Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
C10orf125	282969	broad.mit.edu	36	10	135019284	135019285	+	Missense_Mutation	DNP	TC	AA	AA			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:135019284_135019285TC>AA	uc001lmt.2	-	c.345_346GA>TT	c.(343-348)GAGAGG>GATTGG	p.115_116ER>DW	C10orf125_uc001lms.2_Missense_Mutation_p.115_116ER>DW	NM_001098483	NP_001091953	A2VDF0	FUCM_HUMAN	hypothetical protein LOC282969 isoform 1	115_116					carbohydrate transport		racemase and epimerase activity, acting on carbohydrates and derivatives				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;6.94e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)										1	11.059193	10.998097	4	0	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	135019284	135019285	1627	10	TC	AA	AA	54	54	C10orf125	AA	4	4
PAOX	196743	broad.mit.edu	36	10	135043774	135043774	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:135043774G>T	uc001lmv.1	+	c.463G>T	c.(463-465)GTC>TTC	p.V155F	PAOX_uc001lmw.1_Intron|PAOX_uc001lmx.1_Missense_Mutation_p.V155F|PAOX_uc001lmy.1_Missense_Mutation_p.V155F|PAOX_uc001lmz.1_Non-coding_Transcript|PAOX_uc001lna.1_Intron|PAOX_uc001lnb.1_Non-coding_Transcript|PAOX_uc001lnc.1_Intron	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino) isoform 1	293					oxidation-reduction process|polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)										0.973684	85.791835	87.76387	37	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135043774	135043774	11840	10	G	T	T	40	40	PAOX	T	3	3
PAOX	196743	broad.mit.edu	36	10	135043777	135043777	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:135043777G>C	uc001lmv.1	+	c.466G>C	c.(466-468)GGG>CGG	p.G156R	PAOX_uc001lmw.1_Intron|PAOX_uc001lmx.1_Missense_Mutation_p.G156R|PAOX_uc001lmy.1_Missense_Mutation_p.G156R|PAOX_uc001lmz.1_Non-coding_Transcript|PAOX_uc001lna.1_Intron|PAOX_uc001lnb.1_Non-coding_Transcript|PAOX_uc001lnc.1_Intron	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino) isoform 1	294					oxidation-reduction process|polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)										0.986842	179.202221	180.8722	75	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135043777	135043777	11840	10	G	C	C	39	39	PAOX	C	3	3
ITGA8	8516	broad.mit.edu	36	10	15800777	15800777	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:15800777T>A	uc001ioc.1	-	c.337A>T	c.(337-339)ACC>TCC	p.T113S		NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	113	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6														0.304348	9.898686	10.696189	7	16	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15800777	15800777	8186	10	T	A	A	59	59	ITGA8	A	4	4
PIP4K2A	5305	broad.mit.edu	36	10	23043245	23043245	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:23043245T>G	uc001irl.2	-	c.17A>C	c.(16-18)AAC>ACC	p.N6T		NM_005028	NP_005019	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	6							1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding			ovary(1)|skin(1)	2										213				0.3	7.221673	7.951359	6	14	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23043245	23043245	12360	10	T	G	G	60	60	PIP4K2A	G	4	4
PRF1	5551	broad.mit.edu	36	10	72028516	72028516	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:72028516C>A	uc009xqg.1	-	c.967G>T	c.(967-969)GAG>TAG	p.E323*	PRF1_uc001jrf.2_Nonsense_Mutation_p.E323*	NM_001083116	NP_005032	P14222	PERF_HUMAN	perforin 1 precursor	323	MACPF.				apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3														0.8	8.593799	9.005202	4	1	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	72028516	72028516	12921	10	C	A	A	31	31	PRF1	A	5	3
PRF1	5551	broad.mit.edu	36	10	72028519	72028519	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:72028519G>C	uc009xqg.1	-	c.964C>G	c.(964-966)CCC>GCC	p.P322A	PRF1_uc001jrf.2_Missense_Mutation_p.P322A	NM_001083116	NP_005032	P14222	PERF_HUMAN	perforin 1 precursor	322	MACPF.				apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3														0.75	7.123747	7.348106	3	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72028519	72028519	12921	10	G	C	C	42	42	PRF1	C	3	3
POLR3A	11128	broad.mit.edu	36	10	79439642	79439642	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:79439642G>A	uc001jzn.1	-	c.1756C>T	c.(1756-1758)CCT>TCT	p.P586S		NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	586					innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)											0.367925	203.577426	206.832959	78	134	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	79439642	79439642	12656	10	G	A	A	42	42	POLR3A	A	2	2
CYP26A1	1592	broad.mit.edu	36	10	94823701	94823701	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:94823701T>C	uc001kil.2	+	c.20T>C	c.(19-21)CTG>CCG	p.L7P	CYP26A1_uc001kik.1_Intron|CYP26A1_uc001kim.1_5'Flank	NM_000783	NP_000774	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A,	7					negative regulation of retinoic acid receptor signaling pathway|oxidation-reduction process|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|oxygen binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			ovary(1)|breast(1)	2		Colorectal(252;0.122)												0.75	6.427343	6.643862	3	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94823701	94823701	4320	10	T	C	C	55	55	CYP26A1	C	4	4
FJX1	24147	broad.mit.edu	36	11	35597667	35597667	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:35597667G>A	uc001mwh.1	+	c.907G>A	c.(907-909)GAC>AAC	p.D303N		NM_014344	NP_055159	Q86VR8	FJX1_HUMAN	four jointed box 1	303						extracellular space					0	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				Melanoma(161;10 2587 27165 47356)								0.976744	88.411146	90.231598	42	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35597667	35597667	6139	11	G	A	A	37	37	FJX1	A	1	1
LDLRAD3	143458	broad.mit.edu	36	11	36207353	36207353	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:36207353C>A	uc001mwk.1	+	c.868C>A	c.(868-870)CTG>ATG	p.L290M		NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain	290	Cytoplasmic (Potential).					integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)												0.2	6.498514	9.449412	7	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36207353	36207353	9031	11	C	A	A	24	24	LDLRAD3	A	3	3
OR5W2	390148	broad.mit.edu	36	11	55437931	55437931	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55437931A>G	uc001nib.1	-	c.704T>C	c.(703-705)TTC>TCC	p.F235S		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						Melanoma(48;171 1190 15239 43886 49348)								0.322034	48.00277	49.6635	19	40	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55437931	55437931	11595	11	A	G	G	9	9	OR5W2	G	4	4
PLCB3	5331	broad.mit.edu	36	11	63780518	63780518	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:63780518C>T	uc001nzb.2	+	c.793C>T	c.(793-795)CCG>TCG	p.P265S	PLCB3_uc009ypg.1_Missense_Mutation_p.P265S|PLCB3_uc009yph.1_Missense_Mutation_p.P198S|PLCB3_uc009ypi.1_Missense_Mutation_p.P265S	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C, beta 3	265					intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2														0.789474	87.323064	90.292269	30	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63780518	63780518	12455	11	C	T	T	22	22	PLCB3	T	2	2
SCYL1	57410	broad.mit.edu	36	11	65050070	65050071	+	Missense_Mutation	DNP	TG	CA	CA			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:65050070_65050071TG>CA	uc001oea.1	+	c.355_356TG>CA	c.(355-357)TGG>CAG	p.W119Q	SCYL1_uc009yqk.1_Missense_Mutation_p.W119Q|SCYL1_uc001oeb.1_Missense_Mutation_p.W119Q|SCYL1_uc001oec.1_Missense_Mutation_p.W119Q|SCYL1_uc001oed.1_5'UTR	NM_020680	NP_065731	Q96KG9	NTKL_HUMAN	SCY1-like 1 isoform A	119	Protein kinase.				protein phosphorylation|regulation of transcription, DNA-dependent|retrograde vesicle-mediated transport, Golgi to ER|transcription, DNA-dependent	cis-Golgi network|COPI vesicle coat|ER-Golgi intermediate compartment|microtubule organizing center|nucleus	ATP binding|DNA binding|protein tyrosine kinase activity			skin(1)	1										387				0.8	8.650345	8.915714	4	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	65050070	65050071	14432	11	TG	CA	CA	55	55	SCYL1	CA	4	4
SCYL1	57410	broad.mit.edu	36	11	65062115	65062115	+	Silent	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:65062115C>G	uc001oea.1	+	c.2133C>G	c.(2131-2133)TCC>TCG	p.S711S	SCYL1_uc009yqk.1_Silent_p.S711S|SCYL1_uc001oeb.1_Silent_p.S694S|SCYL1_uc001oec.1_Missense_Mutation_p.P699R|SCYL1_uc001oed.1_Silent_p.S568S|SCYL1_uc001oee.1_Silent_p.S355S	NM_020680	NP_065731	Q96KG9	NTKL_HUMAN	SCY1-like 1 isoform A	711					protein phosphorylation|regulation of transcription, DNA-dependent|retrograde vesicle-mediated transport, Golgi to ER|transcription, DNA-dependent	cis-Golgi network|COPI vesicle coat|ER-Golgi intermediate compartment|microtubule organizing center|nucleus	ATP binding|DNA binding|protein tyrosine kinase activity			skin(1)	1										387				0.254237	23.083897	26.335101	15	44	CC		KEEP	---	---	---	---	capture			Silent	SNP	65062115	65062115	14432	11	C	G	G	22	22	SCYL1	G	3	3
GRM5	2915	broad.mit.edu	36	11	88420239	88420239	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:88420239G>A	uc001pcq.1	-	c.450C>T	c.(448-450)GGC>GGT	p.G150G	GRM5_uc001pcp.1_Silent_p.G150G|GRM5_uc009yvm.1_Silent_p.G150G|GRM5_uc009yvn.1_Silent_p.G150G	NM_000842	NP_000833	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform b	150	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(1)	5		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)									0.202703	42.591324	54.867145	30	118	GG		KEEP	---	---	---	---	capture			Silent	SNP	88420239	88420239	7079	11	G	A	A	34	34	GRM5	A	2	2
ACACB	32	broad.mit.edu	36	12	108090164	108090164	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:108090164C>T	uc001tob.1	+	c.867C>T	c.(865-867)AAC>AAT	p.N289N	ACACB_uc001toc.1_Silent_p.N289N	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	289	Biotin carboxylation.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|pancreas(1)	6					Biotin(DB00121)				p.N289K(SKMES1-Tumor)	1843				0.470085	908.714545	909.257399	330	372	CC		KEEP	---	---	---	---	capture			Silent	SNP	108090164	108090164	108	12	C	T	T	19	19	ACACB	T	1	1
KIAA1467	57613	broad.mit.edu	36	12	13100123	13100123	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:13100123A>G	uc001rbi.1	+	c.409A>G	c.(409-411)AGC>GGC	p.S137G	KIAA1467_uc009zhx.1_Non-coding_Transcript	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	137						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)										0.368421	9.212524	9.540492	7	12	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13100123	13100123	8544	12	A	G	G	11	11	KIAA1467	G	4	4
CHFR	55743	broad.mit.edu	36	12	131943210	131943210	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:131943210G>A	uc001ulf.1	-	c.1182C>T	c.(1180-1182)GTC>GTT	p.V394V	CHFR_uc001ulc.1_Non-coding_Transcript|CHFR_uc001uld.1_Silent_p.V353V|CHFR_uc001ule.1_Silent_p.V382V	NM_018223	NP_060693	Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger	394					cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)										0.368421	11.501998	11.797426	7	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	131943210	131943210	3471	12	G	A	A	45	45	CHFR	A	2	2
TUBA1B	10376	broad.mit.edu	36	12	47808341	47808341	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:47808341G>A	uc001rtm.1	-	c.1023C>T	c.(1021-1023)ATC>ATT	p.I341I	TUBA1B_uc001rto.1_Silent_p.I306I|TUBA1B_uc001rtk.1_Silent_p.I306I|TUBA1B_uc001rtl.1_Silent_p.I306I|TUBA1B_uc001rtn.1_Silent_p.I188I	NM_006082	NP_006073	P68363	TBA1B_HUMAN	tubulin, alpha, ubiquitous	341					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0														0.263158	6.451442	7.428888	5	14	GG		KEEP	---	---	---	---	capture			Silent	SNP	47808341	47808341	17299	12	G	A	A	41	41	TUBA1B	A	2	2
KRT74	121391	broad.mit.edu	36	12	51252681	51252681	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51252681G>A	uc001sap.1	-	c.509C>T	c.(508-510)ACC>ATC	p.T170I		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	170	Coil 1A.|Rod.					keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.191)										0.357143	64.649469	65.909719	25	45	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51252681	51252681	8802	12	G	A	A	44	44	KRT74	A	2	2
SOAT2	8435	broad.mit.edu	36	12	51795540	51795540	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51795540G>A	uc001sbv.1	+	c.543G>A	c.(541-543)CCG>CCA	p.P181P	SOAT2_uc009zms.1_Non-coding_Transcript	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2	181					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|intestinal cholesterol absorption|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1														0.829268	98.138084	102.326572	34	7	GG		KEEP	---	---	---	---	capture			Silent	SNP	51795540	51795540	15411	12	G	A	A	40	40	SOAT2	A	1	1
CARS2	79587	broad.mit.edu	36	13	110138096	110138097	+	Missense_Mutation	DNP	GA	AT	AT			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:110138096_110138097GA>AT	uc001vrd.1	-	c.543_544TC>AT	c.(541-546)GCTCGT>GCATGT	p.R182C		NM_024537	NP_078813	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2	182				RGNAYSTAKGNVYFDLKSRGD -> SWERLFNGKRQCLLRS ESLEET (in Ref. 4; BAB93499).	cysteinyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|cysteine-tRNA ligase activity|metal ion binding				0	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)									0.263158	12.907277	14.859473	10	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	110138096	110138097	2777	13	GA	AT	AT	37	37	CARS2	AT	1	1
PCDH8	5100	broad.mit.edu	36	13	52318543	52318543	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:52318543A>G	uc001vhi.1	-	c.2030T>C	c.(2029-2031)CTC>CCC	p.L677P	PCDH8_uc001vhj.1_Missense_Mutation_p.L677P	NM_002590	NP_002581	O95206	PCDH8_HUMAN	protocadherin 8 isoform 1 precursor	677	Extracellular (Potential).|Cadherin 6.				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding			breast(1)	1		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GBM(36;25 841 9273 49207)								1	16.958766	16.943027	6	0	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52318543	52318543	11937	13	A	G	G	11	11	PCDH8	G	4	4
PCDH8	5100	broad.mit.edu	36	13	52318546	52318546	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:52318546T>C	uc001vhi.1	-	c.2027A>G	c.(2026-2028)GAC>GGC	p.D676G	PCDH8_uc001vhj.1_Missense_Mutation_p.D676G	NM_002590	NP_002581	O95206	PCDH8_HUMAN	protocadherin 8 isoform 1 precursor	676	Extracellular (Potential).|Cadherin 6.				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding			breast(1)	1		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GBM(36;25 841 9273 49207)								1	12.880124	12.848467	5	0	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52318546	52318546	11937	13	T	C	C	58	58	PCDH8	C	4	4
DLK1	8788	broad.mit.edu	36	14	100270972	100270972	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:100270972G>A	uc001yhs.2	+	c.1138G>A	c.(1138-1140)GAC>AAC	p.D380N	DLK1_uc001yhu.2_Missense_Mutation_p.D307N	NM_003836	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog	380	Cytoplasmic (Potential).				multicellular organismal development	extracellular space|integral to membrane|soluble fraction				ovary(2)	2		Melanoma(154;0.155)												0.537037	180.443456	180.572332	58	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100270972	100270972	4744	14	G	A	A	37	37	DLK1	A	1	1
DYNC1H1	1778	broad.mit.edu	36	14	101541156	101541156	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:101541156C>T	uc001yks.1	+	c.5263C>T	c.(5263-5265)CAG>TAG	p.Q1755*		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1755	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10														0.178571	32.186236	40.346077	15	69	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	101541156	101541156	5027	14	C	T	T	21	21	DYNC1H1	T	5	2
TECPR2	9895	broad.mit.edu	36	14	101988584	101988584	+	Silent	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:101988584C>G	uc001ylw.1	+	c.3507C>G	c.(3505-3507)GCC>GCG	p.A1169A	TECPR2_uc010awl.1_Silent_p.A1169A	NM_014844	NP_055659	O15040	TCPR2_HUMAN	hypothetical protein LOC9895	1169							protein binding			lung(1)|central_nervous_system(1)	2														0.266667	6.500789	7.235309	4	11	CC		KEEP	---	---	---	---	capture			Silent	SNP	101988584	101988584	16271	14	C	G	G	23	23	TECPR2	G	3	3
XRCC3	7517	broad.mit.edu	36	14	103235021	103235022	+	Missense_Mutation	DNP	TC	CA	CA			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:103235021_103235022TC>CA	uc001yny.2	-	c.907_908GA>TG	c.(907-909)GAG>TGG	p.E303W	KLC1_uc001yno.1_Intron|KLC1_uc001yns.1_Intron|KLC1_uc001ynt.1_Intron|XRCC3_uc001ynx.2_Missense_Mutation_p.E303W|XRCC3_uc001ynz.2_Missense_Mutation_p.E303W|XRCC3_uc001yoa.2_Missense_Mutation_p.E303W	NM_005432	NP_005423	O43542	XRCC3_HUMAN	X-ray repair cross complementing protein 3	303					DNA recombination|DNA repair	mitochondrion|nucleus|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)										0.666667	8.891725	9.036959	4	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	103235021	103235022	18037	14	TC	CA	CA	54	54	XRCC3	CA	4	4
HECTD1	25831	broad.mit.edu	36	14	30668133	30668133	+	Silent	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:30668133A>G	uc001wrc.1	-	c.4195T>C	c.(4195-4197)TTG>CTG	p.L1399L	HECTD1_uc001wrd.1_Silent_p.L867L|HECTD1_uc001wrb.1_5'UTR	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	1399	Ser-rich.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)										0.285714	8.126374	9.003625	6	15	AA		KEEP	---	---	---	---	capture			Silent	SNP	30668133	30668133	7322	14	A	G	G	3	3	HECTD1	G	4	4
FAM179B	23116	broad.mit.edu	36	14	44501597	44501597	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:44501597T>G	uc001wvw.1	+	c.223T>G	c.(223-225)TCG>GCG	p.S75A	FAM179B_uc001wvv.1_Missense_Mutation_p.S75A|FAM179B_uc010anc.1_Non-coding_Transcript|KLHL28_uc001wvq.1_5'Flank|KLHL28_uc001wvr.1_5'Flank|FAM179B_uc010anb.1_Missense_Mutation_p.S75A|FAM179B_uc001wvu.2_Missense_Mutation_p.S75A	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116	75							binding				0														0.357143	7.855646	8.113461	5	9	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44501597	44501597	5712	14	T	G	G	54	54	FAM179B	G	4	4
C14orf169	79697	broad.mit.edu	36	14	73027490	73027491	+	Missense_Mutation	DNP	GG	AC	AC			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:73027490_73027491GG>AC	uc001xok.1	+	c.15_16GG>AC	c.(13-18)CAGGCC>CAACCC	p.A6P	HEATR4_uc010art.1_Intron	NM_024644	NP_078920	Q9H6W3	NO66_HUMAN	chromosome 14 open reading frame 169	6					negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|oxidation-reduction process|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K4 specific)|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.215)										0.888889	15.346767	16.597074	8	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	73027490	73027491	1806	14	GG	AC	AC	35	35	C14orf169	AC	2	2
ALDH6A1	4329	broad.mit.edu	36	14	73601741	73601741	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:73601741C>T	uc001xpo.1	-	c.1300G>A	c.(1300-1302)GCC>ACC	p.A434T	C14orf45_uc001xpl.2_3'UTR|C14orf45_uc001xpm.1_Intron|ALDH6A1_uc010asa.1_Missense_Mutation_p.A279T	NM_005589	NP_005580	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6A1 precursor	434					oxidation-reduction process	mitochondrial matrix|nucleus	fatty-acyl-CoA binding|malonate-semialdehyde dehydrogenase (acetylating) activity|methylmalonate-semialdehyde dehydrogenase (acylating) activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00354)	NADH(DB00157)									0.169851	131.06116	179.663266	80	391	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73601741	73601741	506	14	C	T	T	28	28	ALDH6A1	T	2	2
ZDHHC22	283576	broad.mit.edu	36	14	76669986	76669986	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:76669986G>A	uc010asp.1	-	c.585C>T	c.(583-585)ATC>ATT	p.I195I		NM_174976	NP_777636	Q8N966	ZDH22_HUMAN	zinc finger, DHHC domain containing 22	195						integral to membrane	acyltransferase activity|zinc ion binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)										0.497717	296.942498	296.943374	109	110	GG		KEEP	---	---	---	---	capture			Silent	SNP	76669986	76669986	18201	14	G	A	A	37	37	ZDHHC22	A	1	1
