Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
CHUK	1147	broad.mit.edu	36	10	101957071	101957071	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:101957071A>C	uc001kqp.1	-	c.1137T>G	c.(1135-1137)TGT>TGG	p.C379W		NM_001278	NP_001269	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	379					I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)		Ovarian(159;52 1904 10536 35305 37148)			p.C379W(DEL-Tumor)	415				0.466667	7.824594	7.854211	7	8	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	101957071	101957071	3550	10	A	C	C	6	6	CHUK	C	4	4
COL17A1	1308	broad.mit.edu	36	10	105806864	105806865	+	Missense_Mutation	DNP	CA	AG	AG			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:105806864_105806865CA>AG	uc001kxr.1	-	c.1323_1324TG>CT	c.(1321-1326)GTTGGT>GTCTGT	p.G442C		NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	442	Cytoplasmic (Potential).|Nonhelical region (NC16).				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane				ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)										0.4	10.732936	10.867633	6	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	105806864	105806865	3812	10	CA	AG	AG	21	21	COL17A1	AG	3	3
ADARB2	105	broad.mit.edu	36	10	1220860	1220860	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:1220860C>T	uc009xhq.1	-	c.1984G>A	c.(1984-1986)GGC>AGC	p.G662S	ADARB2_uc009xhp.1_Missense_Mutation_p.G46S|ADARB2_uc001igl.2_Missense_Mutation_p.G24S|ADARB2_uc001igm.2_Missense_Mutation_p.G171S	NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	662	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)						191				0.1875	24.428972	30.232897	12	52	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1220860	1220860	284	10	C	T	T	22	22	ADARB2	T	2	2
DDX21	9188	broad.mit.edu	36	10	70395224	70395224	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:70395224G>T	uc001jov.1	+	c.872G>T	c.(871-873)TGT>TTT	p.C291F	DDX21_uc001jow.1_Missense_Mutation_p.C223F	NM_004728	NP_004719	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21	291	Helicase ATP-binding.					nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)	3														0.25	6.407002	7.805813	6	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70395224	70395224	4520	10	G	T	T	48	48	DDX21	T	3	3
PLA2G12B	84647	broad.mit.edu	36	10	74384429	74384429	+	Silent	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:74384429G>A	uc001jtf.1	-	c.21C>T	c.(19-21)TTC>TTT	p.F7F	PLA2G12B_uc009xqt.1_5'UTR	NM_032562	NP_115951	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	7					lipid catabolic process	extracellular region	calcium ion binding|phospholipase A2 activity			ovary(1)	1	Prostate(51;0.0198)													0.206897	12.661392	17.468347	12	46	GG		KEEP	---	---	---	---	capture			Silent	SNP	74384429	74384429	12417	10	G	A	A	33	33	PLA2G12B	A	2	2
WAPAL	23063	broad.mit.edu	36	10	88250375	88250375	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:88250375G>A	uc001kdn.1	-	c.734C>T	c.(733-735)TCT>TTT	p.S245F	WAPAL_uc001kdo.1_Missense_Mutation_p.S202F|WAPAL_uc009xsw.1_Missense_Mutation_p.S202F	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	202	Mediates interaction with the cohesin complex.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1														0.233766	12.994946	18.27196	18	59	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88250375	88250375	17820	10	G	A	A	33	33	WAPAL	A	2	2
ZDHHC16	84287	broad.mit.edu	36	10	99201638	99201638	+	Silent	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:99201638A>G	uc001knj.1	+	c.216A>G	c.(214-216)GTA>GTG	p.V72V	ZDHHC16_uc001knp.1_Silent_p.V72V|ZDHHC16_uc001knk.1_Silent_p.V72V|ZDHHC16_uc001knl.1_Silent_p.V72V|ZDHHC16_uc001knm.1_Silent_p.V72V|ZDHHC16_uc001knn.1_Silent_p.V72V|ZDHHC16_uc009xvq.1_Non-coding_Transcript|ZDHHC16_uc001kno.1_Silent_p.V72V|ZDHHC16_uc009xvr.1_Silent_p.V72V	NM_198046	NP_932163	Q969W1	ZDH16_HUMAN	Abl-philin 2 isoform 1	72	Cytoplasmic (Potential).				apoptosis	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)										0.189189	7.29295	10.813104	7	30	AA		KEEP	---	---	---	---	capture			Silent	SNP	99201638	99201638	18194	10	A	G	G	15	15	ZDHHC16	G	4	4
BLID	414899	broad.mit.edu	36	11	121491710	121491710	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:121491710C>G	uc001pyf.1	-	c.131G>C	c.(130-132)CGC>CCC	p.R44P	LOC399959_uc001pyb.2_Intron|LOC399959_uc009zba.1_Intron	NM_001001786	NP_001001786	Q8IZY5	BLID_HUMAN	BRCC2 protein	44					apoptosis	mitochondrion					0		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)								OREG0021435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.36	15.78721	16.250968	9	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	121491710	121491710	1468	11	C	G	G	27	27	BLID	G	3	3
BARX2	8538	broad.mit.edu	36	11	128826284	128826284	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:128826284G>A	uc001qfc.2	+	c.617G>A	c.(616-618)CGC>CAC	p.R206H		NM_003658	NP_003649	Q9UMQ3	BARX2_HUMAN	BarH-like homeobox 2	206							transcription regulator activity				0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)										0.16	7.784456	10.536629	4	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128826284	128826284	1337	11	G	A	A	38	38	BARX2	A	1	1
KRTAP5-5	439915	broad.mit.edu	36	11	1607668	1607669	+	Missense_Mutation	DNP	GG	CC	CC			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:1607668_1607669GG>CC	uc001lty.1	+	c.22_23GG>CC	c.(22-24)GGA>CCA	p.G8P		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	8						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)										0.25	14.348738	16.403734	9	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	1607668	1607669	8886	11	GG	CC	CC	39	39	KRTAP5-5	CC	3	3
STIM1	6786	broad.mit.edu	36	11	4047976	4047976	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:4047976G>A	uc001lyv.1	+	c.758G>A	c.(757-759)CGA>CAA	p.R253Q	STIM1_uc009yef.1_Missense_Mutation_p.R253Q|STIM1_uc009yeg.1_Missense_Mutation_p.R80Q	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	253	Cytoplasmic (Potential).|Potential.				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)										0.127404	66.177521	122.533153	53	363	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4047976	4047976	15803	11	G	A	A	37	37	STIM1	A	1	1
OR52N2	390077	broad.mit.edu	36	11	5798366	5798366	+	Silent	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:5798366G>A	uc001mbx.1	+	c.225G>A	c.(223-225)TTG>TTA	p.L75L	TRIM5_uc001mbq.1_Intron	NM_001005174	NP_001005174	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N,	75	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)										0.470588	679.842034	680.188805	216	243	GG		KEEP	---	---	---	---	capture			Silent	SNP	5798366	5798366	11538	11	G	A	A	48	48	OR52N2	A	2	2
ZP1	22917	broad.mit.edu	36	11	60393804	60393804	+	Silent	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:60393804T>C	uc001nqd.1	+	c.537T>C	c.(535-537)TTT>TTC	p.F179F	ZP1_uc001nqe.1_5'Flank	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1	179	Extracellular (Potential).				single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0														0.6	7.124449	7.168294	3	2	TT		KEEP	---	---	---	---	capture			Silent	SNP	60393804	60393804	18819	11	T	C	C	62	62	ZP1	C	4	4
RRP8	23378	broad.mit.edu	36	11	6578368	6578368	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6578368T>C	uc001med.1	-	c.1175A>G	c.(1174-1176)GAG>GGG	p.E392G		NM_015324	NP_056139	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase,	392					chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity				0														0.416667	7.528144	7.609669	5	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6578368	6578368	14170	11	T	C	C	54	54	RRP8	C	4	4
