Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
TDRD1	56165	broad.mit.edu	36	10	115975884	115975884	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:115975884A>C	uc001lbg.1	+	c.3094A>C	c.(3094-3096)ACC>CCC	p.T1032P	TDRD1_uc001lbf.2_Missense_Mutation_p.T909P|TDRD1_uc001lbh.1_Missense_Mutation_p.T1019P|TDRD1_uc001lbi.1_Missense_Mutation_p.T1023P|TDRD1_uc001lbj.2_Missense_Mutation_p.T741P	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1032	Tudor 4.				DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)										0.25974	19.151328	23.660703	20	57	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	115975884	115975884	16256	10	A	C	C	2	2	TDRD1	C	4	4
MKX	283078	broad.mit.edu	36	10	28004209	28004209	+	Silent	SNP	T	A	A			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:28004209T>A	uc001ity.2	-	c.1014A>T	c.(1012-1014)ATA>ATT	p.I338I	MKX_uc001itx.2_Silent_p.I338I	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox	338					muscle organ development|regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(1)	1														0.251825	181.647472	196.976003	69	205	TT		KEEP	---	---	---	---	capture			Silent	SNP	28004209	28004209	10000	10	T	A	A	53	53	MKX	A	4	4
CAMK2G	818	broad.mit.edu	36	10	75244880	75244880	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:75244880T>G	uc001jvm.1	-	c.1570A>C	c.(1570-1572)ACC>CCC	p.T524P	CAMK2G_uc001jvo.1_Missense_Mutation_p.T495P|CAMK2G_uc001jvq.1_Missense_Mutation_p.T472P|CAMK2G_uc001jvr.1_Missense_Mutation_p.T463P|CAMK2G_uc001jvp.1_Missense_Mutation_p.T486P|CAMK2G_uc001jvs.1_Missense_Mutation_p.T507P|CAMK2G_uc001jvt.1_Non-coding_Transcript|CAMK2G_uc001jvu.1_Missense_Mutation_p.T464P|CAMK2G_uc009xrp.1_Missense_Mutation_p.T113P	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	526					insulin secretion|interferon-gamma-mediated signaling pathway|protein phosphorylation|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)	1	Prostate(51;0.0112)									423				0.290323	14.026935	15.350745	9	22	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75244880	75244880	2719	10	T	G	G	59	59	CAMK2G	G	4	4
C2CD2L	9854	broad.mit.edu	36	11	118490116	118490116	+	Silent	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118490116A>C	uc001pvn.1	+	c.1743A>C	c.(1741-1743)CCA>CCC	p.P581P	C2CD2L_uc001pvo.1_Silent_p.P580P	NM_014807	NP_055622	O14523	C2C2L_HUMAN	transmembrane protein 24	580						integral to membrane					0														0.282051	14.554881	16.341943	11	28	AA		KEEP	---	---	---	---	capture			Silent	SNP	118490116	118490116	2236	11	A	C	C	6	6	C2CD2L	C	4	4
HPS5	11234	broad.mit.edu	36	11	18260280	18260280	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:18260280G>A	uc001mod.1	-	c.3122C>T	c.(3121-3123)ACG>ATG	p.T1041M	HPS5_uc001moe.1_Missense_Mutation_p.T927M|HPS5_uc001mof.1_Missense_Mutation_p.T927M	NM_181507	NP_852609	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5 isoform a	1041						cytosol				ovary(1)|pancreas(1)	2														0.396985	208.582988	210.424394	79	120	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18260280	18260280	7634	11	G	A	A	40	40	HPS5	A	1	1
OR10A3	26496	broad.mit.edu	36	11	7917328	7917328	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:7917328G>A	uc001mfu.1	-	c.316C>T	c.(316-318)CTT>TTT	p.L106F		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	106	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)										0.286533	252.027686	266.320045	100	249	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7917328	7917328	11297	11	G	A	A	33	33	OR10A3	A	2	2
SDS	10993	broad.mit.edu	36	12	112315330	112315330	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:112315330C>A	uc001tvg.1	-	c.786G>T	c.(784-786)GAG>GAT	p.E262D		NM_006843	NP_006834	P20132	SDHL_HUMAN	serine dehydratase	262					gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)									0.377049	59.102733	59.914125	23	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	112315330	112315330	14461	12	C	A	A	32	32	SDS	A	3	3
SPPL3	121665	broad.mit.edu	36	12	119690673	119690673	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:119690673A>C	uc001tzd.1	-	c.611T>G	c.(610-612)GTA>GGA	p.V204G	SPPL3_uc009zwz.1_Missense_Mutation_p.V197G|SPPL3_uc001tzc.1_Missense_Mutation_p.V34G	NM_139015	NP_620584	Q8TCT6	PSL4_HUMAN	signal peptide peptidase 3	205	Helical; (Potential).					integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)													0.304348	12.024494	13.799474	14	32	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119690673	119690673	15603	12	A	C	C	14	14	SPPL3	C	4	4
DDX11	1663	broad.mit.edu	36	12	31133692	31133692	+	Splice_Site_SNP	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:31133692G>T	uc001rjt.1	+	c.e8_splice_site			DDX11_uc001rjr.1_Splice_Site_SNP|DDX11_uc001rjs.1_Splice_Site_SNP|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Splice_Site_SNP|DDX11_uc001rjw.1_Splice_Site_SNP|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)										Multiple Myeloma(12;0.14)			0.4	6.962194	7.058469	4	6	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	31133692	31133692	4514	12	G	T	T	44	44	DDX11	T	5	3
KRT18	3875	broad.mit.edu	36	12	51631816	51631816	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51631816C>A	uc001sbe.1	+	c.857C>A	c.(856-858)TCT>TAT	p.S286Y	KRT8_uc009zml.1_5'Flank|KRT8_uc009zmm.1_5'Flank|KRT18_uc009zmn.1_Missense_Mutation_p.S286Y|KRT18_uc001sbf.1_Missense_Mutation_p.S113Y|KRT18_uc001sbg.1_Missense_Mutation_p.S286Y|KRT18_uc009zmo.1_Missense_Mutation_p.S286Y	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	286	Interaction with DNAJB6.|Coil 2.|Rod.|Necessary for interaction with PNN.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity				0														0.112745	18.784727	49.003399	23	181	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51631816	51631816	8770	12	C	A	A	32	32	KRT18	A	3	3
OR6C68	403284	broad.mit.edu	36	12	54173185	54173185	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:54173185T>G	uc001shb.1	+	c.772T>G	c.(772-774)TGC>GGC	p.C258G		NM_001005519	NP_001005519	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.192308	7.252153	9.564091	5	21	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54173185	54173185	11606	12	T	G	G	55	55	OR6C68	G	4	4
CD163	9332	broad.mit.edu	36	12	7542895	7542895	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7542895G>A	uc001qsz.2	-	c.614C>T	c.(613-615)GCT>GTT	p.A205V	CD163_uc001qta.2_Missense_Mutation_p.A205V|CD163_uc009zfw.1_Missense_Mutation_p.A205V	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	205	SRCR 2.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8														0.406721	969.21556	975.78065	351	512	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7542895	7542895	3094	12	G	A	A	34	34	CD163	A	2	2
ZDHHC20	253832	broad.mit.edu	36	13	20885907	20885907	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:20885907T>C	uc001uob.1	-	c.254A>G	c.(253-255)TAC>TGC	p.Y85C	ZDHHC20_uc001uoc.1_Non-coding_Transcript|ZDHHC20_uc001uod.1_Non-coding_Transcript|ZDHHC20_uc001uoe.1_Non-coding_Transcript	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20	85						integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)										0.136364	8.929019	14.555349	6	38	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20885907	20885907	18199	13	T	C	C	57	57	ZDHHC20	C	4	4
RALGAPA1	253959	broad.mit.edu	36	14	35277517	35277517	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:35277517C>T	uc001wtj.1	-	c.1540G>A	c.(1540-1542)GAA>AAA	p.E514K	RALGAPA1_uc001wti.1_Missense_Mutation_p.E514K|RALGAPA1_uc001wtk.1_Missense_Mutation_p.E365K	NM_194301	NP_919277	Q6GYQ0	RGPA1_HUMAN	GTPase activating Rap/RanGAP domain-like 1	514					activation of Ral GTPase activity|signal transduction	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4														0.545455	8.176194	8.180214	6	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35277517	35277517	13473	14	C	T	T	32	32	RALGAPA1	T	2	2
FOS	2353	broad.mit.edu	36	14	74817456	74817456	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:74817456C>T	uc001xrn.1	+	c.719C>T	c.(718-720)ACC>ATC	p.T240I	FOS_uc010asi.1_Missense_Mutation_p.T126I|FOS_uc001xro.1_Missense_Mutation_p.T92I	NM_005252	NP_005243	P01100	FOS_HUMAN	v-fos FBJ murine osteosarcoma viral oncogene	240					cellular response to reactive oxygen species|DNA methylation|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		promoter binding|protein dimerization activity|R-SMAD binding|sequence-specific DNA binding transcription factor activity|specific RNA polymerase II transcription factor activity			lung(2)|ovary(1)	3		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)						232				0.255319	16.251975	18.830227	12	35	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74817456	74817456	6227	14	C	T	T	18	18	FOS	T	2	2
CYFIP1	23191	broad.mit.edu	36	15	20505688	20505688	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:20505688G>C	uc001yus.1	+	c.1397G>C	c.(1396-1398)GGC>GCC	p.G466A	CYFIP1_uc001yut.1_Missense_Mutation_p.G466A|CYFIP1_uc010aya.1_Missense_Mutation_p.G494A|CYFIP1_uc001yuu.1_5'Flank	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform	466					axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)	8		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)						1870				0.372093	46.89231	47.508783	16	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20505688	20505688	4302	15	G	C	C	42	42	CYFIP1	C	3	3
MAP1A	4130	broad.mit.edu	36	15	41602864	41602864	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:41602864T>C	uc001zrt.1	+	c.1901T>C	c.(1900-1902)CTC>CCC	p.L634P		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	634						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)	8		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)									0.227273	7.459237	8.968913	5	17	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41602864	41602864	9610	15	T	C	C	54	54	MAP1A	C	4	4
