953431	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116953431C>T	uc001twq.1	+	c.988C>T	c.(988-990)CAA>TAA	p.Q330*	RFC5_uc001twp.1_Nonsense_Mutation_p.Q245*|RFC5_uc009zwr.1_Nonsense_Mutation_p.Q327*	NM_007370	NP_853556	P40937	RFC5_HUMAN	replication factor C 5 isoform 1	330					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.267442	584.00408	626.052797	230	630	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	116953431	116953431	13719	12	C	T	T	29	29	RFC5	T	5	2
CDKN1B	1027	broad.mit.edu	36	12	12763029	12763029	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:12763029C>T	uc001rat.1	+	c.479C>T	c.(478-480)TCT>TTT	p.S160F		NM_004064	NP_004055	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B	160	Nuclear localization signal (Potential).				autophagic cell death|cell cycle arrest|cellular response to lithium ion|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of gene-specific transcription|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process|S phase of mitotic cell cycle	cytosol|endosome|nucleoplasm	cyclin-dependent protein kinase inhibitor activity|protein phosphatase binding|transforming growth factor beta receptor, cytoplasmic mediator activity			ovary(1)	1		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)						63				0.31746	53.375775	55.243148	20	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12763029	12763029	3288	12	C	T	T	32	32	CDKN1B	T	2	2
MBD6	114785	broad.mit.edu	36	12	56204400	56204400	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:56204400C>T	uc001soj.1	+	c.47C>T	c.(46-48)CCT>CTT	p.P16L	MBD6_uc001sok.1_5'Flank|MBD6_uc001sol.1_5'Flank	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	16	MBD.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4														0.135747	50.206133	78.608161	30	191	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56204400	56204400	9736	12	C	T	T	24	24	MBD6	T	2	2
TNFSF11	8600	broad.mit.edu	36	13	42078929	42078929	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:42078929G>A	uc001uyu.1	+	c.829G>A	c.(829-831)GTT>ATT	p.V277I	TNFSF11_uc001uyt.1_Missense_Mutation_p.V204I	NM_003701	NP_143026	O14788	TNF11_HUMAN	tumor necrosis factor ligand superfamily, member	277	Extracellular (Potential).				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation|tumor necrosis factor-mediated signaling pathway	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding				0		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)						113				0.664894	411.325098	415.854161	125	63	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42078929	42078929	16843	13	G	A	A	40	40	TNFSF11	A	1	1
RB1	5925	broad.mit.edu	36	13	47928486	47928486	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:47928486G>A	uc001vcb.1	+	c.1960G>A	c.(1960-1962)GTG>ATG	p.V654M		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	654	Pocket; binds T and E1A.|Domain B.		V -> E (in RB).		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|transcription repressor activity|ubiquitin protein ligase binding	p.V654fs*6(1)|p.V654L(1)		lung(93)|eye(89)|central_nervous_system(47)|bone(22)|breast(20)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|soft_tissue(8)|prostate(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	355		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)			6	p.V654M(MPP89-Tumor)	568	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.456522	63.670269	63.745746	21	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47928486	47928486	13559	13	G	A	A	35	35	RB1	A	2	2
SCFD1	23256	broad.mit.edu	36	14	30169473	30169473	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:30169473C>G	uc001wqm.1	+	c.172C>G	c.(172-174)CCT>GCT	p.P58A	SCFD1_uc010amd.1_5'UTR|SCFD1_uc010ame.1_5'UTR|SCFD1_uc001wqn.1_5'UTR|SCFD1_uc010amf.1_5'UTR	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a	58					post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)										0.309524	80.818128	83.533801	26	58	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30169473	30169473	14370	14	C	G	G	30	30	SCFD1	G	3	3
GPHN	10243	broad.mit.edu	36	14	66679896	66679896	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:66679896G>A	uc001xix.1	+	c.1813G>A	c.(1813-1815)GGG>AGG	p.G605R	GPHN_uc001xiy.1_Missense_Mutation_p.G572R	NM_020806	NP_065857	Q9NQX3	GEPH_HUMAN	gephyrin isoform 1	572	MPT adenylyltransferase.				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)						590				0.551383	941.361621	942.523957	279	227	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66679896	66679896	6884	14	G	A	A	35	35	GPHN	A	2	2