CHRNA7	1139	broad.mit.edu	36	15	30191329	30191329	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:30191329G>A	uc001zft.1	+	c.287G>A	c.(286-288)GGG>GAG	p.G96E	CHRNA7_uc010bab.1_Missense_Mutation_p.G96E|CHRNA7_uc010bac.1_Missense_Mutation_p.G96E|CHRNA7_uc010bad.1_Non-coding_Transcript|CHRNA7_uc010bae.1_Intron|CHRNA7_uc010baf.1_Intron|CHRNA7_uc010bag.1_Non-coding_Transcript|CHRNA7_uc010bah.1_Non-coding_Transcript|CHRNA7_uc010bai.1_Non-coding_Transcript|CHRNA7_uc010baj.1_5'Flank|CHRNA7_uc010bak.1_5'Flank	NM_000746	NP_683709	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7	96	Extracellular (Potential).				activation of MAPK activity|calcium ion transport|cellular calcium ion homeostasis|memory|negative regulation of tumor necrosis factor production|positive regulation of angiogenesis|positive regulation of cell proliferation|response to hypoxia|response to nicotine	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|beta-amyloid binding|chloride channel regulator activity|nicotinic acetylcholine-activated cation-selective channel activity|protein homodimerization activity|toxin binding			ovary(1)	1		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Nicotine(DB00184)|Varenicline(DB01273)	Esophageal Squamous(193;529 2900 40232 43193)								0.209877	119.60386	138.528194	51	192	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30191329	30191329	3522	15	G	A	A	43	43	CHRNA7	A	2	2
SPTBN5	51332	broad.mit.edu	36	15	39956332	39956332	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39956332T>G	uc001zos.1	-	c.3713A>C	c.(3712-3714)AAG>ACG	p.K1238T		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1273	Spectrin 9.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)										0.444444	6.486828	6.512067	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39956332	39956332	15636	15	T	G	G	56	56	SPTBN5	G	4	4
CDAN1	146059	broad.mit.edu	36	15	40814856	40814856	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:40814856C>G	uc001zql.1	-	c.952G>C	c.(952-954)GTA>CTA	p.V318L	CDAN1_uc001zqk.1_5'Flank|CDAN1_uc010bcx.1_Non-coding_Transcript	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	318	Helical; (Potential).					integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)										0.444444	7.791372	7.816483	4	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40814856	40814856	3182	15	C	G	G	18	18	CDAN1	G	3	3
THSD4	79875	broad.mit.edu	36	15	69817374	69817374	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:69817374C>T	uc002atb.1	+	c.1880C>T	c.(1879-1881)ACA>ATA	p.T627I	THSD4_uc002ate.1_Missense_Mutation_p.T267I	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	627						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2														0.196078	36.444724	45.232163	20	82	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69817374	69817374	16406	15	C	T	T	17	17	THSD4	T	2	2
MAN2A2	4122	broad.mit.edu	36	15	89257898	89257898	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:89257898C>T	uc010bnz.1	+	c.2769C>T	c.(2767-2769)TAC>TAT	p.Y923Y	MAN2A2_uc002bqa.1_Non-coding_Transcript|MAN2A2_uc002bqb.1_Non-coding_Transcript|MAN2A2_uc002bqc.1_Silent_p.Y923Y	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	912					mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)											0.363636	6.785738	6.969914	4	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	89257898	89257898	9598	15	C	T	T	18	18	MAN2A2	T	2	2
LRRK1	79705	broad.mit.edu	36	15	99423100	99423100	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:99423100G>A	uc002bwr.1	+	c.4935G>A	c.(4933-4935)GCG>GCA	p.A1645A	LRRK1_uc002bws.1_Non-coding_Transcript	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1645					protein phosphorylation|small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)							1100				0.120805	109.100672	214.001405	90	655	GG		KEEP	---	---	---	---	capture			Silent	SNP	99423100	99423100	9408	15	G	A	A	39	39	LRRK1	A	1	1
UMOD	7369	broad.mit.edu	36	16	20260014	20260014	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:20260014C>T	uc002dhb.1	-	c.1576G>A	c.(1576-1578)GGG>AGG	p.G526R	UMOD_uc002dgz.1_Missense_Mutation_p.G493R|UMOD_uc002dha.1_Missense_Mutation_p.G493R	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	493	ZP.				cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)	1														0.258065	38.974404	42.2622	16	46	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20260014	20260014	17537	16	C	T	T	21	21	UMOD	T	2	2
MEFV	4210	broad.mit.edu	36	16	3246482	3246482	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3246482T>A	uc002cun.1	-	c.107A>T	c.(106-108)GAG>GTG	p.E36V		NM_000243	NP_000234	O15553	MEFV_HUMAN	Mediterranean fever protein	36	DAPIN.				inflammatory response	cytoplasm|microtubule|microtubule associated complex|nucleus	actin binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5					Colchicine(DB01394)									0.192308	7.696216	12.344101	10	42	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3246482	3246482	9848	16	T	A	A	54	54	MEFV	A	4	4
PHKB	5257	broad.mit.edu	36	16	46252166	46252166	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:46252166C>A	uc002eev.2	+	c.2131C>A	c.(2131-2133)CAG>AAG	p.Q711K	PHKB_uc002eeu.2_Missense_Mutation_p.Q704K	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	711					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)												0.099282	38.382432	172.636336	83	753	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46252166	46252166	12269	16	C	A	A	25	25	PHKB	A	3	3
PPL	5493	broad.mit.edu	36	16	4880300	4880300	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4880300C>G	uc002cyd.1	-	c.2199G>C	c.(2197-2199)GAG>GAC	p.E733D		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	733	Spectrin 4.|Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)	4														0.571429	7.284643	7.313722	4	3	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4880300	4880300	12769	16	C	G	G	28	28	PPL	G	3	3
CYLD	1540	broad.mit.edu	36	16	49382991	49382991	+	Silent	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:49382991A>G	uc002egp.1	+	c.2130A>G	c.(2128-2130)CAA>CAG	p.Q710Q	CYLD_uc010cbs.1_Silent_p.Q707Q|CYLD_uc002egq.1_Silent_p.Q707Q|CYLD_uc002egr.1_Silent_p.Q707Q	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	710					cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)								247				0.244444	23.505946	26.184864	11	34	AA		KEEP	---	---	---	---	capture			Silent	SNP	49382991	49382991	4308	16	A	G	G	3	3	CYLD	G	4	4
SLC12A4	6560	broad.mit.edu	36	16	66537648	66537648	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66537648T>C	uc002euz.1	-	c.2534A>G	c.(2533-2535)CAC>CGC	p.H845R	LCAT_uc002euy.1_5'Flank|SLC12A4_uc010ceu.1_5'Flank|SLC12A4_uc002eva.1_Missense_Mutation_p.H845R|SLC12A4_uc010cev.1_Non-coding_Transcript	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride	845	Helical; (Potential).				cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)									0.222222	7.123102	9.056891	6	21	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66537648	66537648	14880	16	T	C	C	59	59	SLC12A4	C	4	4
HYDIN	54768	broad.mit.edu	36	16	69544037	69544037	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69544037G>A	uc002ezr.1	-	c.6316C>T	c.(6316-6318)CAG>TAG	p.Q2106*	HYDIN_uc002ezt.1_Intron|HYDIN_uc002ezu.1_Intron	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2107										ovary(1)	1		Ovarian(137;0.0654)												0.205607	43.899406	52.500985	22	85	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	69544037	69544037	7767	16	G	A	A	47	47	HYDIN	A	5	2
PHLPP2	23035	broad.mit.edu	36	16	70282083	70282083	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:70282083C>A	uc002fax.1	-	c.449G>T	c.(448-450)CGA>CTA	p.R150L	PHLPP2_uc010cgf.1_Missense_Mutation_p.R150L|PHLPP2_uc002fay.1_Missense_Mutation_p.R150L	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	150	PH.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			central_nervous_system(1)	1														0.090573	7.95347	99.361436	49	492	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70282083	70282083	12279	16	C	A	A	31	31	PHLPP2	A	3	3
KARS	3735	broad.mit.edu	36	16	74233079	74233079	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:74233079T>C	uc002fer.1	-	c.190A>G	c.(190-192)AAG>GAG	p.K64E	KARS_uc002feq.1_Missense_Mutation_p.K36E|KARS_uc002fes.1_5'UTR|KARS_uc010cgz.1_5'Flank|KARS_uc010cha.1_Missense_Mutation_p.K73E	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2	36				Missing: Loss of nuclear localization, but no effect on packaging into HIV-1.	interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)									0.140518	129.455094	220.943952	103	630	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74233079	74233079	8284	16	T	C	C	62	62	KARS	C	4	4
NECAB2	54550	broad.mit.edu	36	16	82572219	82572219	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:82572219G>C	uc002fhd.1	+	c.445G>C	c.(445-447)GGT>CGT	p.G149R	NECAB2_uc002fhe.1_Missense_Mutation_p.G66R	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2	149					antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2														0.272727	8.431617	9.46484	6	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	82572219	82572219	10704	16	G	C	C	43	43	NECAB2	C	3	3
RAI1	10743	broad.mit.edu	36	17	17638494	17638494	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:17638494A>T	uc002grm.1	+	c.1507A>T	c.(1507-1509)AGC>TGC	p.S503C	RAI1_uc002grn.1_Missense_Mutation_p.S503C	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	503						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(1115;0.0276)										0.8	7.588587	7.99599	4	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17638494	17638494	13467	17	A	T	T	7	7	RAI1	T	4	4
SUPT6H	6830	broad.mit.edu	36	17	24024620	24024620	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:24024620G>A	uc002hby.1	+	c.74G>A	c.(73-75)CGA>CAA	p.R25Q	SUPT6H_uc010crt.1_Missense_Mutation_p.R25Q	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	25	Asp/Glu-rich.				chromatin remodeling|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity|transcription elongation regulator activity			ovary(2)	2	Lung NSC(42;0.00431)													0.835821	190.534008	197.726676	56	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24024620	24024620	15920	17	G	A	A	37	37	SUPT6H	A	1	1
CDC6	990	broad.mit.edu	36	17	35703344	35703344	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:35703344G>A	uc002huj.1	+	c.771G>A	c.(769-771)AGG>AGA	p.R257R		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	257					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3														0.132075	9.29222	16.262184	7	46	GG		KEEP	---	---	---	---	capture			Silent	SNP	35703344	35703344	3212	17	G	A	A	42	42	CDC6	A	2	2
PLEKHH3	79990	broad.mit.edu	36	17	38073740	38073740	+	Silent	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:38073740A>G	uc002iau.2	-	c.2313T>C	c.(2311-2313)CCT>CCC	p.P771P	PLEKHH3_uc010cyl.1_Non-coding_Transcript|PLEKHH3_uc002iat.1_Non-coding_Transcript|PLEKHH3_uc002iav.2_Non-coding_Transcript|PLEKHH3_uc010cym.1_Silent_p.P132P|PLEKHH3_uc002iaw.2_3'UTR	NM_024927	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H	771					signal transduction	cytoskeleton				large_intestine(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)										0.242424	7.683124	9.906157	8	25	AA		KEEP	---	---	---	---	capture			Silent	SNP	38073740	38073740	12504	17	A	G	G	11	11	PLEKHH3	G	4	4
UBTF	7343	broad.mit.edu	36	17	39645747	39645747	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:39645747T>G	uc002igb.1	-	c.626A>C	c.(625-627)CAC>CCC	p.H209P	UBTF_uc002igc.1_Missense_Mutation_p.H209P|UBTF_uc010czs.1_Missense_Mutation_p.H209P|UBTF_uc002igd.1_Missense_Mutation_p.H209P|UBTF_uc010czt.1_Missense_Mutation_p.H209P|UBTF_uc002ige.2_Missense_Mutation_p.H209P	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	209	HMG box 2.				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding|RNA polymerase I transcription factor activity				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)										0.208333	7.26184	9.155664	5	19	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39645747	39645747	17467	17	T	G	G	59	59	UBTF	G	4	4
BPTF	2186	broad.mit.edu	36	17	63320038	63320038	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:63320038T>A	uc002jgf.1	+	c.2146T>A	c.(2146-2148)TTG>ATG	p.L716M	BPTF_uc002jge.1_Missense_Mutation_p.L842M	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	842	Interaction with MAZ.				brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene-specific transcription|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|transcription regulator activity|zinc ion binding			ovary(2)	2	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)											0.153846	7.401687	19.422538	16	88	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63320038	63320038	1523	17	T	A	A	52	52	BPTF	A	4	4
RPTOR	57521	broad.mit.edu	36	17	76473411	76473411	+	Nonsense_Mutation	SNP	C	A	A	rs34554642	by-frequency	TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:76473411C>A	uc002jyt.1	+	c.1851C>A	c.(1849-1851)TGC>TGA	p.C617*		NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor	617					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)	5										1368				0.6	16.746	16.872382	9	6	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	76473411	76473411	14145	17	C	A	A	27	27	RPTOR	A	5	3
KDM6B	23135	broad.mit.edu	36	17	7692560	7692560	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7692560C>T	uc002giw.1	+	c.2229C>T	c.(2227-2229)ACC>ACT	p.T743T	KDM6B_uc002gix.2_Silent_p.T45T	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	jumonji domain containing 3, histone lysine	743	Pro-rich.|Thr-rich.				inflammatory response|oxidation-reduction process	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			pancreas(1)	1														0.666667	7.48564	7.629115	4	2	CC		KEEP	---	---	---	---	capture			Silent	SNP	7692560	7692560	8444	17	C	T	T	21	21	KDM6B	T	2	2
FASN	2194	broad.mit.edu	36	17	77634773	77634773	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:77634773T>A	uc002kdu.1	-	c.5250A>T	c.(5248-5250)GAA>GAT	p.E1750D	FASN_uc002kdv.1_5'Flank	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	1750	Enoyl reductase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	Colon(59;314 1043 11189 28578 32273)				1201				0.8	9.046838	9.41246	4	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	77634773	77634773	5919	17	T	A	A	56	56	FASN	A	4	4
FASN	2194	broad.mit.edu	36	17	77634777	77634777	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:77634777G>C	uc002kdu.1	-	c.5246C>G	c.(5245-5247)GCG>GGG	p.A1749G	FASN_uc002kdv.1_5'Flank	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	1749	Enoyl reductase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	Colon(59;314 1043 11189 28578 32273)				1201				0.8	8.517557	8.906447	4	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	77634777	77634777	5919	17	G	C	C	38	38	FASN	C	3	3
HEXDC	284004	broad.mit.edu	36	17	77975627	77975627	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:77975627C>T	uc002kev.2	+	c.153C>T	c.(151-153)TAC>TAT	p.Y51Y	HEXDC_uc010diq.1_Silent_p.Y51Y|HEXDC_uc002kew.1_Silent_p.Y51Y	NM_173620	NP_775891	Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20,	51					carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)											0.2	7.51993	8.772731	3	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	77975627	77975627	7358	17	C	T	T	19	19	HEXDC	T	1	1
TNFRSF11A	8792	broad.mit.edu	36	18	58187177	58187177	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:58187177C>A	uc002lin.1	+	c.1047C>A	c.(1045-1047)TAC>TAA	p.Y349*	TNFRSF11A_uc010dpv.1_Intron	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	349	Cytoplasmic (Potential).				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity				0		Colorectal(73;0.188)												0.25	6.55191	7.701807	5	15	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	58187177	58187177	16825	18	C	A	A	17	17	TNFRSF11A	A	5	3
ICAM4	3386	broad.mit.edu	36	19	10259835	10259836	+	Missense_Mutation	DNP	GG	AT	AT			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:10259835_10259836GG>AT	uc002mnr.1	+	c.794_795GG>AT	c.(793-795)GGG>GAT	p.G265D	ICAM4_uc002mns.1_3'UTR|ICAM4_uc002mnt.1_3'UTR|ICAM5_uc002mnu.2_5'Flank	NM_001039132	NP_001034221	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 isoform 3	Error:Variant_position_missing_in_Q14773_after_alignment					cell-cell adhesion|regulation of immune response	extracellular region|integral to membrane|plasma membrane	integrin binding			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)											0.25	9.6621	11.503875	8	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	10259835	10259836	7782	19	GG	AT	AT	43	43	ICAM4	AT	2	2
PLVAP	83483	broad.mit.edu	36	19	17348762	17348762	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17348762G>A	uc002ngk.1	-	c.336C>T	c.(334-336)ATC>ATT	p.I112I		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	112	Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0														0.437063	336.33581	337.334029	125	161	GG		KEEP	---	---	---	---	capture			Silent	SNP	17348762	17348762	12542	19	G	A	A	45	45	PLVAP	A	2	2
ZNF254	9534	broad.mit.edu	36	19	24102354	24102354	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:24102354A>T	uc002nru.1	+	c.1712A>T	c.(1711-1713)GAG>GTG	p.E571V		NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	571					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)												0.178218	29.890276	39.749599	18	83	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24102354	24102354	18389	19	A	T	T	11	11	ZNF254	T	4	4
THEG	51298	broad.mit.edu	36	19	313410	313410	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:313410C>T	uc002lol.1	-	c.930G>A	c.(928-930)TCG>TCA	p.S310S	THEG_uc002lom.1_Silent_p.S286S	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	310					cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.19403	30.048511	35.894345	13	54	CC		KEEP	---	---	---	---	capture			Silent	SNP	313410	313410	16385	19	C	T	T	23	23	THEG	T	1	1
AXL	558	broad.mit.edu	36	19	46435802	46435802	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:46435802C>T	uc010ehj.1	+	c.897C>T	c.(895-897)CTC>CTT	p.L299L	AXL_uc010ehi.1_Silent_p.L299L|AXL_uc010ehk.1_Silent_p.L299L	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1	299	Extracellular (Potential).|Fibronectin type-III 1.				protein phosphorylation	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)|stomach(1)|central_nervous_system(1)	8										318				0.296578	359.996381	379.474781	156	370	CC		KEEP	---	---	---	---	capture			Silent	SNP	46435802	46435802	1259	19	C	T	T	30	30	AXL	T	2	2
PPP1R12C	54776	broad.mit.edu	36	19	60295043	60295046	+	Missense_Mutation	ONP	CTCT	AGGC	AGGC			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:60295043_60295046CTCT>AGGC	uc002qix.1	-	c.2204_2207AGAG>GCCT	c.(2203-2208)GAGAGA>GGCCTA	p.735_736ER>GL	PPP1R12C_uc002qiy.1_Missense_Mutation_p.733_734ER>GL	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	735_736	Potential.					cytoplasm				central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)										0.833333	9.949981	10.389116	5	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	ONP	60295043	60295046	12791	19	CTCT	AGGC	AGGC	32	32	PPP1R12C	AGGC	3	3
ZNF497	162968	broad.mit.edu	36	19	63559459	63559459	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:63559459A>G	uc002qsh.1	-	c.1355T>C	c.(1354-1356)GTG>GCG	p.V452A	A1BG_uc002qsd.2_5'Flank|A1BG_uc002qsf.1_Intron|ZNF497_uc002qsi.1_Missense_Mutation_p.V452A|ZNF497_uc010eup.1_Missense_Mutation_p.V452A	NM_198458	NP_940860	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	452	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(2)	2		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)						25				0.8	8.228975	8.415488	4	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63559459	63559459	18540	19	A	G	G	6	6	ZNF497	G	4	4
ZNF324B	388569	broad.mit.edu	36	19	63658623	63658623	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:63658623G>T	uc002qsv.1	+	c.500G>T	c.(499-501)AGG>ATG	p.R167M	ZNF324B_uc002qsu.1_Missense_Mutation_p.R157M|ZNF324B_uc010euq.1_Missense_Mutation_p.R167M	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	167					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)										0.428571	6.420483	6.452074	3	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	63658623	63658623	18437	19	G	T	T	35	35	ZNF324B	T	3	3
MUC16	94025	broad.mit.edu	36	19	8950762	8950762	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8950762G>A	uc002mkp.1	-	c.2053C>T	c.(2053-2055)CTA>TTA	p.L685L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	685	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.460385	583.435472	584.071799	215	252	GG		KEEP	---	---	---	---	capture			Silent	SNP	8950762	8950762	10367	19	G	A	A	33	33	MUC16	A	2	2
PTCHD2	57540	broad.mit.edu	36	1	11519133	11519133	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:11519133G>C	uc001ash.2	+	c.3982G>C	c.(3982-3984)GTG>CTG	p.V1328L		NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1328	Helical; (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)										0.5	12.043516	12.043516	6	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11519133	11519133	13187	1	G	C	C	40	40	PTCHD2	C	3	3
AADACL4	343066	broad.mit.edu	36	1	12649059	12649059	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12649059A>G	uc001auf.1	+	c.950A>G	c.(949-951)CAT>CGT	p.H317R		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	317	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)										0.20598	141.286793	165.420566	62	239	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12649059	12649059	14	1	A	G	G	8	8	AADACL4	G	4	4
