Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
SORCS3	22986	broad.mit.edu	36	10	107005526	107005526	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:107005526T>G	uc001kyi.1	+	c.3314T>G	c.(3313-3315)GTG>GGG	p.V1105G		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3	1105	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|central_nervous_system(1)	7		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)				NSCLC(116;1497 1690 7108 13108 14106)								0.523077	111.638498	111.667976	34	31	TT		KEEP	---	---	---	---	capture		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)	Missense_Mutation	SNP	107005526	107005526	15432	10	T	G	G	59	59	SORCS3	G	4	4
AKR1C1	1645	broad.mit.edu	36	10	5004817	5004817	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2557-01	TCGA-06-2557-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:5004817T>A	uc001iho.1	+	c.722T>A	c.(721-723)CTT>CAT	p.L241H	AKR1E2_uc001ihl.1_Intron|AKR1C3_uc001ihr.1_Intron|AKR1C1_uc001ihq.1_Missense_Mutation_p.L241H	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	241	NADP (By similarity).				bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|oxidation-reduction process|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)	Colon(130;2054 2316 13360 15380)								0.183099	25.030397	31.726549	13	58	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5004817	5004817	472	10	T	A	A	56	56	AKR1C1	A	4	4
KRTAP5-5	439915	broad.mit.edu	36	11	1608108	1608108	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:1608108C>G	uc001lty.1	+	c.462C>G	c.(460-462)TGC>TGG	p.C154W		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	154	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)												0.194444	7.231073	10.502604	7	29	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)	Missense_Mutation	SNP	1608108	1608108	8886	11	C	G	G	28	28	KRTAP5-5	G	3	3
MADD	8567	broad.mit.edu	36	11	47263698	47263698	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:47263698G>A	uc001ner.1	+	c.2532G>A	c.(2530-2532)GGG>GGA	p.G844G	MADD_uc001neq.1_Silent_p.G844G|MADD_uc001nes.1_Silent_p.G801G|MADD_uc001net.1_Silent_p.G844G|MADD_uc001neu.1_Silent_p.G801G|MADD_uc001nev.1_Silent_p.G801G|MADD_uc009yln.1_Silent_p.G801G|MADD_uc001ney.1_Silent_p.G844G|MADD_uc001nez.1_Silent_p.G801G|MADD_uc001new.1_Silent_p.G844G|MADD_uc001nex.1_Silent_p.G844G	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	844					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(3)|central_nervous_system(2)	10										5				0.259259	161.823697	174.576097	63	180	GG		KEEP	---	---	---	---	capture		Lung(87;0.182)	Silent	SNP	47263698	47263698	9529	11	G	A	A	43	43	MADD	A	2	2
OR5T3	390154	broad.mit.edu	36	11	55776455	55776455	+	Silent	SNP	C	A	A			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55776455C>A	uc001nin.1	+	c.204C>A	c.(202-204)ACC>ACA	p.T68T		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	68	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)													0.389222	190.232172	192.02934	65	102	CC		KEEP	---	---	---	---	capture			Silent	SNP	55776455	55776455	11593	11	C	A	A	24	24	OR5T3	A	3	3
MS4A3	932	broad.mit.edu	36	11	59591151	59591151	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:59591151C>T	uc001nom.1	+	c.503C>T	c.(502-504)TCC>TTC	p.S168F	MS4A3_uc001non.1_Missense_Mutation_p.S122F|MS4A3_uc001noo.1_Missense_Mutation_p.S45F	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	168	Extracellular (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)	2		all_epithelial(135;0.245)												0.277778	40.304241	42.702044	15	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59591151	59591151	10254	11	C	T	T	30	30	MS4A3	T	2	2
FLRT1	23769	broad.mit.edu	36	11	63640713	63640713	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:63640713A>G	uc001nyi.1	+	c.398A>G	c.(397-399)CAC>CGC	p.H133R	MACROD1_uc001nyh.1_Intron|FLRT1_uc009ypc.1_Missense_Mutation_p.H133R	NM_013280	NP_037412	Q9NZU1	FLRT1_HUMAN	fibronectin leucine rich transmembrane protein	105	LRR 3.|Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity				0														0.309524	72.620623	75.335072	26	58	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63640713	63640713	6180	11	A	G	G	6	6	FLRT1	G	4	4
KAT5	10524	broad.mit.edu	36	11	65238727	65238727	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:65238727C>T	uc001ofk.1	+	c.876C>T	c.(874-876)GTC>GTT	p.V292V	KAT5_uc001ofi.1_Silent_p.V259V|KAT5_uc001ofj.1_Silent_p.V207V|KAT5_uc001ofl.1_Silent_p.V48V	NM_182710	NP_874369	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5 isoform 1	259					androgen receptor signaling pathway|chromatin assembly or disassembly|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|double-strand break repair|interspecies interaction between organisms|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of interleukin-2 production|positive regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	chromatin|NuA4 histone acetyltransferase complex|nucleolus|perinuclear region of cytoplasm|Piccolo NuA4 histone acetyltransferase complex	androgen receptor binding|chromatin binding|histone acetyltransferase activity|metal ion binding|repressing transcription factor binding|transcription coactivator activity|transcription repressor activity				0														0.413386	312.661226	314.315143	105	149	CC		KEEP	---	---	---	---	capture			Silent	SNP	65238727	65238727	8287	11	C	T	T	30	30	KAT5	T	2	2