TP53	7157	broad.mit.edu	36	17	7518285	7518285	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1800-01	TCGA-06-1800-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7518285A>G	uc002gim.2	-	c.721T>C	c.(721-723)TCC>CCC	p.S241P	TP53_uc002gig.1_Missense_Mutation_p.S241P|TP53_uc002gih.1_Missense_Mutation_p.S241P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.S109P|TP53_uc010cng.1_Missense_Mutation_p.S109P|TP53_uc002gii.1_Missense_Mutation_p.S109P|TP53_uc010cnh.1_Missense_Mutation_p.S241P|TP53_uc010cni.1_Missense_Mutation_p.S241P|TP53_uc002gij.2_Missense_Mutation_p.S241P|TP53_uc010cnj.1_Non-coding_Transcript|TP53_uc002gin.2_Missense_Mutation_p.S148P|TP53_uc002gio.2_Missense_Mutation_p.S109P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	241	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		S -> A (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> C (in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.S241fs*6(8)|p.0?(6)|p.S241A(6)|p.S241T(5)|p.N239_C242delNSSC(3)|p.S241P(3)|p.S241del(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.S241fs*23(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.H233fs*6(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.S241fs*7(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)		111	p.C238fs(SW1417-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.731449	1523.897583	1551.275388	414	152	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7518285	7518285	16923	17	A	G	G	9	9	TP53	G	4	4
DHPS	1725	broad.mit.edu	36	19	12649202	12649202	+	Silent	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12649202G>A	uc002muh.1	-	c.687C>T	c.(685-687)ATC>ATT	p.I229I	DHPS_uc002muf.1_Silent_p.I106I|DHPS_uc002mug.1_Silent_p.I187I|DHPS_uc002mui.1_Silent_p.I229I|DHPS_uc002muj.1_Silent_p.I229I|DHPS_uc002muk.1_Non-coding_Transcript	NM_001930	NP_001921	P49366	DHYS_HUMAN	deoxyhypusine synthase isoform a	229					peptidyl-lysine modification to hypusine|positive regulation of cell proliferation|post-translational protein modification|spermidine catabolic process to deoxyhypusine, using deoxyhypusine synthase|translation	cytosol	deoxyhypusine synthase activity|protein binding			central_nervous_system(1)	1					Sulfadoxine(DB01299)									0.491228	85.893939	85.897836	28	29	GG		KEEP	---	---	---	---	capture			Silent	SNP	12649202	12649202	4664	19	G	A	A	41	41	DHPS	A	2	2
CYP4F22	126410	broad.mit.edu	36	19	15509391	15509391	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15509391G>A	uc002nbh.2	+	c.467G>A	c.(466-468)CGT>CAT	p.R156H		NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,	156					oxidation-reduction process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity			pancreas(1)	1														0.445946	191.747116	192.119727	66	82	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15509391	15509391	4354	19	G	A	A	40	40	CYP4F22	A	1	1
PRX	57716	broad.mit.edu	36	19	45594560	45594560	+	Silent	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:45594560C>T	uc002onr.1	-	c.1539G>A	c.(1537-1539)CCG>CCA	p.P513P	PRX_uc002onq.1_Silent_p.P374P|PRX_uc002ons.1_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	513	13.|55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)											0.365217	243.441892	247.114846	84	146	CC		KEEP	---	---	---	---	capture			Silent	SNP	45594560	45594560	13093	19	C	T	T	23	23	PRX	T	1	1
PSG3	5671	broad.mit.edu	36	19	47935056	47935056	+	Silent	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:47935056C>T	uc010eil.1	-	c.156G>A	c.(154-156)TTG>TTA	p.L52L	PSG3_uc002ouf.1_Non-coding_Transcript|PSG1_uc002oug.1_Intron|PSG3_uc002oue.1_Silent_p.L30L	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	30					defense response|female pregnancy	extracellular region				ovary(1)	1		Prostate(69;0.00682)												0.140411	84.215009	157.126574	82	502	CC		KEEP	---	---	---	---	capture			Silent	SNP	47935056	47935056	13109	19	C	T	T	25	25	PSG3	T	2	2
KCNA7	3743	broad.mit.edu	36	19	54265295	54265295	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:54265295C>T	uc002pmg.1	-	c.1208G>A	c.(1207-1209)CGG>CAG	p.R403Q		NM_031886	NP_114092	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related	403						voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(1)	1		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)		Colon(74;686 1235 3793 23366 48562)								0.307692	10.295941	10.724185	4	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54265295	54265295	8313	19	C	T	T	23	23	KCNA7	T	1	1