TNFAIP8L2	79626	broad.mit.edu	36	1	149397943	149397943	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:149397943A>T	uc001ewx.2	+	c.146A>T	c.(145-147)TAC>TTC	p.Y49F	TNFAIP8L2_uc009wmm.1_Missense_Mutation_p.Y49F	NM_024575	NP_078851	Q6P589	TP8L2_HUMAN	tumor necrosis factor, alpha-induced protein	49					innate immune response						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)											0.28	8.998114	10.100607	7	18	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	149397943	149397943	16819	1	A	T	T	14	14	TNFAIP8L2	T	4	4
KLHL20	27252	broad.mit.edu	36	1	171989031	171989031	+	Silent	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:171989031A>T	uc001gjc.1	+	c.813A>T	c.(811-813)GTA>GTT	p.V271V	KLHL20_uc009wwf.1_Silent_p.V253V	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20	271	BACK.				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						GBM(159;862 2695 6559 23041)								0.227273	6.351643	7.867423	5	17	AA		KEEP	---	---	---	---	capture			Silent	SNP	171989031	171989031	8687	1	A	T	T	15	15	KLHL20	T	4	4
NPHS2	7827	broad.mit.edu	36	1	177800454	177800454	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:177800454G>A	uc001gmq.2	-	c.372C>T	c.(370-372)TGC>TGT	p.C124C	NPHS2_uc009wxi.1_Silent_p.C124C	NM_014625	NP_055440	Q9NP85	PODO_HUMAN	podocin	124	Cytoplasmic (Potential).				excretion	integral to plasma membrane	protein binding				0														0.642857	29.477111	29.728509	9	5	GG		KEEP	---	---	---	---	capture			Silent	SNP	177800454	177800454	10987	1	G	A	A	38	38	NPHS2	A	1	1
TNNT2	7139	broad.mit.edu	36	1	199605574	199605574	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:199605574G>A	uc001gwf.1	-	c.90C>T	c.(88-90)GAC>GAT	p.D30D	TNNT2_uc009wzq.1_Intron|TNNT2_uc001gwg.1_Intron|TNNT2_uc001gwh.1_Intron|TNNT2_uc001gwi.1_Silent_p.D30D|TNNT2_uc009wzr.1_Intron|TNNT2_uc009wzs.1_5'Flank|TNNT2_uc001gwk.1_Intron|TNNT2_uc009wzt.1_Intron|TNNT2_uc001gwl.1_Non-coding_Transcript	NM_000364	NP_000355	P45379	TNNT2_HUMAN	troponin T type 2, cardiac isoform 1	30					ATP catabolic process|muscle filament sliding|negative regulation of ATPase activity|positive regulation of ATPase activity|regulation of heart contraction|response to calcium ion|response to calcium ion|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|tropomyosin binding|troponin C binding|troponin I binding				0														0.833333	18.384399	19.011162	5	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	199605574	199605574	16872	1	G	A	A	40	40	TNNT2	A	1	1
DISP1	84976	broad.mit.edu	36	1	221242371	221242371	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:221242371G>A	uc001hnu.1	+	c.1009G>A	c.(1009-1011)GGT>AGT	p.G337S		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	337					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)								OREG0014268|OREG0026708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.333333	6.484619	6.785532	4	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	221242371	221242371	4718	1	G	A	A	47	47	DISP1	A	2	2
SIPA1L2	57568	broad.mit.edu	36	1	230641570	230641570	+	Nonsense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:230641570A>T	uc001hvg.1	-	c.3938T>A	c.(3937-3939)TTA>TAA	p.L1313*	SIPA1L2_uc001hvf.1_Nonsense_Mutation_p.L387*	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1313					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)												0.4	7.289958	7.379352	4	6	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	230641570	230641570	14825	1	A	T	T	13	13	SIPA1L2	T	5	4
ARID1A	8289	broad.mit.edu	36	1	26928884	26928884	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:26928884G>A	uc001bmv.1	+	c.1293G>A	c.(1291-1293)CCG>CCA	p.P431P	ARID1A_uc001bmt.1_Silent_p.P431P|ARID1A_uc001bmu.1_Silent_p.P431P|ARID1A_uc001bmw.1_Silent_p.P48P	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	431					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding|transcription activator activity			ovary(124)|endometrium(3)|kidney(3)|central_nervous_system(2)|pancreas(2)|lung(1)|skin(1)	136		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)						478				0.266667	9.493213	10.231926	4	11	GG		KEEP	---	---	---	---	capture			Silent	SNP	26928884	26928884	928	1	G	A	A	37	37	ARID1A	A	1	1
PLEKHG5	57449	broad.mit.edu	36	1	6452281	6452281	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:6452281T>C	uc001anp.1	-	c.2074A>G	c.(2074-2076)ACC>GCC	p.T692A	PLEKHG5_uc001anj.1_Missense_Mutation_p.T176A|PLEKHG5_uc009vma.1_Missense_Mutation_p.T455A|PLEKHG5_uc001ank.1_Missense_Mutation_p.T615A|PLEKHG5_uc009vmb.1_Missense_Mutation_p.T615A|PLEKHG5_uc001anl.1_Missense_Mutation_p.T615A|PLEKHG5_uc001anm.1_Missense_Mutation_p.T615A|PLEKHG5_uc001ann.1_Missense_Mutation_p.T652A|PLEKHG5_uc001ano.1_Missense_Mutation_p.T671A|PLEKHG5_uc001anq.1_Missense_Mutation_p.T692A|PLEKHG5_uc001anr.1_5'Flank	NM_198681	NP_065682	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G	671	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)										0.6	6.418579	6.461169	3	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6452281	6452281	12499	1	T	C	C	58	58	PLEKHG5	C	4	4
DNAJC6	9829	broad.mit.edu	36	1	65630992	65630992	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:65630992G>A	uc001dce.1	+	c.1759G>A	c.(1759-1761)GGT>AGT	p.G587S	DNAJC6_uc001dcc.1_Missense_Mutation_p.G561S|DNAJC6_uc001dcd.1_Missense_Mutation_p.G530S	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	530	Poly-Gly.|Pro-rich.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3														0.275	14.073375	15.926159	11	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65630992	65630992	4836	1	G	A	A	43	43	DNAJC6	A	2	2
PYGB	5834	broad.mit.edu	36	20	25221234	25221234	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:25221234C>G	uc002wup.1	+	c.2162C>G	c.(2161-2163)GCC>GGC	p.A721G		NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	721					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)	1					Pyridoxal Phosphate(DB00114)									0.875	15.478007	16.505836	7	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	25221234	25221234	13318	20	C	G	G	26	26	PYGB	G	3	3
PYGB	5834	broad.mit.edu	36	20	25221237	25221237	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:25221237T>G	uc002wup.1	+	c.2165T>G	c.(2164-2166)TTG>TGG	p.L722W		NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	722					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)	1					Pyridoxal Phosphate(DB00114)									0.833333	10.08451	10.588207	5	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	25221237	25221237	13318	20	T	G	G	63	63	PYGB	G	4	4
BPIL1	80341	broad.mit.edu	36	20	31071191	31071191	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:31071191T>G	uc002wyj.1	+	c.1054T>G	c.(1054-1056)TTC>GTC	p.F352V		NM_025227	NP_079503	Q8N4F0	BPIL1_HUMAN	bactericidal/permeability-increasing	352						extracellular region	lipid binding			large_intestine(1)|ovary(1)	2														0.25	18.016357	19.604647	7	21	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31071191	31071191	1519	20	T	G	G	64	64	BPIL1	G	4	4
DYNLRB1	83658	broad.mit.edu	36	20	32586150	32586150	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:32586150T>A	uc002xal.1	+	c.137T>A	c.(136-138)ATG>AAG	p.M46K	DYNLRB1_uc002xam.1_Non-coding_Transcript|DYNLRB1_uc002xan.1_Non-coding_Transcript	NM_014183	NP_054902	Q9NP97	DLRB1_HUMAN	Roadblock-1	46					microtubule-based movement|transport|visual behavior	cytoplasmic dynein complex|microtubule	microtubule motor activity				0														0.232143	16.412315	20.133393	13	43	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32586150	32586150	5036	20	T	A	A	51	51	DYNLRB1	A	4	4
CEP250	11190	broad.mit.edu	36	20	33542021	33542021	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:33542021C>T	uc002xcm.1	+	c.2731C>T	c.(2731-2733)CAG>TAG	p.Q911*	CEP250_uc002xcn.1_Intron	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2 isoform 1	911	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)											0.188889	34.115869	42.278938	17	73	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	33542021	33542021	3385	20	C	T	T	21	21	CEP250	T	5	2
FAM83D	81610	broad.mit.edu	36	20	37013871	37013871	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:37013871C>T	uc002xjg.1	+	c.1142C>T	c.(1141-1143)CCC>CTC	p.P381L		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	351					cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)												1	51.76898	51.76898	22	0	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37013871	37013871	5862	20	C	T	T	22	22	FAM83D	T	2	2
FAM83D	81610	broad.mit.edu	36	20	37013873	37013875	+	Missense_Mutation	TNP	GCA	ATC	ATC			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:37013873_37013875GCA>ATC	uc002xjg.1	+	c.1144_1146GCA>ATC	c.(1144-1146)GCA>ATC	p.A382I		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	352					cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)												1	37.23587	37.235853	16	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	37013873	37013875	5862	20	GCA	ATC	ATC	38	38	FAM83D	ATC	1	1
SLC2A10	81031	broad.mit.edu	36	20	44788266	44788266	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:44788266T>G	uc002xsl.1	+	c.1184T>G	c.(1183-1185)CTC>CGC	p.L395R		NM_030777	NP_110404	O95528	GTR10_HUMAN	solute carrier family 2 member 10	395	Extracellular (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)												0.183673	7.437982	12.070848	9	40	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44788266	44788266	15036	20	T	G	G	54	54	SLC2A10	G	4	4
SULF2	55959	broad.mit.edu	36	20	45726336	45726336	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:45726336G>A	uc002xto.1	-	c.2002C>T	c.(2002-2004)CAC>TAC	p.H668Y	SULF2_uc002xtp.1_Missense_Mutation_p.H668Y|SULF2_uc002xtq.1_Missense_Mutation_p.H668Y|SULF2_uc002xtr.1_Missense_Mutation_p.H668Y	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	668					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)	5										709		OREG0026005	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.182119	104.488825	133.154858	55	247	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45726336	45726336	15891	20	G	A	A	47	47	SULF2	A	2	2
SLC23A2	9962	broad.mit.edu	36	20	4828336	4828336	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:4828336C>A	uc002wlg.1	-	c.347G>T	c.(346-348)GGC>GTC	p.G116V	SLC23A2_uc002wlh.1_Missense_Mutation_p.G116V|SLC23A2_uc002wli.2_Missense_Mutation_p.G115V	NM_005116	NP_976072	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	116	Helical; (Potential).				L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2														0.171053	9.699998	17.536963	13	63	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4828336	4828336	14960	20	C	A	A	26	26	SLC23A2	A	3	3
BCAS1	8537	broad.mit.edu	36	20	52108592	52108592	+	Splice_Site_SNP	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:52108592C>T	uc002xws.2	-	c.e2_splice_site			BCAS1_uc002xwt.2_Splice_Site_SNP|BCAS1_uc010gil.1_Splice_Site_SNP	NM_003657	NP_003648			breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)											0.160976	54.75651	77.109085	33	172	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	52108592	52108592	1371	20	C	T	T	18	18	BCAS1	T	5	2
KRTAP15-1	254950	broad.mit.edu	36	21	30734626	30734626	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:30734626C>T	uc002yod.1	+	c.110C>T	c.(109-111)TCT>TTT	p.S37F		NM_181623	NP_853654	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	37						intermediate filament					0														0.257143	19.353613	21.229838	9	26	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30734626	30734626	8841	21	C	T	T	32	32	KRTAP15-1	T	2	2
CABIN1	23523	broad.mit.edu	36	22	22894415	22894417	+	Missense_Mutation	TNP	GTG	ACA	ACA			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:22894415_22894417GTG>ACA	uc002zzi.1	+	c.5683_5685GTG>ACA	c.(5683-5685)GTG>ACA	p.V1895T	CABIN1_uc002zzj.1_Missense_Mutation_p.V1816T|CABIN1_uc002zzl.1_Missense_Mutation_p.V1895T|CABIN1_uc002zzm.1_Missense_Mutation_p.V320T	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1895					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														1	7.839477	7.720787	3	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	22894415	22894417	2644	22	GTG	ACA	ACA	44	44	CABIN1	ACA	2	2
SYN3	8224	broad.mit.edu	36	22	31732580	31732580	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:31732580G>A	uc003amx.1	-	c.68C>T	c.(67-69)ACG>ATG	p.T23M	SYN3_uc003amy.1_Missense_Mutation_p.T23M|SYN3_uc003amz.1_Missense_Mutation_p.T23M	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	23	A.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity				0										35				0.545455	79.009873	79.090362	24	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31732580	31732580	15963	22	G	A	A	40	40	SYN3	A	1	1
FOXRED2	80020	broad.mit.edu	36	22	35230160	35230160	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:35230160G>C	uc003apn.2	-	c.980C>G	c.(979-981)GCC>GGC	p.A327G	FOXRED2_uc003apo.2_Missense_Mutation_p.A327G|FOXRED2_uc003app.2_Missense_Mutation_p.A327G	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing	327					ER-associated protein catabolic process|oxidation-reduction process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2														0.181818	6.655655	10.87551	8	36	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35230160	35230160	6280	22	G	C	C	42	42	FOXRED2	C	3	3
A4GALT	53947	broad.mit.edu	36	22	41419744	41419744	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr22:41419744T>G	uc003bdb.1	-	c.158A>C	c.(157-159)TAT>TCT	p.Y53S	A4GALT_uc010gzd.1_Missense_Mutation_p.Y53S|A4GALT_uc010gze.1_Missense_Mutation_p.Y53S	NM_017436	NP_059132	Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	53	Lumenal (Potential).				glycosphingolipid biosynthetic process|plasma membrane organization	Golgi stack|integral to Golgi membrane|membrane fraction	lactosylceramide 4-alpha-galactosyltransferase activity			central_nervous_system(1)	1														0.4	9.626416	9.762571	6	9	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41419744	41419744	7	22	T	G	G	49	49	A4GALT	G	4	4
TUBGCP6	85378	broad.mit.edu	36	22	49024447	49024447	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:49024447A>G	uc003bkb.1	-	c.569T>C	c.(568-570)CTG>CCG	p.L190P	TUBGCP6_uc010har.1_Missense_Mutation_p.L190P|TUBGCP6_uc010has.1_Non-coding_Transcript|TUBGCP6_uc010hau.1_Missense_Mutation_p.L190P	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	190					G2/M transition of mitotic cell cycle|microtubule nucleation	cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)										0.25	8.395381	10.004678	7	21	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49024447	49024447	17325	22	A	G	G	7	7	TUBGCP6	G	4	4
SCTR	6344	broad.mit.edu	36	2	119920929	119920929	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:119920929C>T	uc002tma.1	-	c.1016G>A	c.(1015-1017)CGC>CAC	p.R339H	SCTR_uc002tlz.1_Missense_Mutation_p.R161H	NM_002980	NP_002971	P47872	SCTR_HUMAN	secretin receptor precursor	339	Cytoplasmic (Potential).				digestion|excretion	integral to plasma membrane	secretin receptor activity			ovary(1)	1					Secretin(DB00021)									0.75	25.176718	25.861523	9	3	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119920929	119920929	14426	2	C	T	T	27	27	SCTR	T	1	1
RAB3GAP1	22930	broad.mit.edu	36	2	135604100	135604100	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:135604100C>T	uc010fnf.1	+	c.1039C>T	c.(1039-1041)CGA>TGA	p.R347*	RAB3GAP1_uc002tuj.1_Nonsense_Mutation_p.R347*|RAB3GAP1_uc010fng.1_Nonsense_Mutation_p.R172*|RAB3GAP1_uc010fnh.1_Non-coding_Transcript	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	347						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)										0.171429	13.630671	17.20022	6	29	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	135604100	135604100	13394	2	C	T	T	19	19	RAB3GAP1	T	5	1
NBAS	51594	broad.mit.edu	36	2	15276511	15276511	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:15276511T>A	uc002rcc.1	-	c.6269A>T	c.(6268-6270)GAG>GTG	p.E2090V	NBAS_uc010exl.1_Missense_Mutation_p.E1162V|NBAS_uc002rcd.1_Intron|NBAS_uc002rcb.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	2090										ovary(2)|liver(1)	3														0.777778	19.126776	19.76774	7	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15276511	15276511	10582	2	T	A	A	54	54	NBAS	A	4	4
NBAS	51594	broad.mit.edu	36	2	15276516	15276518	+	Missense_Mutation	TNP	CAG	GCT	GCT			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:15276516_15276518CAG>GCT	uc002rcc.1	-	c.6262_6264CTG>AGC	c.(6262-6264)CTG>AGC	p.L2088S	NBAS_uc010exl.1_Missense_Mutation_p.L1160S|NBAS_uc002rcd.1_Intron|NBAS_uc002rcb.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	2088										ovary(2)|liver(1)	3														0.8	9.121533	9.511771	4	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	15276516	15276518	10582	2	CAG	GCT	GCT	25	25	NBAS	GCT	3	3
NBAS	51594	broad.mit.edu	36	2	15530864	15530864	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:15530864G>A	uc002rcc.1	-	c.1658C>T	c.(1657-1659)ACT>ATT	p.T553I	NBAS_uc002rcd.1_Non-coding_Transcript	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	553										ovary(2)|liver(1)	3														0.194444	6.583632	9.752017	7	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15530864	15530864	10582	2	G	A	A	36	36	NBAS	A	2	2
SLC4A10	57282	broad.mit.edu	36	2	162447158	162447158	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:162447158C>T	uc002ubx.2	+	c.1152C>T	c.(1150-1152)TAC>TAT	p.Y384Y	SLC4A10_uc002uby.2_Silent_p.Y354Y|SLC4A10_uc010fpa.1_Silent_p.Y396Y	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	384	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5														0.138889	6.754691	11.29193	5	31	CC		KEEP	---	---	---	---	capture			Silent	SNP	162447158	162447158	15148	2	C	T	T	18	18	SLC4A10	T	2	2
XIRP2	129446	broad.mit.edu	36	2	167815800	167815800	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:167815800C>T	uc002udx.1	+	c.9652C>T	c.(9652-9654)CCT>TCT	p.P3218S	XIRP2_uc010fpn.1_Intron|XIRP2_uc010fpo.1_Intron|XIRP2_uc010fpp.1_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.P3043S|XIRP2_uc010fpq.1_Missense_Mutation_p.P2996S|XIRP2_uc010fpr.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3043					actin cytoskeleton organization	cell junction	actin binding			ovary(6)|pancreas(1)|skin(1)	8														0.333333	10.295124	10.823214	7	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	167815800	167815800	18011	2	C	T	T	30	30	XIRP2	T	2	2
TTN	7273	broad.mit.edu	36	2	179106267	179106267	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179106267T>C	uc002umr.1	-	c.95617A>G	c.(95617-95619)ACA>GCA	p.T31873A	TTN_uc002ums.1_Missense_Mutation_p.T25568A|TTN_uc010frc.1_Missense_Mutation_p.T25501A|TTN_uc010frd.1_Missense_Mutation_p.T25376A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32800										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.12959	63.102835	124.928059	60	403	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	179106267	179106267	17290	2	T	C	C	59	59	TTN	C	4	4
NUP35	129401	broad.mit.edu	36	2	183703481	183703481	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:183703481C>T	uc002upf.1	+	c.302C>T	c.(301-303)CCA>CTA	p.P101L	NUP35_uc002upg.1_Non-coding_Transcript	NM_138285	NP_612142	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa	101					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	intermediate filament cytoskeleton|nuclear membrane|nuclear pore|plasma membrane					0														0.152672	28.612194	43.766593	20	111	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	183703481	183703481	11168	2	C	T	T	21	21	NUP35	T	2	2
PLCL1	5334	broad.mit.edu	36	2	198661835	198661835	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:198661835C>T	uc010fsp.1	+	c.2724C>T	c.(2722-2724)ATC>ATT	p.I908I	PLCL1_uc002uuv.2_Silent_p.I829I|PLCL1_uc002uuw.2_Silent_p.I810I	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	phospholipase C-like 1 isoform a	908	Potential.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)	1					Quinacrine(DB01103)									0.2	128.004095	155.627929	66	264	CC		KEEP	---	---	---	---	capture			Silent	SNP	198661835	198661835	12465	2	C	T	T	31	31	PLCL1	T	1	1
ICA1L	130026	broad.mit.edu	36	2	203401892	203401892	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:203401892A>T	uc002uzh.1	-	c.86T>A	c.(85-87)GTC>GAC	p.V29D	ICA1L_uc002uzi.1_Missense_Mutation_p.V29D|ICA1L_uc010fts.1_Non-coding_Transcript|ICA1L_uc002uzk.1_Missense_Mutation_p.V29D|ICA1L_uc002uzj.2_Missense_Mutation_p.V29D	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1	29											0														0.482759	238.979255	239.02344	84	90	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	203401892	203401892	7778	2	A	T	T	10	10	ICA1L	T	4	4