IQCK	124152	broad.mit.edu	36	16	19652556	19652556	+	Silent	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:19652556C>T	uc002dgr.1	+	c.282C>T	c.(280-282)TTC>TTT	p.F94F	IQCK_uc002dgs.1_Non-coding_Transcript|IQCK_uc010bwc.1_Non-coding_Transcript	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K	94											0														0.138889	15.372066	28.994621	15	93	CC		KEEP	---	---	---	---	capture			Silent	SNP	19652556	19652556	8116	16	C	T	T	29	29	IQCK	T	2	2
ACSM1	116285	broad.mit.edu	36	16	20544303	20544303	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:20544303C>A	uc002dhm.1	-	c.1470G>T	c.(1468-1470)GAG>GAT	p.E490D	ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Missense_Mutation_p.E490D	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	490					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)	1														0.100358	26.502039	115.540645	56	502	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20544303	20544303	183	16	C	A	A	28	28	ACSM1	A	3	3
USP31	57478	broad.mit.edu	36	16	22988026	22988026	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:22988026G>T	uc002dll.1	-	c.2901C>A	c.(2899-2901)AGC>AGA	p.S967R	USP31_uc002dlk.1_Missense_Mutation_p.S239R|USP31_uc010bxm.1_Missense_Mutation_p.S255R	NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	967	Ser-rich.				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(2)|lung(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0187)										0.135593	11.058929	18.654186	8	51	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22988026	22988026	17626	16	G	T	T	46	46	USP31	T	3	3
MAPK3	5595	broad.mit.edu	36	16	30041894	30041894	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:30041894C>G	uc002dws.1	-	c.138G>C	c.(136-138)CAG>CAC	p.Q46H	BOLA2_uc010bzb.1_Intron|BOLA2_uc010bzc.1_Intron|MAPK3_uc002dwr.1_5'Flank|MAPK3_uc002dwt.1_Missense_Mutation_p.Q46H|MAPK3_uc002dwv.2_Missense_Mutation_p.Q46H|MAPK3_uc002dwu.1_Non-coding_Transcript|MAPK3_uc010bzp.1_Non-coding_Transcript	NM_002746	NP_002737	P27361	MK03_HUMAN	mitogen-activated protein kinase 3 isoform 1	46	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|cellular response to mechanical stimulus|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription initiation from RNA polymerase I promoter	cytosol|nucleoplasm	ATP binding|MAP kinase activity|phosphatase binding				0					Arsenic trioxide(DB01169)|Isoproterenol(DB01064)|Simvastatin(DB00641)|Sulindac(DB00605)					91				0.648148	104.717052	105.757651	35	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30041894	30041894	9662	16	C	G	G	20	20	MAPK3	G	3	3
ADCY7	113	broad.mit.edu	36	16	48882030	48882030	+	Silent	SNP	G	C	C			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:48882030G>C	uc002egd.1	+	c.333G>C	c.(331-333)CTG>CTC	p.L111L	ADCY7_uc002egb.1_Silent_p.L111L|ADCY7_uc002egc.1_Silent_p.L111L	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	111	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding				0		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)									0.189189	7.500873	10.857609	7	30	GG		KEEP	---	---	---	---	capture			Silent	SNP	48882030	48882030	300	16	G	C	C	47	47	ADCY7	C	3	3
HYDIN	54768	broad.mit.edu	36	16	69535242	69535242	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69535242C>T	uc002ezr.1	-	c.6640G>A	c.(6640-6642)GTG>ATG	p.V2214M	HYDIN_uc002ezt.1_Intron|HYDIN_uc002ezu.1_Intron	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2215										ovary(1)	1		Ovarian(137;0.0654)												0.24	14.937473	16.480067	6	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69535242	69535242	7767	16	C	T	T	19	19	HYDIN	T	1	1
ACSF3	197322	broad.mit.edu	36	16	87739856	87739856	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:87739856T>G	uc002fmp.2	+	c.1511T>G	c.(1510-1512)GTG>GGG	p.V504G	ACSF3_uc010cig.1_Missense_Mutation_p.V504G|ACSF3_uc010cih.1_Missense_Mutation_p.V239G|ACSF3_uc002fmq.1_Non-coding_Transcript|ACSF3_uc010cii.1_Non-coding_Transcript|ACSF3_uc002fmr.1_Missense_Mutation_p.V239G	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	504					fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)										0.363636	8.595127	8.775725	4	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87739856	87739856	177	16	T	G	G	59	59	ACSF3	G	4	4
SLC5A10	125206	broad.mit.edu	36	17	18864464	18864464	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:18864464G>C	uc002gut.1	+	c.1834G>C	c.(1834-1836)GCC>CCC	p.A612P	SLC5A10_uc002gur.1_Missense_Mutation_p.A566P|SLC5A10_uc002guu.1_Missense_Mutation_p.A596P|SLC5A10_uc002guv.1_Missense_Mutation_p.A569P	NM_152351	NP_689564	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/glucose	596	Helical; (Potential).				sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1														0.269231	9.976559	11.259506	7	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18864464	18864464	15159	17	G	C	C	38	38	SLC5A10	C	3	3
NOS2	4843	broad.mit.edu	36	17	23108436	23108436	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:23108436G>A	uc002gzu.1	-	c.3425C>T	c.(3424-3426)GCG>GTG	p.A1142V		NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	1142					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|oxidation-reduction process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			ovary(1)|breast(1)	2					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)					578		OREG0024267	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.191919	157.758295	192.814043	76	320	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23108436	23108436	10946	17	G	A	A	38	38	NOS2	A	1	1
SUPT6H	6830	broad.mit.edu	36	17	24037499	24037499	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:24037499A>C	uc002hby.1	+	c.2503A>C	c.(2503-2505)ACG>CCG	p.T835P	SUPT6H_uc010crt.1_Missense_Mutation_p.T835P|SUPT6H_uc002hbz.1_5'Flank	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	835					chromatin remodeling|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity|transcription elongation regulator activity			ovary(2)	2	Lung NSC(42;0.00431)													0.166667	8.193989	12.629533	7	35	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24037499	24037499	15920	17	A	C	C	2	2	SUPT6H	C	4	4
CDK5R1	8851	broad.mit.edu	36	17	27839373	27839374	+	Missense_Mutation	DNP	TG	AA	AA			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:27839373_27839374TG>AA	uc002hhn.1	+	c.622_623TG>AA	c.(622-624)TGC>AAC	p.C208N	CDK5R1_uc010ctb.1_Missense_Mutation_p.C208N|CDK5R1_uc010ctc.1_Intron	NM_003885	NP_003876	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1	208					axon guidance|axonal fasciculation|brain development|cell proliferation|embryo development|ionotropic glutamate receptor signaling pathway|muscarinic acetylcholine receptor signaling pathway|neuron cell-cell adhesion|neuron migration|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of neuron apoptosis|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation	axon|contractile fiber|cyclin-dependent protein kinase 5 holoenzyme complex|cytosol|dendritic spine|growth cone|neuromuscular junction|neuronal cell body|perinuclear region of cytoplasm|plasma membrane	cadherin binding|calcium ion binding|protein kinase binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)											0.215686	10.869576	14.716247	11	40	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	27839373	27839374	3272	17	TG	AA	AA	55	55	CDK5R1	AA	4	4
SSTR2	6752	broad.mit.edu	36	17	68677881	68677881	+	Silent	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:68677881C>T	uc002jje.1	+	c.828C>T	c.(826-828)AAC>AAT	p.N276N	SSTR2_uc010dfi.1_Silent_p.N276N	NM_001050	NP_001041	P30874	SSR2_HUMAN	somatostatin receptor 2	276	Helical; Name=6; (Potential).				digestion|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	PDZ domain binding|somatostatin receptor activity				0			LUSC - Lung squamous cell carcinoma(166;0.197)											0.125	13.359422	26.535081	12	84	CC		KEEP	---	---	---	---	capture			Silent	SNP	68677881	68677881	15714	17	C	T	T	19	19	SSTR2	T	1	1
TP53	7157	broad.mit.edu	36	17	7517846	7517846	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7517846G>A	uc002gim.2	-	c.817C>T	c.(817-819)CGT>TGT	p.R273C	TP53_uc002gig.1_Intron|TP53_uc002gih.1_Missense_Mutation_p.R273C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141C|TP53_uc010cng.1_Missense_Mutation_p.R141C|TP53_uc002gii.1_Missense_Mutation_p.R141C|TP53_uc010cnh.1_Missense_Mutation_p.R273C|TP53_uc010cni.1_Missense_Mutation_p.R273C|TP53_uc002gij.2_Missense_Mutation_p.R273C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.R273C(388)|p.R273S(11)|p.R273G(9)|p.0?(6)|p.R273fs*72(2)|p.R273fs*33(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.?(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.C141fs*29(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)	R273C(SH10TC_STOMACH)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(RH30_SOFT_TISSUE)|R273C(PANC0213_PANCREAS)|R273C(SJRH30_SOFT_TISSUE)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(TT2609C02_THYROID)|R273C(MFE319_ENDOMETRIUM)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(NCIH1048_LUNG)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	p.R273C(SUDHL4-Tumor)|p.R273C(EFO27-Tumor)|p.R273C(SH10TC-Tumor)|p.R273C(TGBC11TKB-Tumor)|p.R273C(KARPAS299-Tumor)|p.R273C(SW1710-Tumor)|p.R273Y(SNUC2A-Tumor)|p.R273C(TT2609C02-Tumor)|p.R273Y(PF382-Tumor)|p.R273Y(SW1783-Tumor)|p.R273C(RPMI8402-Tumor)|p.R273C(BL70-Tumor)|p.R273C(8305C-Tumor)|p.R273C(SW1088-Tumor)|p.R273C(NCIH1048-Tumor)|p.R273C(SNU1196-Tumor)|p.R273C(CL14-Tumor)|p.R273C(SJRH30-Tumor)|p.R273C(MFE319-Tumor)|p.R273C(PANC02.13-Tumor)|p.R273C(8MGBA-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.834171	492.86441	513.921782	166	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7517846	7517846	16923	17	G	A	A	38	38	TP53	A	1	1
