Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
CAMK2G	818	broad.mit.edu	36	10	75302797	75302797	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0812-01	TCGA-14-0812-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:75302797T>C	uc001jvv.1	-	c.92A>G	c.(91-93)GAG>GGG	p.E31G	CAMK2G_uc001jvm.1_Missense_Mutation_p.E39G|CAMK2G_uc001jvo.1_Missense_Mutation_p.E39G|CAMK2G_uc001jvq.1_Missense_Mutation_p.E39G|CAMK2G_uc001jvr.1_Missense_Mutation_p.E39G|CAMK2G_uc001jvp.1_Missense_Mutation_p.E39G|CAMK2G_uc001jvs.1_Missense_Mutation_p.E39G|CAMK2G_uc001jvt.1_Non-coding_Transcript|CAMK2G_uc001jvu.1_Missense_Mutation_p.E39G	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	39	Protein kinase.				insulin secretion|interferon-gamma-mediated signaling pathway|protein phosphorylation|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)	1	Prostate(51;0.0112)									423				0.28	11.803444	12.899808	7	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75302797	75302797	2719	10	T	C	C	54	54	CAMK2G	C	4	4
PDE6C	5146	broad.mit.edu	36	10	95390243	95390243	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0812-01	TCGA-14-0812-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:95390243T>C	uc001kiu.2	+	c.1676T>C	c.(1675-1677)GTC>GCC	p.V559A		NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha	559					visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)	3		Colorectal(252;0.123)												0.083437	21.819699	163.463426	67	736	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95390243	95390243	12068	10	T	C	C	58	58	PDE6C	C	4	4
ABCC8	6833	broad.mit.edu	36	11	17390848	17390848	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:17390848G>A	uc001mnc.1	-	c.2497C>T	c.(2497-2499)CAA>TAA	p.Q833*		NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	833	ABC transporter 1.|Cytoplasmic (By similarity).				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)									0.204545	19.656962	23.217318	9	35	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	17390848	17390848	59	11	G	A	A	45	45	ABCC8	A	5	2
TYR	7299	broad.mit.edu	36	11	88564165	88564165	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:88564165A>G	uc001pcs.1	+	c.967A>G	c.(967-969)AGT>GGT	p.S323G		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	323	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|oxidation-reduction process|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)									0.252632	134.21491	144.768744	48	142	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88564165	88564165	17370	11	A	G	G	11	11	TYR	G	4	4
KIF21A	55605	broad.mit.edu	36	12	38000026	38000026	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:38000026C>A	uc001rly.1	-	c.3728G>T	c.(3727-3729)AGG>ATG	p.R1243M	KIF21A_uc001rlv.1_Missense_Mutation_p.R248M|KIF21A_uc001rlw.1_Missense_Mutation_p.R560M|KIF21A_uc001rlx.1_Missense_Mutation_p.R1230M|KIF21A_uc001rlz.1_Missense_Mutation_p.R1207M|KIF21A_uc001rlu.1_De_novo_Start_InFrame	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1243					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|lung(1)|pancreas(1)	6		Lung NSC(34;0.179)|all_lung(34;0.213)												0.147059	8.05059	12.12163	5	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38000026	38000026	8599	12	C	A	A	24	24	KIF21A	A	3	3
OR9K2	441639	broad.mit.edu	36	12	53810071	53810071	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:53810071G>T	uc001sgq.1	+	c.252G>T	c.(250-252)ATG>ATT	p.M84I		NM_001005243	NP_001005243	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K,	84	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2														0.47014	1191.876945	1192.487951	370	417	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53810071	53810071	11665	12	G	T	T	48	48	OR9K2	T	3	3
RB1	5925	broad.mit.edu	36	13	47928487	47928487	+	Splice_Site_SNP	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:47928487G>A	uc001vcb.1	+	c.e19_splice_site				NM_000321	NP_000312			retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|transcription repressor activity|ubiquitin protein ligase binding	p.?(1)		lung(93)|eye(89)|central_nervous_system(47)|bone(22)|breast(20)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|soft_tissue(8)|prostate(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	355		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)			6		568	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.296296	21.187582	22.190792	8	19	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	47928487	47928487	13559	13	G	A	A	44	44	RB1	A	5	2