GSTP1	2950	broad.mit.edu	36	11	67108595	67108595	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:67108595A>G	uc001omf.1	+	c.122A>G	c.(121-123)GAG>GGG	p.E41G	GSTP1_uc001omg.1_Missense_Mutation_p.E22G	NM_000852	NP_000843	P09211	GSTP1_HUMAN	glutathione transferase	41	GST N-terminal.				anti-apoptosis|cellular response to lipopolysaccharide|central nervous system development|common myeloid progenitor cell proliferation|glutathione metabolic process|negative regulation of acute inflammatory response|negative regulation of ERK1 and ERK2 cascade|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 beta production|negative regulation of JUN kinase activity|negative regulation of leukocyte proliferation|negative regulation of monocyte chemotactic protein-1 production|negative regulation of necrotic cell death|negative regulation of nitric-oxide synthase 2 biosynthetic process|negative regulation of stress-activated MAPK cascade|negative regulation of tumor necrosis factor production|negative regulation of tumor necrosis factor-mediated signaling pathway|nitric oxide storage|positive regulation of superoxide anion generation|response to reactive oxygen species|xenobiotic metabolic process	cytosol|protein complex	dinitrosyl-iron complex binding|glutathione transferase activity|JUN kinase binding|kinase regulator activity|nitric oxide binding|S-nitrosoglutathione binding			ovary(1)	1					Ethacrynic acid(DB00903)|Glutathione(DB00143)									0.307692	7.580443	8.018324	4	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	67108595	67108595	7124	11	A	G	G	11	11	GSTP1	G	4	4
ATF7IP	55729	broad.mit.edu	36	12	14480326	14480326	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:14480326A>T	uc001rbw.1	+	c.1665A>T	c.(1663-1665)AAA>AAT	p.K555N	ATF7IP_uc001rbu.2_Missense_Mutation_p.K555N|ATF7IP_uc001rbv.1_Missense_Mutation_p.K554N|ATF7IP_uc001rbx.1_Missense_Mutation_p.K554N|ATF7IP_uc001rby.2_Missense_Mutation_p.K555N|ATF7IP_uc001rca.1_Missense_Mutation_p.K555N	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	555	Glu-rich.|Nuclear localization signal (By similarity).				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5														0.212766	43.962127	51.119478	20	74	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14480326	14480326	1106	12	A	T	T	2	2	ATF7IP	T	4	4
KRT84	3890	broad.mit.edu	36	12	51065486	51065486	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51065486C>A	uc001sah.1	-	c.151G>T	c.(151-153)GGT>TGT	p.G51C		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	51	Head.					keratin filament	structural constituent of epidermis				0	all_hematologic(5;0.12)													0.327273	97.68265	100.583054	36	74	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(357;0.189)	Missense_Mutation	SNP	51065486	51065486	8813	12	C	A	A	21	21	KRT84	A	3	3
KRT76	51350	broad.mit.edu	36	12	51451137	51451137	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51451137C>T	uc001sax.1	-	c.1397G>A	c.(1396-1398)CGT>CAT	p.R466H		NM_015848	NP_056932	Q01546	K22O_HUMAN	keratin 76	466	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			breast(1)	1														0.421875	74.710602	75.051992	27	37	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51451137	51451137	8804	12	C	T	T	19	19	KRT76	T	1	1
APOBEC1	339	broad.mit.edu	36	12	7696600	7696600	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7696600C>T	uc001qtb.1	-	c.143G>A	c.(142-144)CGG>CAG	p.R48Q	APOBEC1_uc001qtc.1_Missense_Mutation_p.R3Q	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	48					cytidine to uridine editing|lipid metabolic process|mRNA modification|mRNA processing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						Pancreas(135;929 1826 4531 10527 41012)								0.17	35.424144	45.718424	17	83	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7696600	7696600	798	12	C	T	T	23	23	APOBEC1	T	1	1
GPR65	8477	broad.mit.edu	36	14	87547826	87547826	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:87547826C>T	uc001xvv.1	+	c.882C>T	c.(880-882)ACC>ACT	p.T294T	GPR65_uc010ate.1_Silent_p.T294T	NM_003608	NP_003599	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	294	Helical; Name=7; (Potential).				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity				0														0.137931	26.623609	41.328265	16	100	CC		KEEP	---	---	---	---	capture			Silent	SNP	87547826	87547826	6981	14	C	T	T	23	23	GPR65	T	1	1
DICER1	23405	broad.mit.edu	36	14	94627146	94627146	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:94627146C>T	uc001ydw.2	-	c.5581G>A	c.(5581-5583)GAA>AAA	p.E1861K	DICER1_uc010avh.1_Missense_Mutation_p.E759K|DICER1_uc001ydv.2_Missense_Mutation_p.E1851K|DICER1_uc001ydx.2_Missense_Mutation_p.E1861K	NM_030621	NP_803187	Q9UPY3	DICER_HUMAN	dicer1	1861	DRBM.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-microRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			ovary(1)|pancreas(1)|lung(1)|skin(1)	4		all_cancers(154;0.0621)|all_epithelial(191;0.223)								741				0.274725	65.531211	69.693533	25	66	CC		KEEP	---	---	---	---	capture		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)	Missense_Mutation	SNP	94627146	94627146	4700	14	C	T	T	30	30	DICER1	T	2	2