BBS1	582	broad.mit.edu	36	11	66045424	66045424	+	Splice_Site_SNP	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:66045424G>T	uc001oii.1	+	c.e9_splice_site			ZDHHC24_uc001oim.1_Non-coding_Transcript|ZDHHC24_uc009yrg.1_3'UTR|BBS1_uc001oij.1_Splice_Site_SNP|BBS1_uc001oik.1_Splice_Site_SNP|BBS1_uc001oil.1_Intron	NM_024649	NP_078925			Bardet-Biedl syndrome 1						photoreceptor cell maintenance|response to stimulus|retina homeostasis|sensory cilium assembly	BBSome|cilium membrane|cytoplasm	protein binding			ovary(1)	1						GBM(152;173 2612 9770 10137)								0.261905	16.530153	18.684848	11	31	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	66045424	66045424	1356	11	G	T	T	44	44	BBS1	T	5	3
PC	5091	broad.mit.edu	36	11	66387921	66387921	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:66387921T>A	uc001ojn.1	-	c.1268A>T	c.(1267-1269)GAC>GTC	p.D423V	PC_uc001ojo.1_Missense_Mutation_p.D423V|PC_uc001ojp.1_Missense_Mutation_p.D423V	NM_022172	NP_071504	P11498	PYC_HUMAN	pyruvate carboxylase precursor	423	Biotin carboxylation.				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)									0.444444	8.092386	8.117396	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66387921	66387921	11917	11	T	A	A	58	58	PC	A	4	4
STARD10	10809	broad.mit.edu	36	11	72169783	72169783	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:72169783C>T	uc001osy.1	-	c.92G>A	c.(91-93)CGC>CAC	p.R31H	ARAP1_uc001osv.1_Intron|STARD10_uc001osz.2_Missense_Mutation_p.R31H|STARD10_uc001ota.1_Intron|STARD10_uc001otb.1_Missense_Mutation_p.R31H	NM_006645	NP_006636	Q9Y365	PCTL_HUMAN	START domain containing 10	31	START.										0			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)											0.578947	35.326957	35.430262	11	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72169783	72169783	15774	11	C	T	T	27	27	STARD10	T	1	1
TMEM126B	55863	broad.mit.edu	36	11	85024463	85024463	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:85024463G>A	uc001pao.1	+	c.412G>A	c.(412-414)GCA>ACA	p.A138T	TMEM126B_uc001pap.1_Missense_Mutation_p.A138T|TMEM126B_uc001paq.1_Missense_Mutation_p.A138T	NM_018480	NP_060950	Q8IUX1	T126B_HUMAN	transmembrane protein 126B	168						integral to membrane					0		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)												0.3125	14.569612	15.070111	5	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85024463	85024463	16570	11	G	A	A	42	42	TMEM126B	A	2	2
RFX4	5992	broad.mit.edu	36	12	105650868	105650868	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:105650868C>G	uc001tlt.1	+	c.1535C>G	c.(1534-1536)GCC>GGC	p.A512G	RFX4_uc001tlr.1_Missense_Mutation_p.A503G|RFX4_uc001tls.1_Missense_Mutation_p.A512G|RFX4_uc001tlv.1_Missense_Mutation_p.A409G	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c	503					transcription, DNA-dependent	nucleus	DNA binding				0														0.5	7.175325	7.175325	4	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105650868	105650868	13737	12	C	G	G	26	26	RFX4	G	3	3
MED13L	23389	broad.mit.edu	36	12	114883585	114883585	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:114883585A>C	uc001tvw.1	-	c.6502T>G	c.(6502-6504)TTT>GTT	p.F2168V		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	2168					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		RNA polymerase II transcription mediator activity			skin(3)|ovary(1)|lung(1)	5	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)						497				0.233333	10.465004	16.976582	21	69	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114883585	114883585	9820	12	A	C	C	2	2	MED13L	C	4	4
GCN1L1	10985	broad.mit.edu	36	12	119067218	119067218	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:119067218C>A	uc001txo.1	-	c.5047G>T	c.(5047-5049)GCC>TCC	p.A1683S		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1683	HEAT 12.			A -> V (in Ref. 7; AAC51648).	regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(3)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.357143	8.761217	9.016814	5	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119067218	119067218	6565	12	C	A	A	26	26	GCN1L1	A	3	3
TWF1	5756	broad.mit.edu	36	12	42477521	42477521	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr12:42477521T>C	uc001rob.1	-	c.734A>G	c.(733-735)GAA>GGA	p.E245G	TWF1_uc001rnz.1_Missense_Mutation_p.E106G|TWF1_uc001roa.1_Missense_Mutation_p.E238G|TWF1_uc001roc.1_Missense_Mutation_p.E106G	NM_002822	NP_002813	Q12792	TWF1_HUMAN	twinfilin 1	204	ADF-H 2.				protein phosphorylation	actin cytoskeleton|cytoplasm	actin binding|protein tyrosine kinase activity			stomach(1)	1	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)					p.E245G(NCIH1437-Tumor)|p.E245G(T3M4-Tumor)|p.E245G(NCIH1651-Tumor)|p.E245G(NCIH2122-Tumor)|p.E245G(HS698.T-Tumor)|p.E245G(MFE296-Tumor)|p.E245G(HCC44-Tumor)|p.E245G(SH10TC-Tumor)|p.E245G(COLO818-Tumor)|p.E245G(SNU46-Tumor)|p.E245G(SKOV3-Tumor)|p.E245G(P3HR1-Tumor)|p.E245G(CAKI1-Tumor)|p.E245G(697-Tumor)|p.E245G(COLO680N-Tumor)|p.E245G(SNU1196-Tumor)|p.E245G(G361-Tumor)|p.E245G(COLO320-Tumor)|p.E245G(CAS1-Tumor)|p.E245G(NCIH1793-Tumor)	111				0.333333	10.511772	11.25616	9	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42477521	42477521	17337	12	T	C	C	62	62	TWF1	C	4	4
SLC4A8	9498	broad.mit.edu	36	12	50155214	50155214	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:50155214G>T	uc001rys.1	+	c.2129G>T	c.(2128-2130)AGC>ATC	p.S710I	SLC4A8_uc001rym.1_Missense_Mutation_p.S657I|SLC4A8_uc001ryn.1_Missense_Mutation_p.S657I|SLC4A8_uc001ryo.1_Missense_Mutation_p.S657I|SLC4A8_uc001ryr.1_Missense_Mutation_p.S710I	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	710	Cytoplasmic (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)	4				BRCA - Breast invasive adenocarcinoma(357;0.15)										0.132075	20.780068	34.720867	14	92	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50155214	50155214	15156	12	G	T	T	34	34	SLC4A8	T	3	3
ANKRD33	341405	broad.mit.edu	36	12	50569203	50569203	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:50569203A>C	uc001rzd.1	+	c.482A>C	c.(481-483)CAG>CCG	p.Q161P	ANKRD33_uc001rze.1_Missense_Mutation_p.Q26P|ANKRD33_uc001rzf.2_Missense_Mutation_p.Q26P|ANKRD33_uc001rzg.2_Intron|ANKRD33_uc001rzh.2_3'UTR|ANKRD33_uc001rzi.2_Missense_Mutation_p.Q26P	NM_182608	NP_872414	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 2	26											0				BRCA - Breast invasive adenocarcinoma(357;0.0969)										0.163265	7.056761	12.361376	8	41	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50569203	50569203	667	12	A	C	C	7	7	ANKRD33	C	4	4
SP1	6667	broad.mit.edu	36	12	52063329	52063329	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:52063329C>T	uc001scw.1	+	c.1331C>T	c.(1330-1332)CCA>CTA	p.P444L		NM_138473	NP_612482	P08047	SP1_HUMAN	Sp1 transcription factor isoform a	444	Transactivation domain B (Gln-rich).				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter, global	cytoplasm|nucleus	double-stranded DNA binding|histone deacetylase binding|promoter binding|protein C-terminus binding|protein homodimerization activity|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(357;0.00527)						103				0.217391	6.454949	8.159124	5	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52063329	52063329	15459	12	C	T	T	21	21	SP1	T	2	2
MARCH9	92979	broad.mit.edu	36	12	56438165	56438165	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:56438165C>G	uc001spx.1	+	c.521C>G	c.(520-522)GCC>GGC	p.A174G	MARCH9_uc001spy.2_Missense_Mutation_p.A61G	NM_138396	NP_612405	Q86YJ5	MARH9_HUMAN	membrane-associated RING-CH protein IX	174						Golgi membrane|Golgi stack|integral to membrane|lysosomal membrane|trans-Golgi network	ligase activity|zinc ion binding				0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)											0.217391	9.071545	10.76035	5	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56438165	56438165	9691	12	C	G	G	26	26	MARCH9	G	3	3
IL22	50616	broad.mit.edu	36	12	66933394	66933394	+	Silent	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:66933394C>T	uc001sty.1	-	c.102G>A	c.(100-102)GCG>GCA	p.A34A		NM_020525	NP_065386	Q9GZX6	IL22_HUMAN	interleukin 22	34					acute-phase response|cell-cell signaling	extracellular space	cytokine activity|interleukin-22 receptor binding				0		Myeloproliferative disorder(1001;0.0255)	Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;5.06e-05)|BRCA - Breast invasive adenocarcinoma(357;0.00104)										0.393617	108.161454	109.089894	37	57	CC		KEEP	---	---	---	---	capture			Silent	SNP	66933394	66933394	7973	12	C	T	T	27	27	IL22	T	1	1