PCDH17	27253	broad.mit.edu	36	13	57106526	57106526	+	Silent	SNP	C	T	T			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:57106526C>T	uc001vhq.1	+	c.1845C>T	c.(1843-1845)AGC>AGT	p.S615S	PCDH17_uc010aec.1_Silent_p.S615S	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	615	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(2)|pancreas(2)	4		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		Melanoma(72;952 1291 1619 12849 33676)								0.428571	6.322565	6.353747	3	4	CC		KEEP	---	---	---	---	capture			Silent	SNP	57106526	57106526	11932	13	C	T	T	27	27	PCDH17	T	1	1
C15orf55	256646	broad.mit.edu	36	15	32436808	32436808	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:32436808C>T	uc001zif.1	+	c.3223C>T	c.(3223-3225)CGA>TGA	p.R1075*		NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	1075						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)						408				0.295455	99.731284	104.640527	39	93	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	32436808	32436808	1853	15	C	T	T	27	27	C15orf55	T	5	1
NR2F2	7026	broad.mit.edu	36	15	94678669	94678669	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:94678669C>T	uc002btq.1	+	c.803C>T	c.(802-804)CCG>CTG	p.P268L	NR2F2_uc002btp.1_Missense_Mutation_p.P135L	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	268	Interaction with ZFPM2 (By similarity).|Ligand-binding (By similarity).				lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of gene-specific transcription|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene-specific transcription|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|promoter binding|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription activator activity|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)	2	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)											0.192982	22.598802	27.611069	11	46	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94678669	94678669	11033	15	C	T	T	23	23	NR2F2	T	1	1
KRT12	3859	broad.mit.edu	36	17	36276912	36276912	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36276912G>A	uc002hvk.2	-	c.53C>T	c.(52-54)TCC>TTC	p.S18F		NM_000223	NP_000214	Q99456	K1C12_HUMAN	keratin 12	18	Head.				visual perception	intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)												0.285714	21.511016	22.972315	10	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36276912	36276912	8764	17	G	A	A	41	41	KRT12	A	2	2
KRT31	3881	broad.mit.edu	36	17	36804681	36804681	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36804681G>A	uc002hwn.1	-	c.1042C>T	c.(1042-1044)CGG>TGG	p.R348W	KRT31_uc010cxn.1_Missense_Mutation_p.R348W	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31	348	Coil 2.|Rod.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)												0.405488	405.937766	408.489526	133	195	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36804681	36804681	8782	17	G	A	A	39	39	KRT31	A	1	1
TBX21	30009	broad.mit.edu	36	17	43176664	43176664	+	Silent	SNP	C	A	A			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:43176664C>A	uc002ilv.1	+	c.873C>A	c.(871-873)ATC>ATA	p.I291I		NM_013351	NP_037483	Q9UL17	TBX21_HUMAN	T-box 21	291	T-box.				multicellular organismal development|regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0														0.181319	61.567638	78.944013	33	149	CC		KEEP	---	---	---	---	capture			Silent	SNP	43176664	43176664	16183	17	C	A	A	32	32	TBX21	A	3	3
HEATR6	63897	broad.mit.edu	36	17	55489458	55489458	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0812-01	TCGA-14-0812-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:55489458T>G	uc002iyk.1	-	c.1812A>C	c.(1810-1812)CAA>CAC	p.Q604H	HEATR6_uc010ddk.1_Missense_Mutation_p.Q143H	NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	604							binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)											0.210526	7.084913	8.566091	4	15	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55489458	55489458	7316	17	T	G	G	60	60	HEATR6	G	4	4
SSTR2	6752	broad.mit.edu	36	17	68677295	68677295	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:68677295A>C	uc002jje.1	+	c.242A>C	c.(241-243)TAC>TCC	p.Y81S	SSTR2_uc010dfi.1_Missense_Mutation_p.Y81S	NM_001050	NP_001041	P30874	SSR2_HUMAN	somatostatin receptor 2	81	Helical; Name=2; (Potential).				digestion|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	PDZ domain binding|somatostatin receptor activity				0			LUSC - Lung squamous cell carcinoma(166;0.197)											0.594595	1147.302315	1151.640726	330	225	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68677295	68677295	15714	17	A	C	C	14	14	SSTR2	C	4	4