ANKMY1	51281	broad.mit.edu	36	2	241117434	241117434	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:241117434G>C	uc010fzd.1	-	c.646C>G	c.(646-648)CAC>GAC	p.H216D	ANKMY1_uc002vyz.1_Missense_Mutation_p.H127D|ANKMY1_uc002vza.1_Intron|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	127							zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)										0.363636	6.385213	6.569566	4	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	241117434	241117434	637	2	G	C	C	47	47	ANKMY1	C	3	3
CAPN10	11132	broad.mit.edu	36	2	241184418	241184418	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:241184418C>G	uc002vzk.1	+	c.1288C>G	c.(1288-1290)CGG>GGG	p.R430G	CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Missense_Mutation_p.R302G|CAPN10_uc002vzo.1_Non-coding_Transcript|CAPN10_uc010fzg.1_Non-coding_Transcript|CAPN10_uc002vzp.1_Non-coding_Transcript|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	430	Domain III 1.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)										1	7.738654	7.619885	3	0	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	241184418	241184418	2740	2	C	G	G	27	27	CAPN10	G	3	3
FARP2	9855	broad.mit.edu	36	2	242081390	242081390	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:242081390C>G	uc002wbi.1	+	c.2905C>G	c.(2905-2907)CCA>GCA	p.P969A		NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	969	PH 2.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)										0.238095	6.856103	8.181589	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	242081390	242081390	5913	2	C	G	G	22	22	FARP2	G	3	3
ALMS1	7840	broad.mit.edu	36	2	73531355	73531355	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:73531355G>A	uc002sje.1	+	c.4196G>A	c.(4195-4197)GGT>GAT	p.G1399D	ALMS1_uc002sjf.1_Missense_Mutation_p.G1355D|ALMS1_uc002sjg.2_Missense_Mutation_p.G785D|ALMS1_uc002sjh.1_Missense_Mutation_p.G785D	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	ALMS1	1397	19.|34 X 47 AA approximate tandem repeat.				G2/M transition of mitotic cell cycle|visual perception	centrosome|cilium|cytosol|microtubule basal body|spindle pole				ovary(2)|breast(2)|lung(1)|pancreas(1)	6														0.259259	10.704708	12.130807	7	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73531355	73531355	538	2	G	A	A	44	44	ALMS1	A	2	2
MRPL19	9801	broad.mit.edu	36	2	75735530	75735530	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:75735530C>T	uc002snl.1	+	c.636C>T	c.(634-636)AAC>AAT	p.N212N	MRPL19_uc002snm.1_Silent_p.N212N	NM_014763	NP_055578	P49406	RM19_HUMAN	mitochondrial ribosomal protein L19	212					translation	mitochondrion|nuclear membrane|ribosome	structural constituent of ribosome				0														0.2	20.05266	23.817511	9	36	CC		KEEP	---	---	---	---	capture			Silent	SNP	75735530	75735530	10177	2	C	T	T	18	18	MRPL19	T	2	2
CNNM3	26505	broad.mit.edu	36	2	96858508	96858508	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96858508A>C	uc002swy.1	+	c.1969A>C	c.(1969-1971)AAC>CAC	p.N657H	CNNM3_uc002swz.1_Missense_Mutation_p.N609H	NM_017623	NP_060093	Q8NE01	CNNM3_HUMAN	cyclin M3 isoform 1	657					ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1														0.75	7.38825	7.552086	3	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	96858508	96858508	3752	2	A	C	C	9	9	CNNM3	C	4	4
H1FX	8971	broad.mit.edu	36	3	130516959	130516959	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:130516959C>G	uc003elx.1	-	c.477G>C	c.(475-477)AAG>AAC	p.K159N	C3orf47_uc003elz.2_5'Flank	NM_006026	NP_006017	Q92522	H1X_HUMAN	H1 histone family, member X	159					nucleosome assembly	nucleosome|nucleus	DNA binding				0														0.9	19.666623	20.548107	9	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130516959	130516959	7203	3	C	G	G	32	32	H1FX	G	3	3
H1FX	8971	broad.mit.edu	36	3	130516962	130516962	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:130516962G>T	uc003elx.1	-	c.474C>A	c.(472-474)GAC>GAA	p.D158E	C3orf47_uc003elz.2_5'Flank	NM_006026	NP_006017	Q92522	H1X_HUMAN	H1 histone family, member X	158					nucleosome assembly	nucleosome|nucleus	DNA binding				0														0.833333	10.353851	10.793638	5	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130516962	130516962	7203	3	G	T	T	48	48	H1FX	T	3	3
H1FOO	132243	broad.mit.edu	36	3	130752740	130752740	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:130752740C>T	uc003emu.1	+	c.908C>T	c.(907-909)GCT>GTT	p.A303V	H1FOO_uc003emv.1_Missense_Mutation_p.A164V	NM_153833	NP_722575	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific	303					meiosis|nucleosome assembly	cytoplasm|nucleosome	DNA binding				0														0.4	6.78548	6.876088	4	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130752740	130752740	7202	3	C	T	T	28	28	H1FOO	T	2	2
CHRD	8646	broad.mit.edu	36	3	185589076	185589076	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:185589076G>A	uc003fov.1	+	c.2562G>A	c.(2560-2562)TCG>TCA	p.S854S	CHRD_uc003fow.1_Silent_p.S484S|CHRD_uc003fox.1_Silent_p.S854S|CHRD_uc003foy.1_Silent_p.S484S|CHRD_uc010hyc.1_Silent_p.S444S	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin	854					BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			ovary(1)	1	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)											0.128571	11.836325	21.242026	9	61	GG		KEEP	---	---	---	---	capture			Silent	SNP	185589076	185589076	3506	3	G	A	A	39	39	CHRD	A	1	1
SENP5	205564	broad.mit.edu	36	3	198097149	198097149	+	Nonsense_Mutation	SNP	G	T	T			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:198097149G>T	uc003fwz.2	+	c.700G>T	c.(700-702)GAG>TAG	p.E234*		NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	234					cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			lung(1)	1	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		Ovarian(47;891 1095 11174 13858 51271)								0.2	13.013705	15.940747	7	28	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	198097149	198097149	14535	3	G	T	T	45	45	SENP5	T	5	3
C3orf39	84892	broad.mit.edu	36	3	43096480	43096480	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:43096480C>A	uc003cmq.1	-	c.1448G>T	c.(1447-1449)GGC>GTC	p.G483V	C3orf39_uc003cmr.1_Missense_Mutation_p.G483V|C3orf39_uc010hij.1_Missense_Mutation_p.G483V	NM_032806	NP_116195	Q8NAT1	AGO61_HUMAN	glycosyltransferase	483						extracellular region	transferase activity, transferring glycosyl groups			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0571)|Kidney(284;0.0718)										0.25	7.219038	8.602176	6	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43096480	43096480	2322	3	C	A	A	26	26	C3orf39	A	3	3
DAG1	1605	broad.mit.edu	36	3	49543912	49543912	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49543912A>G	uc003cxc.2	+	c.964A>G	c.(964-966)ACT>GCT	p.T322A		NM_004393	NP_004384	Q14118	DAG1_HUMAN	dystroglycan 1 preproprotein	322	Thr-rich.|Required for laminin recognition.|Mucin-like domain.				cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|structural constituent of muscle|tubulin binding|vinculin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)										0.375	10.635971	10.858453	6	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49543912	49543912	4392	3	A	G	G	6	6	DAG1	G	4	4
IQCF1	132141	broad.mit.edu	36	3	51904238	51904238	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:51904238A>G	uc003dbv.1	-	c.326T>C	c.(325-327)ATT>ACT	p.I109T	IQCF1_uc003dbq.2_Intron	NM_152397	NP_689610	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	109										ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)										0.238095	7.264204	8.584934	5	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51904238	51904238	8108	3	A	G	G	4	4	IQCF1	G	4	4
FAM19A4	151647	broad.mit.edu	36	3	68884772	68884772	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:68884772G>A	uc003dnh.1	-	c.218C>T	c.(217-219)ACG>ATG	p.T73M	FAM19A4_uc003dni.1_Missense_Mutation_p.T73M	NM_182522	NP_872328	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine	73						extracellular region					0		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)										0.76	608.603535	624.045982	190	60	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68884772	68884772	5748	3	G	A	A	40	40	FAM19A4	A	1	1
SRGAP3	9901	broad.mit.edu	36	3	9141595	9141595	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:9141595C>T	uc003brf.1	-	c.74G>A	c.(73-75)CGC>CAC	p.R25H	SRGAP3_uc003brg.1_Missense_Mutation_p.R25H|SRGAP3_uc003bri.1_Non-coding_Transcript|SRGAP3_uc003brk.2_Missense_Mutation_p.R25H	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	25	FCH.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|urinary_tract(1)|breast(1)	6				OV - Ovarian serous cystadenocarcinoma(96;0.0563)										0.363636	42.780683	43.503121	16	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9141595	9141595	15661	3	C	T	T	27	27	SRGAP3	T	1	1
CIDEC	63924	broad.mit.edu	36	3	9887001	9887001	+	Silent	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:9887001C>A	uc003btp.1	-	c.243G>T	c.(241-243)CGG>CGT	p.R81R	CIDEC_uc003bto.1_Intron|CIDEC_uc010hcp.1_Intron|CIDEC_uc003btq.1_Silent_p.R71R|CIDEC_uc003btr.1_5'UTR|CIDEC_uc003bts.1_5'UTR	NM_022094	NP_071377	Q96AQ7	CIDEC_HUMAN	cell death-inducing DFFA-like effector c	71	CIDE-N.				apoptosis|induction of apoptosis	cytosol|focal adhesion|nucleus				central_nervous_system(1)	1	Medulloblastoma(99;0.227)													0.277778	7.05621	7.865426	5	13	CC		KEEP	---	---	---	---	capture			Silent	SNP	9887001	9887001	3561	3	C	A	A	22	22	CIDEC	A	3	3
OR5H14	403273	broad.mit.edu	36	3	99351192	99351192	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:99351192G>A	uc003dsg.1	+	c.273G>A	c.(271-273)ATG>ATA	p.M91I		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.603448	102.312019	102.852965	35	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99351192	99351192	11570	3	G	A	A	45	45	OR5H14	A	2	2
CASP6	839	broad.mit.edu	36	4	110831464	110831464	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:110831464C>G	uc003hzn.1	-	c.634G>C	c.(634-636)GTT>CTT	p.V212L	CASP6_uc003hzo.1_Missense_Mutation_p.V123L	NM_001226	NP_001217	P55212	CASP6_HUMAN	caspase 6 isoform alpha preproprotein	212					cellular component disassembly involved in apoptosis|induction of apoptosis|proteolysis	cytosol|nucleoplasm	cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)					p.V212I(JHUEM2-Tumor)	203				0.239105	468.923592	521.639453	203	646	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110831464	110831464	2794	4	C	G	G	17	17	CASP6	G	3	3
FAM198B	51313	broad.mit.edu	36	4	159311877	159311877	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:159311877G>A	uc003ipq.2	-	c.101C>T	c.(100-102)ACC>ATC	p.T34I	FAM198B_uc003ipp.2_Missense_Mutation_p.T34I|FAM198B_uc003ipr.2_Missense_Mutation_p.T34I|FAM198B_uc003ips.2_Missense_Mutation_p.T34I	NM_001031700	NP_001026870	Q6UWH4	F198B_HUMAN	hypothetical protein LOC51313 isoform 1	34	Cytoplasmic (Potential).					Golgi membrane|integral to membrane					0														0.8	8.494162	8.906432	4	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	159311877	159311877	5743	4	G	A	A	44	44	FAM198B	A	2	2
ING2	3622	broad.mit.edu	36	4	184668471	184668471	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:184668471A>C	uc003ivs.1	+	c.215A>C	c.(214-216)AAA>ACA	p.K72T		NM_001564	NP_001555	Q9H160	ING2_HUMAN	inhibitor of growth family, member 2	72	Potential.				chromatin modification|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	CCAAT-binding factor complex|Sin3 complex	chromatin binding|DNA binding|protein complex binding|transcription activator activity|zinc ion binding			ovary(1)	1		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|all_hematologic(60;0.0207)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)										0.1625	7.99433	16.732654	13	67	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	184668471	184668471	8037	4	A	C	C	1	1	ING2	C	4	4
ATP10D	57205	broad.mit.edu	36	4	47288116	47288116	+	Silent	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:47288116C>A	uc003gxk.1	+	c.4242C>A	c.(4240-4242)GCC>GCA	p.A1414A	ATP10D_uc003gxl.1_Silent_p.A662A	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1414	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3														0.666667	8.491575	8.63656	4	2	CC		KEEP	---	---	---	---	capture			Silent	SNP	47288116	47288116	1137	4	C	A	A	24	24	ATP10D	A	3	3
CNGA1	1259	broad.mit.edu	36	4	47633875	47633875	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:47633875T>A	uc003gxu.1	-	c.1600A>T	c.(1600-1602)ATT>TTT	p.I534F	CNGA1_uc003gxs.1_Missense_Mutation_p.I465F|CNGA1_uc003gxt.2_Missense_Mutation_p.I465F	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	465	Extracellular (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2														0.103774	7.16071	23.731053	11	95	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47633875	47633875	3734	4	T	A	A	52	52	CNGA1	A	4	4
SLC6A18	348932	broad.mit.edu	36	5	1291077	1291077	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:1291077A>C	uc003jby.1	+	c.634A>C	c.(634-636)ACA>CCA	p.T212P		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	212	Helical; Name=5; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)											0.166667	7.979593	16.514642	13	65	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1291077	1291077	15178	5	A	C	C	6	6	SLC6A18	C	4	4
ETF1	2107	broad.mit.edu	36	5	137871915	137871915	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:137871915A>C	uc003ldc.2	-	c.1292T>G	c.(1291-1293)TTT>TGT	p.F431C	ETF1_uc003ldd.2_Missense_Mutation_p.F398C|ETF1_uc010jex.1_Non-coding_Transcript	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	431					protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)											0.157895	7.932477	14.315991	9	48	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	137871915	137871915	5461	5	A	C	C	1	1	ETF1	C	4	4
CD14	929	broad.mit.edu	36	5	139992277	139992277	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:139992277G>A	uc003lgi.1	-	c.476C>T	c.(475-477)TCT>TTT	p.S159F	CD14_uc003lgj.1_Missense_Mutation_p.S159F	NM_000591	NP_001035110	P08571	CD14_HUMAN	CD14 antigen precursor	159	LRR 4.				apoptosis|cellular response to lipopolysaccharide|cellular response to lipoteichoic acid|inflammatory response|innate immune response|phagocytosis|positive regulation of tumor necrosis factor production|Toll signaling pathway	anchored to membrane|plasma membrane	lipopolysaccharide binding|lipoteichoic acid binding|opsonin receptor activity|peptidoglycan receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.4	9.195694	9.283639	4	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139992277	139992277	3091	5	G	A	A	33	33	CD14	A	2	2
PCDHA6	56142	broad.mit.edu	36	5	140188240	140188240	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140188240A>G	uc003lho.1	+	c.380A>G	c.(379-381)AAC>AGC	p.N127S	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lhn.1_Missense_Mutation_p.N127S|PCDHA6_uc003lhm.1_Missense_Mutation_p.N127S	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	127	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.209302	8.732793	12.129937	9	34	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140188240	140188240	11948	5	A	G	G	2	2	PCDHA6	G	4	4
SLC6A3	6531	broad.mit.edu	36	5	1469303	1469303	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:1469303G>A	uc003jck.2	-	c.941C>T	c.(940-942)GCG>GTG	p.A314V		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	314					cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)									0.777778	22.529315	23.168395	7	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1469303	1469303	15182	5	G	A	A	38	38	SLC6A3	A	1	1
NIPBL	25836	broad.mit.edu	36	5	37060445	37060445	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:37060445A>T	uc003jkl.2	+	c.5576A>T	c.(5575-5577)GAT>GTT	p.D1859V	NIPBL_uc003jkk.2_Missense_Mutation_p.D1859V	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1859	HEAT 2.				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of gene-specific transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding|transcription repressor activity			ovary(3)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	8	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)							934				0.294118	11.062753	11.711787	5	12	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37060445	37060445	10829	5	A	T	T	12	12	NIPBL	T	4	4
ZNF366	167465	broad.mit.edu	36	5	71775736	71775736	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:71775736C>G	uc003kce.1	-	c.1838G>C	c.(1837-1839)GGC>GCC	p.G613A		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	613					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)										0.6	7.223981	7.267681	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71775736	71775736	18462	5	C	G	G	26	26	ZNF366	G	3	3
ZDHHC11	79844	broad.mit.edu	36	5	896807	896809	+	Missense_Mutation	TNP	GCT	AGA	AGA			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:896807_896809GCT>AGA	uc003jbi.1	-	c.534_536AGC>TCT	c.(532-537)ACAGCT>ACTCTT	p.A179L	ZDHHC11_uc003jbj.1_Non-coding_Transcript|ZDHHC11_uc010itd.1_5'Flank|ZDHHC11_uc003jbk.2_5'UTR	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	179	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			pancreas(1)	1			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)											0.933333	33.667024	34.650402	14	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	896807	896809	18189	5	GCT	AGA	AGA	34	34	ZDHHC11	AGA	2	2
ZDHHC11	79844	broad.mit.edu	36	5	896811	896811	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:896811T>G	uc003jbi.1	-	c.532A>C	c.(532-534)ACA>CCA	p.T178P	ZDHHC11_uc003jbj.1_Non-coding_Transcript|ZDHHC11_uc010itd.1_5'Flank|ZDHHC11_uc003jbk.2_5'UTR	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11	178	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			pancreas(1)	1			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)											1	19.985567	19.981561	8	0	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	896811	896811	18189	5	T	G	G	59	59	ZDHHC11	G	4	4
ANKRD32	84250	broad.mit.edu	36	5	94049966	94049966	+	Splice_Site_SNP	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:94049966G>A	uc003kkr.2	+	c.e17_splice_site			ANKRD32_uc003kks.1_Splice_Site_SNP	NM_032290	NP_115666			ankyrin repeat domain 32											ovary(2)	2		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)										0.219512	20.66065	23.627113	9	32	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	94049966	94049966	666	5	G	A	A	35	35	ANKRD32	A	5	2
LAMA2	3908	broad.mit.edu	36	6	129819236	129819236	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:129819236C>T	uc003qbn.1	+	c.6771C>T	c.(6769-6771)CCC>CCT	p.P2257P	LAMA2_uc003qbo.1_Silent_p.P2257P|LAMA2_uc010kfe.1_Silent_p.P2257P	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2257	Laminin G-like 1.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)										0.265957	526.98619	573.597577	250	690	CC		KEEP	---	---	---	---	capture			Silent	SNP	129819236	129819236	8929	6	C	T	T	21	21	LAMA2	T	2	2
ECT2L	345930	broad.mit.edu	36	6	139245666	139245666	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:139245666A>T	uc003qif.1	+	c.1993A>T	c.(1993-1995)AAC>TAC	p.N665Y		NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	hypothetical protein LOC345930	665	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0														0.3125	7.152091	7.663134	5	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139245666	139245666	5089	6	A	T	T	5	5	ECT2L	T	4	4
VARS	7407	broad.mit.edu	36	6	31855012	31855012	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31855012A>T	uc003nxe.1	-	c.3437T>A	c.(3436-3438)CTG>CAG	p.L1146Q	C6orf27_uc003nxb.2_5'Flank|C6orf27_uc003nxd.2_5'Flank|VARS_uc003nxf.1_Missense_Mutation_p.L83Q	NM_006295	NP_006286	P26640	SYVC_HUMAN	valyl-tRNA synthetase	1146					translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			ovary(1)	1					L-Valine(DB00161)									0.833333	11.751619	12.301439	5	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31855012	31855012	17688	6	A	T	T	7	7	VARS	T	4	4
SKIV2L	6499	broad.mit.edu	36	6	32044141	32044141	+	Silent	SNP	T	G	G			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:32044141T>G	uc003nyn.1	+	c.2916T>G	c.(2914-2916)GCT>GCG	p.A972A	STK19_uc003nyt.1_5'Flank	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	972						nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4														0.333333	8.191893	8.489158	4	8	TT		KEEP	---	---	---	---	capture			Silent	SNP	32044141	32044141	14854	6	T	G	G	54	54	SKIV2L	G	4	4
COL11A2	1302	broad.mit.edu	36	6	33241495	33241495	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33241495C>T	uc003ocx.1	-	c.4559G>A	c.(4558-4560)CGT>CAT	p.R1520H	COL11A2_uc010jul.1_Missense_Mutation_p.R90H|COL11A2_uc003ocy.1_Missense_Mutation_p.R1434H|COL11A2_uc003ocz.1_Missense_Mutation_p.R1413H	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1520					cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(1)	4						Melanoma(1;90 116 3946 5341 17093)								0.27907	29.592319	31.474592	12	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33241495	33241495	3806	6	C	T	T	19	19	COL11A2	T	1	1