USP5	8078	broad.mit.edu	36	12	6840900	6840900	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6840900C>A	uc001qri.2	+	c.1531C>A	c.(1531-1533)CAA>AAA	p.Q511K	USP5_uc001qrh.2_Missense_Mutation_p.Q511K	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	511					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding				0														0.210526	7.988973	9.462681	4	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6840900	6840900	17645	12	C	A	A	25	25	USP5	A	3	3
CLSTN3	9746	broad.mit.edu	36	12	7193473	7193473	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7193473G>A	uc001qss.1	+	c.2198G>A	c.(2197-2199)CGG>CAG	p.R733Q	CLSTN3_uc001qsr.1_Missense_Mutation_p.R721Q	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	721	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1														0.270408	129.888356	139.21306	53	143	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7193473	7193473	3701	12	G	A	A	39	39	CLSTN3	A	1	1
MFAP5	8076	broad.mit.edu	36	12	8698335	8698335	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:8698335A>C	uc001qut.1	-	c.182T>G	c.(181-183)GTT>GGT	p.V61G	MFAP5_uc001qus.1_Missense_Mutation_p.V61G|MFAP5_uc009zge.1_Intron	NM_003480	NP_003471	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5	61			V -> D (in a breast cancer sample; somatic mutation).			microfibril	extracellular matrix structural constituent	p.V61D(1)		breast(1)	1	Lung SC(5;0.184)													0.416667	6.341454	6.441908	5	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8698335	8698335	9908	12	A	C	C	2	2	MFAP5	C	4	4
SACS	26278	broad.mit.edu	36	13	22827247	22827247	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:22827247G>A	uc001uon.2	-	c.1504C>T	c.(1504-1506)CCC>TCC	p.P502S	SACS_uc001uoo.2_Missense_Mutation_p.P355S|SACS_uc001uop.1_Missense_Mutation_p.P289S|SACS_uc001uoq.1_Missense_Mutation_p.P355S	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	502					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)|skin(1)	11		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)						738				0.622951	480.727934	483.968201	152	92	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22827247	22827247	14284	13	G	A	A	43	43	SACS	A	2	2
FAM48A	55578	broad.mit.edu	36	13	36497492	36497492	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:36497492T>A	uc001uwk.1	-	c.1294A>T	c.(1294-1296)AGT>TGT	p.S432C	FAM48A_uc001uwd.1_5'Flank|FAM48A_uc001uwe.1_5'Flank|FAM48A_uc001uwf.1_Missense_Mutation_p.S10C|FAM48A_uc010abt.1_Missense_Mutation_p.S433C|FAM48A_uc001uwg.1_Missense_Mutation_p.S432C|FAM48A_uc001uwh.1_Missense_Mutation_p.S433C|FAM48A_uc001uwi.1_Missense_Mutation_p.S432C|FAM48A_uc001uwj.1_Missense_Mutation_p.S433C|FAM48A_uc001uwl.1_Missense_Mutation_p.S432C	NM_017569	NP_060039	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A	432					autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)										0.173913	56.608349	72.766491	28	133	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36497492	36497492	5794	13	T	A	A	55	55	FAM48A	A	4	4
FREM2	341640	broad.mit.edu	36	13	38352479	38352479	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:38352479A>G	uc001uwv.1	+	c.9065A>G	c.(9064-9066)AAT>AGT	p.N3022S		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	3022	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	10		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)										0.391304	52.73961	53.215363	18	28	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38352479	38352479	6292	13	A	G	G	4	4	FREM2	G	4	4
RNASEH2B	79621	broad.mit.edu	36	13	50426124	50426124	+	Splice_Site_SNP	SNP	T	A	A			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:50426124T>A	uc001vfa.2	+	c.e10_splice_site			RNASEH2B_uc001vfb.2_Intron	NM_024570	NP_078846			ribonuclease H2, subunit B isoform 1						RNA catabolic process	nucleus|ribonuclease H2 complex					0		Acute lymphoblastic leukemia(7;1.03e-07)|Breast(56;0.00122)|Lung NSC(96;0.00143)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;9e-08)										0.5	8.292867	8.292867	4	4	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	50426124	50426124	13890	13	T	A	A	57	57	RNASEH2B	A	5	4
MYCBP2	23077	broad.mit.edu	36	13	76643740	76643740	+	Silent	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:76643740T>C	uc001vkf.1	-	c.5568A>G	c.(5566-5568)CAA>CAG	p.Q1856Q	MYCBP2_uc010aev.1_Silent_p.Q1260Q	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1856					regulation of mitotic metaphase/anaphase transition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	anaphase-promoting complex	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|lung(2)|pancreas(1)	11		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)										0.205128	17.279886	20.426699	8	31	TT		KEEP	---	---	---	---	capture			Silent	SNP	76643740	76643740	10413	13	T	C	C	60	60	MYCBP2	C	4	4
DZIP1	22873	broad.mit.edu	36	13	95091934	95091934	+	Silent	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:95091934C>G	uc001vmk.1	-	c.213G>C	c.(211-213)CGG>CGC	p.R71R	DZIP1_uc001vml.1_Silent_p.R71R|DZIP1_uc001vmn.1_Silent_p.R60R	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	71					germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)											0.625	12.173692	12.283792	5	3	CC		KEEP	---	---	---	---	capture			Silent	SNP	95091934	95091934	5049	13	C	G	G	26	26	DZIP1	G	3	3
PSME1	5720	broad.mit.edu	36	14	23677162	23677162	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:23677162T>G	uc001wmh.1	+	c.455T>G	c.(454-456)GTC>GGC	p.V152G	PSME1_uc001wmg.1_Missense_Mutation_p.V152G	NM_176783	NP_788955	Q06323	PSME1_HUMAN	proteasome activator subunit 1 isoform 2	152					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|proteasome activator complex				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00831)										0.294118	9.466005	10.113372	5	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23677162	23677162	13159	14	T	G	G	58	58	PSME1	G	4	4
TMED8	283578	broad.mit.edu	36	14	76877876	76877876	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:76877876G>T	uc001xto.1	-	c.969C>A	c.(967-969)TAC>TAA	p.Y323*	TMED8_uc010ast.1_Non-coding_Transcript|TMED8_uc001xtn.1_Nonsense_Mutation_p.Y167*	NM_213601	NP_998766	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain	323	GOLD.				transport	integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)										0.153584	76.268433	109.931072	45	248	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	76877876	76877876	16541	14	G	T	T	48	48	TMED8	T	5	3
GALC	2581	broad.mit.edu	36	14	87501700	87501700	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:87501700C>T	uc001xvt.1	-	c.935G>A	c.(934-936)AGT>AAT	p.S312N	GALC_uc001xvu.1_Missense_Mutation_p.S312N	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	312					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0														0.24	12.844136	14.383104	6	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87501700	87501700	6465	14	C	T	T	20	20	GALC	T	2	2
OCA2	4948	broad.mit.edu	36	15	25905376	25905376	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:25905376T>A	uc001zbh.2	-	c.1191A>T	c.(1189-1191)TTA>TTT	p.L397F	OCA2_uc010ayv.1_Missense_Mutation_p.L373F	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	397	Helical; (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										0.253731	21.740049	25.531448	17	50	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	25905376	25905376	11220	15	T	A	A	53	53	OCA2	A	4	4