POLG	5428	broad.mit.edu	36	15	87663574	87663574	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:87663574G>C	uc002bns.2	-	c.2993C>G	c.(2992-2994)TCG>TGG	p.S998W	POLG_uc002bnr.2_Missense_Mutation_p.S998W	NM_002693	NP_002684	P54098	DPOG1_HUMAN	DNA polymerase gamma	998					base-excision repair, gap-filling|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					Colon(73;648 1203 11348 18386 27782)								0.227273	6.953438	8.490063	5	17	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(125;0.165)		Missense_Mutation	SNP	87663574	87663574	12628	15	G	C	C	37	37	POLG	C	3	3
IL27	246778	broad.mit.edu	36	16	28422613	28422613	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:28422613C>T	uc002dqc.1	-	c.207G>A	c.(205-207)GCG>GCA	p.A69A		NM_145659	NP_663634	Q8NEV9	IL27A_HUMAN	interleukin 27	69					inflammatory response|innate immune response|positive regulation of interferon-gamma biosynthetic process|regulation of defense response to virus|regulation of T cell proliferation|regulation of T-helper 1 cell differentiation	extracellular space	cytokine activity|interleukin-27 receptor binding				0														0.25	37.84683	41.222876	15	45	CC		KEEP	---	---	---	---	capture			Silent	SNP	28422613	28422613	7981	16	C	T	T	23	23	IL27	T	1	1
HEATR3	55027	broad.mit.edu	36	16	48664126	48664126	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:48664126G>A	uc002efw.1	+	c.622G>A	c.(622-624)GCA>ACA	p.A208T	HEATR3_uc002efx.1_Missense_Mutation_p.A122T	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	208							binding			ovary(1)	1														0.632911	173.369687	174.596211	50	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48664126	48664126	7312	16	G	A	A	35	35	HEATR3	A	2	2
MYH13	8735	broad.mit.edu	36	17	10156088	10156088	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:10156088C>T	uc002gmk.1	-	c.4396G>A	c.(4396-4398)GAA>AAA	p.E1466K		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1466	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)	4														0.308824	55.957166	58.167919	21	47	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10156088	10156088	10427	17	C	T	T	31	31	MYH13	T	1	1
MYO15A	51168	broad.mit.edu	36	17	17993350	17993350	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:17993350G>C	uc010cpt.1	+	c.7052G>C	c.(7051-7053)AGC>ACC	p.S2351T	MYO15A_uc010cpu.1_Missense_Mutation_p.S2351T	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2351	Tail.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)|skin(1)	6	all_neural(463;0.228)													0.217391	7.457463	9.167439	5	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17993350	17993350	10458	17	G	C	C	34	34	MYO15A	C	3	3
GPR179	440435	broad.mit.edu	36	17	33740490	33740490	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:33740490G>T	uc002hpz.1	-	c.2488C>A	c.(2488-2490)CCC>ACC	p.P830T		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1	830	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)												0.5	10.721132	10.721132	4	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33740490	33740490	6949	17	G	T	T	44	44	GPR179	T	3	3
RAX	30062	broad.mit.edu	36	18	55091133	55091133	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:55091133C>T	uc002lhx.1	-	c.286G>A	c.(286-288)GAA>AAA	p.E96K	RAX_uc010dpp.1_Missense_Mutation_p.E87K	NM_013435	NP_038463	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	96					regulation of transcription, DNA-dependent|visual perception	nucleus	RNA polymerase II transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1		Lung NSC(161;0.0804)|Colorectal(73;0.0946)				GBM(150;770 1898 17679 24325 37807)								0.4	16.954474	17.083072	6	9	CC		KEEP	---	---	---	---	capture		STAD - Stomach adenocarcinoma(84;0.18)	Missense_Mutation	SNP	55091133	55091133	13557	18	C	T	T	31	31	RAX	T	1	1
ATG4D	84971	broad.mit.edu	36	19	10516709	10516709	+	Silent	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:10516709T>G	uc002mov.1	+	c.396T>G	c.(394-396)CCT>CCG	p.P132P	ATG4D_uc010dxh.1_Non-coding_Transcript|ATG4D_uc010dxi.1_Non-coding_Transcript|ATG4D_uc010dxj.1_5'UTR	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	132					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0														0.292254	208.357151	219.373207	83	201	TT		KEEP	---	---	---	---	capture	Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)		Silent	SNP	10516709	10516709	1118	19	T	G	G	55	55	ATG4D	G	4	4
ZNF208	7757	broad.mit.edu	36	19	21948487	21948487	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:21948487A>G	uc002nqp.1	-	c.1189T>C	c.(1189-1191)TAC>CAC	p.Y397H	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)	5		all_lung(12;0.0961)|Lung NSC(12;0.103)												0.302752	102.731359	106.518436	33	76	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21948487	21948487	18357	19	A	G	G	15	15	ZNF208	G	4	4