UBE2O	63893	broad.mit.edu	36	17	71904306	71904306	+	Silent	SNP	A	C	C			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71904306A>C	uc002jrm.2	-	c.2307T>G	c.(2305-2307)CCT>CCG	p.P769P	UBE2O_uc002jrn.2_Silent_p.P769P|UBE2O_uc002jrl.2_Silent_p.P373P	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	769					post-translational protein modification		ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5										583				0.206897	8.730779	11.045825	6	23	AA		KEEP	---	---	---	---	capture			Silent	SNP	71904306	71904306	17425	17	A	C	C	7	7	UBE2O	C	4	4
MFSD6L	162387	broad.mit.edu	36	17	8641583	8641583	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:8641583G>T	uc002glp.1	-	c.1581C>A	c.(1579-1581)TGC>TGA	p.C527*		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	527	Helical; (Potential).					integral to membrane					0														0.26087	13.739171	14.930225	6	17	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	8641583	8641583	9926	17	G	T	T	34	34	MFSD6L	T	5	3
C18orf34	374864	broad.mit.edu	36	18	28808552	28808552	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0812-01	TCGA-14-0812-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr18:28808552T>A	uc002kxn.2	-	c.2480A>T	c.(2479-2481)CAG>CTG	p.Q827L	C18orf34_uc010dme.1_Missense_Mutation_p.Q291L|C18orf34_uc010dmf.1_Missense_Mutation_p.Q147L|C18orf34_uc002kxo.2_Missense_Mutation_p.Q789L|C18orf34_uc002kxp.2_Missense_Mutation_p.Q827L	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	827										ovary(1)	1														0.246154	40.565804	44.381717	16	49	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28808552	28808552	1963	18	T	A	A	55	55	C18orf34	A	4	4
ELAVL3	1995	broad.mit.edu	36	19	11426584	11426584	+	Silent	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:11426584G>A	uc002mry.1	-	c.861C>T	c.(859-861)TTC>TTT	p.F287F	ELAVL3_uc002mrx.1_Silent_p.F280F	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1	287	RRM 3.				cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)	2														0.217949	35.239095	40.956946	17	61	GG		KEEP	---	---	---	---	capture			Silent	SNP	11426584	11426584	5242	19	G	A	A	37	37	ELAVL3	A	1	1
EGLN2	112398	broad.mit.edu	36	19	46004982	46004982	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:46004982C>T	uc010ehd.1	+	c.1063C>T	c.(1063-1065)CGG>TGG	p.R355W	EGLN2_uc002opg.2_Missense_Mutation_p.R355W|EGLN2_uc002oph.1_Missense_Mutation_p.R355W|EGLN2_uc002opi.1_Missense_Mutation_p.R355W	NM_080732	NP_542770	Q96KS0	EGLN2_HUMAN	EGL nine (C.elegans) homolog 2	355	Fe2OG dioxygenase.				cell redox homeostasis|estrogen receptor signaling pathway|oxidation-reduction process|positive regulation of protein catabolic process|regulation of cell growth|response to hypoxia	cytoplasm|nucleus	ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|oxygen sensor activity			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)							OREG0025478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.320099	317.099105	328.707249	129	274	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46004982	46004982	5158	19	C	T	T	27	27	EGLN2	T	1	1
KLK4	9622	broad.mit.edu	36	19	56103648	56103648	+	Silent	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56103648G>A	uc002pua.1	-	c.474C>T	c.(472-474)AAC>AAT	p.N158N	KLK4_uc002pty.1_Silent_p.N109N|KLK4_uc002ptz.1_Non-coding_Transcript|KLK4_uc002pub.1_Silent_p.N63N|KLK4_uc002puc.1_Non-coding_Transcript|KLK4_uc010eoi.1_Silent_p.N63N|KLK4_uc002pud.1_Silent_p.N63N	NM_004917	NP_004908	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4 preproprotein	158	Peptidase S1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)										0.282443	97.423982	102.992663	37	94	GG		KEEP	---	---	---	---	capture			Silent	SNP	56103648	56103648	8720	19	G	A	A	40	40	KLK4	A	1	1
ATP13A2	23400	broad.mit.edu	36	1	17195228	17195228	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:17195228C>T	uc001baa.1	-	c.1372G>A	c.(1372-1374)GTA>ATA	p.V458I	ATP13A2_uc001bab.1_Missense_Mutation_p.V453I|ATP13A2_uc001bac.1_Missense_Mutation_p.V453I|ATP13A2_uc009vpa.1_Missense_Mutation_p.V134I|ATP13A2_uc001bad.1_Missense_Mutation_p.V171I	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	458	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)										0.294118	8.159257	8.810456	5	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17195228	17195228	1143	1	C	T	T	17	17	ATP13A2	T	2	2