JMJD7-PLA2G4B	8681	broad.mit.edu	36	15	39920284	39920284	+	Silent	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39920284C>A	uc001zoo.2	+	c.933C>A	c.(931-933)GTC>GTA	p.V311V	JMJD7-PLA2G4B_uc010bcn.1_Silent_p.V311V|JMJD7-PLA2G4B_uc001zoq.2_5'UTR|JMJD7-PLA2G4B_uc010bco.1_Silent_p.V80V|JMJD7-PLA2G4B_uc001zor.1_5'Flank	NM_005090	NP_005081	P0C869	PA24B_HUMAN	JMJD7-PLA2G4B protein	80	C2.				arachidonic acid metabolic process|calcium-mediated signaling|glycerophospholipid catabolic process|inflammatory response|parturition	cytosol|early endosome membrane|extracellular region|mitochondrial membrane	calcium ion binding|calcium-dependent phospholipase A2 activity|calcium-dependent phospholipid binding|lysophospholipase activity			large_intestine(1)	1														0.10596	15.592753	38.88398	16	135	CC		KEEP	---	---	---	---	capture			Silent	SNP	39920284	39920284	8259	15	C	A	A	32	32	JMJD7-PLA2G4B	A	3	3
DUOXA1	90527	broad.mit.edu	36	15	43200109	43200109	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:43200109G>A	uc001zup.1	-	c.527C>T	c.(526-528)GCG>GTG	p.A176V	DUOXA1_uc010bec.1_Missense_Mutation_p.A176V|DUOXA1_uc001zuq.1_Missense_Mutation_p.A176V|DUOXA1_uc001zur.1_Missense_Mutation_p.A131V|DUOXA1_uc010bed.1_Missense_Mutation_p.A131V	NM_144565	NP_653166	Q1HG43	DOXA1_HUMAN	Numb-interacting protein	176	Extracellular (Potential).				protein transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)										0.1875	7.216251	8.678624	3	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43200109	43200109	4987	15	G	A	A	38	38	DUOXA1	A	1	1
E4F1	1877	broad.mit.edu	36	16	2223065	2223065	+	Silent	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:2223065C>G	uc002cpm.1	+	c.936C>G	c.(934-936)GGC>GGG	p.G312G	E4F1_uc010bsi.1_Silent_p.G312G|E4F1_uc010bsj.1_Silent_p.G312G	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F	312					cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth|regulation of transcription, DNA-dependent	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1														0.6	6.918018	6.960955	3	2	CC		KEEP	---	---	---	---	capture			Silent	SNP	2223065	2223065	5060	16	C	G	G	27	27	E4F1	G	3	3
SULT1A2	6799	broad.mit.edu	36	16	28514454	28514454	+	Silent	SNP	G	A	A	rs1126449	by-cluster	TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:28514454G>A	uc002dqg.1	-	c.192C>T	c.(190-192)GGC>GGT	p.G64G	SULT1A2_uc010byh.1_Silent_p.G64G|SULT1A2_uc002dqh.1_Silent_p.G64G	NM_177528	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A,	64					3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine biosynthetic process|catecholamine metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity				0														0.243243	15.444477	17.680335	9	28	GG		KEEP	---	---	---	---	capture			Silent	SNP	28514454	28514454	15893	16	G	A	A	38	38	SULT1A2	A	1	1
QPRT	23475	broad.mit.edu	36	16	29616073	29616073	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:29616073T>G	uc002dto.1	+	c.734T>G	c.(733-735)GTG>GGG	p.V245G	BOLA2_uc010bzb.1_Intron|BOLA2_uc010bzc.1_Intron	NM_014298	NP_055113	Q15274	NADC_HUMAN	quinolinate phosphoribosyltransferase	245					protein oligomerization|quinolinate catabolic process	cytosol	nicotinate-nucleotide diphosphorylase (carboxylating) activity|protein homodimerization activity				0					Niacin(DB00627)									0.244898	11.820849	14.999919	12	37	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29616073	29616073	13334	16	T	G	G	59	59	QPRT	G	4	4
INO80E	283899	broad.mit.edu	36	16	29919827	29919827	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:29919827C>T	uc002dvg.1	+	c.361C>T	c.(361-363)CAG>TAG	p.Q121*	BOLA2_uc010bzb.1_Intron|BOLA2_uc010bzc.1_Intron|INO80E_uc002dvh.1_Non-coding_Transcript|INO80E_uc002dvi.1_Nonsense_Mutation_p.Q121*|INO80E_uc002dvj.1_Non-coding_Transcript|INO80E_uc002dvk.1_Nonsense_Mutation_p.Q121*	NM_173618	NP_775889	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	121	Pro-rich.										0														0.3125	8.56154	9.066927	5	11	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	29919827	29919827	8051	16	C	T	T	29	29	INO80E	T	5	2
ZNF689	115509	broad.mit.edu	36	16	30528455	30528455	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:30528455C>A	uc002dyx.1	-	c.211G>T	c.(211-213)GCA>TCA	p.A71S	ZNF689_uc010bzy.1_5'UTR	NM_138447	NP_612456	Q96CS4	ZN689_HUMAN	zinc finger protein HIT-39	71	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			Colorectal(24;0.198)											0.38806	81.835961	82.571052	26	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30528455	30528455	18689	16	C	A	A	27	27	ZNF689	A	3	3
ITGAD	3681	broad.mit.edu	36	16	31341990	31341990	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31341990G>T	uc010cap.1	+	c.2838G>T	c.(2836-2838)ATG>ATT	p.M946I	ITGAD_uc002ebv.1_Missense_Mutation_p.M945I	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	945	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1														0.147541	29.064895	43.632618	18	104	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31341990	31341990	8188	16	G	T	T	45	45	ITGAD	T	3	3
ZCCHC14	23174	broad.mit.edu	36	16	86003282	86003282	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:86003282T>G	uc002fjz.1	-	c.2135A>C	c.(2134-2136)CAC>CCC	p.H712P	ZCCHC14_uc002fka.1_Non-coding_Transcript|ZCCHC14_uc002fkb.2_Missense_Mutation_p.H488P	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	712	Ser-rich.				cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0285)										0.3	6.619782	6.97812	3	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	86003282	86003282	18171	16	T	G	G	59	59	ZCCHC14	G	4	4
MYH4	4622	broad.mit.edu	36	17	10299041	10299041	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:10299041G>T	uc002gmn.1	-	c.2377C>A	c.(2377-2379)CAA>AAA	p.Q793K		NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	793	IQ.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|central_nervous_system(1)	11														0.428571	6.320183	6.351872	3	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10299041	10299041	10432	17	G	T	T	45	45	MYH4	T	3	3
MYH3	4621	broad.mit.edu	36	17	10482359	10482359	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:10482359T>C	uc002gmq.1	-	c.3455A>G	c.(3454-3456)GAG>GGG	p.E1152G		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1152	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(1)|pancreas(1)	6														0.333333	6.424705	6.756706	4	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10482359	10482359	10431	17	T	C	C	54	54	MYH3	C	4	4
MPRIP	23164	broad.mit.edu	36	17	16970760	16970760	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:16970760G>A	uc002gqv.1	+	c.287G>A	c.(286-288)GGC>GAC	p.G96D	MPRIP_uc002gqu.1_Missense_Mutation_p.G96D	NM_015134	NP_055949	Q6WCQ1	MPRIP_HUMAN	myosin phosphatase-Rho interacting protein	96	Interaction with F-actin (By similarity).|PH 1.					cytoplasm|cytoskeleton	actin binding				0														0.363636	7.592108	7.77385	4	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16970760	16970760	10135	17	G	A	A	42	42	MPRIP	A	2	2
NR1D1	9572	broad.mit.edu	36	17	35507147	35507147	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:35507147A>G	uc002htz.1	-	c.67T>C	c.(67-69)TCC>CCC	p.S23P	NR1D1_uc010cwq.1_Non-coding_Transcript|NR1D1_uc010cwr.1_5'Flank	NM_021724	NP_068370	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	23					cellular response to lipopolysaccharide|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of receptor biosynthetic process|negative regulation of toll-like receptor 4 signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin|nucleoplasm	promoter binding|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(1)	1	Colorectal(19;0.000442)													0.444444	8.99497	9.019455	4	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35507147	35507147	11020	17	A	G	G	11	11	NR1D1	G	4	4
KCTD2	23510	broad.mit.edu	36	17	70560755	70560755	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:70560755T>G	uc002jmp.1	+	c.500T>G	c.(499-501)GTT>GGT	p.V167G	KCTD2_uc010dfz.1_Non-coding_Transcript|KCTD2_uc002jmq.1_Non-coding_Transcript	NM_015353	NP_056168	Q14681	KCTD2_HUMAN	potassium channel tetramerisation domain	167	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity				0	all_lung(278;0.226)													0.666667	7.350817	7.455563	4	2	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70560755	70560755	8413	17	T	G	G	60	60	KCTD2	G	4	4