SIGLEC9	27180	broad.mit.edu	36	19	56320461	56320461	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1800-01	TCGA-06-1800-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56320461A>T	uc002pvu.1	+	c.418A>T	c.(418-420)ACA>TCA	p.T140S		NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	140	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding				0		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)										0.185185	10.357492	12.869335	5	22	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56320461	56320461	14810	19	A	T	T	10	10	SIGLEC9	T	4	4
FPR2	2358	broad.mit.edu	36	19	56963835	56963835	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56963835G>T	uc002pxr.1	+	c.112G>T	c.(112-114)GTC>TTC	p.V38F	FPR2_uc002pxs.2_Missense_Mutation_p.V38F|FPR2_uc010epf.1_Missense_Mutation_p.V38F|FPR2_uc010epg.1_Missense_Mutation_p.V38F	NM_001005738	NP_001453	P25090	FPR2_HUMAN	formyl peptide receptor-like 1	38	Helical; Name=1; (Potential).				cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)	1														0.32491	239.164191	246.695219	90	187	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56963835	56963835	6285	19	G	T	T	48	48	FPR2	T	3	3
ACSBG2	81616	broad.mit.edu	36	19	6102731	6102731	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:6102731G>A	uc002mef.1	+	c.311G>A	c.(310-312)CGT>CAT	p.R104H	ACSBG2_uc002mee.1_5'UTR|ACSBG2_uc002meg.1_Missense_Mutation_p.R104H|ACSBG2_uc002meh.1_Missense_Mutation_p.R104H|ACSBG2_uc002mei.1_Missense_Mutation_p.R54H	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum related protein	104					cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1														0.340909	46.313311	47.296721	15	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6102731	6102731	175	19	G	A	A	40	40	ACSBG2	A	1	1
C3	718	broad.mit.edu	36	19	6641679	6641679	+	Silent	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:6641679C>T	uc002mfm.1	-	c.3450G>A	c.(3448-3450)TCG>TCA	p.S1150S	C3_uc002mfl.1_5'UTR	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1150					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)										0.3	34.684438	36.11388	12	28	CC		KEEP	---	---	---	---	capture			Silent	SNP	6641679	6641679	2296	19	C	T	T	27	27	C3	T	1	1
MUC16	94025	broad.mit.edu	36	19	8827660	8827660	+	Silent	SNP	G	T	T			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8827660G>T	uc002mkp.1	-	c.43293C>A	c.(43291-43293)GTC>GTA	p.V14431V	MUC16_uc010dwh.1_Non-coding_Transcript|MUC16_uc010dwi.1_Non-coding_Transcript|MUC16_uc010dwj.1_Silent_p.V1231V	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	14529	SEA 16.|Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.346457	236.109067	241.401874	88	166	GG		KEEP	---	---	---	---	capture			Silent	SNP	8827660	8827660	10367	19	G	T	T	41	41	MUC16	T	3	3
HSD17B7	51478	broad.mit.edu	36	1	161029125	161029125	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:161029125C>G	uc001gci.1	+	c.88C>G	c.(88-90)CAT>GAT	p.H30D	HSD17B7_uc009wuv.1_Non-coding_Transcript	NM_016371	NP_057455	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	30	Extracellular (Potential).				cholesterol biosynthetic process|oxidation-reduction process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	3-keto sterol reductase activity|estradiol 17-beta-dehydrogenase activity			ovary(1)	1	all_hematologic(112;0.115)				NADH(DB00157)									0.113122	9.896798	42.600502	25	196	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	161029125	161029125	7683	1	C	G	G	29	29	HSD17B7	G	3	3
RGS4	5999	broad.mit.edu	36	1	161310852	161310852	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:161310852C>T	uc001gcl.2	+	c.787C>T	c.(787-789)CGC>TGC	p.R263C	RGS4_uc009wuy.1_Missense_Mutation_p.R166C|RGS4_uc009wuz.1_3'UTR|RGS4_uc009wva.1_Missense_Mutation_p.R148C	NM_001102445	NP_001095915	P49798	RGS4_HUMAN	regulator of G-protein signaling 4 isoform 1	166	RGS.				inactivation of MAPK activity|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	p.R166C(1)		ovary(2)|central_nervous_system(1)	3						Ovarian(76;1257 1738 3039 6086)								0.40604	378.526144	380.822289	121	177	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	161310852	161310852	13781	1	C	T	T	23	23	RGS4	T	1	1
F5	2153	broad.mit.edu	36	1	167750315	167750315	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:167750315C>G	uc001ggg.1	-	c.6535G>C	c.(6535-6537)GAA>CAA	p.E2179Q		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	2179	F5/8 type C 2.				cell adhesion|oxidation-reduction process|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)	5	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)									0.307692	37.385861	38.67128	12	27	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	167750315	167750315	5542	1	C	G	G	29	29	F5	G	3	3