NID1	4811	broad.mit.edu	36	1	234272188	234272188	+	Silent	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:234272188G>A	uc001hxo.1	-	c.780C>T	c.(778-780)GTC>GTT	p.V260V	NID1_uc009xgd.1_Silent_p.V260V	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	260	NIDO.				bioluminescence|cell-matrix adhesion|protein-chromophore linkage	basement membrane|membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)									0.235294	38.86796	43.224743	16	52	GG		KEEP	---	---	---	---	capture			Silent	SNP	234272188	234272188	10815	1	G	A	A	33	33	NID1	A	2	2
SLC12A5	57468	broad.mit.edu	36	20	44113878	44113878	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:44113878G>A	uc002xrb.1	+	c.2339G>A	c.(2338-2340)CGC>CAC	p.R780H		NM_020708	NP_065759	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	803					potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)									0.341463	37.626678	38.542371	14	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44113878	44113878	14881	20	G	A	A	38	38	SLC12A5	A	1	1
MX1	4599	broad.mit.edu	36	21	41730921	41730921	+	Silent	SNP	T	A	A			TCGA-14-0812-01	TCGA-14-0812-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr21:41730921T>A	uc002yzh.1	+	c.408T>A	c.(406-408)GCT>GCA	p.A136A	MX1_uc002yzi.1_Silent_p.A136A|MX1_uc010goq.1_Silent_p.A136A	NM_002462	NP_002453	P20591	MX1_HUMAN	myxovirus resistance protein 1	136					induction of apoptosis|response to virus|type I interferon-mediated signaling pathway	cytosol	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)												0.127869	28.290524	69.55051	39	266	TT		KEEP	---	---	---	---	capture			Silent	SNP	41730921	41730921	10391	21	T	A	A	56	56	MX1	A	4	4
MICALL1	85377	broad.mit.edu	36	22	36666730	36666730	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36666730C>A	uc003aui.1	+	c.2539C>A	c.(2539-2541)CTG>ATG	p.L847M		NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13	847						cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)													0.100952	40.58112	124.043294	53	472	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36666730	36666730	9963	22	C	A	A	20	20	MICALL1	A	3	3
SOX10	6663	broad.mit.edu	36	22	36703949	36703949	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36703949A>G	uc003aun.1	-	c.568T>C	c.(568-570)TGC>CGC	p.C190R	POLR2F_uc003aum.1_Intron|SOX10_uc003auo.1_Missense_Mutation_p.C190R	NM_006941	NP_008872	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	190						cytoplasm|nucleus	identical protein binding|RNA polymerase II transcription factor activity|transcription coactivator activity				0	Melanoma(58;0.045)					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)				67				0.238095	8.362476	9.681919	5	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36703949	36703949	15441	22	A	G	G	6	6	SOX10	G	4	4
PDCL3	79031	broad.mit.edu	36	2	100554602	100554602	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:100554602C>A	uc002tao.2	+	c.487C>A	c.(487-489)CTG>ATG	p.L163M		NM_024065	NP_076970	Q9H2J4	PDCL3_HUMAN	phosducin-like 3	163					apoptosis|interspecies interaction between organisms	cytoplasm	protein binding				0														0.151967	199.702822	285.205199	112	625	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100554602	100554602	12049	2	C	A	A	32	32	PDCL3	A	3	3
TMEFF2	23671	broad.mit.edu	36	2	192767431	192767431	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:192767431A>T	uc002utc.1	-	c.65T>A	c.(64-66)CTG>CAG	p.L22Q	TMEFF2_uc002utd.1_Missense_Mutation_p.L22Q	NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two	22						extracellular region|integral to membrane				pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			Pancreas(50;1277 1381 28487 47072)								0.706897	132.389482	134.610571	41	17	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	192767431	192767431	16544	2	A	T	T	7	7	TMEFF2	T	4	4
CCL20	6364	broad.mit.edu	36	2	228388435	228388435	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:228388435G>C	uc002vpl.1	+	c.98G>C	c.(97-99)TGT>TCT	p.C33S	CCL20_uc002vpm.1_Missense_Mutation_p.C32S	NM_004591	NP_004582	P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20 isoform 1	33					cell-cell signaling|chemotaxis|defense response to bacterium|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity				0		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)										0.294118	15.46944	16.113602	5	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	228388435	228388435	3017	2	G	C	C	48	48	CCL20	C	3	3