ROCK1	6093	broad.mit.edu	36	18	16862812	16862812	+	Silent	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr18:16862812T>C	uc002kte.1	-	c.1134A>G	c.(1132-1134)GAA>GAG	p.E378E		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	378	AGC-kinase C-terminal.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|protein phosphorylation|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)									408				0.241379	153.400068	169.33335	63	198	TT		KEEP	---	---	---	---	capture			Silent	SNP	16862812	16862812	13996	18	T	C	C	56	56	ROCK1	C	4	4
DTNA	1837	broad.mit.edu	36	18	30711720	30711720	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:30711720C>G	uc010dmn.1	+	c.1862C>G	c.(1861-1863)GCA>GGA	p.A621G	DTNA_uc002kxw.2_Missense_Mutation_p.A564G|DTNA_uc010dmj.1_Missense_Mutation_p.A561G|DTNA_uc002kxz.2_Missense_Mutation_p.A568G|DTNA_uc002kxy.2_Missense_Mutation_p.A561G|DTNA_uc002kye.2_Missense_Mutation_p.A269G	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1	621					neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0														0.235294	6.579879	7.683161	4	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30711720	30711720	4973	18	C	G	G	25	25	DTNA	G	3	3
CCDC11	220136	broad.mit.edu	36	18	46007928	46007928	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:46007928C>A	uc002lee.1	-	c.1366G>T	c.(1366-1368)GCC>TCC	p.A456S		NM_145020	NP_659457	Q96M91	CCD11_HUMAN	coiled-coil domain containing 11	456	Potential.									ovary(1)|pancreas(1)	2				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)										0.314088	393.30958	406.592617	136	297	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46007928	46007928	2866	18	C	A	A	27	27	CCDC11	A	3	3
GALR1	2587	broad.mit.edu	36	18	73091769	73091769	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:73091769G>T	uc002lms.2	+	c.277G>T	c.(277-279)GCC>TCC	p.A93S		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	93	Extracellular (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity				0		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)										0.158621	69.658454	101.858517	46	244	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73091769	73091769	6491	18	G	T	T	42	42	GALR1	T	3	3
C19orf57	79173	broad.mit.edu	36	19	13861868	13861868	+	Silent	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:13861868T>C	uc002mxl.1	-	c.801A>G	c.(799-801)GGA>GGG	p.G267G	C19orf57_uc002mxk.1_Silent_p.G149G|C19orf57_uc002mxm.1_Intron	NM_024323	NP_077299	Q0VDD7	CS057_HUMAN	hypothetical protein LOC79173	267					multicellular organismal development		protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2e-21)											0.2	7.027585	9.550704	6	24	TT		KEEP	---	---	---	---	capture			Silent	SNP	13861868	13861868	2003	19	T	C	C	54	54	C19orf57	C	4	4
FBXO27	126433	broad.mit.edu	36	19	44213779	44213779	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:44213779A>C	uc002okh.1	-	c.386T>G	c.(385-387)GTG>GGG	p.V129G		NM_178820	NP_849142	Q8NI29	FBX27_HUMAN	F-box protein 27	129	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding			ovary(1)	1	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)											0.196429	6.342592	11.528302	11	45	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44213779	44213779	5974	19	A	C	C	6	6	FBXO27	C	4	4
FAM71E1	112703	broad.mit.edu	36	19	55662825	55662825	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:55662825T>G	uc002psh.1	-	c.613A>C	c.(613-615)ACC>CCC	p.T205P	FAM71E1_uc002psg.1_Missense_Mutation_p.T189P|FAM71E1_uc002psi.1_Non-coding_Transcript	NM_138411	NP_612420	Q6IPT2	F71E1_HUMAN	hypothetical protein LOC112703	205										breast(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)										0.5	14.50221	14.50221	7	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55662825	55662825	5834	19	T	G	G	59	59	FAM71E1	G	4	4
SIGLEC10	89790	broad.mit.edu	36	19	56610349	56610349	+	Silent	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56610349G>A	uc002pwo.1	-	c.1228C>T	c.(1228-1230)CTG>TTG	p.L410L	SIGLEC10_uc002pwp.1_Silent_p.L352L|SIGLEC10_uc002pwq.1_Silent_p.L352L|SIGLEC10_uc002pwr.1_Silent_p.L410L|SIGLEC10_uc010eow.1_Silent_p.L222L|SIGLEC10_uc002pws.1_Silent_p.L246L	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	410	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)										0.5	11.837188	11.837188	6	6	GG		KEEP	---	---	---	---	capture			Silent	SNP	56610349	56610349	14801	19	G	A	A	35	35	SIGLEC10	A	2	2
COL5A3	50509	broad.mit.edu	36	19	9938022	9938022	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:9938022T>G	uc002mmq.1	-	c.4750A>C	c.(4750-4752)ACC>CCC	p.T1584P		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1584	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)	9			Epithelial(33;7.11e-05)											0.28	9.744139	10.892328	7	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9938022	9938022	3836	19	T	G	G	58	58	COL5A3	G	4	4
TTF2	8458	broad.mit.edu	36	1	117423772	117423772	+	Silent	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:117423772G>A	uc001egy.1	+	c.1761G>A	c.(1759-1761)CAG>CAA	p.Q587Q	TTF2_uc001egx.1_Silent_p.Q587Q	NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	587	Helicase ATP-binding.				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|RNA polymerase II transcription termination factor activity|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)										0.214286	7.700583	9.868676	6	22	GG		KEEP	---	---	---	---	capture			Silent	SNP	117423772	117423772	17274	1	G	A	A	33	33	TTF2	A	2	2
FLG	2312	broad.mit.edu	36	1	150549307	150549307	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150549307C>T	uc001ezu.1	-	c.4679G>A	c.(4678-4680)CGT>CAT	p.R1560H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1560	Ser-rich.|Filaggrin 9.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.145349	35.098429	55.889162	25	147	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150549307	150549307	6160	1	C	T	T	19	19	FLG	T	1	1
TPR	7175	broad.mit.edu	36	1	184610690	184610690	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:184610690G>C	uc001grv.1	-	c.94C>G	c.(94-96)CAG>GAG	p.Q32E	TPR_uc009wyn.1_Missense_Mutation_p.Q92E|C1orf27_uc001grw.1_5'Flank	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	32	Potential.			Q -> R (in Ref. 5; CAA44719 and 6; CAA68681).	carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)						1949				0.763158	392.545505	402.178793	116	36	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	184610690	184610690	16960	1	G	C	C	45	45	TPR	C	3	3
UBR4	23352	broad.mit.edu	36	1	19383139	19383139	+	Silent	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:19383139G>A	uc001bbi.1	-	c.2056C>T	c.(2056-2058)CTA>TTA	p.L686L		NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	686					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)	23		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)										0.208333	6.561849	8.458109	5	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	19383139	19383139	17462	1	G	A	A	35	35	UBR4	A	2	2
RNPEP	6051	broad.mit.edu	36	1	200233071	200233071	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:200233071T>G	uc001gxd.1	+	c.856T>G	c.(856-858)TAT>GAT	p.Y286D	RNPEP_uc001gxe.1_5'UTR|RNPEP_uc001gxf.1_Missense_Mutation_p.Y155D	NM_020216	NP_064601	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	286					leukotriene biosynthetic process|proteolysis		epoxide hydrolase activity|zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		GBM(19;39 479 7473 13131 19462)								0.225806	10.569482	12.765123	7	24	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	200233071	200233071	13988	1	T	G	G	57	57	RNPEP	G	4	4
KIF17	57576	broad.mit.edu	36	1	20908731	20908731	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:20908731T>C	uc001bdr.2	-	c.658A>G	c.(658-660)ATG>GTG	p.M220V	KIF17_uc001bds.2_Missense_Mutation_p.M220V	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	220	Kinesin-motor.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)	3		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)										0.354167	50.767547	51.664451	17	31	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20908731	20908731	8590	1	T	C	C	50	50	KIF17	C	4	4
KCTD3	51133	broad.mit.edu	36	1	213817640	213817640	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:213817640G>A	uc001hks.1	+	c.262G>A	c.(262-264)GTG>ATG	p.V88M	KCTD3_uc001hkt.1_Missense_Mutation_p.V88M|KCTD3_uc009xdn.1_5'Flank	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	88						voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(2)	2				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)										0.145161	14.930998	22.44617	9	53	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	213817640	213817640	8416	1	G	A	A	36	36	KCTD3	A	2	2
PEX10	5192	broad.mit.edu	36	1	2331732	2331732	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:2331732T>C	uc001ajg.1	-	c.131A>G	c.(130-132)GAG>GGG	p.E44G	PEX10_uc001ajh.1_Missense_Mutation_p.E44G	NM_153818	NP_722540	O60683	PEX10_HUMAN	peroxisome biogenesis factor 10 isoform 1	44					protein import into peroxisome matrix|protein import into peroxisome matrix	integral to peroxisomal membrane|peroxisomal membrane	protein binding|protein C-terminus binding|zinc ion binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		GBM(12;9 508 1649 13619)								0.294118	6.854326	7.581832	5	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2331732	2331732	12158	1	T	C	C	54	54	PEX10	C	4	4