PTGIR	5739	broad.mit.edu	36	19	51816468	51816468	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:51816468A>C	uc002pex.1	-	c.1070T>G	c.(1069-1071)GTG>GGG	p.V357G		NM_000960	NP_000951	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	357	Cytoplasmic (Potential).				cell-cell signaling|G-protein signaling, coupled to cyclic nucleotide second messenger|platelet activation	integral to plasma membrane	G-protein coupled receptor activity|guanyl-nucleotide exchange factor activity				0		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)			Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Epoprostenol(DB01240)|Iloprost(DB01088)|Misoprostol(DB00929)									0.181818	7.35683	11.74597	8	36	AA		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Missense_Mutation	SNP	51816468	51816468	13206	19	A	C	C	6	6	PTGIR	C	4	4
TTF2	8458	broad.mit.edu	36	1	117404628	117404628	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:117404628C>T	uc001egy.1	+	c.57C>T	c.(55-57)GTC>GTT	p.V19V	TTF2_uc001egx.1_Silent_p.V19V	NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	19					mRNA processing|regulation of transcription, DNA-dependent|RNA splicing	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|RNA polymerase II transcription termination factor activity|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)												0.396552	132.421705	133.508974	46	70	CC		KEEP	---	---	---	---	capture		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)	Silent	SNP	117404628	117404628	17274	1	C	T	T	30	30	TTF2	T	2	2
AQP10	89872	broad.mit.edu	36	1	152561140	152561140	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152561140C>T	uc001feu.1	+	c.213C>T	c.(211-213)TAC>TAT	p.Y71Y	AQP10_uc001fev.2_Silent_p.Y71Y	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	71	Helical; (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)													0.215686	24.100657	27.902867	11	40	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.185)		Silent	SNP	152561140	152561140	833	1	C	T	T	19	19	AQP10	T	1	1
ATP13A2	23400	broad.mit.edu	36	1	17187420	17187420	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:17187420C>T	uc001baa.1	-	c.2746G>A	c.(2746-2748)GTG>ATG	p.V916M	ATP13A2_uc001azz.1_Missense_Mutation_p.V63M|ATP13A2_uc001bab.1_Missense_Mutation_p.V911M|ATP13A2_uc001bac.1_Missense_Mutation_p.V872M	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	916	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)												0.521186	369.752759	369.847854	123	113	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Missense_Mutation	SNP	17187420	17187420	1143	1	C	T	T	19	19	ATP13A2	T	1	1
PLA2G2A	5320	broad.mit.edu	36	1	20177511	20177511	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:20177511C>G	uc001bcu.1	-	c.134G>C	c.(133-135)GGC>GCC	p.G45A	PLA2G2A_uc001bcv.1_Missense_Mutation_p.G45A	NM_000300	NP_000291	P14555	PA2GA_HUMAN	phospholipase A2, group IIA	45					defense response to Gram-positive bacterium|lipid catabolic process|low-density lipoprotein particle remodeling|phosphatidic acid metabolic process|positive regulation of inflammatory response|positive regulation of macrophage derived foam cell differentiation	endoplasmic reticulum|extracellular space|membrane	calcium ion binding|calcium-dependent phospholipase A2 activity|phospholipid binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)												0.285714	8.355032	8.896803	4	10	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Missense_Mutation	SNP	20177511	20177511	12421	1	C	G	G	26	26	PLA2G2A	G	3	3
MYSM1	114803	broad.mit.edu	36	1	58905317	58905317	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:58905317T>C	uc009wab.1	-	c.2012A>G	c.(2011-2013)GAC>GGC	p.D671G	MYSM1_uc009waa.1_Missense_Mutation_p.D77G|MYSM1_uc001czc.2_Non-coding_Transcript	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	671	MPN.				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0	all_cancers(7;9.36e-06)													0.583333	202.224684	202.809466	56	40	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	58905317	58905317	10496	1	T	C	C	58	58	MYSM1	C	4	4
NAPB	63908	broad.mit.edu	36	20	23331673	23331673	+	Nonsense_Mutation	SNP	A	T	T			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:23331673A>T	uc002wtb.1	-	c.135T>A	c.(133-135)TAT>TAA	p.Y45*	NAPB_uc002wta.1_Nonsense_Mutation_p.Y45*|NAPB_uc002wtc.1_5'UTR|NAPB_uc002wtd.2_Non-coding_Transcript	NM_022080	NP_071363	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment	45					intracellular protein transport|vesicle-mediated transport	membrane				ovary(1)	1	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)													0.292453	84.288802	88.374058	31	75	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	23331673	23331673	10558	20	A	T	T	16	16	NAPB	T	5	4
LAMA5	3911	broad.mit.edu	36	20	60320088	60320088	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:60320088G>C	uc002ycq.1	-	c.9783C>G	c.(9781-9783)TGC>TGG	p.C3261W		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5	3261	Laminin G-like 3.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding|receptor activity|structural molecule activity			pancreas(1)	1	Breast(26;1.57e-08)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.333333	7.493469	7.789947	4	8	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Missense_Mutation	SNP	60320088	60320088	8932	20	G	C	C	46	46	LAMA5	C	3	3