EFHC1	114327	broad.mit.edu	36	6	52465091	52465091	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:52465091C>T	uc003pap.2	+	c.1916C>T	c.(1915-1917)TCA>TTA	p.S639L		NM_018100	NP_060570	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	639						axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding			ovary(2)	2	Lung NSC(77;0.109)													0.340741	122.192452	125.226314	46	89	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52465091	52465091	5134	6	C	T	T	29	29	EFHC1	T	2	2
RIOK1	83732	broad.mit.edu	36	6	7346239	7346239	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:7346239G>T	uc003mxn.1	+	c.530G>T	c.(529-531)GGA>GTA	p.G177V	RIOK1_uc003mxm.1_Missense_Mutation_p.G73V|RIOK1_uc003mxo.1_5'Flank	NM_031480	NP_694550	Q9BRS2	RIOK1_HUMAN	RIO kinase 1 isoform 1	177							ATP binding|protein serine/threonine kinase activity			ovary(2)	2	Ovarian(93;0.0418)									302				0.13089	22.538202	48.127476	25	166	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7346239	7346239	13854	6	G	T	T	41	41	RIOK1	T	3	3
IMPG1	3617	broad.mit.edu	36	6	76808456	76808456	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:76808456G>A	uc003pik.1	-	c.175C>T	c.(175-177)CGA>TGA	p.R59*		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	59					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)	2		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				Pancreas(37;839 1141 2599 26037)								0.408537	192.29473	193.490829	67	97	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	76808456	76808456	8029	6	G	A	A	40	40	IMPG1	A	5	1
C7orf50	84310	broad.mit.edu	36	7	1003930	1003930	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:1003930G>T	uc003sjt.1	-	c.442C>A	c.(442-444)CTG>ATG	p.L148M	C7orf50_uc003sju.1_Missense_Mutation_p.L148M|C7orf50_uc003sjs.1_Non-coding_Transcript	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310	148							protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)										0.857143	11.833726	12.186183	6	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1003930	1003930	2506	7	G	T	T	35	35	C7orf50	T	3	3
SLC26A5	375611	broad.mit.edu	36	7	102835633	102835633	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:102835633G>A	uc003vbz.1	-	c.789C>T	c.(787-789)GGC>GGT	p.G263G	SLC26A5_uc003vbt.1_Silent_p.G263G|SLC26A5_uc003vbu.1_Silent_p.G263G|SLC26A5_uc003vbv.1_Silent_p.G263G|SLC26A5_uc003vbw.1_Non-coding_Transcript|SLC26A5_uc003vbx.1_Silent_p.G263G|SLC26A5_uc003vby.1_Non-coding_Transcript|SLC26A5_uc010liy.1_Non-coding_Transcript	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	263	Helical; Name=6; (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	motor activity|secondary active sulfate transmembrane transporter activity			ovary(1)	1														0.164179	18.692605	25.868037	11	56	GG		KEEP	---	---	---	---	capture			Silent	SNP	102835633	102835633	15017	7	G	A	A	38	38	SLC26A5	A	1	1
WDR91	29062	broad.mit.edu	36	7	134546770	134546770	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:134546770C>A	uc003vsp.1	-	c.25G>T	c.(25-27)GAC>TAC	p.D9Y		NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	9										breast(2)|ovary(1)	3														0.217391	9.160071	10.859131	5	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134546770	134546770	17912	7	C	A	A	29	29	WDR91	A	3	3
INTS1	26173	broad.mit.edu	36	7	1503474	1503474	+	Silent	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:1503474G>A	uc003skn.2	-	c.1428C>T	c.(1426-1428)TTC>TTT	p.F476F		NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	476					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)										0.206897	19.678206	24.295957	12	46	GG		KEEP	---	---	---	---	capture			Silent	SNP	1503474	1503474	8076	7	G	A	A	41	41	INTS1	A	2	2
TMEM195	392636	broad.mit.edu	36	7	15424788	15424788	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:15424788G>C	uc003stb.1	-	c.529C>G	c.(529-531)CTG>GTG	p.L177V		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	177					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process|oxidation-reduction process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0														0.428571	24.767523	24.861565	9	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15424788	15424788	16652	7	G	C	C	35	35	TMEM195	C	3	3
MPP6	51678	broad.mit.edu	36	7	24671758	24671758	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:24671758C>T	uc003swx.1	+	c.810C>T	c.(808-810)AGC>AGT	p.S270S	MPP6_uc003swy.1_Silent_p.S270S|MPP6_uc010kur.1_5'Flank	NM_016447	NP_057531	Q9NZW5	MPP6_HUMAN	membrane protein, palmitoylated 6	270	SH3.				protein complex assembly		protein binding				0														0.125	11.030386	20.919789	9	63	CC		KEEP	---	---	---	---	capture			Silent	SNP	24671758	24671758	10130	7	C	T	T	27	27	MPP6	T	1	1
ELMO1	9844	broad.mit.edu	36	7	37277978	37277978	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:37277978C>T	uc003tfk.1	-	c.227G>A	c.(226-228)CGA>CAA	p.R76Q	ELMO1_uc010kxg.1_Missense_Mutation_p.R76Q	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	76					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)	3														0.233766	47.215301	52.206904	18	59	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37277978	37277978	5257	7	C	T	T	31	31	ELMO1	T	1	1
EGFR	1956	broad.mit.edu	36	7	55208184	55208184	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55208184C>G	uc003tqk.1	+	c.1934C>G	c.(1933-1935)TCC>TGC	p.S645C	EGFR_uc010kzg.1_Missense_Mutation_p.S600C	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	645	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.768608	1560.993682	1601.843791	475	143	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55208184	55208184	5156	7	C	G	G	30	30	EGFR	G	3	3
WBSCR17	64409	broad.mit.edu	36	7	70235851	70235851	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:70235851C>T	uc003tvy.1	+	c.127C>T	c.(127-129)CGG>TGG	p.R43W		NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	43	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)												0.2	8.035711	10.551609	6	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70235851	70235851	17836	7	C	T	T	23	23	WBSCR17	T	1	1
PVRIG	79037	broad.mit.edu	36	7	99656718	99656718	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:99656718G>T	uc003uue.2	+	c.889G>T	c.(889-891)GGG>TGG	p.G297W	GATS_uc003uty.2_Intron|GATS_uc010lgt.1_Intron|GATS_uc003utz.2_Intron|GATS_uc003uua.2_Intron|GATS_uc003uuc.1_Intron|GATS_uc003uud.1_Intron|GATS_uc010lgu.1_Intron|PVRIG_uc003uuf.1_Missense_Mutation_p.G297W	NM_024070	NP_076975	Q6DKI7	PVRIG_HUMAN	poliovirus receptor related immunoglobulin	297						integral to membrane					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)													0.25	15.004545	18.006528	13	39	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99656718	99656718	13296	7	G	T	T	35	35	PVRIG	T	3	3
EIF2C2	27161	broad.mit.edu	36	8	141636378	141636378	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:141636378G>C	uc003yvn.1	-	c.1018C>G	c.(1018-1020)CCC>GCC	p.P340A	EIF2C2_uc010men.1_Missense_Mutation_p.P263A|EIF2C2_uc010meo.1_Missense_Mutation_p.P340A	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	eukaryotic translation initiation factor 2C, 2	340	PAZ.				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-microRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)											1	24.420907	24.419891	10	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	141636378	141636378	5195	8	G	C	C	41	41	EIF2C2	C	3	3
BAI1	575	broad.mit.edu	36	8	143559922	143559922	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:143559922G>A	uc003ywm.1	+	c.1978G>A	c.(1978-1980)GAG>AAG	p.E660K		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	660	Extracellular (Potential).				axonogenesis|cell adhesion|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)									829				0.184615	22.480482	28.532109	12	53	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	143559922	143559922	1319	8	G	A	A	41	41	BAI1	A	2	2
PLEC	5339	broad.mit.edu	36	8	145070058	145070058	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:145070058C>T	uc003zaf.1	-	c.6438G>A	c.(6436-6438)GAG>GAA	p.E2146E	PLEC_uc003zag.1_Silent_p.E1987E|PLEC_uc003zah.1_Silent_p.E1995E|PLEC_uc003zai.1_Silent_p.E2036E|PLEC_uc003zaj.1_Silent_p.E2036E|PLEC_uc003zab.1_Silent_p.E2009E|PLEC_uc003zac.1_Silent_p.E2013E|PLEC_uc003zad.1_Silent_p.E2009E|PLEC_uc003zae.1_Silent_p.E1977E	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin 1 isoform 6	2146	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|central_nervous_system(1)	7														1	7.634864	7.515733	3	0	CC		KEEP	---	---	---	---	capture			Silent	SNP	145070058	145070058	12478	8	C	T	T	24	24	PLEC	T	2	2
RECQL4	9401	broad.mit.edu	36	8	145712183	145712185	+	Missense_Mutation	TNP	CTT	AAG	AAG			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:145712183_145712185CTT>AAG	uc003zdj.1	-	c.1126_1128AAG>CTT	c.(1126-1128)AAG>CTT	p.K376L	LRRC14_uc003zdk.1_5'Flank|LRRC14_uc003zdl.1_5'Flank	NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4	376					DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			skin(1)	1	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)						p.K376K(NUDUL1-Tumor)	474				0.888889	14.587421	15.878882	8	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	145712183	145712185	13671	8	CTT	AAG	AAG	28	28	RECQL4	AAG	3	3
RIPK2	8767	broad.mit.edu	36	8	90844259	90844259	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:90844259C>T	uc003yee.1	+	c.239C>T	c.(238-240)CCA>CTA	p.P80L	RIPK2_uc003yef.1_Intron	NM_003821	NP_003812	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	80	Protein kinase.				activation of MAPK activity|anti-apoptosis|apoptosis|inflammatory response|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|CARD domain binding|LIM domain binding|protein homodimerization activity|protein serine/threonine kinase activity|signal transducer activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.0474)							686				0.183007	54.922366	69.351911	28	125	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	90844259	90844259	13858	8	C	T	T	21	21	RIPK2	T	2	2
TMEM67	91147	broad.mit.edu	36	8	94837204	94837204	+	Silent	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:94837204A>T	uc003ygd.2	+	c.216A>T	c.(214-216)CCA>CCT	p.P72P	TMEM67_uc003yga.2_Intron|TMEM67_uc010mat.1_5'UTR|TMEM67_uc010mau.1_Silent_p.P82P|TMEM67_uc010mav.1_Silent_p.P82P|TMEM67_uc010maw.1_Silent_p.P82P	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	82			P -> S (in a patient with Joubert syndrome related disorder without clinically apparent liver disease).|P -> R (in a patient with Joubert syndrome related disorder without clinically apparent liver disease).		cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)											0.75	6.731868	6.947096	3	1	AA		KEEP	---	---	---	---	capture			Silent	SNP	94837204	94837204	16735	8	A	T	T	7	7	TMEM67	T	4	4
KCNS2	3788	broad.mit.edu	36	8	99510469	99510469	+	Silent	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:99510469T>C	uc003yin.1	+	c.1086T>C	c.(1084-1086)CCT>CCC	p.P362P	KCNS2_uc010mbl.1_Silent_p.P362P	NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	362						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			Pancreas(138;844 2489 9202 24627)								0.8	9.196704	9.608279	4	1	TT		KEEP	---	---	---	---	capture			Silent	SNP	99510469	99510469	8394	8	T	C	C	55	55	KCNS2	C	4	4
OR1J2	26740	broad.mit.edu	36	9	124312960	124312960	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0829-01	TCGA-12-0829-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:124312960G>A	uc004bmj.1	+	c.59G>A	c.(58-60)CGG>CAG	p.R20Q	OR1J2_uc004bml.2_Missense_Mutation_p.R20Q	NM_054107	NP_473448	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J,	20	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|breast(1)|skin(1)	3														0.186722	106.087655	128.201639	45	196	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	124312960	124312960	11366	9	G	A	A	39	39	OR1J2	A	1	1
FPGS	2356	broad.mit.edu	36	9	129610666	129610667	+	Missense_Mutation	DNP	AT	CC	CC			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:129610666_129610667AT>CC	uc004bsg.1	+	c.831_832AT>CC	c.(829-834)CTATAC>CTCCAC	p.Y278H	FPGS_uc004bsh.1_Missense_Mutation_p.Y95H|FPGS_uc004bsi.1_Missense_Mutation_p.Y228H	NM_004957	NP_004948	Q05932	FOLC_HUMAN	folylpolyglutamate synthase isoform a precursor	278					folic acid metabolic process|folic acid-containing compound biosynthetic process|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|one-carbon metabolic process	cytosol|mitochondrial matrix	ATP binding|tetrahydrofolylpolyglutamate synthase activity				0					L-Glutamic Acid(DB00142)									0.428571	6.526374	6.556626	3	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	129610666	129610667	6282	9	AT	CC	CC	16	16	FPGS	CC	4	4
SURF4	6836	broad.mit.edu	36	9	135224130	135224130	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:135224130T>A	uc004cdj.1	-	c.61A>T	c.(61-63)ACA>TCA	p.T21S	SURF4_uc010nal.1_Missense_Mutation_p.T53S	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4	21						endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)										0.956522	45.751598	47.447194	22	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135224130	135224130	15925	9	T	A	A	59	59	SURF4	A	4	4
ANAPC2	29882	broad.mit.edu	36	9	139190026	139190027	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:139190026_139190027CC>AA	uc004clr.1	-	c.1974_1975GG>TT	c.(1972-1977)GCGGTC>GCTTTC	p.V659F	ANAPC2_uc004clq.1_Missense_Mutation_p.V515F	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2	659					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)										0.75	6.522947	6.744457	3	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	139190026	139190027	606	9	CC	AA	AA	18	18	ANAPC2	AA	3	3
SLC34A3	142680	broad.mit.edu	36	9	139247156	139247156	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:139247156C>T	uc004cme.1	+	c.404C>T	c.(403-405)TCC>TTC	p.S135F	SLC34A3_uc004cmc.1_5'UTR|SLC34A3_uc004cmd.1_Missense_Mutation_p.S135F|SLC34A3_uc004cmf.1_Missense_Mutation_p.S135F	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	135	Cytoplasmic (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)										0.6	6.317582	6.359931	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	139247156	139247156	15066	9	C	T	T	30	30	SLC34A3	T	2	2
NRK	203447	broad.mit.edu	36	X	105039748	105039749	+	Missense_Mutation	DNP	GC	TT	TT			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:105039748_105039749GC>TT	uc004emd.1	+	c.1459_1460GC>TT	c.(1459-1461)GCA>TTA	p.A487L	NRK_uc010npc.1_Missense_Mutation_p.A155L	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	487	Gln-rich.				protein phosphorylation		ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14										430				0.421053	12.766685	12.875421	8	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	105039748	105039749	11060	23	GC	TT	TT	42	42	NRK	TT	3	3
ARHGAP36	158763	broad.mit.edu	36	X	130050360	130050360	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:130050360A>T	uc004evz.1	+	c.1564A>T	c.(1564-1566)ATT>TTT	p.I522F	ARHGAP36_uc004ewa.1_Missense_Mutation_p.I510F|ARHGAP36_uc004ewb.1_Missense_Mutation_p.I491F|ARHGAP36_uc004ewc.1_Missense_Mutation_p.I386F	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763	522					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3														0.272727	7.523851	8.563176	6	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130050360	130050360	895	23	A	T	T	8	8	ARHGAP36	T	4	4
GPR112	139378	broad.mit.edu	36	X	135259949	135259949	+	Silent	SNP	C	T	T			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:135259949C>T	uc004ezu.1	+	c.6418C>T	c.(6418-6420)CTA>TTA	p.L2140L	GPR112_uc010nsb.1_Silent_p.L1935L|GPR112_uc010nsc.1_Silent_p.L1907L	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2140	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	11	Acute lymphoblastic leukemia(192;0.000127)								p.L2140V(HEYA8-Tumor)	487				0.372727	104.538042	106.104576	41	69	CC		KEEP	---	---	---	---	capture			Silent	SNP	135259949	135259949	6903	23	C	T	T	32	32	GPR112	T	2	2
SLITRK2	84631	broad.mit.edu	36	X	144713454	144713454	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:144713454A>G	uc004fcc.1	+	c.1819A>G	c.(1819-1821)AGT>GGT	p.S607G	SLITRK2_uc010nso.1_Missense_Mutation_p.S607G|SLITRK2_uc004fcd.1_Missense_Mutation_p.S607G|SLITRK2_uc004fce.1_Missense_Mutation_p.S607G|SLITRK2_uc004fcg.1_Missense_Mutation_p.S607G|SLITRK2_uc010nsp.1_Missense_Mutation_p.S607G	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	607	Extracellular (Potential).					integral to membrane				ovary(4)|pancreas(1)	5	Acute lymphoblastic leukemia(192;6.56e-05)													0.416667	9.060051	9.135308	5	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	144713454	144713454	15241	23	A	G	G	15	15	SLITRK2	G	4	4
TRO	7216	broad.mit.edu	36	X	54973465	54973465	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0829-01	TCGA-12-0829-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:54973465A>C	uc004dtq.1	+	c.3583A>C	c.(3583-3585)ACC>CCC	p.T1195P	TRO_uc004dtr.1_Intron|TRO_uc004dts.1_Intron|TRO_uc004dtt.1_Intron|TRO_uc004dtu.1_Intron|TRO_uc004dtv.1_Intron|TRO_uc004dtw.1_Missense_Mutation_p.T798P|TRO_uc004dtx.1_Missense_Mutation_p.T578P	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	1195	39.|62 X 10 AA approximate tandem repeats.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1														0.238095	6.353934	7.682282	5	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54973465	54973465	17125	23	A	C	C	14	14	TRO	C	4	4
USP51	158880	broad.mit.edu	36	X	55531207	55531207	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0829-01	TCGA-12-0829-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:55531207T>C	uc004dun.1	-	c.891A>G	c.(889-891)ATA>ATG	p.I297M	USP51_uc010nke.1_Missense_Mutation_p.I297M	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	297					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1														0.4	6.685437	6.775985	4	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55531207	55531207	17647	23	T	C	C	53	53	USP51	C	4	4
PJA1	64219	broad.mit.edu	36	X	68299376	68299376	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0829-01	TCGA-12-0829-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:68299376C>A	uc004dxh.1	-	c.431G>T	c.(430-432)GGC>GTC	p.G144V	PJA1_uc004dxg.1_Intron|PJA1_uc004dxi.1_Missense_Mutation_p.G89V|PJA1_uc004dxf.2_Missense_Mutation_p.G144V	NM_145119	NP_001027568	Q8NG27	PJA1_HUMAN	praja 1 isoform a	144							zinc ion binding				0														0.714286	9.654835	9.937505	5	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68299376	68299376	12385	23	C	A	A	26	26	PJA1	A	3	3
ANK3	288	broad.mit.edu	36	10	61504475	61504480	+	In_Frame_Del	DEL	TTTGCA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:61504475_61504480delTTTGCA	uc001jky.1	-	c.6165_6170delTGCAAA	c.(6163-6171)GATGCAAAG>GAG	p.2055_2057DAK>E	ANK3_uc001jkz.2_Intron|ANK3_uc001jkv.1_Intron|ANK3_uc001jkw.1_Intron|ANK3_uc009xpa.1_Intron|ANK3_uc001jkx.1_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	2055_2057					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			ovary(6)|pancreas(2)|central_nervous_system(1)|skin(1)	10														0.39			58	90				---	---	---	---	capture_indel			In_Frame_Del	DEL	61504475	61504480	625	10	TTTGCA	-	-	56	56	ANK3	-	5	5
ARID5B	84159	broad.mit.edu	36	10	63520876	63520877	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:63520876_63520877insA	uc001jlt.1	+	c.1648_1649insA	c.(1648-1650)GAAfs	p.E550fs		NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	550					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription repressor activity			ovary(2)|kidney(1)	3	Prostate(12;0.016)|all_hematologic(501;0.215)													0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	63520876	63520877	937	10	-	A	A	33	33	ARID5B	A	5	5
GRID1	2894	broad.mit.edu	36	10	87956166	87956167	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:87956166_87956167delAC	uc001kdl.1	-	c.454_455delGT	c.(454-456)GTCfs	p.V152fs	GRID1_uc009xsu.1_Non-coding_Transcript	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	152	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|large_intestine(2)	7					L-Glutamic Acid(DB00142)						Multiple Myeloma(13;0.14)			0.42			103	140				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	87956166	87956167	7049	10	AC	-	-	10	10	GRID1	-	5	5
C10orf12	26148	broad.mit.edu	36	10	98734244	98734244	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:98734244_98734244delG	uc001kmv.1	+	c.3107_3107delG	c.(3106-3108)CGTfs	p.R1036fs		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	1036											0		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)										0.38			158	259				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	98734244	98734244	1624	10	G	-	-	40	40	C10orf12	-	5	5