CACNA1S	779	broad.mit.edu	36	1	199298218	199298218	+	Silent	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:199298218C>T	uc001gvv.1	-	c.2901G>A	c.(2899-2901)GAG>GAA	p.E967E		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	967	III.|Extracellular (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)	4					Magnesium Sulfate(DB00653)|Verapamil(DB00661)									0.235955	51.125379	56.803362	21	68	CC		KEEP	---	---	---	---	capture			Silent	SNP	199298218	199298218	2663	1	C	T	T	20	20	CACNA1S	T	2	2
LAD1	3898	broad.mit.edu	36	1	199622743	199622743	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:199622743G>C	uc001gwm.1	-	c.369C>G	c.(367-369)AGC>AGG	p.S123R	LAD1_uc009wzu.1_Missense_Mutation_p.S145R	NM_005558	NP_005549	O00515	LAD1_HUMAN	ladinin 1	123						basement membrane	structural molecule activity				0														0.333333	17.643372	18.086498	6	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	199622743	199622743	8922	1	G	C	C	42	42	LAD1	C	3	3
OR2M2	391194	broad.mit.edu	36	1	246410716	246410716	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:246410716C>T	uc001iea.1	+	c.806C>T	c.(805-807)ACG>ATG	p.T269M		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)											0.306122	214.746441	222.9518	75	170	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	246410716	246410716	11416	1	C	T	T	19	19	OR2M2	T	1	1
MAN1C1	57134	broad.mit.edu	36	1	25962984	25962984	+	Silent	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:25962984C>T	uc001bkm.2	+	c.1080C>T	c.(1078-1080)ATC>ATT	p.I360I	MAN1C1_uc009vry.1_Silent_p.I180I	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	360	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)										0.444444	12.49914	12.523286	4	5	CC		KEEP	---	---	---	---	capture			Silent	SNP	25962984	25962984	9596	1	C	T	T	31	31	MAN1C1	T	1	1
CLCA1	1179	broad.mit.edu	36	1	86724956	86724956	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:86724956G>A	uc001dlt.1	+	c.1114G>A	c.(1114-1116)GCC>ACC	p.A372T	CLCA1_uc001dls.1_Missense_Mutation_p.A311T	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	372	VWFA.				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)										0.454198	367.39762	367.875242	119	143	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	86724956	86724956	3593	1	G	A	A	38	38	CLCA1	A	1	1
CCBL2	56267	broad.mit.edu	36	1	89226586	89226586	+	Silent	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:89226586G>A	uc001dmp.1	-	c.36C>T	c.(34-36)AGC>AGT	p.S12S	CCBL2_uc001dmq.1_Intron|CCBL2_uc001dmr.1_5'UTR|CCBL2_uc001dms.1_Intron	NM_001008661	NP_001008662	Q6YP21	KAT3_HUMAN	kynurenine aminotransferase III isoform 1	12					biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)									0.365854	94.127913	95.425778	30	52	GG		KEEP	---	---	---	---	capture			Silent	SNP	89226586	89226586	2853	1	G	A	A	38	38	CCBL2	A	1	1
PIGT	51604	broad.mit.edu	36	20	43482646	43482646	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43482646C>A	uc002xoh.1	+	c.932C>A	c.(931-933)ACT>AAT	p.T311N	PIGT_uc010ghb.1_Missense_Mutation_p.T301N|PIGT_uc010ghc.1_Non-coding_Transcript|PIGT_uc010ghd.1_Missense_Mutation_p.T218N|PIGT_uc010ghe.1_Missense_Mutation_p.T274N|PIGT_uc010ghf.1_Missense_Mutation_p.T264N|PIGT_uc002xoi.1_Non-coding_Transcript|PIGT_uc002xoj.1_Missense_Mutation_p.T311N|PIGT_uc002xok.1_Missense_Mutation_p.T276N|PIGT_uc002xol.1_Missense_Mutation_p.T167N|PIGT_uc002xom.1_5'Flank	NM_015937	NP_057021	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	311	Lumenal (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)												0.402597	282.628527	284.544339	93	138	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43482646	43482646	12323	20	C	A	A	20	20	PIGT	A	3	3
PLCB4	5332	broad.mit.edu	36	20	9348504	9348504	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:9348504C>T	uc002wne.1	+	c.2066C>T	c.(2065-2067)CCC>CTC	p.P689L	PLCB4_uc010gbw.1_Missense_Mutation_p.P689L|PLCB4_uc010gbx.1_Missense_Mutation_p.P701L|PLCB4_uc002wnf.1_Missense_Mutation_p.P689L|PLCB4_uc002wnh.1_Missense_Mutation_p.P536L	NM_000933	NP_000924	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform a	689	C2.				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			ovary(3)|pancreas(1)|skin(1)	5														0.310219	240.662677	249.460177	85	189	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9348504	9348504	12456	20	C	T	T	22	22	PLCB4	T	2	2