EIF4A3	9775	broad.mit.edu	36	17	75725882	75725882	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:75725882G>C	uc002jxs.1	-	c.881C>G	c.(880-882)ACG>AGG	p.T294R		NM_014740	NP_055555	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A,	294	Helicase C-terminal.				mRNA transport|negative regulation of translation|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)											0.3	9.599066	10.343666	6	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75725882	75725882	5217	17	G	C	C	40	40	EIF4A3	C	3	3
C17orf101	79701	broad.mit.edu	36	17	77955175	77955175	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:77955175G>T	uc002ket.1	-	c.626C>A	c.(625-627)ACC>AAC	p.T209N	C17orf101_uc002keu.1_Missense_Mutation_p.T209N|C17orf101_uc010dip.1_Non-coding_Transcript	NM_175902	NP_787098	Q6PK18	CQ101_HUMAN	hypothetical protein LOC79701 isoform 2	209	Fe2OG dioxygenase.|Lumenal (Potential).				oxidation-reduction process	integral to membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(1)	1														0.151515	7.954241	11.793652	5	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	77955175	77955175	1901	17	G	T	T	44	44	C17orf101	T	3	3
ZADH2	284273	broad.mit.edu	36	18	71042403	71042403	+	Nonsense_Mutation	SNP	T	A	A			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr18:71042403T>A	uc002llx.1	-	c.1090A>T	c.(1090-1092)AAA>TAA	p.K364*	ZADH2_uc010dqv.1_Nonsense_Mutation_p.K241*	NM_175907	NP_787103	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain	364					oxidation-reduction process	peroxisome	oxidoreductase activity|zinc ion binding				0		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)										0.272727	9.330727	10.363277	6	16	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	71042403	71042403	18094	18	T	A	A	64	64	ZADH2	A	5	4
LDLR	3949	broad.mit.edu	36	19	11083285	11083285	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:11083285G>T	uc002mqk.2	+	c.1156G>T	c.(1156-1158)GAC>TAC	p.D386Y		NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	386	EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)	2		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	GBM(18;201 575 7820 21545)				1109				0.206897	7.826487	10.147884	6	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11083285	11083285	9028	19	G	T	T	41	41	LDLR	T	3	3
RTBDN	83546	broad.mit.edu	36	19	12800503	12800503	+	Silent	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12800503T>G	uc002mvj.1	-	c.429A>C	c.(427-429)GCA>GCC	p.A143A	RTBDN_uc002mvh.1_Silent_p.A143A|RTBDN_uc002mvi.1_Silent_p.A111A	NM_031429	NP_001074466	Q9BSG5	RTBDN_HUMAN	retbindin isoform 2	111						extracellular region					0														0.35	7.219949	7.659991	7	13	TT		KEEP	---	---	---	---	capture			Silent	SNP	12800503	12800503	14197	19	T	G	G	59	59	RTBDN	G	4	4
DNAJB1	3337	broad.mit.edu	36	19	14488777	14488777	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:14488777G>T	uc002myz.1	-	c.293C>A	c.(292-294)CCT>CAT	p.P98H		NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	98					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)										0.2	6.922633	9.449982	6	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14488777	14488777	4798	19	G	T	T	35	35	DNAJB1	T	3	3
JAK3	3718	broad.mit.edu	36	19	17815220	17815220	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17815220T>G	uc002nhn.2	-	c.389A>C	c.(388-390)GAC>GCC	p.D130A	JAK3_uc010ebh.1_Non-coding_Transcript|JAK3_uc002nho.2_Missense_Mutation_p.D130A	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	130	FERM.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(36)|lung(3)|ovary(3)|stomach(2)|breast(2)	46								2		364				0.333333	8.784975	9.085759	4	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17815220	17815220	8243	19	T	G	G	58	58	JAK3	G	4	4
RYR1	6261	broad.mit.edu	36	19	43710160	43710160	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:43710160G>A	uc002oit.1	+	c.10720G>A	c.(10720-10722)GCT>ACT	p.A3574T	RYR1_uc002oiu.1_Missense_Mutation_p.A3569T|RYR1_uc002oiv.1_Non-coding_Transcript	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3574					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)	10	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)									0.380952	14.281187	14.546294	8	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43710160	43710160	14248	19	G	A	A	42	42	RYR1	A	2	2
ARHGEF1	9138	broad.mit.edu	36	19	47088281	47088281	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:47088281C>G	uc002osa.1	+	c.409C>G	c.(409-411)CTT>GTT	p.L137V	ARHGEF1_uc002orw.1_Missense_Mutation_p.L122V|ARHGEF1_uc002orx.1_Missense_Mutation_p.L122V|ARHGEF1_uc002ory.1_Missense_Mutation_p.L89V|ARHGEF1_uc002orz.1_5'UTR|ARHGEF1_uc002osb.1_Missense_Mutation_p.L104V|ARHGEF1_uc002osc.2_5'Flank	NM_199002	NP_945353	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor 1 isoform	122	RGSL.				cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)										0.4	7.590347	7.679734	4	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47088281	47088281	907	19	C	G	G	20	20	ARHGEF1	G	3	3
PSG7	5676	broad.mit.edu	36	19	48121783	48121783	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:48121783C>T	uc002ovl.2	-	c.1225G>A	c.(1225-1227)GTG>ATG	p.V409M	PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG3_uc002ouf.1_Intron|PSG7_uc002ous.1_Non-coding_Transcript|PSG7_uc002out.1_Missense_Mutation_p.V135M|PSG11_uc002ouw.1_Missense_Mutation_p.V322M|PSG6_uc002ovh.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.V322M	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	409	Ig-like C2-type 3.				female pregnancy	extracellular region					0		Prostate(69;0.00682)												0.148649	82.908921	117.971887	44	252	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48121783	48121783	13113	19	C	T	T	19	19	PSG7	T	1	1
LILRB1	10859	broad.mit.edu	36	19	59835958	59835958	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:59835958A>C	uc002qgm.1	+	c.893A>C	c.(892-894)TAC>TCC	p.Y298S	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgj.1_Missense_Mutation_p.Y298S|LILRB1_uc002qgk.1_Missense_Mutation_p.Y298S|LILRB1_uc002qgl.1_Missense_Mutation_p.Y298S|LILRB1_uc010erq.1_Missense_Mutation_p.Y298S|LILRB1_uc010err.1_Non-coding_Transcript	NM_001081637	NP_001075106	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	298	Ig-like C2-type 3.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(193;0.0188)										0.333333	6.419672	6.642243	3	6	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59835958	59835958	9116	19	A	C	C	14	14	LILRB1	C	4	4
C3	718	broad.mit.edu	36	19	6648740	6648740	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:6648740G>T	uc002mfm.1	-	c.2506C>A	c.(2506-2508)CCC>ACC	p.P836T		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	836					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)										0.340426	26.428615	27.46553	16	31	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6648740	6648740	2296	19	G	T	T	44	44	C3	T	3	3
IGSF3	3321	broad.mit.edu	36	1	116952424	116952424	+	Silent	SNP	G	C	C			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:116952424G>C	uc001egq.1	-	c.885C>G	c.(883-885)GGC>GGG	p.G295G	IGSF3_uc001egr.1_Silent_p.G295G|IGSF3_uc001egs.1_5'UTR	NM_001542	NP_001533	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 1	295	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)										0.391304	13.021301	13.266654	9	14	GG		KEEP	---	---	---	---	capture			Silent	SNP	116952424	116952424	7902	1	G	C	C	38	38	IGSF3	C	3	3
AGTRAP	57085	broad.mit.edu	36	1	11731184	11731184	+	Silent	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:11731184C>A	uc001asv.1	+	c.294C>A	c.(292-294)CTC>CTA	p.L98L	AGTRAP_uc001asu.1_Missense_Mutation_p.Q131K|AGTRAP_uc001ast.1_Missense_Mutation_p.Q131K|AGTRAP_uc001asw.1_Silent_p.L98L|AGTRAP_uc001asx.1_Missense_Mutation_p.Q87K	NM_020350	NP_065083	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein	98	Helical; (Potential).					cytoplasmic vesicle membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein binding		AGTRAP/BRAF(2)	stomach(2)	2	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)										0.222222	7.190699	8.469323	4	14	CC		KEEP	---	---	---	---	capture			Silent	SNP	11731184	11731184	406	1	C	A	A	29	29	AGTRAP	A	3	3