XDH	7498	broad.mit.edu	36	2	31415883	31415883	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:31415883G>C	uc002rnv.1	-	c.3750C>G	c.(3748-3750)AAC>AAG	p.N1250K		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	1250					oxidation-reduction process|purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	Colon(66;682 1445 30109 40147)								0.204545	91.001965	105.257338	36	140	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31415883	31415883	18007	2	G	C	C	48	48	XDH	C	3	3
C2orf51	200523	broad.mit.edu	36	2	88609697	88609697	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:88609697G>A	uc002stb.1	+	c.133G>A	c.(133-135)GAT>AAT	p.D45N		NM_152670	NP_689883	Q96LM6	TSC21_HUMAN	chromosome 2 open reading frame 51	45						nucleus					0														0.32967	90.720256	93.059835	30	61	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88609697	88609697	2261	2	G	A	A	37	37	C2orf51	A	1	1
GPR149	344758	broad.mit.edu	36	3	155630015	155630015	+	Silent	SNP	C	T	T			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:155630015C>T	uc003faa.1	-	c.84G>A	c.(82-84)CCG>CCA	p.P28P		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	28	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)											0.567164	120.355597	120.61897	38	29	CC		KEEP	---	---	---	---	capture			Silent	SNP	155630015	155630015	6929	3	C	T	T	27	27	GPR149	T	1	1
PRICKLE2	166336	broad.mit.edu	36	3	64107585	64107585	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:64107585G>A	uc003dmf.1	-	c.1621C>T	c.(1621-1623)CGG>TGG	p.R541W		NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2	541						cytoplasm|nuclear membrane	zinc ion binding			ovary(4)	4		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)										0.24	41.818673	46.443564	18	57	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64107585	64107585	12930	3	G	A	A	37	37	PRICKLE2	A	1	1
NPY5R	4889	broad.mit.edu	36	4	164492206	164492206	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:164492206A>G	uc003iqn.1	+	c.1331A>G	c.(1330-1332)CAT>CGT	p.H444R	NPY5R_uc003iqo.2_Missense_Mutation_p.H444R	NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	444	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane					0	all_hematologic(180;0.166)	Prostate(90;0.109)				Melanoma(139;1287 1774 9781 19750 25599)								0.189655	26.491271	31.715325	11	47	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	164492206	164492206	11015	4	A	G	G	8	8	NPY5R	G	4	4
TRIM36	55521	broad.mit.edu	36	5	114494210	114494210	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:114494210G>A	uc003kqs.1	-	c.1810C>T	c.(1810-1812)CCC>TCC	p.P604S	TRIM36_uc003kqt.1_Missense_Mutation_p.P449S	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	604	B30.2/SPRY.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)						304				0.241525	139.285816	153.652306	57	179	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114494210	114494210	17054	5	G	A	A	41	41	TRIM36	A	2	2
HCN1	348980	broad.mit.edu	36	5	45298309	45298309	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:45298309C>G	uc003jok.1	-	c.2144G>C	c.(2143-2145)CGA>CCA	p.R715P		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	715	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1														0.333333	13.468482	13.838252	5	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45298309	45298309	7278	5	C	G	G	31	31	HCN1	G	3	3
SRF	6722	broad.mit.edu	36	6	43254042	43254042	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43254042G>A	uc003oui.1	+	c.1195G>A	c.(1195-1197)GTG>ATG	p.V399M		NM_003131	NP_003122	P11831	SRF_HUMAN	serum response factor (c-fos serum response	399					angiogenesis involved in wound healing|cell migration involved in sprouting angiogenesis|cellular senescence|heart looping|muscle cell homeostasis|neuron development|positive regulation of cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of smooth muscle cell differentiation|response to cytokine stimulus|response to hormone stimulus|response to toxin|trophectodermal cell differentiation	endoplasmic reticulum	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|serum response element binding|specific RNA polymerase II transcription factor activity|transcription factor binding			ovary(1)|central_nervous_system(1)	2			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)							101				0.260417	66.06927	71.034026	25	71	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43254042	43254042	15657	6	G	A	A	40	40	SRF	A	1	1