PAQR7	164091	broad.mit.edu	36	1	26061973	26061974	+	Missense_Mutation	DNP	AA	CC	CC			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:26061973_26061974AA>CC	uc001bkx.1	-	c.944_945TT>GG	c.(943-945)TTT>TGG	p.F315W	PAQR7_uc009vsa.1_Missense_Mutation_p.F315W	NM_178422	NP_848509	Q86WK9	MPRA_HUMAN	progestin and adipoQ receptor family member VII	315	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding			breast(3)	3		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.16e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000724)|BRCA - Breast invasive adenocarcinoma(304;0.000965)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0136)|READ - Rectum adenocarcinoma(331;0.0649)		Esophageal Squamous(111;1206 1556 18433 19151 38418)								0.177778	8.664026	13.081337	8	37	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	26061973	26061974	11857	1	AA	CC	CC	1	1	PAQR7	CC	4	4
CTPS	1503	broad.mit.edu	36	1	41221569	41221569	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:41221569C>A	uc001cgk.2	+	c.20C>A	c.(19-21)ACT>AAT	p.T7N	CTPS_uc001cgl.2_Missense_Mutation_p.T7N	NM_001905	NP_001896	P17812	PYRG1_HUMAN	CTP synthase	7					CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)									0.420118	202.098853	203.037737	71	98	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41221569	41221569	4181	1	C	A	A	20	20	CTPS	A	3	3
ROR1	4919	broad.mit.edu	36	1	64288180	64288180	+	Silent	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:64288180C>T	uc001dbj.2	+	c.393C>T	c.(391-393)TGC>TGT	p.C131C	ROR1_uc001dbi.2_Silent_p.C131C	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	131	Ig-like C2-type.|Extracellular (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|stomach(1)|breast(1)|skin(1)|kidney(1)	13										216				0.404553	629.699439	634.211154	231	340	CC		KEEP	---	---	---	---	capture			Silent	SNP	64288180	64288180	14005	1	C	T	T	27	27	ROR1	T	1	1
CEP250	11190	broad.mit.edu	36	20	33555991	33555991	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:33555991A>C	uc002xcm.1	+	c.6380A>C	c.(6379-6381)CAC>CCC	p.H2127P	CEP250_uc002xcn.1_Missense_Mutation_p.H2071P	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2 isoform 1	2127	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)											0.4	8.796664	8.884192	4	6	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33555991	33555991	3385	20	A	C	C	6	6	CEP250	C	4	4
RBCK1	10616	broad.mit.edu	36	20	357603	357603	+	Silent	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:357603G>A	uc002wdp.2	+	c.1317G>A	c.(1315-1317)CTG>CTA	p.L439L	RBCK1_uc002wdq.2_Silent_p.L397L|RBCK1_uc010fzy.1_Non-coding_Transcript|RBCK1_uc002wdr.2_Silent_p.L269L	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing	439					interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)												0.208333	6.454671	8.355786	5	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	357603	357603	13568	20	G	A	A	46	46	RBCK1	A	2	2
KCNS1	3787	broad.mit.edu	36	20	43159929	43159929	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43159929A>T	uc002xnc.1	-	c.898T>A	c.(898-900)TTC>ATC	p.F300I	KCNS1_uc002xnd.1_Missense_Mutation_p.F300I	NM_002251	NP_002242	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel	300	Cytoplasmic (Potential).					voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity|protein binding				0		Myeloproliferative disorder(115;0.0122)												0.375	10.030562	10.255077	6	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43159929	43159929	8393	20	A	T	T	3	3	KCNS1	T	4	4
PRNP	5621	broad.mit.edu	36	20	4628070	4628070	+	Silent	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:4628070T>C	uc002wku.1	+	c.204T>C	c.(202-204)CCT>CCC	p.P68P	PRNP_uc002wkt.1_Silent_p.P68P|PRNP_uc002wkv.1_Silent_p.P68P|PRNP_uc002wkw.1_Silent_p.P68P|PRNP_uc002wkx.1_Silent_p.P68P|PRNP_uc002wky.1_Silent_p.P68P|PRNP_uc010gbe.1_Silent_p.P68P|PRNP_uc010gbf.1_Silent_p.P68P	NM_001080122	NP_898902	P04156	PRIO_HUMAN	prion protein preproprotein	68	Interaction with GRB2, ERI3 and SYN1 (By similarity).|3.|5 X 8 AA tandem repeats of P-H-G-G-G-W-G- Q.				axon guidance|cell cycle arrest|cellular copper ion homeostasis|metabolic process|negative regulation of activated T cell proliferation|negative regulation of calcineurin-NFAT signaling pathway|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-2 production|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell receptor signaling pathway|protein homooligomerization|response to oxidative stress	anchored to membrane|endoplasmic reticulum|extrinsic to membrane|Golgi apparatus|membrane raft|nucleus|plasma membrane	copper ion binding|identical protein binding|microtubule binding			central_nervous_system(1)	1					Tetracycline(DB00759)									0.230769	7.120666	7.982546	3	10	TT		KEEP	---	---	---	---	capture			Silent	SNP	4628070	4628070	12987	20	T	C	C	54	54	PRNP	C	4	4
DSCAM	1826	broad.mit.edu	36	21	40387535	40387535	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr21:40387535A>C	uc002yyq.1	-	c.3833T>G	c.(3832-3834)GTC>GGC	p.V1278G	DSCAM_uc002yyr.1_Non-coding_Transcript	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1278	Fibronectin type-III 4.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)	6		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				Melanoma(134;970 1778 1785 21664 32388)								0.205882	9.204423	12.075575	7	27	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40387535	40387535	4952	21	A	C	C	10	10	DSCAM	C	4	4
OSM	5008	broad.mit.edu	36	22	28990039	28990039	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:28990039A>C	uc003ahb.1	-	c.592T>G	c.(592-594)TAC>GAC	p.Y198D		NM_020530	NP_065391	P13725	ONCM_HUMAN	oncostatin M precursor	198					cell proliferation|immune response|negative regulation of cell proliferation|negative regulation of hormone secretion|positive regulation of acute inflammatory response|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of MAPKKK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of growth	extracellular space|oncostatin-M receptor complex	cytokine activity|growth factor activity|oncostatin-M receptor binding				0			Epithelial(10;0.206)											0.217391	6.75954	8.460173	5	18	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28990039	28990039	11702	22	A	C	C	15	15	OSM	C	4	4
PATZ1	23598	broad.mit.edu	36	22	30053042	30053042	+	Silent	SNP	C	A	A	rs131206	by-frequency	TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:30053042C>A	uc003akq.1	-	c.1899G>T	c.(1897-1899)GGG>GGT	p.G633G	PATZ1_uc003akp.1_3'UTR|PATZ1_uc003akr.1_Silent_p.G587G	NM_014323	NP_055138	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	633					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription repressor activity|zinc ion binding		EWSR1/PATZ1(2)	soft_tissue(2)	2										104				0.183471	195.632751	252.536813	111	494	CC		KEEP	---	---	---	---	capture			Silent	SNP	30053042	30053042	11896	22	C	A	A	22	22	PATZ1	A	3	3
NCF4	4689	broad.mit.edu	36	22	35596485	35596485	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:35596485A>G	uc003apz.2	+	c.425A>G	c.(424-426)CAG>CGG	p.Q142R	NCF4_uc003apy.2_Missense_Mutation_p.Q142R	NM_013416	NP_038202	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4 isoform 2	142					cell communication|immune response|oxidation-reduction process	cytosol|NADPH oxidase complex	phosphatidylinositol binding|protein dimerization activity			ovary(1)	1														0.307692	8.094598	8.523705	4	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35596485	35596485	10617	22	A	G	G	7	7	NCF4	G	4	4
TCF20	6942	broad.mit.edu	36	22	40936691	40936691	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:40936691G>A	uc003bcj.1	-	c.4565C>T	c.(4564-4566)TCA>TTA	p.S1522L	TCF20_uc003bck.1_Missense_Mutation_p.S1522L	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1522					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)	4														0.12766	13.228196	25.955486	12	82	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40936691	40936691	16216	22	G	A	A	45	45	TCF20	A	2	2
CREG2	200407	broad.mit.edu	36	2	101338163	101338163	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:101338163G>T	uc002tba.1	-	c.709C>A	c.(709-711)CAA>AAA	p.Q237K		NM_153836	NP_722578	Q8IUH2	CREG2_HUMAN	cellular repressor of E1A-stimulated genes 2	237						extracellular region	FMN binding			ovary(1)	1														0.315789	9.525794	10.109548	6	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	101338163	101338163	4004	2	G	T	T	46	46	CREG2	T	3	3
PUM2	23369	broad.mit.edu	36	2	20353941	20353941	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:20353941G>A	uc002rds.1	-	c.1244C>T	c.(1243-1245)GCA>GTA	p.A415V	PUM2_uc002rdr.1_Missense_Mutation_p.A354V|PUM2_uc002rdt.1_Missense_Mutation_p.A415V|PUM2_uc002rdu.1_Missense_Mutation_p.A415V	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	415	Ala-rich.				regulation of translation	perinuclear region of cytoplasm	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.5	69.664287	69.664287	25	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20353941	20353941	13284	2	G	A	A	46	46	PUM2	A	2	2
IDH1	3417	broad.mit.edu	36	2	208821358	208821358	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:208821358G>A	uc002vcs.1	-	c.394C>T	c.(394-396)CGT>TGT	p.R132C	IDH1_uc002vct.1_Missense_Mutation_p.R132C|IDH1_uc002vcu.1_Missense_Mutation_p.R132C	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(296)|p.R132C(292)|p.R132?(210)|p.R132G(95)|p.R132S(69)|p.R132L(6)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(1848)|haematopoietic_and_lymphoid_tissue(593)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2451				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		Pancreas(158;264 1958 3300 35450 36047)			p.R132C(SNU1079-Tumor)|p.R132C(HT1080-Tumor)	134				0.681447	1885.401484	1910.494509	584	273	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	208821358	208821358	7794	2	G	A	A	37	37	IDH1	A	1	1