PRDM15	63977	broad.mit.edu	36	21	42152816	42152816	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:42152816C>T	uc002yzq.1	-	c.985G>A	c.(985-987)GGC>AGC	p.G329S	PRDM15_uc002yzo.1_Missense_Mutation_p.G66S|PRDM15_uc002yzp.1_Missense_Mutation_p.G66S|PRDM15_uc002yzr.1_Missense_Mutation_p.G66S	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	329					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.484848	51.303551	51.309853	16	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42152816	42152816	12898	21	C	T	T	22	22	PRDM15	T	2	2
SEC14L3	266629	broad.mit.edu	36	22	29187619	29187619	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29187619G>A	uc003ahy.1	-	c.834C>T	c.(832-834)TAC>TAT	p.Y278Y	SEC14L3_uc003ahz.1_Silent_p.Y201Y|SEC14L3_uc003aia.1_Silent_p.Y219Y|SEC14L3_uc003aib.1_Silent_p.Y219Y	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	278	GOLD.					integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	Esophageal Squamous(108;290 1516 3584 23771 37333)								0.228571	17.106496	19.455432	8	27	GG		KEEP	---	---	---	---	capture			Silent	SNP	29187619	29187619	14469	22	G	A	A	40	40	SEC14L3	A	1	1
CCDC138	165055	broad.mit.edu	36	2	108777429	108777429	+	Silent	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:108777429T>C	uc002ten.1	+	c.396T>C	c.(394-396)GTT>GTC	p.V132V	CCDC138_uc002teo.1_Silent_p.V132V|CCDC138_uc002tep.1_5'UTR|CCDC138_uc010fjm.1_5'UTR	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	132											0														0.221311	71.356613	80.081684	27	95	TT		KEEP	---	---	---	---	capture			Silent	SNP	108777429	108777429	2892	2	T	C	C	63	63	CCDC138	C	4	4
POTEF	728378	broad.mit.edu	36	2	130594205	130594205	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:130594205G>A	uc010fmh.1	-	c.354C>T	c.(352-354)GGC>GGT	p.G118G	POTEF_uc010fmi.1_Non-coding_Transcript|POTEF_uc010fmj.1_Non-coding_Transcript	NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	118						cell cortex	ATP binding			ovary(2)|skin(1)	3														0.339623	95.770047	98.178984	36	70	GG		KEEP	---	---	---	---	capture			Silent	SNP	130594205	130594205	12695	2	G	A	A	38	38	POTEF	A	1	1
LRP1B	53353	broad.mit.edu	36	2	141703429	141703429	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:141703429C>A	uc002tvj.1	-	c.643G>T	c.(643-645)GAG>TAG	p.E215*	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	215	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|ovary(10)|pancreas(3)|central_nervous_system(2)|liver(1)|kidney(1)	34		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)				Colon(99;50 2074 2507 20106)				2546	TSP Lung(27;0.18)			0.307018	93.17693	96.965492	35	79	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)	Nonsense_Mutation	SNP	141703429	141703429	9328	2	C	A	A	29	29	LRP1B	A	5	3
FAM136A	84908	broad.mit.edu	36	2	70377967	70377967	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:70377967C>T	uc002sgq.2	-	c.375G>A	c.(373-375)ATG>ATA	p.M125I	FAM136A_uc010fdp.1_Non-coding_Transcript	NM_032822	NP_116211	Q96C01	F136A_HUMAN	hypothetical protein LOC84908	125						mitochondrion	protein binding				0														0.36478	164.400432	166.960377	58	101	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70377967	70377967	5647	2	C	T	T	29	29	FAM136A	T	2	2
NAT8B	51471	broad.mit.edu	36	2	73781798	73781798	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:73781798C>T	uc002sjk.1	-	c.143G>A	c.(142-144)GGG>GAG	p.G48E		NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN	N-acetyltransferase 8B	48	Helical; (Potential).				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity				0														0.261538	89.007399	95.687873	34	96	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73781798	73781798	10576	2	C	T	T	22	22	NAT8B	T	2	2
ADRA2B	151	broad.mit.edu	36	2	96144377	96144377	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96144377G>T	uc002svi.1	-	c.1248C>A	c.(1246-1248)TAC>TAA	p.Y416*		NM_000682	NP_000673	P18089	ADA2B_HUMAN	alpha-2B-adrenergic receptor	416	Helical; Name=7; (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation	integral to plasma membrane	alpha2-adrenergic receptor activity|epinephrine binding|protein binding			ovary(2)|lung(1)	3					Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)									0.214286	6.71675	7.772576	3	11	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	96144377	96144377	339	2	G	T	T	36	36	ADRA2B	T	5	3
ABI3BP	25890	broad.mit.edu	36	3	102127950	102127950	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:102127950G>A	uc003dun.1	-	c.166C>T	c.(166-168)CGT>TGT	p.R56C	ABI3BP_uc003duo.1_Missense_Mutation_p.R49C|ABI3BP_uc003dup.2_Missense_Mutation_p.R49C	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding	56						extracellular space				ovary(2)|large_intestine(1)	3														0.367347	100.999352	102.504942	36	62	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102127950	102127950	92	3	G	A	A	38	38	ABI3BP	A	1	1