SRPR	6734	broad.mit.edu	36	11	125643193	125643207	+	Splice_Site_Del	DEL	TGGAGAAAGAGTATG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:125643193_125643207delTGGAGAAAGAGTATG	uc001qdh.1	-	c.e2_splice_site			FOXRED1_uc001qdi.1_5'Flank|FOXRED1_uc001qdj.1_5'Flank|FOXRED1_uc001qdk.1_5'Flank	NM_003139	NP_003130			signal recognition particle receptor						SRP-dependent cotranslational protein targeting to membrane	integral to membrane|signal recognition particle receptor complex	GTP binding|GTPase activity|receptor activity|signal recognition particle binding				0	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)										0.49			28	29				---	---	---	---	capture_indel			Splice_Site_Del	DEL	125643193	125643207	15676	11	TGGAGAAAGAGTATG	-	-	55	55	SRPR	-	5	5
AMBRA1	55626	broad.mit.edu	36	11	46375812	46375814	+	In_Frame_Del	DEL	GTT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:46375812_46375814delGTT	uc001ncv.1	-	c.3668_3670delAAC	c.(3667-3672)CAACTG>CTG	p.Q1223del	AMBRA1_uc009ylc.1_In_Frame_Del_p.Q1191del|AMBRA1_uc001ncu.1_In_Frame_Del_p.Q1130del|AMBRA1_uc001ncw.1_In_Frame_Del_p.Q1101del|AMBRA1_uc001ncx.1_In_Frame_Del_p.Q1160del	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated	1220					autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)										0.62			5	3				---	---	---	---	capture_indel			In_Frame_Del	DEL	46375812	46375814	568	11	GTT	-	-	36	36	AMBRA1	-	5	5
MS4A10	341116	broad.mit.edu	36	11	60318094	60318095	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:60318094_60318095insG	uc001npz.1	+	c.434_435insG	c.(433-435)GATfs	p.D145fs		NM_206893	NP_996776	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member	145	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)	1														0.67			353	172				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	60318094	60318095	10248	11	-	G	G	12	12	MS4A10	G	5	5
TM7SF2	7108	broad.mit.edu	36	11	64639560	64639566	+	Frame_Shift_Del	DEL	TGCTGGT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:64639560_64639566delTGCTGGT	uc001ocv.1	+	c.1073_1079delTGCTGGT	c.(1072-1080)CTGCTGGTGfs	p.L358fs	TM7SF2_uc001oct.1_Frame_Shift_Del_p.L337fs|TM7SF2_uc001ocu.1_Frame_Shift_Del_p.L310fs	NM_003273	NP_003264	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	337_339					cholesterol biosynthetic process|oxidation-reduction process	endoplasmic reticulum membrane|integral to plasma membrane	delta14-sterol reductase activity			ovary(1)	1														0.65			81	44				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	64639560	64639566	16504	11	TGCTGGT	-	-	55	55	TM7SF2	-	5	5
UBC	7316	broad.mit.edu	36	12	123963890	123963900	+	Frame_Shift_Del	DEL	TTCCAGCTGCT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:123963890_123963900delTTCCAGCTGCT	uc001ugs.2	-	c.371_381delAGCAGCTGGAA	c.(370-381)AAGCAGCTGGAAfs	p.K124fs	UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Frame_Shift_Del_p.K124fs|UBC_uc001ugt.2_Frame_Shift_Del_p.K124fs|UBC_uc001ugv.2_Intron|UBC_uc001ugq.2_Frame_Shift_Del_p.K124fs|UBC_uc001ugw.2_5'UTR	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	124_127	Ubiquitin-like 2.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)										0.89			131	16				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	123963890	123963900	17399	12	TTCCAGCTGCT	-	-	56	56	UBC	-	5	5
FAM186B	84070	broad.mit.edu	36	12	48281148	48281152	+	Frame_Shift_Del	DEL	CTTCC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:48281148_48281152delCTTCC	uc001ruo.1	-	c.538_542delGGAAG	c.(538-543)GGAAGAfs	p.G180fs		NM_032130	NP_115506	Q8IYM0	F186B_HUMAN	hypothetical protein LOC84070	180_181						protein complex				ovary(1)	1														0.34			80	156				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48281148	48281152	5722	12	CTTCC	-	-	32	32	FAM186B	-	5	5
RACGAP1	29127	broad.mit.edu	36	12	48685398	48685410	+	Frame_Shift_Del	DEL	TGTGTCACACATG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:48685398_48685410delTGTGTCACACATG	uc001rvt.2	-	c.321_333delCATGTGTGACACA	c.(319-333)CTCATGTGTGACACAfs	p.L107fs	RACGAP1_uc009zlm.1_Frame_Shift_Del_p.L107fs|RACGAP1_uc001rvs.2_Frame_Shift_Del_p.L107fs|RACGAP1_uc001rvu.2_Frame_Shift_Del_p.L107fs	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	107_111	Interaction with SLC26A8.				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1														0.37			68	115				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48685398	48685410	13436	12	TGTGTCACACATG	-	-	51	51	RACGAP1	-	5	5
KRT6B	3854	broad.mit.edu	36	12	51130103	51130104	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:51130103_51130104insA	uc001sak.1	-	c.775_776insT	c.(775-777)AAGfs	p.K259fs		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	259	Coil 1B.|Rod.				ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)										0.63			27	16				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	51130103	51130104	8796	12	-	A	A	56	56	KRT6B	A	5	5
FARP1	10160	broad.mit.edu	36	13	97885838	97885842	+	Frame_Shift_Del	DEL	GGCAG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:97885838_97885842delGGCAG	uc001vnh.1	+	c.2151_2155delGGCAG	c.(2149-2157)TTGGCAGAGfs	p.L717fs	FARP1_uc001vnj.1_Frame_Shift_Del_p.L717fs	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	717_719	DH.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)											0.56			110	88				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	97885838	97885842	5912	13	GGCAG	-	-	47	47	FARP1	-	5	5
MTA1	9112	broad.mit.edu	36	14	105000616	105000616	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:105000616_105000616delG	uc001yqx.1	+	c.993_993delG	c.(991-993)AAGfs	p.K331fs	MTA1_uc001yqy.1_Non-coding_Transcript|MTA1_uc001yrb.1_Frame_Shift_Del_p.K92fs	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein	331	SANT.				regulation of transcription, DNA-dependent|signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)										0.38			5	8				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	105000616	105000616	10301	14	G	-	-	33	33	MTA1	-	5	5
C14orf37	145407	broad.mit.edu	36	14	57675311	57675312	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:57675311_57675312delTA	uc001xdc.1	-	c.518_519delTA	c.(517-519)GTAfs	p.V173fs	C14orf37_uc001xdd.2_Frame_Shift_Del_p.V173fs|C14orf37_uc001xde.1_Frame_Shift_Del_p.V173fs	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407	173	Extracellular (Potential).					integral to membrane	binding				0														0.71			130	54				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	57675311	57675312	1820	14	TA	-	-	53	53	C14orf37	-	5	5
TGM7	116179	broad.mit.edu	36	15	41372274	41372275	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:41372274_41372275delTC	uc001zrf.1	-	c.363_364delGA	c.(361-366)GAGATCfs	p.E121fs		NM_052955	NP_443187	Q96PF1	TGM7_HUMAN	transglutaminase 7	121_122					peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)	2		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)									0.81			22	5				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	41372274	41372275	16363	15	TC	-	-	50	50	TGM7	-	5	5
HERC1	8925	broad.mit.edu	36	15	61753954	61753954	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:61753954_61753954delG	uc002amp.1	-	c.7486_7486delC	c.(7486-7488)CATfs	p.H2496fs		NM_003922	NP_003913	Q15751	HERC1_HUMAN	guanine nucleotide exchange factor p532	2496					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(5)|central_nervous_system(2)|lung(1)|breast(1)	9														0.39			30	46				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	61753954	61753954	7340	15	G	-	-	47	47	HERC1	-	5	5
SNX22	79856	broad.mit.edu	36	15	62231882	62231903	+	Splice_Site_Del	DEL	TCCAGTAGATCAAGAAGCTGTA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:62231882_62231903delTCCAGTAGATCAAGAAGCTGTA	uc002anc.1	+	c.e3_splice_site			SNX22_uc002amz.1_Splice_Site_Del|SNX22_uc002ana.1_3'UTR|SNX22_uc002anb.1_Splice_Site_Del	NM_024798	NP_079074			sorting nexin 22						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0														0.72			31	12				---	---	---	---	capture_indel			Splice_Site_Del	DEL	62231882	62231903	15394	15	TCCAGTAGATCAAGAAGCTGTA	-	-	54	54	SNX22	-	5	5
KIAA1024	23251	broad.mit.edu	36	15	77535880	77535890	+	Frame_Shift_Del	DEL	ACGCAAGAAGG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:77535880_77535890delACGCAAGAAGG	uc002bew.1	+	c.336_346delACGCAAGAAGG	c.(334-348)GTACGCAAGAAGGAGfs	p.V112fs		NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	112_116						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4														0.60			104	68				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	77535880	77535890	8512	15	ACGCAAGAAGG	-	-	14	14	KIAA1024	-	5	5
PCSK6	5046	broad.mit.edu	36	15	99682773	99682774	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:99682773_99682774insC	uc002bxa.1	-	c.2181_2182insG	c.(2179-2184)AGGAAGfs	p.R727fs	PCSK6_uc010bpd.1_Frame_Shift_Ins_p.R523fs|PCSK6_uc002bwy.1_Frame_Shift_Ins_p.R727fs|PCSK6_uc010bpe.1_Frame_Shift_Ins_p.R714fs|PCSK6_uc002bxb.1_Frame_Shift_Ins_p.R714fs	NM_138320	NP_612193	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	727_728	CRM (Cys-rich motif).				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)											0.74			87	30				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	99682773	99682774	12025	15	-	C	C	62	62	PCSK6	C	5	5
MSLNL	401827	broad.mit.edu	36	16	770661	770661	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:770661_770661delC	uc002cjz.1	-	c.341_341delG	c.(340-342)AGCfs	p.S114fs		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	Error:Variant_position_missing_in_Q96KJ4_after_alignment					cell adhesion	integral to membrane				breast(3)|ovary(1)	4														0.65			62	33				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	770661	770661	10275	16	C	-	-	28	28	MSLNL	-	5	5
SMYD4	114826	broad.mit.edu	36	17	1633113	1633116	+	Frame_Shift_Del	DEL	CATG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:1633113_1633116delCATG	uc002ftm.2	-	c.2224_2227delCATG	c.(2224-2229)CATGAGfs	p.H742fs	SMYD4_uc002ftn.1_Frame_Shift_Del_p.H597fs	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	742_743							zinc ion binding			kidney(2)	2														0.78			39	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	1633113	1633116	15324	17	CATG	-	-	29	29	SMYD4	-	5	5
UBTF	7343	broad.mit.edu	36	17	39643326	39643327	+	Frame_Shift_Ins	INS	-	T	T			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:39643326_39643327insT	uc002igb.1	-	c.1400_1401insA	c.(1399-1401)TCGfs	p.S467fs	UBTF_uc002igc.1_Frame_Shift_Ins_p.S430fs|UBTF_uc010czs.1_Frame_Shift_Ins_p.S467fs|UBTF_uc002igd.1_Frame_Shift_Ins_p.S430fs|UBTF_uc010czt.1_Frame_Shift_Ins_p.S467fs|UBTF_uc002ige.2_Frame_Shift_Ins_p.S430fs	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	467	HMG box 4.				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding|RNA polymerase I transcription factor activity				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)								OREG0024456	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.84			27	5				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	39643326	39643327	17467	17	-	T	T	23	23	UBTF	T	5	5
TOB1	10140	broad.mit.edu	36	17	46296129	46296129	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:46296129_46296129delA	uc002isw.1	-	c.249_249delT	c.(247-249)CGTfs	p.R83fs	TOB1_uc002isx.1_Frame_Shift_Del_p.R83fs|TOB1_uc010dbv.1_Frame_Shift_Del_p.R83fs	NM_005749	NP_005740	P50616	TOB1_HUMAN	transducer of ERBB2, 1	83					negative regulation of cell proliferation		SH3/SH2 adaptor activity			large_intestine(1)	1			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			NSCLC(144;643 1919 24513 29423 40686)								0.37			41	70				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	46296129	46296129	16888	17	A	-	-	6	6	TOB1	-	5	5
GPRC5C	55890	broad.mit.edu	36	17	69948340	69948346	+	Frame_Shift_Del	DEL	ACCCCAC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:69948340_69948346delACCCCAC	uc002jkp.1	+	c.965_971delACCCCAC	c.(964-972)GACCCCACGfs	p.D322fs	GPRC5C_uc002jkq.1_Intron|GPRC5C_uc002jkr.1_Frame_Shift_Del_p.D289fs|GPRC5C_uc002jks.1_Frame_Shift_Del_p.D277fs|GPRC5C_uc002jkt.2_Frame_Shift_Del_p.D277fs|GPRC5C_uc002jku.2_5'Flank	NM_022036	NP_071319	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	277_279	Extracellular (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.67			76	37				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	69948340	69948346	7002	17	ACCCCAC	-	-	10	10	GPRC5C	-	5	5
PHF23	79142	broad.mit.edu	36	17	7081665	7081673	+	Splice_Site_Del	DEL	ACCTCACCT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7081665_7081673delACCTCACCT	uc002gfa.1	-	c.e2_splice_site			PHF23_uc010cma.1_Intron	NM_024297	NP_077273			PHD finger protein 23								zinc ion binding				0														0.60			6	4				---	---	---	---	capture_indel			Splice_Site_Del	DEL	7081665	7081673	12258	17	ACCTCACCT	-	-	2	2	PHF23	-	5	5
CHMP6	79643	broad.mit.edu	36	17	76585731	76585732	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:76585731_76585732insC	uc002jyw.2	+	c.490_491insC	c.(490-492)ACTfs	p.T164fs		NM_024591	NP_078867	Q96FZ7	CHMP6_HUMAN	chromatin modifying protein 6	164					cellular membrane organization|endosome transport|protein transport	cytosol|endomembrane system|late endosome membrane	protein N-terminus binding			ovary(1)	1	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)											0.72			41	16				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	76585731	76585732	3494	17	-	C	C	6	6	CHMP6	C	5	5
MYH10	4628	broad.mit.edu	36	17	8324558	8324576	+	Splice_Site_Del	DEL	GCAGCGCGGACCTGGCGGG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:8324558_8324576delGCAGCGCGGACCTGGCGGG	uc002glm.1	-	c.e39_splice_site			MYH10_uc002gll.1_Splice_Site_Del|MYH10_uc010cnx.1_Splice_Site_Del	NM_005964	NP_005955			myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2									p.A1735V(MOLT16-Tumor)|p.S1734S(SJSA1-Tumor)|p.S1734S(HCC1438-Tumor)	971				0.47			9	10				---	---	---	---	capture_indel			Splice_Site_Del	DEL	8324558	8324576	10425	17	GCAGCGCGGACCTGGCGGG	-	-	34	34	MYH10	-	5	5
CACNA1A	773	broad.mit.edu	36	19	13181237	13181237	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:13181237_13181237delA	uc010dzd.1	-	c.6433_6433delT	c.(6433-6435)TCGfs	p.S2145fs	CACNA1A_uc002mwx.2_Frame_Shift_Del_p.S833fs|CACNA1A_uc010dzc.1_Frame_Shift_Del_p.S1665fs|CACNA1A_uc002mwz.2_Frame_Shift_Del_p.S2145fs|CACNA1A_uc002mwy.2_Frame_Shift_Del_p.S2139fs|CACNA1A_uc010dze.1_Frame_Shift_Del_p.S2140fs|CACNA1A_uc002mwv.2_Frame_Shift_Del_p.S644fs	NM_023035	NP_075461	O00555	CAC1A_HUMAN	Voltage-dependent P/Q-type calcium channel subunit alpha-1A (Voltage- gated calcium channel subunit alpha Cav2.1) (Calcium channel, L type, alpha-1 polypeptide isoform 4) (Brain calcium channel I) (BI).	2140	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)									0.73			32	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	13181237	13181237	2654	19	A	-	-	11	11	CACNA1A	-	5	5
EPS15L1	58513	broad.mit.edu	36	19	16374169	16374170	+	Frame_Shift_Del	DEL	CC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:16374169_16374170delCC	uc002ndx.1	-	c.1753_1754delGG	c.(1753-1755)GGCfs	p.G585fs	EPS15L1_uc002ndy.1_Non-coding_Transcript|EPS15L1_uc002ndz.1_Frame_Shift_Del_p.G585fs|EPS15L1_uc002nea.1_Frame_Shift_Del_p.G585fs|EPS15L1_uc010eah.1_Frame_Shift_Del_p.G585fs|EPS15L1_uc002neb.1_Frame_Shift_Del_p.G431fs|EPS15L1_uc002nec.1_Frame_Shift_Del_p.G585fs	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	585					endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)	3														0.57			60	45				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	16374169	16374170	5386	19	CC	-	-	26	26	EPS15L1	-	5	5
PIK3R2	5296	broad.mit.edu	36	19	18134218	18134232	+	In_Frame_Del	DEL	GGAGGAGGTGAACGA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:18134218_18134232delGGAGGAGGTGAACGA	uc002nia.1	+	c.1011_1025delGGAGGAGGTGAACGA	c.(1009-1026)AGGGAGGAGGTGAACGAG>AGG	p.EEVNE338del	PIK3R2_uc002nib.1_Non-coding_Transcript|PIK3R2_uc010ebi.1_Non-coding_Transcript	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	338_342	SH2 1.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|central_nervous_system(1)|pancreas(1)	4									p.N341N(EVSAT-Tumor)	186				0.65			143	78				---	---	---	---	capture_indel			In_Frame_Del	DEL	18134218	18134232	12343	19	GGAGGAGGTGAACGA	-	-	43	43	PIK3R2	-	5	5
CRTC1	23373	broad.mit.edu	36	19	18737206	18737220	+	Splice_Site_Del	DEL	CTCTCTAGGAATGAG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:18737206_18737220delCTCTCTAGGAATGAG	uc010ebv.1	+	c.e10_splice_site			CRTC1_uc002nkb.2_Splice_Site_Del|CRTC1_uc010ebw.1_Splice_Site_Del|CRTC1_uc002nkc.2_Splice_Site_Del	NM_001098482	NP_001091952			mucoepidermoid carcinoma translocated 1 isoform						interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding			ovary(1)|lung(1)|breast(1)	3										173				0.44			24	31				---	---	---	---	capture_indel			Splice_Site_Del	DEL	18737206	18737220	4038	19	CTCTCTAGGAATGAG	-	-	24	24	CRTC1	-	5	5
NR2C2AP	126382	broad.mit.edu	36	19	19174361	19174362	+	In_Frame_Ins	INS	-	TCA	TCA			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:19174361_19174362insTCA	uc002nlx.1	-	c.152_153insTGA	c.(151-153)CTG>CTTGAG	p.52_53insE	NR2C2AP_uc002nly.1_In_Frame_Ins_p.52_53insE	NM_176880	NP_795361	Q86WQ0	NR2CA_HUMAN	TR4 orphan receptor associated protein TRA16	52_53					cell adhesion|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm				ovary(1)	1			Epithelial(12;0.00235)											0.43			78	103				---	---	---	---	capture_indel			In_Frame_Ins	INS	19174361	19174362	11029	19	-	TCA	TCA	21	21	NR2C2AP	TCA	5	5
MIER2	54531	broad.mit.edu	36	19	264510	264527	+	In_Frame_Del	DEL	GGCTTCTCCCTCTGGGAG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:264510_264527delGGCTTCTCCCTCTGGGAG	uc002lok.1	-	c.772_789delCTCCCAGAGGGAGAAGCC	c.(772-789)CTCCCAGAGGGAGAAGCCdel	p.LPEGEA258del		NM_017550	NP_060020	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family	258_263	ELM2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.45			136	165				---	---	---	---	capture_indel			In_Frame_Del	DEL	264510	264527	9971	19	GGCTTCTCCCTCTGGGAG	-	-	39	39	MIER2	-	5	5
PLIN5	440503	broad.mit.edu	36	19	4476721	4476728	+	Frame_Shift_Del	DEL	TGCTCGTA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:4476721_4476728delTGCTCGTA	uc002mas.1	-	c.637_644delTACGAGCA	c.(637-645)TACGAGCACfs	p.Y213fs		NM_001013706	NP_001013728	Q00G26	PLIN5_HUMAN	lipid storage droplet protein 5	213_215						lipid particle					0														0.56			15	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	4476721	4476728	12519	19	TGCTCGTA	-	-	59	59	PLIN5	-	5	5
RUVBL2	10856	broad.mit.edu	36	19	54205554	54205555	+	Splice_Site_Ins	INS	-	A	A			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:54205554_54205555insA	uc002plr.1	+	c.e9_splice_site			RUVBL2_uc002plq.1_Splice_Site_Ins|RUVBL2_uc010emn.1_Splice_Site_Ins|RUVBL2_uc002pls.1_Splice_Site_Ins	NM_006666	NP_006657			RuvB-like 2						DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|protein folding|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|membrane|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|ATP-dependent DNA helicase activity|damaged DNA binding|identical protein binding|unfolded protein binding				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)										0.55			158	127				---	---	---	---	capture_indel			Splice_Site_Ins	INS	54205554	54205555	14233	19	-	A	A	49	49	RUVBL2	A	5	5
ZSCAN22	342945	broad.mit.edu	36	19	63541802	63541822	+	In_Frame_Del	DEL	TCCATACACCTACTCAGGGAA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:63541802_63541822delTCCATACACCTACTCAGGGAA	uc002qsc.1	+	c.774_794delTCCATACACCTACTCAGGGAA	c.(772-795)CCTCCATACACCTACTCAGGGAAG>CCG	p.PYTYSGK259del		NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	259_265					regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)										0.39			89	140				---	---	---	---	capture_indel			In_Frame_Del	DEL	63541802	63541822	18838	19	TCCATACACCTACTCAGGGAA	-	-	54	54	ZSCAN22	-	5	5
ADORA3	140	broad.mit.edu	36	1	111829968	111829970	+	In_Frame_Del	DEL	ATG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:111829968_111829970delATG	uc001ebf.1	-	c.888_890delCAT	c.(886-891)ATCATT>ATT	p.296_297II>I	ADORA3_uc001ebg.2_In_Frame_Del_p.215_216II>I	NM_020683	NP_065734	P33765	AA3R_HUMAN	adenosine A3 receptor isoform 1	33_34	Helical; Name=1; (By similarity).				activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled			ovary(2)|large_intestine(1)	3		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)									0.33			26	54				---	---	---	---	capture_indel			In_Frame_Del	DEL	111829968	111829970	330	1	ATG	-	-	4	4	ADORA3	-	5	5