VIL1	7429	broad.mit.edu	36	2	219013781	219013781	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:219013781C>A	uc002via.1	+	c.2322C>A	c.(2320-2322)AAC>AAA	p.N774K	VIL1_uc002vib.1_Missense_Mutation_p.N774K	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	774	Headpiece.|HP.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.164948	11.122736	21.705849	16	81	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	219013781	219013781	17731	2	C	A	A	17	17	VIL1	A	3	3
FAM124B	79843	broad.mit.edu	36	2	224974464	224974464	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:224974464A>T	uc002vnx.1	-	c.266T>A	c.(265-267)CTC>CAC	p.L89H	FAM124B_uc002vnw.1_Missense_Mutation_p.L89H	NM_001122779	NP_001116251	Q9H5Z6	F124B_HUMAN	hypothetical protein LOC79843 isoform a	89							protein binding			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)										0.25	7.958959	9.102153	5	15	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	224974464	224974464	5623	2	A	T	T	11	11	FAM124B	T	4	4
CCDC142	84865	broad.mit.edu	36	2	74555224	74555224	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:74555224T>G	uc002slr.1	-	c.2210A>C	c.(2209-2211)CAC>CCC	p.H737P	MRPL53_uc002sln.1_5'Flank|CCDC142_uc002slo.1_Intron|CCDC142_uc002slp.1_3'UTR|CCDC142_uc002slq.1_Missense_Mutation_p.H730P	NM_032779	NP_116168	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	737										central_nervous_system(1)	1														0.2	7.867365	9.957369	5	20	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74555224	74555224	2896	2	T	G	G	59	59	CCDC142	G	4	4
TLX2	3196	broad.mit.edu	36	2	74596758	74596758	+	Silent	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:74596758G>A	uc002smb.1	+	c.789G>A	c.(787-789)CAG>CAA	p.Q263Q	TLX2_uc002sma.1_Missense_Mutation_p.E134K	NM_016170	NP_057254	O43763	TLX2_HUMAN	T-cell leukemia homeobox 2	263					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity				0						Esophageal Squamous(7;240 533 18610 24312)								0.888889	26.456446	27.748611	8	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	74596758	74596758	16491	2	G	A	A	33	33	TLX2	A	2	2
TEKT4	150483	broad.mit.edu	36	2	94901198	94901198	+	Nonsense_Mutation	SNP	T	A	A			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:94901198T>A	uc002stw.1	+	c.147T>A	c.(145-147)TAT>TAA	p.Y49*	TEKT4_uc010fhr.1_Non-coding_Transcript	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	49					cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)	2														0.343284	68.615468	70.063946	23	44	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	94901198	94901198	16282	2	T	A	A	51	51	TEKT4	A	5	4
MGAT4A	11320	broad.mit.edu	36	2	98622701	98622701	+	Splice_Site_SNP	SNP	A	G	G			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:98622701A>G	uc002sze.1	-	c.e12_splice_site			MGAT4A_uc010fil.1_Splice_Site_SNP|C2orf64_uc002sza.1_Intron	NM_012214	NP_036346			mannosyl (alpha-1,3-)-glycoprotein						N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding				0														0.144737	7.27319	16.531947	11	65	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	98622701	98622701	9935	2	A	G	G	2	2	MGAT4A	G	5	4
TFDP2	7029	broad.mit.edu	36	3	143294602	143294602	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:143294602G>T	uc003eun.2	-	c.73C>A	c.(73-75)CCA>ACA	p.P25T	TFDP2_uc003eum.2_5'UTR|TFDP2_uc003euo.2_Intron	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization	25					cell cycle|regulation of transcription, DNA-dependent	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1														0.238095	6.35623	7.68291	5	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	143294602	143294602	16326	3	G	T	T	41	41	TFDP2	T	3	3
MED12L	116931	broad.mit.edu	36	3	152576687	152576687	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:152576687C>G	uc003eyp.1	+	c.3943C>G	c.(3943-3945)CTT>GTT	p.L1315V	P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Missense_Mutation_p.L478V	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	1315					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex	RNA polymerase II transcription mediator activity			ovary(4)|large_intestine(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)							59				0.52	39.472735	39.481362	13	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152576687	152576687	9818	3	C	G	G	32	32	MED12L	G	3	3
LAMB2	3913	broad.mit.edu	36	3	49136448	49136448	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49136448G>A	uc003cwe.1	-	c.3514C>T	c.(3514-3516)CGC>TGC	p.R1172C		NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1172	Laminin EGF-like 13.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)										0.5	11.09805	11.09805	4	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49136448	49136448	8934	3	G	A	A	38	38	LAMB2	A	1	1
ACY1	95	broad.mit.edu	36	3	51995510	51995510	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:51995510T>A	uc003dcp.1	+	c.476T>A	c.(475-477)GTG>GAG	p.V159E	ACY1_uc003dcq.1_Missense_Mutation_p.V159E	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1	159					cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)									0.220183	26.69157	34.623167	24	85	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51995510	51995510	227	3	T	A	A	59	59	ACY1	A	4	4
OR5K4	403278	broad.mit.edu	36	3	99555548	99555548	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:99555548G>A	uc003dsk.1	+	c.161G>A	c.(160-162)CGT>CAT	p.R54H		NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K,	54	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1														0.230469	288.313615	322.393839	118	394	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99555548	99555548	11579	3	G	A	A	40	40	OR5K4	A	1	1
AGXT2L1	64850	broad.mit.edu	36	4	109887419	109887419	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:109887419C>A	uc003hzc.1	-	c.1120G>T	c.(1120-1122)GAC>TAC	p.D374Y	AGXT2L1_uc010imc.1_Missense_Mutation_p.D368Y	NM_031279	NP_112569	Q8TBG4	AT2L1_HUMAN	alanine-glyoxylate aminotransferase 2-like 1	374					cellular amino acid metabolic process	mitochondrion	alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000281)										0.202614	112.048889	137.16169	62	244	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	109887419	109887419	409	4	C	A	A	30	30	AGXT2L1	A	3	3
LRBA	987	broad.mit.edu	36	4	151576277	151576277	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:151576277C>T	uc010ipj.1	-	c.6988G>A	c.(6988-6990)GGA>AGA	p.G2330R	LRBA_uc003ilu.2_Missense_Mutation_p.G2319R|LRBA_uc010ipi.1_Intron|LRBA_uc003ils.2_Missense_Mutation_p.G220R|LRBA_uc003ilt.2_Missense_Mutation_p.G978R	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	2330	BEACH.					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)	6	all_hematologic(180;0.151)													0.398496	147.745567	148.944027	53	80	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	151576277	151576277	9304	4	C	T	T	24	24	LRBA	T	2	2
NFXL1	152518	broad.mit.edu	36	4	47596225	47596225	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:47596225C>A	uc010igh.1	-	c.745G>T	c.(745-747)GTG>TTG	p.V249L	NFXL1_uc003gxp.1_Missense_Mutation_p.V249L|NFXL1_uc003gxq.2_Non-coding_Transcript|NFXL1_uc010igi.1_Missense_Mutation_p.V249L	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like	249					regulation of transcription, DNA-dependent	integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1														0.2	8.05363	11.447478	8	32	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47596225	47596225	10788	4	C	A	A	17	17	NFXL1	A	3	3
FRYL	285527	broad.mit.edu	36	4	48202383	48202383	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:48202383C>T	uc003gyh.1	-	c.8401G>A	c.(8401-8403)GAT>AAT	p.D2801N	FRYL_uc003gyg.1_Missense_Mutation_p.D1497N|FRYL_uc003gye.1_5'UTR|FRYL_uc003gyf.1_Missense_Mutation_p.D197N	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	2801					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1														0.428571	12.446393	12.507935	6	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48202383	48202383	6314	4	C	T	T	32	32	FRYL	T	2	2
WWC1	23286	broad.mit.edu	36	5	167783414	167783414	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:167783414T>G	uc003lzu.1	+	c.1573T>G	c.(1573-1575)TCT>GCT	p.S525A	WWC1_uc003lzv.1_Missense_Mutation_p.S431A|WWC1_uc003lzw.1_Missense_Mutation_p.S324A	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	525					cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|breast(1)	3	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)										0.238095	7.157381	8.481759	5	16	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	167783414	167783414	17985	5	T	G	G	58	58	WWC1	G	4	4
SH3PXD2B	285590	broad.mit.edu	36	5	171697987	171697987	+	Silent	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:171697987C>T	uc003mbr.1	-	c.2727G>A	c.(2725-2727)AAG>AAA	p.K909K		NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	909	SH3 4.				adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)	3	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)											0.222222	6.784957	8.767638	6	21	CC		KEEP	---	---	---	---	capture			Silent	SNP	171697987	171697987	14749	5	C	T	T	32	32	SH3PXD2B	T	2	2
ERBB2IP	55914	broad.mit.edu	36	5	65410018	65410018	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:65410018C>A	uc010iwx.1	+	c.4152C>A	c.(4150-4152)TAC>TAA	p.Y1384*	ERBB2IP_uc003jui.1_Nonsense_Mutation_p.Y1340*|ERBB2IP_uc003juj.1_Nonsense_Mutation_p.Y1271*|ERBB2IP_uc003juk.1_Nonsense_Mutation_p.Y1381*|ERBB2IP_uc003jul.1_Nonsense_Mutation_p.Y1336*	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	1381	PDZ.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(1)	6		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)										0.232558	13.635514	16.464804	10	33	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	65410018	65410018	5400	5	C	A	A	17	17	ERBB2IP	A	5	3