ZPLD1	131368	broad.mit.edu	36	3	103640063	103640063	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:103640063G>A	uc003dvt.1	+	c.90G>A	c.(88-90)GTG>GTA	p.V30V	ZPLD1_uc003dvs.1_Silent_p.V14V	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	14						integral to membrane				ovary(2)|central_nervous_system(1)	3														0.278481	48.309001	51.802135	22	57	GG		KEEP	---	---	---	---	capture			Silent	SNP	103640063	103640063	18825	3	G	A	A	46	46	ZPLD1	A	2	2
CCDC37	348807	broad.mit.edu	36	3	127635832	127635832	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:127635832G>A	uc010hsg.1	+	c.1549G>A	c.(1549-1551)GAG>AAG	p.E517K	CCDC37_uc003eiu.1_Missense_Mutation_p.E516K	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	516										ovary(1)	1														0.422222	107.93452	108.409099	38	52	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(114;0.166)	Missense_Mutation	SNP	127635832	127635832	2931	3	G	A	A	45	45	CCDC37	A	2	2
B3GALNT1	8706	broad.mit.edu	36	3	162287194	162287194	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:162287194G>C	uc003fdv.1	-	c.43C>G	c.(43-45)CTG>GTG	p.L15V	B3GALNT1_uc003fdw.1_Missense_Mutation_p.L15V|B3GALNT1_uc003fdx.1_Missense_Mutation_p.L15V|B3GALNT1_uc003fdy.1_Missense_Mutation_p.L15V|B3GALNT1_uc003fdz.1_Missense_Mutation_p.L15V|B3GALNT1_uc003fea.1_Missense_Mutation_p.L15V|B3GALNT1_uc010hwg.1_Missense_Mutation_p.L15V	NM_033169	NP_149359	O75752	B3GL1_HUMAN	UDP-Gal:betaGlcNAc beta	15	Cytoplasmic (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity				0														0.191489	20.247204	24.427175	9	38	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)		Missense_Mutation	SNP	162287194	162287194	1266	3	G	C	C	36	36	B3GALNT1	C	3	3
SCN5A	6331	broad.mit.edu	36	3	38597448	38597448	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:38597448G>A	uc003cio.1	-	c.3206C>T	c.(3205-3207)ACG>ATG	p.T1069M	SCN5A_uc003cim.1_Missense_Mutation_p.T935M|SCN5A_uc003cin.1_Missense_Mutation_p.T1069M|SCN5A_uc003cil.2_Missense_Mutation_p.T1069M|SCN5A_uc010hhi.1_Missense_Mutation_p.T1069M|SCN5A_uc010hhj.1_Missense_Mutation_p.T680M|SCN5A_uc010hhk.1_Missense_Mutation_p.T935M	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1069					blood circulation|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|central_nervous_system(1)	7	Medulloblastoma(35;0.163)				Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)									0.157895	15.944665	22.301114	9	48	GG		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Missense_Mutation	SNP	38597448	38597448	14404	3	G	A	A	40	40	SCN5A	A	1	1
SGK1	6446	broad.mit.edu	36	6	134535087	134535087	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:134535087G>A	uc003qeo.2	-	c.1008C>T	c.(1006-1008)TTC>TTT	p.F336F	SGK1_uc003qen.2_Silent_p.F241F	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	241	Protein kinase.				apoptosis|protein phosphorylation|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|central_nervous_system(1)	3	Colorectal(23;0.221)								p.F241F(CAL851-Tumor)	161				0.591133	381.212011	382.681431	120	83	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)	Silent	SNP	134535087	134535087	14698	6	G	A	A	37	37	SGK1	A	1	1
ZNF391	346157	broad.mit.edu	36	6	27476146	27476146	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:27476146G>A	uc003njf.1	+	c.18G>A	c.(16-18)GGG>GGA	p.G6G	ZNF391_uc010jqu.1_Silent_p.G6G	NM_001076781	NP_001070249	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	6					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(2)	2														0.364341	134.38468	136.474938	47	82	GG		KEEP	---	---	---	---	capture			Silent	SNP	27476146	27476146	18472	6	G	A	A	41	41	ZNF391	A	2	2
TREML2	79865	broad.mit.edu	36	6	41274061	41274061	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2557-01	TCGA-06-2557-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:41274061T>C	uc010jxm.1	-	c.317A>G	c.(316-318)AAA>AGA	p.K106R		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	47	Ig-like V-type.|Extracellular (Potential).				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)													0.353135	345.953642	351.708129	107	196	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41274061	41274061	17017	6	T	C	C	64	64	TREML2	C	4	4
C6orf138	442213	broad.mit.edu	36	6	47954853	47954853	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:47954853G>A	uc003oze.2	-	c.1635C>T	c.(1633-1635)AAC>AAT	p.N545N		NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	562						integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1														0.403509	66.213452	66.677424	23	34	GG		KEEP	---	---	---	---	capture			Silent	SNP	47954853	47954853	2435	6	G	A	A	40	40	C6orf138	A	1	1
SRRT	51593	broad.mit.edu	36	7	100316940	100316940	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100316940G>C	uc003uwy.2	+	c.221G>C	c.(220-222)AGC>ACC	p.S74T	SRRT_uc010lhl.1_Missense_Mutation_p.S74T|SRRT_uc003uxa.2_Missense_Mutation_p.S74T|SRRT_uc003uwz.2_Missense_Mutation_p.S74T|SRRT_uc003uwx.2_5'UTR	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	74	Arg-rich.				cell proliferation|primary microRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2														0.222222	16.180517	18.737711	8	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100316940	100316940	15687	7	G	C	C	34	34	SRRT	C	3	3