UBASH3A	53347	broad.mit.edu	36	21	42706319	42706319	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:42706319G>A	uc002zbe.1	+	c.472G>A	c.(472-474)GGC>AGC	p.G158S	UBASH3A_uc002zbf.1_Missense_Mutation_p.G158S|UBASH3A_uc010gpc.1_Non-coding_Transcript|UBASH3A_uc010gpd.1_Non-coding_Transcript|UBASH3A_uc010gpe.1_Missense_Mutation_p.G158S	NM_018961	NP_061834	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing,	158						cytosol|nucleus				ovary(3)	3														0.443299	134.624611	134.893666	43	54	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42706319	42706319	17396	21	G	A	A	39	39	UBASH3A	A	1	1
MED15	51586	broad.mit.edu	36	22	19250982	19250982	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:19250982C>A	uc002zsp.1	+	c.919C>A	c.(919-921)CAG>AAG	p.Q307K	MED15_uc002zsq.1_Missense_Mutation_p.Q307K|MED15_uc010gso.1_Missense_Mutation_p.Q307K|MED15_uc002zsr.1_Missense_Mutation_p.Q281K|MED15_uc002zss.1_Missense_Mutation_p.Q226K	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	307	Pro-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding|RNA polymerase II transcription mediator activity				0	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)											0.285714	6.587945	7.169529	4	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19250982	19250982	9822	22	C	A	A	25	25	MED15	A	3	3
RHBDD3	25807	broad.mit.edu	36	22	27991524	27991524	+	Missense_Mutation	SNP	A	C	C			TCGA-06-1800-01	TCGA-06-1800-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:27991524A>C	uc003aeq.1	-	c.92T>G	c.(91-93)GTG>GGG	p.V31G	RHBDD3_uc003aer.1_Non-coding_Transcript|EWSR1_uc003aes.2_5'Flank|EWSR1_uc003aet.1_5'Flank|EWSR1_uc003aeu.1_5'Flank|EWSR1_uc003aev.1_5'Flank|EWSR1_uc003aew.1_5'Flank|EWSR1_uc003aex.1_5'Flank	NM_012265	NP_036397	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	31	Helical; (Potential).					integral to membrane	serine-type endopeptidase activity				0														0.285714	7.583599	8.168612	4	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27991524	27991524	13793	22	A	C	C	6	6	RHBDD3	C	4	4
TNS1	7145	broad.mit.edu	36	2	218465973	218465973	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:218465973C>T	uc002vgt.2	-	c.350G>A	c.(349-351)CGA>CAA	p.R117Q	TNS1_uc010fvk.1_Missense_Mutation_p.R242Q|TNS1_uc002vgr.2_Missense_Mutation_p.R117Q|TNS1_uc002vgs.2_Missense_Mutation_p.R117Q|TNS1_uc010fvj.1_Missense_Mutation_p.R185Q|TNS1_uc002vgu.2_Missense_Mutation_p.R148Q	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	117	Phosphatase tensin-type.					cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)										0.103139	23.962546	58.938621	23	200	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	218465973	218465973	16884	2	C	T	T	31	31	TNS1	T	1	1
DCBLD2	131566	broad.mit.edu	36	3	100013046	100013046	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:100013046C>T	uc003dte.1	-	c.1406G>A	c.(1405-1407)AGC>AAC	p.S469N	DCBLD2_uc003dtd.1_Missense_Mutation_p.S469N	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	469	Extracellular (Potential).				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3														0.328125	247.906029	254.615224	84	172	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100013046	100013046	4452	3	C	T	T	28	28	DCBLD2	T	2	2
ZBED2	79413	broad.mit.edu	36	3	112795525	112795525	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:112795525G>T	uc003dxy.1	-	c.214C>A	c.(214-216)CCC>ACC	p.P72T	CD96_uc003dxw.1_Intron|CD96_uc003dxx.1_Intron|CD96_uc010hpy.1_Intron|CD96_uc003dxv.2_Intron|ZBED2_uc010hpz.1_Missense_Mutation_p.P72T	NM_024508	NP_078784	Q9BTP6	ZBED2_HUMAN	zinc finger, BED domain containing 2	72	BED-type.						DNA binding|metal ion binding				0														0.294118	25.435459	26.726058	10	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	112795525	112795525	18102	3	G	T	T	41	41	ZBED2	T	3	3
DNAJC13	23317	broad.mit.edu	36	3	133636106	133636106	+	Missense_Mutation	SNP	A	C	C			TCGA-06-1800-01	TCGA-06-1800-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:133636106A>C	uc003eor.1	+	c.22A>C	c.(22-24)AAG>CAG	p.K8Q	DNAJC13_uc010htq.1_Missense_Mutation_p.K8Q	NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	8							heat shock protein binding			breast(1)	1														0.265823	63.040115	66.953671	21	58	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	133636106	133636106	4815	3	A	C	C	13	13	DNAJC13	C	4	4
COL7A1	1294	broad.mit.edu	36	3	48598617	48598617	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:48598617C>G	uc003ctz.2	-	c.3617G>C	c.(3616-3618)GGT>GCT	p.G1206A		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1206	Nonhelical region (NC1).|VWFA 2.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(2)	9				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)										0.333333	6.420051	6.642432	3	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48598617	48598617	3842	3	C	G	G	18	18	COL7A1	G	3	3