OR6N1	128372	broad.mit.edu	36	1	157002429	157002429	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:157002429C>A	uc001fsx.1	-	c.668G>T	c.(667-669)TGC>TTC	p.C223F		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)													0.428571	7.117411	7.149555	3	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	157002429	157002429	11616	1	C	A	A	25	25	OR6N1	A	3	3
DUSP27	92235	broad.mit.edu	36	1	165362879	165362879	+	Silent	SNP	G	C	C			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:165362879G>C	uc001geb.1	+	c.1887G>C	c.(1885-1887)CTG>CTC	p.L629L		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	629					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3														0.666667	9.397187	9.543768	4	2	GG		KEEP	---	---	---	---	capture			Silent	SNP	165362879	165362879	5009	1	G	C	C	46	46	DUSP27	C	3	3
ATP13A2	23400	broad.mit.edu	36	1	17185959	17185959	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:17185959T>C	uc001baa.1	-	c.3163A>G	c.(3163-3165)AGC>GGC	p.S1055G	ATP13A2_uc001azz.1_Missense_Mutation_p.S202G|ATP13A2_uc001bab.1_Missense_Mutation_p.S1050G|ATP13A2_uc001bac.1_Missense_Mutation_p.S1011G	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	1055	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)										0.428571	6.420327	6.452078	3	4	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17185959	17185959	1143	1	T	C	C	55	55	ATP13A2	C	4	4
C1orf125	126859	broad.mit.edu	36	1	177728697	177728697	+	Silent	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:177728697G>A	uc001gmo.1	+	c.2376G>A	c.(2374-2376)GTG>GTA	p.V792V	C1orf125_uc009wxg.1_Non-coding_Transcript|C1orf125_uc001gmp.1_Silent_p.V792V|C1orf125_uc009wxh.1_Non-coding_Transcript	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	792											0														0.344828	18.327751	18.95043	10	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	177728697	177728697	2060	1	G	A	A	47	47	C1orf125	A	2	2
HMCN1	83872	broad.mit.edu	36	1	184081822	184081822	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:184081822C>A	uc001grq.1	+	c.310C>A	c.(310-312)CAA>AAA	p.Q104K		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1	104	VWFA.				bioluminescence|protein-chromophore linkage|response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)	22														0.135135	16.495491	26.050374	10	64	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	184081822	184081822	7511	1	C	A	A	29	29	HMCN1	A	3	3
HMCN1	83872	broad.mit.edu	36	1	184381601	184381601	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:184381601C>A	uc001grq.1	+	c.14531C>A	c.(14530-14532)CCT>CAT	p.P4844H	HMCN1_uc001grs.1_Missense_Mutation_p.P413H	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1	4844	TSP type-1 6.				bioluminescence|protein-chromophore linkage|response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)	22														0.097087	6.38327	23.129384	10	93	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	184381601	184381601	7511	1	C	A	A	24	24	HMCN1	A	3	3
AKR7A2	8574	broad.mit.edu	36	1	19503363	19503363	+	Silent	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:19503363A>G	uc001bbw.1	-	c.1023T>C	c.(1021-1023)GAT>GAC	p.D341D	AKR7A2_uc001bbx.1_Silent_p.D306D	NM_003689	NP_003680	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2	341					carbohydrate metabolic process|cellular aldehyde metabolic process|oxidation-reduction process	Golgi apparatus	alditol:NADP+ 1-oxidoreductase activity|electron carrier activity			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)										0.113636	6.855508	13.323113	5	39	AA		KEEP	---	---	---	---	capture			Silent	SNP	19503363	19503363	478	1	A	G	G	8	8	AKR7A2	G	4	4
ASPM	259266	broad.mit.edu	36	1	195364414	195364414	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:195364414C>T	uc001gtu.1	-	c.2765G>A	c.(2764-2766)AGT>AAT	p.S922N	ASPM_uc001gtv.1_Missense_Mutation_p.S922N|ASPM_uc001gtw.2_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	922	CH 1.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6														0.3	11.445427	12.159093	6	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	195364414	195364414	1075	1	C	T	T	20	20	ASPM	T	2	2
IPO9	55705	broad.mit.edu	36	1	200094245	200094245	+	Silent	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:200094245T>C	uc001gwz.1	+	c.1269T>C	c.(1267-1269)GCT>GCC	p.A423A		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	423					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2														0.375	7.522198	7.632089	3	5	TT		KEEP	---	---	---	---	capture			Silent	SNP	200094245	200094245	8100	1	T	C	C	55	55	IPO9	C	4	4
KLHDC8A	55220	broad.mit.edu	36	1	203574266	203574266	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:203574266A>G	uc001hcf.1	-	c.839T>C	c.(838-840)GTC>GCC	p.V280A	KLHDC8A_uc001hcg.1_Missense_Mutation_p.V280A	NM_018203	NP_060673	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	280	Kelch 7.									ovary(1)	1	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)											0.572327	285.531335	286.257512	91	68	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	203574266	203574266	8674	1	A	G	G	10	10	KLHDC8A	G	4	4
TP53BP2	7159	broad.mit.edu	36	1	222043391	222043391	+	Silent	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:222043391A>G	uc001hod.1	-	c.2718T>C	c.(2716-2718)GCT>GCC	p.A906A	TP53BP2_uc001hoe.1_Silent_p.A906A	NM_005426	NP_005417	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein, 2 isoform 2	1029	Mediates interaction with APC2.				apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)										0.135831	174.643531	284.402848	116	738	AA		KEEP	---	---	---	---	capture			Silent	SNP	222043391	222043391	16926	1	A	G	G	7	7	TP53BP2	G	4	4
MPL	4352	broad.mit.edu	36	1	43578294	43578294	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:43578294C>G	uc001ciw.1	+	c.763C>G	c.(763-765)CAG>GAG	p.Q255E	MPL_uc001civ.2_Missense_Mutation_p.Q255E|MPL_uc009vwr.1_Missense_Mutation_p.Q248E	NM_005373	NP_005364	P40238	TPOR_HUMAN	myeloproliferative leukemia virus oncogene	255	Extracellular (Potential).				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity			haematopoietic_and_lymphoid_tissue(359)|pancreas(1)	360	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				NSCLC(52;534 1204 10016 41452 44427)				169				0.166667	6.985815	9.514108	4	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43578294	43578294	10122	1	C	G	G	25	25	MPL	G	3	3
TMEM53	79639	broad.mit.edu	36	1	44893030	44893030	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:44893030A>G	uc001cmc.1	-	c.622T>C	c.(622-624)TCT>CCT	p.S208P	TMEM53_uc001cmb.1_Intron|TMEM53_uc001cmd.1_Missense_Mutation_p.S135P|TMEM53_uc009vxh.1_Missense_Mutation_p.S91P	NM_024587	NP_078863	Q6P2H8	TMM53_HUMAN	transmembrane protein 53	208						integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)													0.333333	8.661251	9.034642	5	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44893030	44893030	16718	1	A	G	G	11	11	TMEM53	G	4	4
HOOK1	51361	broad.mit.edu	36	1	60101104	60101104	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:60101104A>C	uc009wad.1	+	c.1593A>C	c.(1591-1593)TTA>TTC	p.L531F	HOOK1_uc001czo.1_Missense_Mutation_p.L531F|HOOK1_uc001czp.1_Non-coding_Transcript	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	531	Sufficient for interaction with microtubules.|Potential.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)													0.363636	8.193436	8.374693	4	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60101104	60101104	7574	1	A	C	C	14	14	HOOK1	C	4	4