MUC17	140453	broad.mit.edu	36	7	100465607	100465607	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100465607C>T	uc003uxp.1	+	c.4190C>T	c.(4189-4191)CCG>CTG	p.P1397L	MUC17_uc010lho.1_Non-coding_Transcript	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17	1397	Extracellular (Potential).|59 X approximate tandem repeats.|21.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|breast(3)|lung(2)	19	Lung NSC(181;0.136)|all_lung(186;0.182)													0.180905	232.250802	289.392371	108	489	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100465607	100465607	10368	7	C	T	T	23	23	MUC17	T	1	1
FIS1	51024	broad.mit.edu	36	7	100674101	100674101	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100674101A>T	uc003uyj.2	-	c.85T>A	c.(85-87)TCG>ACG	p.S29T	FIS1_uc010lht.1_Non-coding_Transcript|FIS1_uc010lhu.1_Intron	NM_016068	NP_057152	Q9Y3D6	FIS1_HUMAN	tetratricopeptide repeat domain 11	29	Cytoplasmic (Potential).				apoptosis|mitochondrial fission|peroxisome fission	integral to mitochondrial outer membrane|integral to peroxisomal membrane	protein binding				0	Lung NSC(181;0.168)|all_lung(186;0.215)											OREG0018218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.266187	90.913967	97.779166	37	102	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100674101	100674101	6135	7	A	T	T	11	11	FIS1	T	4	4
DUS4L	11062	broad.mit.edu	36	7	107001458	107001458	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2557-01	TCGA-06-2557-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:107001458T>G	uc003veh.1	+	c.312T>G	c.(310-312)TGT>TGG	p.C104W	DUS4L_uc003veg.1_Intron|DUS4L_uc010ljl.1_5'Flank	NM_181581	NP_853559	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like	104					oxidation-reduction process|tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0														0.388102	445.107556	448.975829	137	216	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107001458	107001458	4993	7	T	G	G	58	58	DUS4L	G	4	4
KBTBD2	25948	broad.mit.edu	36	7	32875984	32875984	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:32875984G>T	uc003tdb.1	-	c.1370C>A	c.(1369-1371)ACT>AAT	p.T457N		NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	457	Kelch 3.										0														0.342391	179.464936	183.505239	63	121	GG		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(11;0.0499)		Missense_Mutation	SNP	32875984	32875984	8298	7	G	T	T	36	36	KBTBD2	T	3	3
IKZF1	10320	broad.mit.edu	36	7	50435426	50435426	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:50435426C>T	uc003tow.2	+	c.1167C>T	c.(1165-1167)TCC>TCT	p.S389S	IKZF1_uc003tox.2_Silent_p.S347S|IKZF1_uc003toy.2_Silent_p.S347S|IKZF1_uc003toz.2_Silent_p.S359S|IKZF1_uc010kyx.1_Silent_p.S129S|IKZF1_uc003tpa.2_Silent_p.S131S	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	389					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	p.?(25)		haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)								226				0.162791	13.898371	18.545004	7	36	CC		KEEP	---	---	---	---	capture			Silent	SNP	50435426	50435426	7915	7	C	T	T	22	22	IKZF1	T	2	2
FKBP6	8468	broad.mit.edu	36	7	72380587	72380587	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:72380587G>A	uc003tya.2	+	c.131G>A	c.(130-132)CGA>CAA	p.R44Q	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank|FKBP6_uc010lbe.1_Non-coding_Transcript	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	44					protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)												0.416667	163.111183	163.908636	55	77	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72380587	72380587	6150	7	G	A	A	37	37	FKBP6	A	1	1
SEMA3C	10512	broad.mit.edu	36	7	80225644	80225644	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:80225644G>A	uc003uhj.1	-	c.1582C>T	c.(1582-1584)CGG>TGG	p.R528W		NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C	528					immune response|response to drug	membrane	receptor activity			ovary(1)	1														0.514354	641.906804	641.98135	215	203	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	80225644	80225644	14512	7	G	A	A	38	38	SEMA3C	A	1	1
NPTX2	4885	broad.mit.edu	36	7	98095811	98095811	+	Silent	SNP	C	T	T			TCGA-06-2557-01	TCGA-06-2557-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:98095811C>T	uc003upl.1	+	c.1230C>T	c.(1228-1230)GTC>GTT	p.V410V		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II	410	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)	2	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)													0.212121	14.90837	17.436002	7	26	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.215)		Silent	SNP	98095811	98095811	11008	7	C	T	T	31	31	NPTX2	T	1	1
NPM2	10361	broad.mit.edu	36	8	21949964	21949964	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2557-01	TCGA-06-2557-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:21949964A>G	uc003xab.1	+	c.581A>G	c.(580-582)GAC>GGC	p.D194G	NPM2_uc003xac.1_Missense_Mutation_p.D194G|NPM2_uc003xad.1_Missense_Mutation_p.D194G|NPM2_uc003xae.1_Missense_Mutation_p.D194G|NPM2_uc003xaf.1_3'UTR	NM_182795	NP_877724	Q86SE8	NPM2_HUMAN	nucleoplasmin 2	194					chromatin remodeling|embryo development|oocyte differentiation|positive regulation of meiosis|regulation of exit from mitosis|single fertilization	cytoplasmic chromatin|nuclear chromatin	histone binding|nucleic acid binding				0												OREG0018603	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.625	34.253406	34.473067	10	6	AA		KEEP	---	---	---	---	capture		Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)	Missense_Mutation	SNP	21949964	21949964	10993	8	A	G	G	10	10	NPM2	G	4	4