MST1R	4486	broad.mit.edu	36	3	49915914	49915914	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49915914C>T	uc003cxy.2	-	c.133G>A	c.(133-135)GTG>ATG	p.V45M		NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	45	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|protein phosphorylation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)						205				0.348837	88.729949	90.461376	30	56	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49915914	49915914	10284	3	C	T	T	19	19	MST1R	T	1	1
NSUN3	63899	broad.mit.edu	36	3	95285778	95285778	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1800-01	TCGA-06-1800-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:95285778A>T	uc003drl.1	+	c.260A>T	c.(259-261)AAA>ATA	p.K87I	NSUN3_uc010hos.1_Missense_Mutation_p.K87I	NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3	87							methyltransferase activity				0														0.40367	135.979893	136.863689	44	65	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95285778	95285778	11084	3	A	T	T	1	1	NSUN3	T	4	4
RGS12	6002	broad.mit.edu	36	4	3288382	3288382	+	Silent	SNP	G	T	T			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:3288382G>T	uc003ggw.1	+	c.687G>T	c.(685-687)GCG>GCT	p.A229A	RGS12_uc003ggu.2_Silent_p.A229A|RGS12_uc010ics.1_Intron|RGS12_uc003ggv.1_Silent_p.A229A|RGS12_uc003ggx.1_Silent_p.A229A	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	229	PID.					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)										0.253968	37.366176	40.831375	16	47	GG		KEEP	---	---	---	---	capture			Silent	SNP	3288382	3288382	13769	4	G	T	T	37	37	RGS12	T	3	3
OTOP1	133060	broad.mit.edu	36	4	4255112	4255112	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:4255112G>A	uc003ghp.1	-	c.694C>T	c.(694-696)CGG>TGG	p.R232W		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	232					biomineral tissue development	extracellular space|integral to membrane				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)										0.206612	55.102911	64.763799	25	96	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4255112	4255112	11717	4	G	A	A	40	40	OTOP1	A	1	1
CORIN	10699	broad.mit.edu	36	4	47323226	47323226	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:47323226G>C	uc003gxm.1	-	c.2268C>G	c.(2266-2268)AAC>AAG	p.N756K		NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	756	Extracellular (Potential).|SRCR.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)	1														0.4329	327.371817	328.277171	100	131	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47323226	47323226	3890	4	G	C	C	36	36	CORIN	C	3	3
SLC10A6	345274	broad.mit.edu	36	4	87973576	87973576	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:87973576C>T	uc003hqd.1	-	c.403G>A	c.(403-405)GTG>ATG	p.V135M		NM_197965	NP_932069	Q3KNW5	SOAT_HUMAN	sodium-dependent organic anion transporter	135	Helical; (Potential).					integral to membrane|plasma membrane	bile acid:sodium symporter activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)										0.286957	91.431166	96.111525	33	82	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87973576	87973576	14873	4	C	T	T	19	19	SLC10A6	T	1	1
FBN2	2201	broad.mit.edu	36	5	127669189	127669189	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:127669189G>A	uc003kuu.1	-	c.5587C>T	c.(5587-5589)CGG>TGG	p.R1863W		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1863	EGF-like 30; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|kidney(1)|pancreas(1)	14		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)					p.R1863R(SNU738-Tumor)	1552				0.43379	299.79864	300.634063	95	124	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	127669189	127669189	5939	5	G	A	A	38	38	FBN2	A	1	1
NRG2	9542	broad.mit.edu	36	5	139211442	139211442	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:139211442C>T	uc003lev.1	-	c.1727G>A	c.(1726-1728)CGG>CAG	p.R576Q	NRG2_uc003lew.1_Missense_Mutation_p.R570Q|NRG2_uc003lex.1_Missense_Mutation_p.R568Q|NRG2_uc003ley.1_Missense_Mutation_p.R562Q	NM_013982	NP_053585	O14511	NRG2_HUMAN	neuregulin 2 isoform 3	568	Cytoplasmic (Potential).				embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.229167	26.497968	29.732317	11	37	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139211442	139211442	11053	5	C	T	T	23	23	NRG2	T	1	1
ATP10B	23120	broad.mit.edu	36	5	159925064	159925064	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:159925064G>A	uc003lym.1	-	c.4360C>T	c.(4360-4362)CGA>TGA	p.R1454*	ATP10B_uc010jit.1_Nonsense_Mutation_p.R704*	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1454	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)											0.372024	393.599328	398.429476	125	211	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	159925064	159925064	1136	5	G	A	A	39	39	ATP10B	A	5	1