FCAMR	83953	broad.mit.edu	36	1	205198585	205198603	+	Frame_Shift_Del	DEL	GGGGGTTCACTTCCAGAAA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:205198585_205198603delGGGGGTTCACTTCCAGAAA	uc001hfc.2	-	c.1540_1558delTTTCTGGAAGTGAACCCCC	c.(1540-1560)TTTCTGGAAGTGAACCCCCAAfs	p.F514fs	FCAMR_uc001hfa.2_Frame_Shift_Del_p.F494fs|FCAMR_uc001hfb.2_3'UTR|FCAMR_uc009xca.1_3'UTR	NM_001122980	NP_001116452	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity isoform 2	494_500	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)	1						Ovarian(199;1883 2142 16966 44409 45154)								0.53			48	43				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	205198585	205198603	6009	1	GGGGGTTCACTTCCAGAAA	-	-	47	47	FCAMR	-	5	5
SLC35F3	148641	broad.mit.edu	36	1	232107440	232107484	+	Start_Codon_Del	DEL	TTTGCCTATGGGGATTCGAGAGTTTCCCAGCGGCGCACCCAGGGG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:232107440_232107484delTTTGCCTATGGGGATTCGAGAGTTTCCCAGCGGCGCACCCAGGGG	uc001hvy.1	+					NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)											0.33			3	6				---	---	---	---	capture_indel			Start_Codon_Del	DEL	232107440	232107484	15087	1	TTTGCCTATGGGGATTCGAGAGTTTCCCAGCGGCGCACCCAGGGG	-	-	56	56	SLC35F3	-	5	5
GRHL3	57822	broad.mit.edu	36	1	24545622	24545631	+	Splice_Site_Del	DEL	CCCCACAGGC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:24545622_24545631delCCCCACAGGC	uc001biy.1	+	c.e13_splice_site			GRHL3_uc001bix.1_Splice_Site_Del|GRHL3_uc001biz.1_Splice_Site_Del	NM_021180	NP_067003			sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)										0.75			83	27				---	---	---	---	capture_indel			Splice_Site_Del	DEL	24545622	24545631	7043	1	CCCCACAGGC	-	-	30	30	GRHL3	-	5	5
ZNF692	55657	broad.mit.edu	36	1	247119054	247119055	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:247119054_247119055insA	uc001ifc.1	-	c.77_78insT	c.(76-78)AAGfs	p.K26fs	ZNF692_uc001iez.1_5'Flank|ZNF692_uc001ifa.1_5'Flank|ZNF692_uc001ifb.1_De_novo_Start_OutOfFrame|ZNF692_uc001ifd.1_Frame_Shift_Ins_p.K26fs|ZNF692_uc001ife.1_Non-coding_Transcript|ZNF692_uc001iff.1_Frame_Shift_Ins_p.K26fs|ZNF692_uc009xhc.1_Frame_Shift_Ins_p.K26fs	NM_017865	NP_060335	Q9BU19	ZN692_HUMAN	zinc finger protein 692 isoform 2	26					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)											0.50			8	8				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	247119054	247119055	18692	1	-	A	A	20	20	ZNF692	A	5	5
SPOCD1	90853	broad.mit.edu	36	1	32029385	32029392	+	Frame_Shift_Del	DEL	CCCTTCCT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:32029385_32029392delCCCTTCCT	uc001bts.1	-	c.3050_3057delAGGAAGGG	c.(3049-3057)AAGGAAGGGfs	p.K1017fs	SPOCD1_uc001btr.1_3'UTR|SPOCD1_uc001btt.2_Frame_Shift_Del_p.K309fs|SPOCD1_uc001btu.2_Frame_Shift_Del_p.K1004fs|SPOCD1_uc001btv.2_Frame_Shift_Del_p.K497fs	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	1017_1019										ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)										0.71			113	47				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	32029385	32029392	15591	1	CCCTTCCT	-	-	26	26	SPOCD1	-	5	5
CSMD2	114784	broad.mit.edu	36	1	33962427	33962427	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:33962427_33962427delG	uc001bxm.1	-	c.2958_2958delC	c.(2956-2958)AACfs	p.N986fs	CSMD2_uc001bxn.1_Frame_Shift_Del_p.N946fs	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	946	Extracellular (Potential).|CUB 6.					integral to membrane|plasma membrane	protein binding			ovary(5)|pancreas(1)	6		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)												0.73			77	28				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	33962427	33962427	4086	1	G	-	-	48	48	CSMD2	-	5	5
RIMKLA	284716	broad.mit.edu	36	1	42648262	42648263	+	Frame_Shift_Ins	INS	-	T	T			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:42648262_42648263insT	uc001chi.2	+	c.379_380insT	c.(379-381)AGAfs	p.R127fs		NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family	168	ATP-grasp.|ATP (By similarity).				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0														0.40			21	31				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	42648262	42648263	13842	1	-	T	T	3	3	RIMKLA	T	5	5
FAM73A	374986	broad.mit.edu	36	1	78111333	78111360	+	Frame_Shift_Del	DEL	CCTAGCCTGGGGCTTTTTGGGTCCTAGA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:78111333_78111360delCCTAGCCTGGGGCTTTTTGGGTCCTAGA	uc001dhx.1	+	c.1620_1647delCCTAGCCTGGGGCTTTTTGGGTCCTAGA	c.(1618-1647)GTCCTAGCCTGGGGCTTTTTGGGTCCTAGAfs	p.V540fs		NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986	540_549						integral to membrane				ovary(1)	1				Colorectal(170;0.226)										0.35			56	103				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	78111333	78111360	5841	1	CCTAGCCTGGGGCTTTTTGGGTCCTAGA	-	-	30	30	FAM73A	-	5	5
SAMD11	148398	broad.mit.edu	36	1	855557	855559	+	In_Frame_Del	DEL	CAC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:855557_855559delCAC	uc001abw.1	+	c.232_234delCAC	c.(232-234)CACdel	p.H78del	SAMD11_uc001abv.1_In_Frame_Del_p.H78del	NM_152486	NP_689699	Q96NU1	SAM11_HUMAN	sterile alpha motif domain containing 11	78						nucleus					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.74e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000472)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)										0.71			5	2				---	---	---	---	capture_indel			In_Frame_Del	DEL	855557	855559	14296	1	CAC	-	-	25	25	SAMD11	-	5	5
SLC2A5	6518	broad.mit.edu	36	1	9021149	9021150	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:9021149_9021150insG	uc001apo.1	-	c.1101_1102insC	c.(1099-1104)GACACAfs	p.D367fs		NM_003039	NP_003030	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated	367_368	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)										0.78			247	69				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	9021149	9021150	15045	1	-	G	G	59	59	SLC2A5	G	5	5
MTF2	22823	broad.mit.edu	36	1	93371868	93371868	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:93371868_93371868delA	uc009wdj.1	+	c.1181_1181delA	c.(1180-1182)GAAfs	p.E394fs	MTF2_uc001dpj.2_Frame_Shift_Del_p.E292fs|MTF2_uc009wdk.1_Frame_Shift_Del_p.E337fs|MTF2_uc001dpi.2_Frame_Shift_Del_p.E121fs|MTF2_uc001dpl.2_Frame_Shift_Del_p.E292fs|MTF2_uc001dpm.2_Frame_Shift_Del_p.E63fs	NM_007358	NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription	394						nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)										0.43			3	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	93371868	93371868	10316	1	A	-	-	9	9	MTF2	-	5	5
POFUT1	23509	broad.mit.edu	36	20	30279729	30279734	+	In_Frame_Del	DEL	TTTCTC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:30279729_30279734delTTTCTC	uc002wxp.1	+	c.545_550delTTTCTC	c.(544-552)TTTTCTCCA>TCA	p.182_184FSP>S		NM_015352	NP_056167	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1 isoform 1	182_184					fucose metabolic process|Notch signaling pathway|O-glycan processing|regulation of transcription, DNA-dependent	endoplasmic reticulum|membrane	peptide-O-fucosyltransferase activity			breast(1)	1			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)											0.34			235	449				---	---	---	---	capture_indel			In_Frame_Del	DEL	30279729	30279734	12611	20	TTTCTC	-	-	64	64	POFUT1	-	5	5
RALY	22913	broad.mit.edu	36	20	32128278	32128280	+	In_Frame_Del	DEL	TCC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:32128278_32128280delTCC	uc002xab.1	+	c.654_656delTCC	c.(652-657)AATCCA>AAA	p.218_219NP>K	RALY_uc002xac.1_In_Frame_Del_p.202_203NP>K|RALY_uc002xad.1_Non-coding_Transcript|RALY_uc002xae.1_In_Frame_Del_p.218_219NP>K	NM_016732	NP_057951	Q9UKM9	RALY_HUMAN	RNA binding protein (autoantigenic,	218_219					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1														0.86			60	10				---	---	---	---	capture_indel			In_Frame_Del	DEL	32128278	32128280	13479	20	TCC	-	-	50	50	RALY	-	5	5
DDX27	55661	broad.mit.edu	36	20	47280153	47280154	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:47280153_47280154delTG	uc002xuh.1	+	c.984_985delTG	c.(982-987)GATGTGfs	p.D328fs		NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	328_329	Helicase ATP-binding.					nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)											0.90			183	20				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	47280153	47280154	4525	20	TG	-	-	51	51	DDX27	-	5	5
C20orf196	149840	broad.mit.edu	36	20	5792023	5792029	+	Frame_Shift_Del	DEL	TCTTTGG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:5792023_5792029delTCTTTGG	uc002wmf.1	+	c.532_538delTCTTTGG	c.(532-540)TCTTTGGATfs	p.S178fs		NM_152504	NP_689717	Q8IYI0	CT196_HUMAN	hypothetical protein LOC149840	178_180											0														0.35			53	100				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	5792023	5792029	2179	20	TCTTTGG	-	-	50	50	C20orf196	-	5	5
TPD52L2	7165	broad.mit.edu	36	20	61987827	61987827	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:61987827_61987827delC	uc002ygy.1	+	c.491_491delC	c.(490-492)TCAfs	p.S164fs	TPD52L2_uc002ygz.1_Intron|TPD52L2_uc002yha.1_Frame_Shift_Del_p.S144fs|TPD52L2_uc002yhb.1_Intron|TPD52L2_uc002yhc.1_Intron|TPD52L2_uc002yhd.1_Intron|TPD52L2_uc002yhe.1_Intron	NM_199360	NP_955392	O43399	TPD54_HUMAN	tumor protein D52-like 2 isoform a	157					regulation of cell proliferation	perinuclear region of cytoplasm	protein binding|protein homodimerization activity			ovary(1)	1	all_cancers(38;1.3e-12)|all_epithelial(29;2.23e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)													0.47			232	264				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	61987827	61987827	16943	20	C	-	-	29	29	TPD52L2	-	5	5
CLDN5	7122	broad.mit.edu	36	22	17891719	17891720	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:17891719_17891720insC	uc002zpu.1	-	c.59_60insG	c.(58-60)GGTfs	p.G20fs	CLDN5_uc010grr.1_Frame_Shift_Ins_p.G20fs	NM_003277	NP_003268	O00501	CLD5_HUMAN	claudin 5	20	Helical; (Potential).				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity				0	Colorectal(54;0.0993)													0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	17891719	17891720	3625	22	-	C	C	10	10	CLDN5	C	5	5
HMOX1	3162	broad.mit.edu	36	22	34109218	34109223	+	Splice_Site_Del	DEL	AGGTAT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:34109218_34109223delAGGTAT	uc003ant.1	+	c.e2_splice_site				NM_002133	NP_002124			heme oxygenase (decyclizing) 1						angiogenesis|anti-apoptosis|cell death|cellular iron ion homeostasis|endothelial cell proliferation|erythrocyte homeostasis|excretion|heme catabolic process|heme oxidation|intracellular protein kinase cascade|low-density lipoprotein particle clearance|negative regulation of leukocyte migration|negative regulation of smooth muscle cell proliferation|positive regulation of chemokine biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of smooth muscle cell proliferation|positive regulation of vasodilation|protein homooligomerization|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hydrogen peroxide|response to nicotine|smooth muscle hyperplasia|transmembrane transport|wound healing involved in inflammatory response	endoplasmic reticulum membrane|extracellular space|microsome	enzyme binding|heme binding|heme oxygenase (decyclizing) activity|protein homodimerization activity|signal transducer activity			ovary(1)	1					NADH(DB00157)									0.52			197	180				---	---	---	---	capture_indel			Splice_Site_Del	DEL	34109218	34109223	7535	22	AGGTAT	-	-	3	3	HMOX1	-	5	5
MYH9	4627	broad.mit.edu	36	22	35021513	35021537	+	Frame_Shift_Del	DEL	CAGCTGTGGAATCCAGCGTGTCCTC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:35021513_35021537delCAGCTGTGGAATCCAGCGTGTCCTC	uc003apg.1	-	c.3445_3469delGAGGACACGCTGGATTCCACAGCTG	c.(3445-3471)GAGGACACGCTGGATTCCACAGCTGCCfs	p.E1149fs		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1149_1157	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	10										1624				0.83			137	28				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	35021513	35021537	10437	22	CAGCTGTGGAATCCAGCGTGTCCTC	-	-	25	25	MYH9	-	5	5
EP300	2033	broad.mit.edu	36	22	39853650	39853651	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:39853650_39853651delAA	uc003azl.2	+	c.1120_1121delAA	c.(1120-1122)AATfs	p.N374fs		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	374	TAZ-type 1.			TMKNVL->NAAIRS: Inhibits interaction with HIF1A. Reduces interaction with CITED2.	apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|histone acetyltransferase activity|transcription coactivator activity|zinc ion binding			central_nervous_system(5)|upper_aerodigestive_tract(3)|pancreas(2)|ovary(1)|lung(1)	12										1103				0.83			124	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	39853650	39853651	5341	22	AA	-	-	9	9	EP300	-	5	5
EP300	2033	broad.mit.edu	36	22	39888674	39888684	+	Frame_Shift_Del	DEL	ACAATAAATAA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:39888674_39888684delACAATAAATAA	uc003azl.2	+	c.3673_3683delACAATAAATAA	c.(3673-3684)ACAATAAATAAAfs	p.T1225fs		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1225_1228					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|histone acetyltransferase activity|transcription coactivator activity|zinc ion binding			central_nervous_system(5)|upper_aerodigestive_tract(3)|pancreas(2)|ovary(1)|lung(1)	12										1103				0.54			65	56				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	39888674	39888684	5341	22	ACAATAAATAA	-	-	14	14	EP300	-	5	5
TOB2	10766	broad.mit.edu	36	22	40162473	40162487	+	In_Frame_Del	DEL	CCGCATCAAAGAAGA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:40162473_40162487delCCGCATCAAAGAAGA	uc003azz.1	-	c.809_823delTCTTCTTTGATGCGG	c.(808-825)CTCTTCTTTGATGCGGCC>CCC	p.270_275LFFDAA>P	TOB2_uc003baa.2_In_Frame_Del_p.270_275LFFDAA>P	NM_016272	NP_057356	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	270_275					female gamete generation|negative regulation of cell proliferation	cytoplasm|nucleus				ovary(1)	1														0.41			9	13				---	---	---	---	capture_indel			In_Frame_Del	DEL	40162473	40162487	16889	22	CCGCATCAAAGAAGA	-	-	26	26	TOB2	-	5	5
ARSA	410	broad.mit.edu	36	22	49412506	49412507	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:49412506_49412507insG	uc003bnb.2	-	c.412_413insC	c.(412-414)CATfs	p.H138fs	ARSA_uc003bna.2_Frame_Shift_Ins_p.H54fs|ARSA_uc003bnc.2_Frame_Shift_Ins_p.H138fs|ARSA_uc003bnd.2_Frame_Shift_Ins_p.H138fs|ARSA_uc003bmz.2_Frame_Shift_Ins_p.H138fs|ARSA_uc010hbf.1_Frame_Shift_Ins_p.H138fs	NM_001085426	NP_001078897	P15289	ARSA_HUMAN	arylsulfatase A isoform a precursor	138						lysosome	arylsulfatase activity|calcium ion binding|cerebroside-sulfatase activity			pancreas(1)|skin(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)									0.32			10	21				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	49412506	49412507	1005	22	-	G	G	51	51	ARSA	G	5	5
FASTKD2	22868	broad.mit.edu	36	2	207339823	207339825	+	In_Frame_Del	DEL	TTC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:207339823_207339825delTTC	uc002vbx.1	+	c.161_163delTTC	c.(160-165)GTTCAT>GAT	p.54_55VH>D	FASTKD2_uc002vbu.1_In_Frame_Del_p.38_39VH>D|FASTKD2_uc002vbv.1_In_Frame_Del_p.38_39VH>D|FASTKD2_uc002vbw.1_In_Frame_Del_p.38_39VH>D|MDH1B_uc002vbs.1_5'Flank|MDH1B_uc010fui.1_5'Flank|MDH1B_uc010fuj.1_5'Flank|MDH1B_uc002vbt.1_5'Flank	NM_014929	NP_055744	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	54_55					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)	2				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)										0.32			99	213				---	---	---	---	capture_indel			In_Frame_Del	DEL	207339823	207339825	5922	2	TTC	-	-	60	60	FASTKD2	-	5	5
ABCB6	10058	broad.mit.edu	36	2	219783900	219783901	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219783900_219783901delCT	uc002vkc.1	-	c.2142_2143delAG	c.(2140-2145)GAAGGGfs	p.E714fs	ABCB6_uc010fwe.1_Frame_Shift_Del_p.E668fs	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	714_715	ABC transporter.				cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|cadmium ion transmembrane transporter activity|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.39			92	144				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	219783900	219783901	46	2	CT	-	-	24	24	ABCB6	-	5	5
ECEL1	9427	broad.mit.edu	36	2	233056443	233056451	+	In_Frame_Del	DEL	TTGATGTCT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:233056443_233056451delTTGATGTCT	uc002vsv.2	-	c.1425_1433delAGACATCAA	c.(1423-1434)GAAGACATCAAG>GAG	p.DIK476del	ECEL1_uc010fya.1_In_Frame_Del_p.DIK476del|ECEL1_uc010fyb.1_In_Frame_Del_p.DIK183del	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	476_478	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)										0.50			9	9				---	---	---	---	capture_indel			In_Frame_Del	DEL	233056443	233056451	5078	2	TTGATGTCT	-	-	56	56	ECEL1	-	5	5
EMILIN1	11117	broad.mit.edu	36	2	27159982	27159983	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:27159982_27159983delCA	uc002rii.2	+	c.2039_2040delCA	c.(2038-2040)GCAfs	p.A680fs	EMILIN1_uc002rik.2_5'UTR	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	680					cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.76			133	43				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	27159982	27159983	5285	2	CA	-	-	25	25	EMILIN1	-	5	5
EMILIN1	11117	broad.mit.edu	36	2	27160174	27160175	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:27160174_27160175delTG	uc002rii.2	+	c.2231_2232delTG	c.(2230-2232)CTGfs	p.L744fs	EMILIN1_uc002rik.2_5'UTR|KHK_uc002ril.2_5'Flank|KHK_uc002rim.2_5'Flank|KHK_uc002rin.2_5'Flank|KHK_uc002rio.2_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	744	Potential.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.89			59	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	27160174	27160175	5285	2	TG	-	-	55	55	EMILIN1	-	5	5
EHD3	30845	broad.mit.edu	36	2	31311083	31311091	+	In_Frame_Del	DEL	GCAAGCTGC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:31311083_31311091delGCAAGCTGC	uc002rnu.1	+	c.92_100delGCAAGCTGC	c.(91-102)AGCAAGCTGCTG>ATG	p.31_34SKLL>M	CAPN14_uc002rnt.1_5'Flank	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	31_34					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)													0.69			20	9				---	---	---	---	capture_indel			In_Frame_Del	DEL	31311083	31311091	5168	2	GCAAGCTGC	-	-	34	34	EHD3	-	5	5
GPR128	84873	broad.mit.edu	36	3	101896322	101896322	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:101896322_101896322delC	uc003duc.1	+	c.2181_2181delC	c.(2179-2181)TTCfs	p.F727fs	GPR128_uc003dud.1_Frame_Shift_Del_p.F250fs	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	727	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						Pancreas(87;185 1975 7223 18722)								0.32			18	39				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	101896322	101896322	6915	3	C	-	-	30	30	GPR128	-	5	5
KNG1	3827	broad.mit.edu	36	3	187918140	187918148	+	In_Frame_Del	DEL	GCTGCTCTG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:187918140_187918148delGCTGCTCTG	uc010hyt.1	+	c.115_123delGCTGCTCTG	c.(115-123)GCTGCTCTGdel	p.AAL39del	KNG1_uc003fqr.1_In_Frame_Del_p.AAL39del	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	39_41	Cystatin 1.				blood coagulation, intrinsic pathway|diuresis|elevation of cytosolic calcium ion concentration|inflammatory response|natriuresis|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding				0	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)									0.76			63	20				---	---	---	---	capture_indel			In_Frame_Del	DEL	187918140	187918148	8741	3	GCTGCTCTG	-	-	46	46	KNG1	-	5	5
ATP13A3	79572	broad.mit.edu	36	3	195650648	195650649	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:195650648_195650649delCT	uc003fty.2	-	c.976_977delAG	c.(976-978)AGTfs	p.S326fs	ATP13A3_uc003ftz.1_Frame_Shift_Del_p.S32fs	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	326					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)										0.72			18	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	195650648	195650649	1144	3	CT	-	-	20	20	ATP13A3	-	5	5
LARS2	23395	broad.mit.edu	36	3	45564025	45564035	+	Stop_Codon_Del	DEL	GACAGCCAGGA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:45564025_45564035delGACAGCCAGGA	uc003cop.1	+				LARS2_uc010hit.1_Stop_Codon_Del	NM_015340	NP_056155			leucyl-tRNA synthetase 2, mitochondrial						leucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|leucine-tRNA ligase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)									0.45			226	278				---	---	---	---	capture_indel			Stop_Codon_Del	DEL	45564025	45564035	8958	3	GACAGCCAGGA	-	-	45	45	LARS2	-	5	5
IL17RB	55540	broad.mit.edu	36	3	53874073	53874074	+	Frame_Shift_Ins	INS	-	TC	TC			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:53874073_53874074insTC	uc003dha.1	+	c.1207_1208insTC	c.(1207-1209)GTGfs	p.V403fs		NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor	403	Cytoplasmic (Potential).|SEFIR.				defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)										0.74			663	239				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	53874073	53874074	7941	3	-	TC	TC	48	48	IL17RB	TC	5	5