MAGEB6	158809	broad.mit.edu	36	X	26122632	26122632	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:26122632G>A	uc004dbr.1	+	c.748G>A	c.(748-750)GTT>ATT	p.V250I	MAGEB6_uc010ngc.1_Missense_Mutation_p.V30I|MAGEB6_uc010ngd.1_Missense_Mutation_p.V250I	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	250	MAGE.									ovary(3)	3														0.762712	147.50191	151.224159	45	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26122632	26122632	9560	23	G	A	A	40	40	MAGEB6	A	1	1
ARSD	414	broad.mit.edu	36	X	2846060	2846060	+	Silent	SNP	G	A	A			TCGA-06-2557-01	TCGA-06-2557-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:2846060G>A	uc004cqy.1	-	c.648C>T	c.(646-648)GCC>GCT	p.A216A	ARSD_uc004cqz.1_Intron|ARSD_uc004cra.1_Silent_p.A216A	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor	216						lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)												0.2	6.817517	8.07228	3	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	2846060	2846060	1007	23	G	A	A	39	39	ARSD	A	1	1
KRTAP5-5	439915	broad.mit.edu	36	11	1608162	1608191	+	In_Frame_Del	DEL	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-			TCGA-06-2557-01	TCGA-06-2557-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1608162_1608191delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	uc001lty.1	+	c.516_545delCTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	c.(514-546)TCCTGCTGCCAGTCCAGCTGCTGTAAGCCTTAC>TCC	p.CCQSSCCKPY183del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	183_192	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.31			34	75				---	---	---	---	capture_indel			In_Frame_Del	DEL	1608162	1608191	8886	11	CTGCTGCCAGTCCAGCTGCTGTAAGCCTTA	-	-	24	24	KRTAP5-5	-	5	5
TRPM4	54795	broad.mit.edu	36	19	54363721	54363722	+	In_Frame_Ins	INS	-	GCA	GCA			TCGA-06-2557-01	TCGA-06-2557-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:54363721_54363722insGCA	uc002pmw.1	+	c.712_713insGCA	c.(712-714)GGC>GGCAGC	p.238_239insS	TRPM4_uc010emu.1_In_Frame_Ins_p.238_239insS|TRPM4_uc002pmx.1_In_Frame_Ins_p.64_65insS|TRPM4_uc010emv.1_In_Frame_Ins_p.123_124insS	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	238_239	Cytoplasmic (Potential).				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)										0.32			18	39				---	---	---	---	capture_indel			In_Frame_Ins	INS	54363721	54363722	17139	19	-	GCA	GCA	39	39	TRPM4	GCA	5	5
LENG1	79165	broad.mit.edu	36	19	59352384	59352385	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-06-2557-01	TCGA-06-2557-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:59352384_59352385delTC	uc002qdm.1	-	c.503_504delGA	c.(502-504)AGAfs	p.R168fs		NM_024316	NP_077292	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1	168										ovary(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)													0.38			66	110				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	59352384	59352385	9047	19	TC	-	-	58	58	LENG1	-	5	5
DGKD	8527	broad.mit.edu	36	2	233928007	233928007	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2557-01	TCGA-06-2557-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:233928007_233928007delC	uc002vui.1	+	c.104_104delC	c.(103-105)TCCfs	p.S35fs		NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	35	Pro-rich.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)									0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	233928007	233928007	4646	2	C	-	-	30	30	DGKD	-	5	5
CDKN2A	1029	broad.mit.edu	36	9	21961124	21961125	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-06-2557-01	TCGA-06-2557-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:21961124_21961125delGA	uc003zpl.1	-	c.399_400delTC	c.(397-402)TCTCACfs	p.S133fs	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpk.1_Frame_Shift_Del_p.L78fs|CDKN2A_uc003zpj.1_3'UTR|CDKN2A_uc010miu.1_Non-coding_Transcript	NM_058195	NP_478102	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 4	Error:Variant_position_missing_in_P42771_after_alignment					cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(425)|p.L78fs*41(9)|p.E61_L94del(1)|p.A76fs*64(1)|p.T79fs*41(1)|p.L65fs*38(1)|p.L78fs*67(1)|p.A68fs*3(1)|p.L78H(1)		haematopoietic_and_lymphoid_tissue(647)|skin(417)|upper_aerodigestive_tract(405)|central_nervous_system(380)|lung(319)|pancreas(237)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|ovary(76)|soft_tissue(73)|biliary_tract(71)|bone(70)|breast(46)|stomach(44)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|large_intestine(9)|salivary_gland(8)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3636		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)				17		76	TSP Lung(5;3.83e-07)			0.55			11	9				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	21961124	21961125	3290	9	GA	-	-	45	45	CDKN2A	-	5	5