UTP15	84135	broad.mit.edu	36	5	72898934	72898934	+	Silent	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:72898934T>G	uc003kcw.1	+	c.9T>G	c.(7-9)GGT>GGG	p.G3G	ANKRA2_uc003kcu.1_5'Flank|ANKRA2_uc003kcv.1_5'Flank|UTP15_uc010ize.1_Silent_p.G3G	NM_032175	NP_115551	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein,	3					rRNA processing	cytoplasm|nucleolus					0		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)										0.166667	7.725828	13.637284	9	45	TT		KEEP	---	---	---	---	capture			Silent	SNP	72898934	72898934	17662	5	T	G	G	60	60	UTP15	G	4	4
TAAR2	9287	broad.mit.edu	36	6	132980882	132980882	+	Silent	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:132980882T>C	uc003qdl.1	-	c.156A>G	c.(154-156)GGA>GGG	p.G52G	TAAR2_uc010kfr.1_Silent_p.G7G	NM_001033080	NP_055441	Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2 isoform 1	52	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)										0.16	7.647846	13.229692	8	42	TT		KEEP	---	---	---	---	capture			Silent	SNP	132980882	132980882	16011	6	T	C	C	50	50	TAAR2	C	4	4
FOXC1	2296	broad.mit.edu	36	6	1557233	1557233	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:1557233G>T	uc003mtp.1	+	c.1554G>T	c.(1552-1554)TTG>TTT	p.L518F		NM_001453	NP_001444	Q12948	FOXC1_HUMAN	forkhead box C1	518					anti-apoptosis|artery morphogenesis|blood vessel remodeling|brain development|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|germ cell migration|glycosaminoglycan metabolic process|lacrimal gland development|lymphangiogenesis|metanephros development|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of mitotic cell cycle|neural crest cell fate commitment|Notch signaling pathway|odontogenesis of dentine-containing tooth|ossification|ovarian follicle development|paraxial mesodermal cell fate commitment|positive regulation of gene-specific transcription from RNA polymerase II promoter|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	nuclear heterochromatin|transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)	1	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		Pancreas(133;719 1821 3197 26645 35015)								0.135135	6.302416	11.035873	5	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1557233	1557233	6236	6	G	T	T	45	45	FOXC1	T	3	3
PACRG	135138	broad.mit.edu	36	6	163069329	163069329	+	Silent	SNP	G	C	C			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:163069329G>C	uc003qua.1	+	c.72G>C	c.(70-72)CTG>CTC	p.L24L	PARK2_uc003qtx.2_5'Flank|PARK2_uc003qty.2_5'Flank|PARK2_uc003qtz.2_5'Flank|PARK2_uc010kke.1_5'Flank|PACRG_uc003qub.1_Silent_p.L24L|PACRG_uc003quc.1_Silent_p.L24L	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1	24											0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)										0.235294	6.390924	7.482413	4	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	163069329	163069329	11786	6	G	C	C	47	47	PACRG	C	3	3
KIAA0319	9856	broad.mit.edu	36	6	24672433	24672434	+	Missense_Mutation	DNP	TG	CT	CT			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:24672433_24672434TG>CT	uc003neh.1	-	c.2406_2407CA>AG	c.(2404-2409)GACACT>GAAGCT	p.802_803DT>EA	KIAA0319_uc010jpt.1_Missense_Mutation_p.213_214DT>EA	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319	802_803	PKD 5.|Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)	1														0.208333	6.360371	8.257486	5	19	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	24672433	24672434	8475	6	TG	CT	CT	59	59	KIAA0319	CT	4	4
UHRF1BP1	54887	broad.mit.edu	36	6	34946752	34946752	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:34946752T>G	uc003oju.2	+	c.3862T>G	c.(3862-3864)TGT>GGT	p.C1288G	UHRF1BP1_uc010jvm.1_Non-coding_Transcript|UHRF1BP1_uc010jvn.1_Non-coding_Transcript|UHRF1BP1_uc010jvo.1_Non-coding_Transcript	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	1288										ovary(3)	3														0.211538	14.082946	18.105371	11	41	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34946752	34946752	17526	6	T	G	G	55	55	UHRF1BP1	G	4	4
TJAP1	93643	broad.mit.edu	36	6	43579355	43579355	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43579355A>G	uc003ovd.1	+	c.512A>G	c.(511-513)GAC>GGC	p.D171G	TJAP1_uc003ovc.1_Missense_Mutation_p.D161G|TJAP1_uc010jyp.1_Missense_Mutation_p.D130G|TJAP1_uc003ove.1_Missense_Mutation_p.D161G|TJAP1_uc003ovf.1_Missense_Mutation_p.D161G|TJAP1_uc003ovg.1_Missense_Mutation_p.D37G|TJAP1_uc003ovh.1_5'UTR|TJAP1_uc003ovi.1_Missense_Mutation_p.D37G	NM_080604	NP_542171	Q5JTD0	TJAP1_HUMAN	tight junction protein 4 (peripheral)	171	Potential.					Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)											0.142857	6.70014	12.744035	7	42	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43579355	43579355	16457	6	A	G	G	10	10	TJAP1	G	4	4
PLA2G7	7941	broad.mit.edu	36	6	46787192	46787192	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:46787192C>A	uc010jzf.1	-	c.663G>T	c.(661-663)CAG>CAT	p.Q221H	PLA2G7_uc010jzg.1_Missense_Mutation_p.Q221H	NM_005084	NP_005075	Q13093	PAFA_HUMAN	phospholipase A2, group VII	221					inflammatory response|lipid catabolic process	extracellular space	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding				0			Lung(136;0.192)											0.377919	976.854788	989.172875	356	586	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46787192	46787192	12435	6	C	A	A	24	24	PLA2G7	A	3	3
COL12A1	1303	broad.mit.edu	36	6	75950486	75950486	+	Nonsense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:75950486G>T	uc010kbb.1	-	c.1092C>A	c.(1090-1092)TAC>TAA	p.Y364*	COL12A1_uc010kbc.1_Intron|COL12A1_uc003phs.1_Nonsense_Mutation_p.Y364*|COL12A1_uc003pht.1_Intron|COL12A1_uc003phu.1_Nonsense_Mutation_p.Y22*	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	364	Fibronectin type-III 2.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)	8														0.210526	12.210292	15.141121	8	30	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	75950486	75950486	3807	6	G	T	T	48	48	COL12A1	T	5	3
SLC13A4	26266	broad.mit.edu	36	7	135034683	135034683	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:135034683T>G	uc003vtb.1	-	c.868A>C	c.(868-870)ACC>CCC	p.T290P	SLC13A4_uc003vta.1_Missense_Mutation_p.T289P	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate	289	Helical; (Potential).					integral to plasma membrane	sodium:sulfate symporter activity				0														0.266667	20.436052	24.419354	20	55	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135034683	135034683	14889	7	T	G	G	59	59	SLC13A4	G	4	4
ADCK2	90956	broad.mit.edu	36	7	140020533	140020533	+	Splice_Site_SNP	SNP	G	C	C			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:140020533G>C	uc003vvy.1	+	c.e1_splice_site			ADCK2_uc003vvz.2_Splice_Site_SNP	NM_052853	NP_443085			aarF domain containing kinase 2							integral to membrane	ATP binding|protein serine/threonine kinase activity				0	Melanoma(164;0.00956)									111				0.444444	168.587244	168.947921	60	75	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	140020533	140020533	290	7	G	C	C	36	36	ADCK2	C	5	3
COBL	23242	broad.mit.edu	36	7	51060459	51060459	+	Silent	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:51060459T>G	uc003tpr.2	-	c.3609A>C	c.(3607-3609)CCA>CCC	p.P1203P	COBL_uc003tpp.2_Silent_p.P989P|COBL_uc003tpq.2_Intron|COBL_uc003tpo.2_Silent_p.P745P	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	1203										ovary(2)|skin(1)	3	Glioma(55;0.08)					NSCLC(189;2119 2138 12223 30818 34679)								0.294118	6.601184	7.294777	5	12	TT		KEEP	---	---	---	---	capture			Silent	SNP	51060459	51060459	3791	7	T	G	G	59	59	COBL	G	4	4
FKBP6	8468	broad.mit.edu	36	7	72382290	72382290	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:72382290C>G	uc003tya.2	+	c.467C>G	c.(466-468)GCT>GGT	p.A156G	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank|FKBP6_uc010lbe.1_Non-coding_Transcript	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	156					protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)												0.398305	574.316914	578.580532	188	284	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72382290	72382290	6150	7	C	G	G	28	28	FKBP6	G	3	3
SRCRB4D	136853	broad.mit.edu	36	7	75871571	75871571	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:75871571A>G	uc003ufb.1	-	c.122T>C	c.(121-123)CTC>CCC	p.L41P	ZP3_uc003ufc.2_Intron	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	41						extracellular region|membrane	scavenger receptor activity			pancreas(1)	1														0.24359	19.553939	24.696814	19	59	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75871571	75871571	15651	7	A	G	G	11	11	SRCRB4D	G	4	4
BLK	640	broad.mit.edu	36	8	11445142	11445142	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:11445142C>T	uc003wty.1	+	c.434C>T	c.(433-435)GCC>GTC	p.A145V	BLK_uc003wtz.1_Missense_Mutation_p.A74V	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	145	SH2.				intracellular protein kinase cascade|positive regulation of insulin secretion|protein phosphorylation		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|ovary(1)	2			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)						676				0.387013	785.825289	794.409904	298	472	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11445142	11445142	1469	8	C	T	T	26	26	BLK	T	2	2
MTMR7	9108	broad.mit.edu	36	8	17202097	17202097	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:17202097T>C	uc003wxm.1	-	c.1628A>G	c.(1627-1629)GAA>GGA	p.E543G		NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	543							protein tyrosine phosphatase activity				0				Colorectal(111;0.112)										0.201923	11.723108	20.901707	21	83	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17202097	17202097	10341	8	T	C	C	62	62	MTMR7	C	4	4