MCHR2	84539	broad.mit.edu	36	6	100497567	100497567	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:100497567G>A	uc003pqh.1	-	c.566C>T	c.(565-567)ACA>ATA	p.T189I	MCHR2_uc003pqi.1_Missense_Mutation_p.T189I	NM_001040179	NP_115892	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	189	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)										0.102273	15.114051	42.873107	18	158	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100497567	100497567	9772	6	G	A	A	48	48	MCHR2	A	2	2
COL10A1	1300	broad.mit.edu	36	6	116548066	116548066	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:116548066C>T	uc003pwm.1	-	c.1906G>A	c.(1906-1908)GCT>ACT	p.A636T	NT5DC1_uc003pwj.1_Intron|NT5DC1_uc003pwk.1_Intron|NT5DC1_uc003pwl.1_Intron	NM_000493	NP_000484	Q03692	COAA1_HUMAN	type X collagen alpha 1 precursor	636	Nonhelical region (NC1).|C1q.				skeletal system development	collagen	metal ion binding				0		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)										0.303571	43.748471	45.680261	17	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116548066	116548066	3804	6	C	T	T	26	26	COL10A1	T	2	2
TSPYL1	7259	broad.mit.edu	36	6	116707554	116707554	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:116707554C>T	uc003pwp.2	-	c.133G>A	c.(133-135)GTG>ATG	p.V45M	DSE_uc003pwq.1_5'UTR|DSE_uc003pwr.2_5'Flank|DSE_uc003pws.1_5'Flank	NM_003309	NP_003300	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	45					nucleosome assembly	nucleolus					0		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)										0.411765	20.520476	20.636382	7	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116707554	116707554	17212	6	C	T	T	18	18	TSPYL1	T	2	2
ME1	4199	broad.mit.edu	36	6	83990257	83990257	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:83990257C>A	uc003pjy.1	-	c.1390G>T	c.(1390-1392)GGT>TGT	p.G464C		NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	464					carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|oxidation-reduction process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			ovary(1)	1		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)									0.286611	389.567299	409.100314	137	341	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	83990257	83990257	9806	6	C	A	A	21	21	ME1	A	3	3
WDR91	29062	broad.mit.edu	36	7	134544096	134544096	+	Silent	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:134544096C>T	uc003vsp.1	-	c.498G>A	c.(496-498)CTG>CTA	p.L166L	WDR91_uc010lmq.1_5'Flank|WDR91_uc010lmr.1_5'Flank	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	166										breast(2)|ovary(1)	3														0.150862	56.164382	83.280051	35	197	CC		KEEP	---	---	---	---	capture			Silent	SNP	134544096	134544096	17912	7	C	T	T	17	17	WDR91	T	2	2
TNRC18	84629	broad.mit.edu	36	7	5363335	5363335	+	Silent	SNP	C	T	T			TCGA-06-1800-01	TCGA-06-1800-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:5363335C>T	uc003soi.2	-	c.4932G>A	c.(4930-4932)TCG>TCA	p.S1644S	TNRC18_uc003soj.2_Silent_p.S26S	NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1644							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)										0.253247	498.015861	540.546993	195	575	CC		KEEP	---	---	---	---	capture			Silent	SNP	5363335	5363335	16880	7	C	T	T	27	27	TNRC18	T	1	1
ZNF713	349075	broad.mit.edu	36	7	55958846	55958846	+	Silent	SNP	A	G	G			TCGA-06-1800-01	TCGA-06-1800-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55958846A>G	uc003tra.1	+	c.228A>G	c.(226-228)GAA>GAG	p.E76E	MRPS17_uc003trb.1_Silent_p.E76E|ZNF713_uc003trc.1_Silent_p.E76E	NM_182633	NP_872439	Q8N859	ZN713_HUMAN	zinc finger protein 713	76	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)											0.37931	105.356306	106.467277	33	54	AA		KEEP	---	---	---	---	capture			Silent	SNP	55958846	55958846	18713	7	A	G	G	4	4	ZNF713	G	4	4
SAMD9	54809	broad.mit.edu	36	7	92569232	92569232	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1800-01	TCGA-06-1800-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:92569232A>G	uc003umf.1	-	c.4115T>C	c.(4114-4116)CTC>CCC	p.L1372P	SAMD9_uc003umg.1_Missense_Mutation_p.L1372P|SAMD9_uc010lfa.1_Missense_Mutation_p.L1372P	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1372						cytoplasm				ovary(3)|breast(1)|central_nervous_system(1)	5	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)											0.326733	96.340566	99.030066	33	68	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	92569232	92569232	14306	7	A	G	G	11	11	SAMD9	G	4	4