HTR1B	3351	broad.mit.edu	36	6	78229728	78229728	+	Missense_Mutation	SNP	A	C	C			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:78229728A>C	uc003pil.1	-	c.112T>G	c.(112-114)TAC>GAC	p.Y38D		NM_000863	NP_000854	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B	38	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cAMP biosynthetic process|synaptic transmission	integral to plasma membrane	protein binding|serotonin receptor activity				0		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Dexfenfluramine(DB01191)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Pindolol(DB00960)|Propranolol(DB00571)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Venlafaxine(DB00285)|Zolmitriptan(DB00315)									0.153846	7.021324	11.499712	6	33	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78229728	78229728	7737	6	A	C	C	15	15	HTR1B	C	4	4
LHFPL3	375612	broad.mit.edu	36	7	103756693	103756693	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:103756693A>G	uc003vce.1	+	c.230A>G	c.(229-231)CAC>CGC	p.H77R	LHFPL3_uc003vcf.1_Missense_Mutation_p.H77R	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	63						integral to membrane					0														0.5	8.092653	8.092653	4	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103756693	103756693	9092	7	A	G	G	6	6	LHFPL3	G	4	4
TXNDC3	51314	broad.mit.edu	36	7	37873928	37873928	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:37873928G>A	uc003tfn.1	+	c.721G>A	c.(721-723)GAA>AAA	p.E241K		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	241	NDK 1.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						Ovarian(108;903 1537 27096 29907 47400)								0.196429	101.784833	121.012137	44	180	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37873928	37873928	17354	7	G	A	A	37	37	TXNDC3	A	1	1
ZDHHC4	55146	broad.mit.edu	36	7	6594930	6594930	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:6594930G>A	uc003sqh.1	+	c.899G>A	c.(898-900)CGT>CAT	p.R300H	ZDHHC4_uc003sqi.1_Missense_Mutation_p.R300H|ZDHHC4_uc003sqj.1_Missense_Mutation_p.R300H|ZDHHC4_uc003sqk.1_Missense_Mutation_p.R300H|ZDHHC4_uc003sql.1_Missense_Mutation_p.R300H|ZDHHC4_uc003sqm.1_Missense_Mutation_p.R300H|ZDHHC4_uc003sqn.1_Missense_Mutation_p.R300H|C7orf26_uc003sqo.1_5'Flank|C7orf26_uc003sqp.1_5'Flank|C7orf26_uc003sqq.1_5'Flank	NM_018106	NP_060576	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	300						integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)										0.258503	94.889355	102.654123	38	109	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6594930	6594930	18205	7	G	A	A	40	40	ZDHHC4	A	1	1
MIOS	54468	broad.mit.edu	36	7	7579418	7579419	+	Missense_Mutation	DNP	TT	AG	AG			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:7579418_7579419TT>AG	uc003srf.1	+	c.787_788TT>AG	c.(787-789)TTG>AGG	p.L263R	MIOS_uc010ktp.1_Missense_Mutation_p.L263R	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	263											0														0.126316	7.62785	20.601063	12	83	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	7579418	7579419	9979	7	TT	AG	AG	52	52	MIOS	AG	4	4
SLC25A13	10165	broad.mit.edu	36	7	95613863	95613863	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:95613863C>A	uc003uog.2	-	c.1396G>T	c.(1396-1398)GGT>TGT	p.G466C	SLC25A13_uc003uof.2_Missense_Mutation_p.G465C	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 (citrin)	465	Solcar 2.				ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)	3	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)									0.114583	23.716723	51.829161	22	170	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95613863	95613863	14972	7	C	A	A	21	21	SLC25A13	A	3	3
TBC1D2	55357	broad.mit.edu	36	9	100003750	100003751	+	Missense_Mutation	DNP	GA	TT	TT			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:100003750_100003751GA>TT	uc004ayq.1	-	c.2288_2289TC>AA	c.(2287-2289)CTC>CAA	p.L763Q	TBC1D2_uc004ayo.2_Missense_Mutation_p.L763Q|TBC1D2_uc004ayp.1_Missense_Mutation_p.L303Q|TBC1D2_uc004ayr.1_Missense_Mutation_p.L545Q	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	763	Rab-GAP TBC.					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)										0.25	11.706439	13.302943	7	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	100003750	100003751	16130	9	GA	TT	TT	41	41	TBC1D2	TT	3	3