BMP1	649	broad.mit.edu	36	8	22115338	22115338	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:22115338T>A	uc003xbg.1	+	c.2185T>A	c.(2185-2187)TGC>AGC	p.C729S	BMP1_uc003xbc.1_3'UTR|BMP1_uc003xbd.1_Non-coding_Transcript|BMP1_uc003xbf.1_3'UTR|BMP1_uc003xbe.1_Non-coding_Transcript|BMP1_uc003xbh.1_Non-coding_Transcript|BMP1_uc003xbi.1_Non-coding_Transcript	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3	729	EGF-like 2; calcium-binding (Potential).				cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)										0.184211	7.380969	10.975133	7	31	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22115338	22115338	1481	8	T	A	A	51	51	BMP1	A	4	4
ASH2L	9070	broad.mit.edu	36	8	38115717	38115717	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:38115717G>A	uc003xkt.2	+	c.1858G>A	c.(1858-1860)GGG>AGG	p.G620R	ASH2L_uc003xku.2_Missense_Mutation_p.G526R|ASH2L_uc010lwa.1_Missense_Mutation_p.G493R	NM_004674	NP_004665	Q9UBL3	ASH2L_HUMAN	ash2-like isoform a	620					hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|promoter binding|protein binding|transcription regulator activity			ovary(1)|lung(1)	2	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)								355				0.333333	35.435142	36.468803	14	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38115717	38115717	1061	8	G	A	A	47	47	ASH2L	A	2	2
CHRNA6	8973	broad.mit.edu	36	8	42727512	42727512	+	Silent	SNP	T	G	G			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:42727512T>G	uc003xpj.1	-	c.1452A>C	c.(1450-1452)CTA>CTC	p.L484L		NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6	484	Helical; (Potential).					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)											0.227273	10.260786	11.76822	5	17	TT		KEEP	---	---	---	---	capture			Silent	SNP	42727512	42727512	3521	8	T	G	G	57	57	CHRNA6	G	4	4
SGK223	157285	broad.mit.edu	36	8	8272765	8272765	+	Silent	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:8272765C>A	uc003wsh.2	-	c.564G>T	c.(562-564)GTG>GTT	p.V188V		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	188					protein phosphorylation		ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GBM(34;731 755 10259 33573 33867)				135				0.157895	8.52297	12.770368	6	32	CC		KEEP	---	---	---	---	capture			Silent	SNP	8272765	8272765	14701	8	C	A	A	25	25	SGK223	A	3	3
AKNA	80709	broad.mit.edu	36	9	116179379	116179379	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:116179379G>T	uc004biq.2	-	c.529C>A	c.(529-531)CAA>AAA	p.Q177K	AKNA_uc004bio.2_5'Flank|AKNA_uc004bip.2_Missense_Mutation_p.Q96K|AKNA_uc004bir.2_Missense_Mutation_p.Q177K|AKNA_uc004bis.2_Missense_Mutation_p.Q177K|AKNA_uc010mve.1_Missense_Mutation_p.Q58K|AKNA_uc004biu.1_Intron|AKNA_uc004biv.1_Missense_Mutation_p.Q177K|AKNA_uc004biw.1_Missense_Mutation_p.Q177K	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	177					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6														0.227273	7.575103	9.073895	5	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116179379	116179379	466	9	G	T	T	48	48	AKNA	T	3	3
PAPPA	5069	broad.mit.edu	36	9	117989348	117989348	+	Nonsense_Mutation	SNP	C	G	G			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:117989348C>G	uc004bjn.1	+	c.510C>G	c.(508-510)TAC>TAG	p.Y170*		NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	170					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|pancreas(1)	5										611				0.177215	233.407828	303.223334	126	585	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	117989348	117989348	11849	9	C	G	G	20	20	PAPPA	G	5	3
SUSD3	203328	broad.mit.edu	36	9	94881618	94881618	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:94881618C>T	uc004atb.1	+	c.470C>T	c.(469-471)ACG>ATG	p.T157M	SUSD3_uc004atc.1_Missense_Mutation_p.T144M	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN	sushi domain containing 3	157	Cytoplasmic (Potential).					integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6														0.155556	11.503452	16.60169	7	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94881618	94881618	15929	9	C	T	T	19	19	SUSD3	T	1	1
RNF128	79589	broad.mit.edu	36	X	105902843	105902843	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0818-01	TCGA-12-0818-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:105902843A>G	uc004eml.1	+	c.529A>G	c.(529-531)ACA>GCA	p.T177A	RNF128_uc004emk.1_Missense_Mutation_p.T151A	NM_194463	NP_919445	Q8TEB7	RN128_HUMAN	ring finger protein 128 isoform 1	177	PA.					endomembrane system|integral to membrane|perinuclear region of cytoplasm	zinc ion binding			ovary(1)|central_nervous_system(1)	2														0.330579	106.15499	109.235105	40	81	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105902843	105902843	13913	23	A	G	G	6	6	RNF128	G	4	4
HCFC1	3054	broad.mit.edu	36	X	152871381	152871381	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:152871381G>T	uc004fjp.1	-	c.4720C>A	c.(4720-4722)CCA>ACA	p.P1574T		NM_005334	NP_005325	P51610	HCFC1_HUMAN	host cell factor 1	1574					cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)											OREG0003630	type=REGULATORY REGION|Gene=BC010606|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.75	6.320491	6.543764	3	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152871381	152871381	7273	23	G	T	T	42	42	HCFC1	T	3	3
MECP2	4204	broad.mit.edu	36	X	152949348	152949348	+	Silent	SNP	G	C	C			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:152949348G>C	uc004fjw.2	-	c.1161C>G	c.(1159-1161)TCC>TCG	p.S387S	MECP2_uc004fjv.2_Silent_p.S375S	NM_001110792	NP_001104262	P51608	MECP2_HUMAN	methyl CpG binding protein 2 isoform 2	375					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity|transcription repressor activity				0	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)													0.205128	9.264936	12.432403	8	31	GG		KEEP	---	---	---	---	capture			Silent	SNP	152949348	152949348	9812	23	G	C	C	43	43	MECP2	C	3	3
ARSD	414	broad.mit.edu	36	X	2835573	2835573	+	Silent	SNP	G	A	A			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:2835573G>A	uc004cqy.1	-	c.1521C>T	c.(1519-1521)GGC>GGT	p.G507G	ARSD_uc004cqz.1_Non-coding_Transcript	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor	507						lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)												0.346154	45.267286	46.338526	18	34	GG		KEEP	---	---	---	---	capture			Silent	SNP	2835573	2835573	1007	23	G	A	A	38	38	ARSD	A	1	1
BCOR	54880	broad.mit.edu	36	X	39816823	39816823	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:39816823C>T	uc004den.2	-	c.2720G>A	c.(2719-2721)AGC>AAC	p.S907N	BCOR_uc004dep.2_Missense_Mutation_p.S907N|BCOR_uc004deo.2_Missense_Mutation_p.S907N|BCOR_uc004dem.2_Missense_Mutation_p.S907N|BCOR_uc004deq.2_Missense_Mutation_p.S907N	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	907					chromatin modification|heart development|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|odontogenesis|palate development|protein ubiquitination|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|promoter binding|transcription corepressor activity|transcription factor binding			ovary(2)|kidney(1)|central_nervous_system(1)	4														0.554913	298.394471	298.847242	96	77	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39816823	39816823	1407	23	C	T	T	28	28	BCOR	T	2	2
ATP6AP2	10159	broad.mit.edu	36	X	40345006	40345006	+	Silent	SNP	T	C	C			TCGA-12-0818-01	TCGA-12-0818-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:40345006T>C	uc004det.1	+	c.787T>C	c.(787-789)TTA>CTA	p.L263L	ATP6AP2_uc010nhc.1_Non-coding_Transcript|ATP6AP2_uc004deu.1_Silent_p.L128L	NM_005765	NP_005756	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory	263	Extracellular (Potential).				angiotensin maturation|positive regulation of transforming growth factor-beta1 production|regulation of MAPKKK cascade	external side of plasma membrane|integral to membrane	protein binding|receptor activity				0														0.342857	65.570273	67.101168	24	46	TT		KEEP	---	---	---	---	capture			Silent	SNP	40345006	40345006	1186	23	T	C	C	60	60	ATP6AP2	C	4	4
CXCR3	2833	broad.mit.edu	36	X	70753842	70753842	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0818-01	TCGA-12-0818-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70753842G>T	uc004eaf.1	-	c.205C>A	c.(205-207)CTG>ATG	p.L69M		NM_001504	NP_001495	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3 isoform A	69	Helical; Name=1; (Potential).				cell adhesion|cellular component movement|chemotaxis|elevation of cytosolic calcium ion concentration	cytoplasm|integral to plasma membrane	C-X-C chemokine receptor activity			ovary(2)|central_nervous_system(1)	3	Renal(35;0.156)													0.179724	57.209415	78.185881	39	178	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70753842	70753842	4252	23	G	T	T	34	34	CXCR3	T	3	3
CPXCR1	53336	broad.mit.edu	36	X	87895594	87895594	+	Silent	SNP	C	A	A			TCGA-12-0818-01	TCGA-12-0818-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:87895594C>A	uc004efd.2	+	c.523C>A	c.(523-525)CGA>AGA	p.R175R	CPXCR1_uc004efc.2_Silent_p.R175R|CPXCR1_uc010nms.1_Silent_p.R175R	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	175						intracellular	zinc ion binding			ovary(3)	3														0.147059	14.906761	23.048345	10	58	CC		KEEP	---	---	---	---	capture			Silent	SNP	87895594	87895594	3975	23	C	A	A	27	27	CPXCR1	A	3	3
EBF3	253738	broad.mit.edu	36	10	131651749	131651761	+	Frame_Shift_Del	DEL	CGAAGTGCGCCCG	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:131651749_131651761delCGAAGTGCGCCCG	uc001lki.1	-	c.151_163delCGGGCGCACTTCG	c.(151-165)CGGGCGCACTTCGAGfs	p.R51fs		NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3	51_55					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding|transcription regulator activity			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)										0.38			29	47				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	131651749	131651761	5068	10	CGAAGTGCGCCCG	-	-	31	31	EBF3	-	5	5