CTH	1491	broad.mit.edu	36	1	70649806	70649806	+	Silent	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:70649806C>G	uc001dfd.1	+	c.120C>G	c.(118-120)CCC>CCG	p.P40P	CTH_uc009wbl.1_Non-coding_Transcript|CTH_uc001dfe.1_Silent_p.P40P	NM_001902	NP_001893	P32929	CGL_HUMAN	cystathionase isoform 1	40					cysteine biosynthetic process|hydrogen sulfide biosynthetic process|protein homotetramerization|protein-pyridoxal-5-phosphate linkage via peptidyl-N6-pyridoxal phosphate-L-lysine	cytoplasm|nucleus	cystathionine gamma-lyase activity|L-cysteine desulfhydrase activity|pyridoxal phosphate binding			lung(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)									0.227273	7.157361	8.666921	5	17	CC		KEEP	---	---	---	---	capture			Silent	SNP	70649806	70649806	4168	1	C	G	G	21	21	CTH	G	3	3
FRRS1	391059	broad.mit.edu	36	1	99976272	99976273	+	Missense_Mutation	DNP	AC	CT	CT			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:99976272_99976273AC>CT	uc001dsh.1	-	c.716_717GT>AG	c.(715-717)AGT>AAG	p.S239K		NM_001013660	NP_001013682	Q6ZNA5	FRRS1_HUMAN	stromal cell derived factor receptor 2 homolog	239	DOMON.				electron transport chain|transport	integral to membrane	ferric-chelate reductase activity|metal ion binding				0		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)										0.305556	37.595028	40.041651	22	50	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	99976272	99976273	6310	1	AC	CT	CT	14	14	FRRS1	CT	4	4
MYLK2	85366	broad.mit.edu	36	20	29883234	29883234	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:29883234A>G	uc002wwq.2	+	c.1492A>G	c.(1492-1494)AAC>GAC	p.N498D	MYLK2_uc002wws.2_Missense_Mutation_p.N115D|MYLK2_uc010gdw.1_Non-coding_Transcript	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase	498	Protein kinase.				cardiac muscle contraction|cardiac muscle tissue morphogenesis|regulation of muscle filament sliding	sarcomere	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)							150				0.140909	54.985088	82.359002	31	189	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29883234	29883234	10452	20	A	G	G	5	5	MYLK2	G	4	4
CEP250	11190	broad.mit.edu	36	20	33555991	33555991	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:33555991A>C	uc002xcm.1	+	c.6380A>C	c.(6379-6381)CAC>CCC	p.H2127P	CEP250_uc002xcn.1_Missense_Mutation_p.H2071P	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2 isoform 1	2127	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)											0.5	6.526246	6.526246	4	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33555991	33555991	3385	20	A	C	C	6	6	CEP250	C	4	4
ZBP1	81030	broad.mit.edu	36	20	55613093	55613093	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:55613093C>G	uc002xyo.1	-	c.1232G>C	c.(1231-1233)GGC>GCC	p.G411A	ZBP1_uc010gjm.1_Missense_Mutation_p.G410A|ZBP1_uc002xyp.1_Missense_Mutation_p.G336A	NM_030776	NP_110403	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	411							double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding			ovary(2)	2	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)											0.2	11.097252	15.383273	10	40	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55613093	55613093	18107	20	C	G	G	26	26	ZBP1	G	3	3
PPP1R3D	5509	broad.mit.edu	36	20	57947729	57947731	+	Missense_Mutation	TNP	TCG	CAC	CAC			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:57947729_57947731TCG>CAC	uc002ybb.1	-	c.651_653CGA>GTG	c.(649-654)CACGAG>CAGTGG	p.217_218HE>QW	C20orf177_uc002yba.1_Intron|C20orf177_uc002ybc.1_5'Flank	NM_006242	NP_006233	O95685	PPR3D_HUMAN	protein phosphatase 1, regulatory subunit 3D	217_218	CBM21.				glycogen metabolic process		protein binding|protein serine/threonine phosphatase activity				0	all_lung(29;0.00391)		BRCA - Breast invasive adenocarcinoma(7;5.12e-09)											0.923077	33.618661	34.881309	12	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	57947729	57947731	12809	20	TCG	CAC	CAC	54	54	PPP1R3D	CAC	4	4
PRPF6	24148	broad.mit.edu	36	20	62096760	62096760	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:62096760G>T	uc002yho.1	+	c.486G>T	c.(484-486)GAG>GAT	p.E162D	PRPF6_uc002yhp.1_Missense_Mutation_p.E162D	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog	162					assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)													0.277778	7.55967	8.366016	5	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62096760	62096760	13017	20	G	T	T	35	35	PRPF6	T	3	3
ANKRD5	63926	broad.mit.edu	36	20	9978140	9978140	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:9978140G>A	uc002wno.1	+	c.923G>A	c.(922-924)AGA>AAA	p.R308K	ANKRD5_uc002wnp.1_Missense_Mutation_p.R308K|ANKRD5_uc010gbz.1_Missense_Mutation_p.R119K	NM_022096	NP_942093	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5	308							calcium ion binding			ovary(1)|breast(1)	2														0.875	17.235171	18.312282	7	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9978140	9978140	684	20	G	A	A	33	33	ANKRD5	A	2	2
TPTE	7179	broad.mit.edu	36	21	9955745	9955745	+	Silent	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:9955745C>T	uc002yip.1	-	c.1005G>A	c.(1003-1005)GCG>GCA	p.A335A	TPTE_uc002yiq.1_Silent_p.A317A|TPTE_uc002yir.1_Silent_p.A297A|TPTE_uc010gkv.1_Silent_p.A197A|TPTE_uc002yis.1_Non-coding_Transcript	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	335	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)										0.275261	219.699489	232.754526	79	208	CC		KEEP	---	---	---	---	capture			Silent	SNP	9955745	9955745	16974	21	C	T	T	31	31	TPTE	T	1	1
CLTCL1	8218	broad.mit.edu	36	22	17593150	17593150	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:17593150C>A	uc002zpb.1	-	c.1954G>T	c.(1954-1956)GTC>TTC	p.V652F	CLTCL1_uc002zpc.1_Non-coding_Transcript	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1	652	Proximal segment.|Heavy chain arm.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)									1206				0.266667	15.888128	17.364338	8	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17593150	17593150	3705	22	C	A	A	17	17	CLTCL1	A	3	3
SERPIND1	3053	broad.mit.edu	36	22	19468534	19468534	+	Splice_Site_SNP	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:19468534G>A	uc002ztc.1	+	c.e2_splice_site			PI4KA_uc002zsz.2_Intron|SERPIND1_uc002ztb.1_Splice_Site_SNP	NM_000185	NP_000176			heparin cofactor II precursor						blood coagulation|chemotaxis|regulation of proteolysis	extracellular region	heparin binding|serine-type endopeptidase inhibitor activity				0	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)							OREG0026325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.25	7.158436	8.302753	5	15	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	19468534	19468534	14598	22	G	A	A	44	44	SERPIND1	A	5	2
ELFN2	114794	broad.mit.edu	36	22	36101216	36101216	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36101216T>G	uc003asq.2	-	c.305A>C	c.(304-306)CAG>CCG	p.Q102P	ELFN2_uc010gxg.1_Missense_Mutation_p.Q102P	NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	102	Extracellular (Potential).					cell surface|integral to membrane				ovary(1)	1	Melanoma(58;0.0574)													0.263158	7.360288	8.330715	5	14	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36101216	36101216	5250	22	T	G	G	55	55	ELFN2	G	4	4
L3MBTL2	83746	broad.mit.edu	36	22	39946725	39946725	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:39946725G>C	uc003azo.1	+	c.760G>C	c.(760-762)GCC>CCC	p.A254P	L3MBTL2_uc010gyi.1_Missense_Mutation_p.A163P|L3MBTL2_uc003azn.1_Non-coding_Transcript	NM_031488	NP_113676	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2	254	MBT 1.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3														0.272727	6.923714	7.433739	3	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39946725	39946725	8915	22	G	C	C	38	38	L3MBTL2	C	3	3
CELSR1	9620	broad.mit.edu	36	22	45168795	45168795	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:45168795A>C	uc003bhw.1	-	c.5872T>G	c.(5872-5874)TGG>GGG	p.W1958G		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1958	Extracellular (Potential).|EGF-like 7; calcium-binding.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			pancreas(2)|skin(1)	3		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)										0.5	10.809797	10.809797	10	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45168795	45168795	3354	22	A	C	C	6	6	CELSR1	C	4	4