LARP7	51574	broad.mit.edu	36	4	113787233	113787234	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:113787233_113787234insG	uc003iaz.1	+	c.365_366insG	c.(364-366)CTGfs	p.L122fs	LARP7_uc003iay.1_Frame_Shift_Ins_p.L115fs|LARP7_uc003iba.1_Frame_Shift_Ins_p.L36fs|LARP7_uc003ibb.1_Frame_Shift_Ins_p.L115fs	NM_016648	NP_057732	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	115	HTH La-type RNA-binding.				RNA processing	nucleoplasm|ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(3)	3		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	113787233	113787234	8956	4	-	G	G	55	55	LARP7	G	5	5
WFS1	7466	broad.mit.edu	36	4	6353517	6353532	+	Frame_Shift_Del	DEL	TCCAGGACAGCAAGGC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:6353517_6353532delTCCAGGACAGCAAGGC	uc003gix.1	+	c.1094_1109delTCCAGGACAGCAAGGC	c.(1093-1110)TTCCAGGACAGCAAGGCCfs	p.F365fs	WFS1_uc003giy.1_Frame_Shift_Del_p.F365fs|WFS1_uc003giz.1_Frame_Shift_Del_p.F183fs	NM_006005	NP_005996	O76024	WFS1_HUMAN	wolframin	365_370					endoplasmic reticulum calcium ion homeostasis|endoplasmic reticulum unfolded protein response|ER overload response|ER-associated protein catabolic process|glucose homeostasis|kidney development|negative regulation of neuron apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|polyubiquitinated misfolded protein transport|positive regulation of calcium ion transport|positive regulation of growth|positive regulation of protein ubiquitination|positive regulation of proteolysis|protein maturation by protein folding|protein stabilization|renal water homeostasis|sensory perception of sound|visual perception	dendrite|integral to endoplasmic reticulum membrane	activating transcription factor binding|ATPase binding|transporter activity|ubiquitin protein ligase binding			central_nervous_system(2)	2				Colorectal(103;0.0512)										0.87			112	17				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	6353517	6353532	17934	4	TCCAGGACAGCAAGGC	-	-	62	62	WFS1	-	5	5
PDE6B	5158	broad.mit.edu	36	4	653874	653880	+	Frame_Shift_Del	DEL	CTTCAAC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:653874_653880delCTTCAAC	uc003gap.1	+	c.2543_2549delCTTCAAC	c.(2542-2550)TCTTCAACCfs	p.S848fs	PDE6B_uc003gao.2_Frame_Shift_Del_p.S847fs	NM_000283	NP_000274	P35913	PDE6B_HUMAN	rod cGMP-phosphodiesterase beta-subunit isoform	848_850					cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						GBM(71;463 1194 9848 25922 46834)								0.54			57	48				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	653874	653880	12067	4	CTTCAAC	-	-	32	32	PDE6B	-	5	5
DPYSL3	1809	broad.mit.edu	36	5	146760555	146760557	+	In_Frame_Del	DEL	TGC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:146760555_146760557delTGC	uc003loo.2	-	c.1343_1345delGCA	c.(1342-1347)TGCACC>TCC	p.448_449CT>S	DPYSL3_uc003lon.1_In_Frame_Del_p.334_335CT>S	NM_001387	NP_001378	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	334_335					axon guidance|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)											0.71			72	30				---	---	---	---	capture_indel			In_Frame_Del	DEL	146760555	146760557	4932	5	TGC	-	-	59	59	DPYSL3	-	5	5
DOCK2	1794	broad.mit.edu	36	5	169014065	169014069	+	Splice_Site_Del	DEL	GGAGG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:169014065_169014069delGGAGG	uc003maf.1	+	c.e2_splice_site				NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)											0.41			7	10				---	---	---	---	capture_indel			Splice_Site_Del	DEL	169014065	169014069	4871	5	GGAGG	-	-	47	47	DOCK2	-	5	5
DOCK2	1794	broad.mit.edu	36	5	169033947	169033968	+	Frame_Shift_Del	DEL	GCTTCTCTCAGGAACCTTACCC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:169033947_169033968delGCTTCTCTCAGGAACCTTACCC	uc003maf.1	+	c.390_411delGCTTCTCTCAGGAACCTTACCC	c.(388-411)CAGCTTCTCTCAGGAACCTTACCCfs	p.Q130fs		NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	130_137					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)											0.42			32	44				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	169033947	169033968	4871	5	GCTTCTCTCAGGAACCTTACCC	-	-	34	34	DOCK2	-	5	5
UNC5A	90249	broad.mit.edu	36	5	176239075	176239094	+	Frame_Shift_Del	DEL	CCAGAAACTCCACCTGGACA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:176239075_176239094delCCAGAAACTCCACCTGGACA	uc003mey.1	+	c.2343_2362delCCAGAAACTCCACCTGGACA	c.(2341-2364)GCCCAGAAACTCCACCTGGACAGCfs	p.A781fs		NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1	781_788	Death.|Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane					0	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.74			52	18				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	176239075	176239094	17549	5	CCAGAAACTCCACCTGGACA	-	-	22	22	UNC5A	-	5	5
RUFY1	80230	broad.mit.edu	36	5	178969052	178969053	+	Frame_Shift_Ins	INS	-	CACC	CACC			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:178969052_178969053insCACC	uc003mka.1	+	c.2053_2054insCACC	c.(2053-2055)TACfs	p.Y685fs	RUFY1_uc003mkb.1_Frame_Shift_Ins_p.Y577fs|RUFY1_uc003mkc.1_Frame_Shift_Ins_p.Y577fs|RUFY1_uc003mkd.1_Frame_Shift_Ins_p.Y287fs	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a	685	FYVE-type.				endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.49			36	38				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	178969052	178969053	14218	5	-	CACC	CACC	53	53	RUFY1	CACC	5	5
PELO	53918	broad.mit.edu	36	5	52132087	52132091	+	Frame_Shift_Del	DEL	GGTGG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:52132087_52132091delGGTGG	uc003jos.1	+	c.102_106delGGTGG	c.(100-108)CAGGTGGGCfs	p.Q34fs	ITGA1_uc003jov.1_Intron|ITGA1_uc003jou.1_Intron|PELO_uc003jot.1_Intron	NM_015946	NP_057030	Q9BRX2	PELO_HUMAN	pelota homolog	34_36					cell cycle|cell division|translation	cytoplasm|nucleus	endonuclease activity|metal ion binding|protein binding				0		Lung NSC(810;4.94e-05)|Breast(144;0.0848)												0.32			28	60				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	52132087	52132091	12145	5	GGTGG	-	-	35	35	PELO	-	5	5
MAP3K1	4214	broad.mit.edu	36	5	56213437	56213437	+	Frame_Shift_Del	DEL	T	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:56213437_56213437delT	uc003jqw.2	+	c.2653_2653delT	c.(2653-2655)TTGfs	p.L885fs		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	885				DGQQDSFLQASVPNNYLETTENSSP -> QRQQHNSFCRHL FPTTIWKPQRTVPL (in Ref. 2; AAC97073).	cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)						201				0.56			258	201				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	56213437	56213437	9626	5	T	-	-	56	56	MAP3K1	-	5	5
RHOBTB3	22836	broad.mit.edu	36	5	95093409	95093412	+	Frame_Shift_Del	DEL	AAGC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:95093409_95093412delAAGC	uc003klm.1	+	c.93_96delAAGC	c.(91-96)AGAAGCfs	p.R31fs	RHOBTB3_uc003klk.1_5'UTR|RHOBTB3_uc003kll.2_Frame_Shift_Del_p.R31fs	NM_014899	NP_055714	O94955	RHBT3_HUMAN	rho-related BTB domain containing 3	31_32	Rho-like.				retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)	1		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)										0.87			135	20				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	95093409	95093412	13810	5	AAGC	-	-	9	9	RHOBTB3	-	5	5
ULBP1	80329	broad.mit.edu	36	6	150331646	150331647	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:150331646_150331647insG	uc003qnp.1	+	c.296_297insG	c.(295-297)GATfs	p.D99fs		NM_025218	NP_079494	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1	99	MHC class I alpha-1 like.				antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|endoplasmic reticulum|MHC class I protein complex	MHC class I receptor activity			pancreas(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)										0.36			101	178				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	150331646	150331647	17530	6	-	G	G	12	12	ULBP1	G	5	5
SYNE1	23345	broad.mit.edu	36	6	152731907	152731914	+	Frame_Shift_Del	DEL	TCAGCCTG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:152731907_152731914delTCAGCCTG	uc010kiw.1	-	c.9693_9700delCAGGCTGA	c.(9691-9702)AACAGGCTGAAAfs	p.N3231fs	SYNE1_uc003qot.2_Frame_Shift_Del_p.N3238fs|SYNE1_uc003qou.2_Frame_Shift_Del_p.N3231fs|SYNE1_uc010kja.1_5'UTR|SYNE1_uc003qov.2_Frame_Shift_Del_p.N309fs	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3231_3234	Spectrin 6.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|ovary(8)|large_intestine(5)|pancreas(2)	30		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)										0.52			105	98				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	152731907	152731914	15966	6	TCAGCCTG	-	-	62	62	SYNE1	-	5	5
ITPR3	3710	broad.mit.edu	36	6	33738293	33738301	+	In_Frame_Del	DEL	TGCGGCTGT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:33738293_33738301delTGCGGCTGT	uc010jvc.1	+	c.722_730delTGCGGCTGT	c.(721-732)GTGCGGCTGTTC>GTC	p.RLF242del		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	242_244	MIR 3.|Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			central_nervous_system(5)|ovary(3)|lung(1)|kidney(1)	10														0.86			527	89				---	---	---	---	capture_indel			In_Frame_Del	DEL	33738293	33738301	8226	6	TGCGGCTGT	-	-	59	59	ITPR3	-	5	5
DNAH8	1769	broad.mit.edu	36	6	38971959	38971960	+	Frame_Shift_Ins	INS	-	TC	TC			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:38971959_38971960insTC	uc003ooe.1	+	c.8269_8270insTC	c.(8269-8271)GTAfs	p.V2757fs		NM_001371	NP_001362	Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy polypeptide 8	2757					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(5)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	17										2979				0.37			201	345				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	38971959	38971960	4790	6	-	TC	TC	36	36	DNAH8	TC	5	5
NCR2	9436	broad.mit.edu	36	6	41412059	41412060	+	Frame_Shift_Ins	INS	-	TG	TG			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:41412059_41412060insTG	uc003oqh.2	+	c.309_310insTG	c.(307-312)GACTCAfs	p.D103fs	NCR2_uc003oqi.2_Frame_Shift_Ins_p.D103fs|NCR2_uc003oqj.2_Frame_Shift_Ins_p.D103fs	NM_004828	NP_004819	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	103_104	Extracellular (Potential).|Ig-like.				cellular defense response	integral to plasma membrane	transmembrane receptor activity			ovary(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)													0.53			52	46				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	41412059	41412060	10637	6	-	TG	TG	20	20	NCR2	TG	5	5
MDFI	4188	broad.mit.edu	36	6	41725524	41725525	+	Frame_Shift_Del	DEL	CC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:41725524_41725525delCC	uc003oqp.2	+	c.449_450delCC	c.(448-450)TCCfs	p.S150fs	MDFI_uc003oqq.2_Frame_Shift_Del_p.S150fs|MDFI_uc010jxn.1_Frame_Shift_Del_p.S150fs	NM_005586	NP_005577	Q99750	MDFI_HUMAN	MyoD family inhibitor	150					activation of JUN kinase activity|cytoplasmic sequestering of transcription factor|dorsal/ventral axis specification|negative regulation of DNA binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of Wnt receptor signaling pathway	cytoplasm|nucleus					0	Ovarian(28;0.0327)|Colorectal(47;0.121)		Colorectal(64;0.0123)|COAD - Colon adenocarcinoma(64;0.0264)|KIRC - Kidney renal clear cell carcinoma(1;0.138)											0.54			15	13				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	41725524	41725525	9793	6	CC	-	-	30	30	MDFI	-	5	5
MET	4233	broad.mit.edu	36	7	116209316	116209317	+	Frame_Shift_Ins	INS	-	T	T			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:116209316_116209317insT	uc010lkh.1	+	c.3615_3616insT	c.(3613-3618)CAAGTAfs	p.Q1205fs	MET_uc003vij.1_Frame_Shift_Ins_p.Q1187fs	NM_001127500	NP_001120972	P08581	MET_HUMAN	met proto-oncogene isoform a precursor	1187_1188	Protein kinase.|Cytoplasmic (Potential).		V -> L (in RCCP; germline mutation).		axon guidance|cell proliferation|protein phosphorylation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|NS(3)|large_intestine(2)|testis(1)|breast(1)	148	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)							299				0.52			45	41				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	116209316	116209317	9874	7	-	T	T	3	3	MET	T	5	5
ZMIZ2	83637	broad.mit.edu	36	7	44762552	44762557	+	In_Frame_Del	DEL	TGGTTC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:44762552_44762557delTGGTTC	uc003tlr.1	+	c.54_59delTGGTTC	c.(52-60)GATGGTTCA>GAA	p.18_20DGS>E	ZMIZ2_uc003tlq.1_In_Frame_Del_p.18_20DGS>E|ZMIZ2_uc003tls.1_In_Frame_Del_p.18_20DGS>E	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1	18_20					positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						NSCLC(20;604 852 1948 16908 50522)								0.36			35	63				---	---	---	---	capture_indel			In_Frame_Del	DEL	44762552	44762557	18288	7	TGGTTC	-	-	51	51	ZMIZ2	-	5	5
KIAA0146	23514	broad.mit.edu	36	8	48670966	48670966	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:48670966_48670966delC	uc003xqd.1	+	c.1138_1138delC	c.(1138-1140)CTGfs	p.L380fs	KIAA0146_uc010lxs.1_Intron|KIAA0146_uc003xqe.1_5'UTR|KIAA0146_uc003xqf.1_Non-coding_Transcript|KIAA0146_uc010lxt.1_Frame_Shift_Del_p.L69fs	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	380											0		Lung NSC(58;0.175)												0.54			31	26				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48670966	48670966	8464	8	C	-	-	32	32	KIAA0146	-	5	5
AGPAT2	10555	broad.mit.edu	36	9	138691401	138691406	+	In_Frame_Del	DEL	CCATGA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:138691401_138691406delCCATGA	uc004cii.1	-	c.320_325delTCATGG	c.(319-327)CTCATGGAG>CAG	p.107_109LME>Q	AGPAT2_uc004cij.1_In_Frame_Del_p.107_109LME>Q	NM_006412	NP_006403	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	107_109					phosphatidic acid biosynthetic process|positive regulation of cytokine production|positive regulation of cytokine-mediated signaling pathway|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)										0.72			33	13				---	---	---	---	capture_indel			In_Frame_Del	DEL	138691401	138691406	390	9	CCATGA	-	-	30	30	AGPAT2	-	5	5
PSIP1	11168	broad.mit.edu	36	9	15480046	15480050	+	Frame_Shift_Del	DEL	CTTTT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:15480046_15480050delCTTTT	uc003zlv.2	-	c.222_226delAAAAG	c.(220-228)AGAAAAGGTfs	p.R74fs	PSIP1_uc003zlw.2_Frame_Shift_Del_p.R74fs|PSIP1_uc003zlz.2_Frame_Shift_Del_p.R74fs|PSIP1_uc003zma.2_Frame_Shift_Del_p.R74fs|PSIP1_uc003zly.2_Frame_Shift_Del_p.R74fs	NM_033222	NP_150091	O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1 isoform 2	74_76					initiation of viral infection|interspecies interaction between organisms|provirus integration|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	DNA binding				0				GBM - Glioblastoma multiforme(50;2.38e-06)					p.R74fs(OE19-Tumor)	239				0.35			6	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	15480046	15480050	13116	9	CTTTT	-	-	24	24	PSIP1	-	5	5
CCDC107	203260	broad.mit.edu	36	9	35650898	35650907	+	Frame_Shift_Del	DEL	TCTCTGAAAC	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:35650898_35650907delTCTCTGAAAC	uc003zxi.1	+	c.566_575delTCTCTGAAAC	c.(565-576)GTCTCTGAAACTfs	p.V189fs	C9orf100_uc003zxl.2_Non-coding_Transcript|C9orf100_uc003zxm.1_3'UTR|RMRP_uc003zxh.1_5'Flank|CCDC107_uc010mky.1_Intron|CCDC107_uc003zxj.1_Intron|CCDC107_uc003zxk.1_3'UTR	NM_174923	NP_777583	Q8WV48	CC107_HUMAN	coiled-coil domain containing 107	189_192						integral to membrane					0	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)											0.59			17	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	35650898	35650907	2862	9	TCTCTGAAAC	-	-	58	58	CCDC107	-	5	5
KANK1	23189	broad.mit.edu	36	9	703430	703441	+	In_Frame_Del	DEL	TGACTTCCAGAA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:703430_703441delTGACTTCCAGAA	uc003zgl.1	+	c.2664_2675delTGACTTCCAGAA	c.(2662-2676)CCTGACTTCCAGAAA>CCA	p.DFQK889del	KANK1_uc003zgm.2_In_Frame_Del_p.DFQK889del|KANK1_uc003zgn.1_In_Frame_Del_p.DFQK889del|KANK1_uc003zgo.1_In_Frame_Del_p.DFQK889del|KANK1_uc003zgp.1_In_Frame_Del_p.DFQK889del|KANK1_uc003zgq.2_In_Frame_Del_p.DFQK731del|KANK1_uc003zgr.1_In_Frame_Del_p.DFQK731del|KANK1_uc003zgs.1_In_Frame_Del_p.DFQK731del	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a	889_892					negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)										0.58			602	435				---	---	---	---	capture_indel			In_Frame_Del	DEL	703430	703441	8280	9	TGACTTCCAGAA	-	-	55	55	KANK1	-	5	5
PTPRD	5789	broad.mit.edu	36	9	8476073	8476081	+	In_Frame_Del	DEL	TCTGGAATG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:8476073_8476081delTCTGGAATG	uc003zkk.1	-	c.2736_2744delCATTCCAGA	c.(2734-2745)TCCATTCCAGAA>TCA	p.IPE913del	PTPRD_uc003zkp.1_Intron|PTPRD_uc003zkq.1_Intron|PTPRD_uc003zkr.1_Intron|PTPRD_uc003zks.1_Intron|PTPRD_uc003zkl.1_In_Frame_Del_p.IPE904del|PTPRD_uc003zkm.1_In_Frame_Del_p.IPE900del|PTPRD_uc003zko.1_Intron|PTPRD_uc003zkn.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	913_915	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(10)|large_intestine(3)|ovary(2)|urinary_tract(1)	16		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)						1253	TSP Lung(15;0.13)			0.32			149	318				---	---	---	---	capture_indel			In_Frame_Del	DEL	8476073	8476081	13256	9	TCTGGAATG	-	-	62	62	PTPRD	-	5	5
DAPK1	1612	broad.mit.edu	36	9	89450642	89450649	+	Frame_Shift_Del	DEL	TCCTTTGT	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:89450642_89450649delTCCTTTGT	uc004apc.1	+	c.1024_1031delTCCTTTGT	c.(1024-1032)TCCTTTGTGfs	p.S342fs	DAPK1_uc004apd.1_Frame_Shift_Del_p.S342fs|DAPK1_uc004ape.1_Frame_Shift_Del_p.S143fs|DAPK1_uc004apf.1_5'Flank	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	342_344					apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade|protein phosphorylation	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2										862				0.31			150	339				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	89450642	89450649	4402	9	TCCTTTGT	-	-	54	54	DAPK1	-	5	5
WNK2	65268	broad.mit.edu	36	9	95033040	95033055	+	Frame_Shift_Del	DEL	TGCCGGCAGATCCTGA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:95033040_95033055delTGCCGGCAGATCCTGA	uc004ati.1	+	c.904_919delTGCCGGCAGATCCTGA	c.(904-921)TGCCGGCAGATCCTGAAGfs	p.C302fs	WNK2_uc010mrc.1_Frame_Shift_Del_p.C302fs|WNK2_uc004atj.1_Frame_Shift_Del_p.C302fs|WNK2_uc010mrd.1_5'UTR	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	302_307	Protein kinase.				intracellular protein kinase cascade|protein phosphorylation		ATP binding|protein binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|large_intestine(1)|central_nervous_system(1)	7										1420				0.43			97	131				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	95033040	95033055	17952	9	TGCCGGCAGATCCTGA	-	-	59	59	WNK2	-	5	5
IRS4	8471	broad.mit.edu	36	X	107863431	107863435	+	Frame_Shift_Del	DEL	GTGTA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:107863431_107863435delGTGTA	uc004eoc.1	-	c.2796_2800delTACAC	c.(2794-2802)AATACACCAfs	p.N932fs		NM_003604	NP_003595	O14654	IRS4_HUMAN	insulin receptor substrate 4	932_934						plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity			ovary(4)|large_intestine(2)|lung(1)|breast(1)|pancreas(1)	9														0.31			172	391				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	107863431	107863435	8146	23	GTGTA	-	-	44	44	IRS4	-	5	5
MAGEC1	9947	broad.mit.edu	36	X	140823366	140823368	+	In_Frame_Del	DEL	CCA	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:140823366_140823368delCCA	uc004fbt.1	+	c.2510_2512delCCA	c.(2509-2514)TCCACT>TCT	p.T838del	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	838							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)													0.80			126	31				---	---	---	---	capture_indel			In_Frame_Del	DEL	140823366	140823368	9561	23	CCA	-	-	30	30	MAGEC1	-	5	5
SSX7	280658	broad.mit.edu	36	X	52700599	52700599	+	De_novo_Start_OutOfFrame	DEL	A	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:52700599_52700599delA	uc004dqx.1	-	c.-82_-82delT	c.(-84--80)ATTGG>ATGG			NM_173358	NP_775494			synovial sarcoma, X breakpoint 7						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0	Ovarian(276;0.236)													1.00			9	0				---	---	---	---	capture_indel			De_novo_Start_OutOfFrame	DEL	52700599	52700599	15727	23	A	-	-	5	5	SSX7	-	5	5
FAM155B	27112	broad.mit.edu	36	X	68666498	68666504	+	Frame_Shift_Del	DEL	GAGGAGG	-	-			TCGA-12-0829-01	TCGA-12-0829-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:68666498_68666504delGAGGAGG	uc004dxk.1	+	c.1393_1399delGAGGAGG	c.(1393-1401)GAGGAGGGCfs	p.E465fs		NM_015686	NP_056501	O75949	F155B_HUMAN	transmembrane protein 28	466_468						integral to membrane				ovary(1)|breast(1)	2														0.49			17	18				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	68666498	68666504	5664	23	GAGGAGG	-	-	33	33	FAM155B	-	5	5