SLC6A14	11254	broad.mit.edu	36	X	115488937	115488937	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:115488937G>T	uc004eqi.1	+	c.607G>T	c.(607-609)GGC>TGC	p.G203C		NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	203	Extracellular (Potential).				cellular amino acid metabolic process|response to toxin	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)									0.823529	98.718959	102.071949	28	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	115488937	115488937	15174	23	G	T	T	39	39	SLC6A14	T	3	3
AFF2	2334	broad.mit.edu	36	X	147551673	147551673	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:147551673G>A	uc004fcp.1	+	c.733G>A	c.(733-735)GCC>ACC	p.A245T	AFF2_uc004fcq.1_Missense_Mutation_p.A241T|AFF2_uc004fcr.1_Missense_Mutation_p.A241T|AFF2_uc004fcs.1_Missense_Mutation_p.A241T|AFF2_uc004fco.2_Missense_Mutation_p.A241T	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	245					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)													0.765625	154.292889	158.419201	49	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	147551673	147551673	358	23	G	A	A	38	38	AFF2	A	1	1
GPR50	9248	broad.mit.edu	36	X	150096040	150096040	+	Splice_Site_SNP	SNP	T	G	G			TCGA-06-1800-01	TCGA-06-1800-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:150096040T>G	uc010ntg.1	+	c.e1_splice_site				NM_004224	NP_004215			G protein-coupled receptor 50						cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)													0.253968	189.919331	210.703087	96	282	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	150096040	150096040	6972	23	T	G	G	57	57	GPR50	G	5	4
MXRA5	25878	broad.mit.edu	36	X	3250024	3250024	+	Silent	SNP	G	A	A			TCGA-06-1800-01	TCGA-06-1800-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:3250024G>A	uc004crg.2	-	c.3702C>T	c.(3700-3702)CAC>CAT	p.H1234H		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican	1234						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(23;0.00031)|Lung NSC(23;0.000946)												0.191318	264.174412	319.551662	119	503	GG		KEEP	---	---	---	---	capture			Silent	SNP	3250024	3250024	10397	23	G	A	A	40	40	MXRA5	A	1	1
BIRC6	57448	broad.mit.edu	36	2	32676373	32676379	+	Frame_Shift_Del	DEL	TAAATTA	-	-			TCGA-06-1800-01	TCGA-06-1800-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:32676373_32676379delTAAATTA	uc010ezu.1	+	c.13664_13670delTAAATTA	c.(13663-13671)GTAAATTACfs	p.V4555fs		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4555_4557					anti-apoptosis|apoptosis|post-translational protein modification	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					Pancreas(94;175 1509 16028 18060 45422)			p.V4555G(KMS26-Tumor)|p.Y4557H(CCK81-Tumor)	1555				0.51			172	167				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	32676373	32676379	1463	2	TAAATTA	-	-	57	57	BIRC6	-	5	5
NUP210	23225	broad.mit.edu	36	3	13376806	13376824	+	Frame_Shift_Del	DEL	GTGTTGCTGATAATTCCGG	-	-			TCGA-06-1800-01	TCGA-06-1800-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:13376806_13376824delGTGTTGCTGATAATTCCGG	uc003bxv.1	-	c.2100_2118delCCGGAATTATCAGCAACAC	c.(2098-2118)TCCCGGAATTATCAGCAACACfs	p.S700fs	NUP210_uc003bxx.2_Frame_Shift_Del_p.S372fs	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210	700_706	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(2)|pancreas(1)|liver(1)	10	all_neural(104;0.187)								p.S700S(BT549-Tumor)	587				0.54			101	85				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	13376806	13376824	11165	3	GTGTTGCTGATAATTCCGG	-	-	36	36	NUP210	-	5	5
SIL1	64374	broad.mit.edu	36	5	138310851	138310852	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-1800-01	TCGA-06-1800-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:138310851_138310852insA	uc003ldm.1	-	c.1239_1240insT	c.(1237-1242)CGTCAGfs	p.R413fs	SIL1_uc003ldn.1_Frame_Shift_Ins_p.R412fs|SIL1_uc003ldo.1_Frame_Shift_Ins_p.R413fs|SIL1_uc003ldp.1_Frame_Shift_Ins_p.R413fs	NM_022464	NP_071909	Q9H173	SIL1_HUMAN	SIL1 protein precursor	413_414					intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)											0.38			3	5				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	138310851	138310852	14816	5	-	A	A	45	45	SIL1	A	5	5
EGR3	1960	broad.mit.edu	36	8	22603966	22603967	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-1800-01	TCGA-06-1800-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:22603966_22603967insG	uc003xcm.1	-	c.1128_1129insC	c.(1126-1131)CCCGTGfs	p.P376fs		NM_004430	NP_004421	Q06889	EGR3_HUMAN	early growth response 3	376_377					circadian rhythm|muscle organ development|regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	22603966	22603967	5162	8	-	G	G	19	19	EGR3	G	5	5