EPB41L4B	54566	broad.mit.edu	36	9	111057750	111057750	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0812-01	TCGA-14-0812-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:111057750C>T	uc004bdz.1	-	c.1031G>A	c.(1030-1032)CGG>CAG	p.R344Q	EPB41L4B_uc004bea.1_Missense_Mutation_p.R344Q	NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	344	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)	2														0.445946	103.562801	103.75135	33	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111057750	111057750	5349	9	C	T	T	23	23	EPB41L4B	T	1	1
PTPN3	5774	broad.mit.edu	36	9	111222529	111222529	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0812-01	TCGA-14-0812-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:111222529G>T	uc004bed.1	-	c.1309C>A	c.(1309-1311)CAA>AAA	p.Q437K	PTPN3_uc004beb.1_Missense_Mutation_p.Q306K|PTPN3_uc004bec.1_Missense_Mutation_p.Q261K|PTPN3_uc010mtu.1_Non-coding_Transcript|PTPN3_uc010mtv.1_5'Flank	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	437					negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3														0.5	106.599017	106.599017	32	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111222529	111222529	13246	9	G	T	T	47	47	PTPN3	T	3	3
FLNA	2316	broad.mit.edu	36	X	153245680	153245680	+	Silent	SNP	A	G	G			TCGA-14-0812-01	TCGA-14-0812-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153245680A>G	uc004fkk.2	-	c.2184T>C	c.(2182-2184)AAT>AAC	p.N728N	FLNA_uc010nuu.1_Silent_p.N728N	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	728	Filamin 5.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	actin cytoskeleton|cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)									518				0.272727	9.735689	10.764774	6	16	AA		KEEP	---	---	---	---	capture			Silent	SNP	153245680	153245680	6175	23	A	G	G	8	8	FLNA	G	4	4
CYorf15A	246126	broad.mit.edu	36	Y	20208545	20208545	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0812-01	TCGA-14-0812-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrY:20208545T>C	uc004fud.2	+	c.47T>C	c.(46-48)TTG>TCG	p.L16S	CYorf15A_uc004fuc.2_Non-coding_Transcript	NM_001005852	NP_001005852	Q9BZA5	CY15A_HUMAN	hypothetical protein LOC246126	16											0														0.3	6.519928	6.878096	3	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20208545	20208545	4377	24	T	C	C	63	63	CYorf15A	C	4	4
NTAN1	123803	broad.mit.edu	36	16	15040002	15040011	+	Frame_Shift_Del	DEL	CCTATACGAA	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:15040002_15040011delCCTATACGAA	uc002ddd.1	-	c.674_683delTTCGTATAGG	c.(673-684)CTTCGTATAGGAfs	p.L225fs	PDXDC1_uc002ddc.2_Intron	NM_173474	NP_775745	Q96AB6	NTAN1_HUMAN	N-terminal Asn amidase	225_228						cytoplasm					0														0.31			120	263				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	15040002	15040011	11100	16	CCTATACGAA	-	-	30	30	NTAN1	-	5	5
TP53	7157	broad.mit.edu	36	17	7518240	7518242	+	In_Frame_Del	DEL	TGA	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7518240_7518242delTGA	uc002gim.2	-	c.764_766delTCA	c.(763-768)ATCACA>ACA	p.I255del	TP53_uc002gig.1_In_Frame_Del_p.I255del|TP53_uc002gih.1_In_Frame_Del_p.I255del|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_In_Frame_Del_p.I123del|TP53_uc010cng.1_In_Frame_Del_p.I123del|TP53_uc002gii.1_In_Frame_Del_p.I123del|TP53_uc010cnh.1_In_Frame_Del_p.I255del|TP53_uc010cni.1_In_Frame_Del_p.I255del|TP53_uc002gij.2_In_Frame_Del_p.I255del|TP53_uc010cnj.1_Non-coding_Transcript|TP53_uc002gin.2_In_Frame_Del_p.I162del|TP53_uc002gio.2_In_Frame_Del_p.I123del	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	255	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> T (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> M (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> F (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.I255del(7)|p.I255S(7)|p.I255N(6)|p.0?(6)|p.I255T(6)|p.T256A(3)|p.T256fs*89(3)|p.T256S(2)|p.I255I(2)|p.I255fs*8(1)|p.?(1)|p.T256fs*8(1)|p.I254fs*7(1)|p.I255M(1)|p.T256fs*90(1)|p.T256P(1)|p.T256del(1)|p.R249_T256delRPILTIIT(1)|p.T256fs*87(1)|p.T256fs*17(1)|p.I254_T256del(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)		111	p.I255S(SW579-Tumor)|p.I255S(CGTHW1-Tumor)|p.I255N(PANC10.05-Tumor)|p.I255T(HUPT4-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.54			158	135				---	---	---	---	capture_indel			In_Frame_Del	DEL	7518240	7518242	16923	17	TGA	-	-	59	59	TP53	-	5	5