DLG5	9231	broad.mit.edu	36	10	79251289	79251290	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:79251289_79251290insG	uc001jzk.1	-	c.2958_2959insC	c.(2956-2961)CCCAAAfs	p.P986fs	DLG5_uc009xru.1_Non-coding_Transcript|DLG5_uc001jzi.1_5'Flank|DLG5_uc001jzj.1_Intron|DLG5_uc001jzl.2_Frame_Shift_Ins_p.P590fs	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	986_987	Pro-rich.				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)											0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	79251289	79251290	4738	10	-	G	G	63	63	DLG5	G	5	5
NAA40	79829	broad.mit.edu	36	11	63471001	63471006	+	In_Frame_Del	DEL	TGGAGA	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:63471001_63471006delTGGAGA	uc009yoz.1	+	c.105_110delTGGAGA	c.(103-111)CTTGGAGAC>CTC	p.GD36del		NM_024771	NP_079047	Q86UY6	NAA40_HUMAN	N-acetyltransferase 11	36_37							N-acetyltransferase activity				0														0.38			125	200				---	---	---	---	capture_indel			In_Frame_Del	DEL	63471001	63471006	10520	11	TGGAGA	-	-	63	63	NAA40	-	5	5
CCDC87	55231	broad.mit.edu	36	11	66115552	66115555	+	Frame_Shift_Del	DEL	GAAG	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:66115552_66115555delGAAG	uc001oiq.2	-	c.1508_1511delCTTC	c.(1507-1512)TCTTCTfs	p.S503fs	CCS_uc001oir.1_5'Flank	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	503_504										ovary(1)	1														0.45			387	468				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	66115552	66115555	2987	11	GAAG	-	-	33	33	CCDC87	-	5	5
ACACB	32	broad.mit.edu	36	12	108090197	108090204	+	Frame_Shift_Del	DEL	CCCCGAGG	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:108090197_108090204delCCCCGAGG	uc001tob.1	+	c.900_907delCCCCGAGG	c.(898-909)ACCCCCGAGGACfs	p.T300fs	ACACB_uc001toc.1_Frame_Shift_Del_p.T300fs	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	300_303	Biotin carboxylation.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|pancreas(1)	6					Biotin(DB00121)					1843				0.43			278	365				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	108090197	108090204	108	12	CCCCGAGG	-	-	22	22	ACACB	-	5	5
PITPNM2	57605	broad.mit.edu	36	12	122055893	122055903	+	Frame_Shift_Del	DEL	CCTCCTCACCA	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:122055893_122055903delCCTCCTCACCA	uc001uej.1	-	c.789_799delTGGTGAGGAGG	c.(787-801)GATGGTGAGGAGGCCfs	p.D263fs	PITPNM2_uc001uek.1_Frame_Shift_Del_p.D263fs|PITPNM2_uc009zxu.1_Frame_Shift_Del_p.D263fs	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,	263_267					metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)										0.78			412	114				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	122055893	122055903	12375	12	CCTCCTCACCA	-	-	26	26	PITPNM2	-	5	5
C12orf62	84987	broad.mit.edu	36	12	48800229	48800239	+	Frame_Shift_Del	DEL	CAGGCCGCAGA	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:48800229_48800239delCAGGCCGCAGA	uc001rwb.1	+	c.136_146delCAGGCCGCAGA	c.(136-147)CAGGCCGCAGAAfs	p.Q46fs	C12orf62_uc009zlq.1_Frame_Shift_Del_p.Q46fs	NM_032901	NP_116290	Q96I36	CL062_HUMAN	hypothetical protein LOC84987	46_49						integral to membrane					0														0.51			28	27				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48800229	48800239	1749	12	CAGGCCGCAGA	-	-	21	21	C12orf62	-	5	5
AMDHD2	51005	broad.mit.edu	36	16	2518619	2518620	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2518619_2518620insC	uc002cqp.1	+	c.1028_1029insC	c.(1027-1029)GACfs	p.D343fs	AMDHD2_uc002cqq.1_Intron	NM_015944	NP_057028	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	323					N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity			large_intestine(1)|breast(1)	2														0.50			3	3				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	2518619	2518620	571	16	-	C	C	10	10	AMDHD2	C	5	5
HSF4	3299	broad.mit.edu	36	16	65756299	65756299	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:65756299_65756299delG	uc002erl.1	+	c.84_84delG	c.(82-84)GTGfs	p.V28fs	HSF4_uc002erm.1_Frame_Shift_Del_p.V28fs|HSF4_uc002ern.1_Non-coding_Transcript|HSF4_uc010cec.1_Non-coding_Transcript	NM_001040667	NP_001035757	Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4 isoform b	28	By similarity.				response to stress	nucleus	sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	65756299	65756299	7693	16	G	-	-	47	47	HSF4	-	5	5
MBTPS1	8720	broad.mit.edu	36	16	82686825	82686826	+	Frame_Shift_Ins	INS	-	CA	CA			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:82686825_82686826insCA	uc002fhi.1	-	c.507_508insTG	c.(505-510)CTGGGCfs	p.L169fs		NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1	169_170					cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2														0.44			4	5				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	82686825	82686826	9750	16	-	CA	CA	22	22	MBTPS1	CA	5	5
MYO1C	4641	broad.mit.edu	36	17	1320343	1320344	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:1320343_1320344insG	uc002fsp.1	-	c.2401_2402insC	c.(2401-2403)CGCfs	p.R801fs	MYO1C_uc002fsn.1_Frame_Shift_Ins_p.R782fs|MYO1C_uc002fso.1_Frame_Shift_Ins_p.R766fs	NM_001080779	NP_203693	O00159	MYO1C_HUMAN	myosin IC isoform a	801					mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	1320343	1320344	10465	17	-	G	G	27	27	MYO1C	G	5	5
SERPINB12	89777	broad.mit.edu	36	18	59376575	59376578	+	Frame_Shift_Del	DEL	TCAA	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:59376575_59376578delTCAA	uc002ljb.1	+	c.179_182delTCAA	c.(178-183)TTCAACfs	p.F60fs	SERPINB12_uc002lja.1_Frame_Shift_Del_p.F60fs	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	60_61					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0														0.42			70	96				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	59376575	59376578	14587	18	TCAA	-	-	62	62	SERPINB12	-	5	5
EMILIN1	11117	broad.mit.edu	36	2	27159322	27159323	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:27159322_27159323insG	uc002rii.2	+	c.1379_1380insG	c.(1378-1380)CTGfs	p.L460fs	EMILIN1_uc010eyq.1_Frame_Shift_Ins_p.L460fs|EMILIN1_uc002rik.2_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	460					cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	27159322	27159323	5285	2	-	G	G	55	55	EMILIN1	G	5	5
ALDH1L1	10840	broad.mit.edu	36	3	127327246	127327269	+	Splice_Site_Del	DEL	CCACAAACCCTGCCACACAAAAGA	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:127327246_127327269delCCACAAACCCTGCCACACAAAAGA	uc003eim.1	-	c.e15_splice_site			ALDH1L1_uc010hse.1_Splice_Site_Del	NM_012190	NP_036322			aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process|oxidation-reduction process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)									0.31			32	70				---	---	---	---	capture_indel			Splice_Site_Del	DEL	127327246	127327269	497	3	CCACAAACCCTGCCACACAAAAGA	-	-	26	26	ALDH1L1	-	5	5
ABHD14A	25864	broad.mit.edu	36	3	51987125	51987126	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:51987125_51987126delAA	uc003dco.1	+	c.268_269delAA	c.(268-270)AACfs	p.N90fs	ABHD14B_uc003dcn.1_Intron|ABHD14A_uc010hlz.1_Frame_Shift_Del_p.N90fs	NM_015407	NP_056222	Q9BUJ0	ABHEA_HUMAN	abhydrolase domain containing 14A	90						cytoplasm|integral to membrane	hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)										0.32			6	13				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	51987125	51987126	80	3	AA	-	-	5	5	ABHD14A	-	5	5
HIVEP1	3096	broad.mit.edu	36	6	12233529	12233530	+	In_Frame_Ins	INS	-	TGC	TGC			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:12233529_12233530insTGC	uc003nac.1	+	c.5515_5516insTGC	c.(5515-5517)TCA>TTGCCA	p.1839_1839S>LP		NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1839					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)	5	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)												0.46			37	44				---	---	---	---	capture_indel			In_Frame_Ins	INS	12233529	12233530	7477	6	-	TGC	TGC	62	62	HIVEP1	TGC	5	5
RXRB	6257	broad.mit.edu	36	6	33275023	33275024	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:33275023_33275024insG	uc003odc.1	-	c.383_384insC	c.(382-384)CCAfs	p.P128fs	RXRB_uc003odb.1_Frame_Shift_Ins_p.P128fs|RXRB_uc003odd.1_Intron|RXRB_uc003ode.1_5'Flank|SLC39A7_uc003odf.1_5'Flank|SLC39A7_uc003odg.1_5'Flank|SLC39A7_uc003odh.1_5'Flank	NM_021976	NP_068811	P28702	RXRB_HUMAN	retinoid X receptor, beta	128	Modulating (By similarity).|Pro-rich.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			ovary(3)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)									0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	33275023	33275024	14244	6	-	G	G	59	59	RXRB	G	5	5
GSDMD	79792	broad.mit.edu	36	8	144712746	144712757	+	In_Frame_Del	DEL	GCTTCCAGCCCT	-	-			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:144712746_144712757delGCTTCCAGCCCT	uc003yyf.1	+	c.242_253delGCTTCCAGCCCT	c.(241-255)GGCTTCCAGCCCTAC>GAC	p.81_85GFQPY>D	GSDMD_uc010mfe.1_In_Frame_Del_p.33_37GFQPY>D|GSDMD_uc003yyg.1_In_Frame_Del_p.33_37GFQPY>D|GSDMD_uc003yyh.1_In_Frame_Del_p.33_37GFQPY>D|GSDMD_uc003yyi.1_In_Frame_Del_p.33_37GFQPY>D	NM_024736	NP_079012	P57764	GSDMD_HUMAN	gasdermin D	33_37											0														0.44			91	114				---	---	---	---	capture_indel			In_Frame_Del	DEL	144712746	144712757	7099	8	GCTTCCAGCCCT	-	-	42	42	GSDMD	-	5	5
PLXNB3	5365	broad.mit.edu	36	X	152695884	152695885	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0818-01	TCGA-12-0818-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:152695884_152695885insG	uc004fii.1	+	c.4955_4956insG	c.(4954-4956)GAGfs	p.E1652fs	SRPK3_uc004fik.1_5'UTR|PLXNB3_uc010nuk.1_Frame_Shift_Ins_p.E1675fs	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3	1652	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)													0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	152695884	152695885	12551	23	-	G	G	11	11	PLXNB3	G	5	5