PEPD	5184	broad.mit.edu	36	19	38695357	38695358	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:38695357_38695358delGG	uc002nur.2	-	c.182_183delCC	c.(181-183)ACCfs	p.T61fs		NM_000285	NP_000276	P12955	PEPD_HUMAN	peptidase D	61					cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(1)	1	Esophageal squamous(110;0.137)													0.38			15	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	38695357	38695358	12149	19	GG	-	-	39	39	PEPD	-	5	5
C21orf33	8209	broad.mit.edu	36	21	44381539	44381542	+	Frame_Shift_Del	DEL	GCCA	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:44381539_44381542delGCCA	uc002zec.2	+	c.361_364delGCCA	c.(361-366)GCCAACfs	p.A121fs	C21orf33_uc002zed.2_Frame_Shift_Del_p.A121fs	NM_004649	NP_004640	P30042	ES1_HUMAN	es1 protein isoform Ia precursor	121_122						mitochondrion				ovary(1)	1				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)										0.44			35	45				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	44381539	44381542	2205	21	GCCA	-	-	42	42	C21orf33	-	5	5
GRM7	2917	broad.mit.edu	36	3	6878228	6878229	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:6878228_6878229insG	uc003bql.1	+	c.153_154insG	c.(151-156)CTCGGGfs	p.L51fs	GRM7_uc010hcf.1_Non-coding_Transcript|GRM7_uc010hcg.1_Frame_Shift_Ins_p.L51fs|GRM7_uc003bqm.1_Frame_Shift_Ins_p.L51fs	NM_181874	NP_870989	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform b	51_52	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)	4					L-Glutamic Acid(DB00142)									0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	6878228	6878229	7081	3	-	G	G	31	31	GRM7	G	5	5
ASPH	444	broad.mit.edu	36	8	62721964	62721966	+	In_Frame_Del	DEL	TCT	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:62721964_62721966delTCT	uc003xuj.1	-	c.516_518delAGA	c.(514-519)GAAGAT>GAT	p.E172del	ASPH_uc003xun.1_Intron|ASPH_uc003xum.1_In_Frame_Del_p.E172del|ASPH_uc003xuo.1_In_Frame_Del_p.E172del|ASPH_uc003xul.1_In_Frame_Del_p.E158del	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a	172	Glu-rich.|Lumenal (Potential).				muscle contraction|oxidation-reduction process	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)				p.E172D(HCC2157-Tumor)|p.D173G(FU97-Tumor)	528				0.35			109	200				---	---	---	---	capture_indel			In_Frame_Del	DEL	62721964	62721966	1072	8	TCT	-	-	50	50	ASPH	-	5	5
FAM102A	399665	broad.mit.edu	36	9	129755970	129755972	+	In_Frame_Del	DEL	TAC	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:129755970_129755972delTAC	uc004bsx.1	-	c.200_202delGTA	c.(199-204)TGTAAG>TAG	p.67_68CK>*		NM_001035254	NP_976050	Q5T9C2	F102A_HUMAN	early estrogen-induced gene 1 protein isoform a	67_68										ovary(1)	1														0.42			45	62				---	---	---	---	capture_indel			In_Frame_Del	DEL	129755970	129755972	5579	9	TAC	-	-	61	61	FAM102A	-	5	5
HDAC6	10013	broad.mit.edu	36	X	48566458	48566478	+	In_Frame_Del	DEL	TGGTGGCCCTCACTCAGGACC	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:48566458_48566478delTGGTGGCCCTCACTCAGGACC	uc004dks.1	+	c.2705_2725delTGGTGGCCCTCACTCAGGACC	c.(2704-2727)GTGGTGGCCCTCACTCAGGACCAG>GAG	p.902_909VVALTQDQ>E	HDAC6_uc010nig.1_In_Frame_Del_p.750_757VVALTQDQ>E|HDAC6_uc004dkt.1_In_Frame_Del_p.902_909VVALTQDQ>E|HDAC6_uc004dkv.1_In_Frame_Del_p.550_557VVALTQDQ>E|HDAC6_uc004dkw.1_In_Frame_Del_p.550_557VVALTQDQ>E|HDAC6_uc004dkx.1_In_Frame_Del_p.265_272VVALTQDQ>E	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	902_909					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of hydrogen peroxide metabolic process|negative regulation of oxidoreductase activity|negative regulation of proteolysis|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of microtubule-based movement|regulation of receptor activity|regulation of transcription, DNA-dependent|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|specific transcriptional repressor activity|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)	3					Vorinostat(DB02546)	Pancreas(112;205 1675 2305 8976 15959)				170				0.32			29	63				---	---	---	---	capture_indel			In_Frame_Del	DEL	48566458	48566478	7294	23	TGGTGGCCCTCACTCAGGACC	-	-	59	59	HDAC6	-	5	5
ITIH5L	347365	broad.mit.edu	36	X	54834084	54834087	+	Frame_Shift_Del	DEL	ATGC	-	-			TCGA-14-0812-01	TCGA-14-0812-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:54834084_54834087delATGC	uc004dtj.1	-	c.524_527delGCAT	c.(523-528)AGCATAfs	p.S175fs		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	175_176					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5										249				0.33			52	105				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	54834084	54834087	8212	23	ATGC	-	-	16	16	ITIH5L	-	5	5