TTN	7273	broad.mit.edu	36	2	179116069	179116069	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179116069T>G	uc002umr.1	-	c.89173A>C	c.(89173-89175)ACA>CCA	p.T29725P	TTN_uc002ums.1_Missense_Mutation_p.T23420P|TTN_uc010frc.1_Missense_Mutation_p.T23353P|TTN_uc010frd.1_Missense_Mutation_p.T23228P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30652										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.5	9.119796	9.119796	5	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	179116069	179116069	17290	2	T	G	G	59	59	TTN	G	4	4
TTN	7273	broad.mit.edu	36	2	179154702	179154702	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179154702G>A	uc002umr.1	-	c.58835C>T	c.(58834-58836)CCA>CTA	p.P19612L	TTN_uc002ums.1_Missense_Mutation_p.P13307L|TTN_uc010frc.1_Missense_Mutation_p.P13240L|TTN_uc010frd.1_Missense_Mutation_p.P13115L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20539										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.224033	283.69773	318.067684	110	381	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	179154702	179154702	17290	2	G	A	A	47	47	TTN	A	2	2
CCDC141	285025	broad.mit.edu	36	2	179409847	179409847	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179409847G>T	uc002unf.1	-	c.2619C>A	c.(2617-2619)GAC>GAA	p.D873E	CCDC141_uc002une.1_Intron	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	873	Ig-like.						protein binding			ovary(7)|pancreas(2)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)											0.363636	8.29346	8.474734	4	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	179409847	179409847	2895	2	G	T	T	48	48	CCDC141	T	3	3
ITGA4	3676	broad.mit.edu	36	2	182030697	182030697	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:182030697T>C	uc002unu.1	+	c.71T>C	c.(70-72)CTG>CCG	p.L24P	ITGA4_uc002unt.1_Missense_Mutation_p.L24P	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	24					B cell differentiation|blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)									0.363636	7.189559	7.372301	4	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	182030697	182030697	8182	2	T	C	C	55	55	ITGA4	C	4	4
IDH1	3417	broad.mit.edu	36	2	208821357	208821357	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:208821357C>T	uc002vcs.1	-	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.1_Missense_Mutation_p.R132H|IDH1_uc002vcu.1_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(1725)|p.R132?(210)|p.R132C(92)|p.R132L(48)|p.R132G(26)|p.R132S(11)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(1848)|haematopoietic_and_lymphoid_tissue(593)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2451				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		Pancreas(158;264 1958 3300 35450 36047)				134				0.736957	1138.866343	1162.221584	339	121	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	208821357	208821357	7794	2	C	T	T	19	19	IDH1	T	1	1
ATIC	471	broad.mit.edu	36	2	215907925	215907925	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:215907925T>G	uc002vex.2	+	c.961T>G	c.(961-963)TTG>GTG	p.L321V	ATIC_uc002vey.2_Missense_Mutation_p.L320V	NM_004044	NP_004035	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide	321					IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|soft_tissue(2)	26		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)					243				0.664207	626.472583	632.938051	180	91	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	215907925	215907925	1124	2	T	G	G	52	52	ATIC	G	4	4
CEP68	23177	broad.mit.edu	36	2	65152467	65152467	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:65152467C>T	uc002sdl.2	+	c.733C>T	c.(733-735)CGG>TGG	p.R245W	CEP68_uc002sdj.2_Missense_Mutation_p.R245W|CEP68_uc002sdk.2_Missense_Mutation_p.R245W	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	245					centrosome organization	centrosome					0														0.153846	7.986844	10.962226	4	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65152467	65152467	3391	2	C	T	T	31	31	CEP68	T	1	1
TGFA	7039	broad.mit.edu	36	2	70595537	70595537	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:70595537G>A	uc010fdq.1	-	c.74C>T	c.(73-75)GCG>GTG	p.A25V	TGFA_uc010fdr.1_Missense_Mutation_p.A25V|TGFA_uc002sgs.2_Missense_Mutation_p.A19V|TGFA_uc002sgt.2_Missense_Mutation_p.A19V|TGFA_uc002sgu.2_Missense_Mutation_p.A19V|TGFA_uc002sgv.2_Missense_Mutation_p.A19V|TGFA_uc002sgw.2_Missense_Mutation_p.A19V	NM_003236	NP_003227	P01135	TGFA_HUMAN	transforming growth factor, alpha isoform 1	19					activation of MAPK activity|cell proliferation|positive regulation of cell division|positive regulation of epidermal growth factor receptor activity|positive regulation of epithelial cell proliferation|positive regulation of mitosis	cell surface|extracellular space|integral to membrane|plasma membrane	epidermal growth factor receptor binding|growth factor activity|MAP kinase kinase activity|signal transducer activity				0														0.353659	81.545354	83.095777	29	53	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70595537	70595537	16343	2	G	A	A	38	38	TGFA	A	1	1
EIF5B	9669	broad.mit.edu	36	2	99372662	99372662	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:99372662C>G	uc002tab.1	+	c.2321C>G	c.(2320-2322)GCT>GGT	p.A774G		NM_015904	NP_056988	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	774					regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(1)|pancreas(1)	2						Colon(162;2388 2567 2705 3444)								0.5	6.820271	6.820271	3	3	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99372662	99372662	5235	2	C	G	G	28	28	EIF5B	G	3	3
GAP43	2596	broad.mit.edu	36	3	116878018	116878018	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:116878018C>A	uc003ebr.1	+	c.607C>A	c.(607-609)CAA>AAA	p.Q203K	GAP43_uc003ebq.1_Missense_Mutation_p.Q167K	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	167					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of growth|response to wounding	cell junction|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)										0.333333	6.92269	7.143752	3	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116878018	116878018	6499	3	C	A	A	17	17	GAP43	A	3	3
SEMA5B	54437	broad.mit.edu	36	3	124112531	124112531	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:124112531G>T	uc003efz.1	-	c.3143C>A	c.(3142-3144)TCT>TAT	p.S1048Y	SEMA5B_uc003ega.1_Non-coding_Transcript|SEMA5B_uc003egb.1_Missense_Mutation_p.S1048Y|SEMA5B_uc003efy.1_Missense_Mutation_p.S26Y	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	1048	Helical; Signal-anchor for type III membrane protein; (Potential).				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)						383				0.4	8.192875	8.281628	4	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	124112531	124112531	14524	3	G	T	T	33	33	SEMA5B	T	3	3
MGLL	11343	broad.mit.edu	36	3	128922675	128922675	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:128922675T>G	uc003ejw.1	-	c.421A>C	c.(421-423)ACG>CCG	p.T141P	MGLL_uc010hsn.1_Missense_Mutation_p.T131P|MGLL_uc010hso.1_Intron|MGLL_uc003ejx.1_Missense_Mutation_p.T131P|MGLL_uc010hsp.1_Missense_Mutation_p.T131P|MGLL_uc003ejv.1_Missense_Mutation_p.T105P	NM_007283	NP_009214	Q99685	MGLL_HUMAN	monoglyceride lipase isoform 1	131					arachidonic acid metabolic process|fatty acid biosynthetic process|inflammatory response|platelet activation|regulation of endocannabinoid signaling pathway|regulation of inflammatory response|regulation of sensory perception of pain|triglyceride catabolic process	plasma membrane	acylglycerol lipase activity|lysophospholipase activity|protein homodimerization activity				0														0.214286	7.926713	10.048575	6	22	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128922675	128922675	9946	3	T	G	G	59	59	MGLL	G	4	4
PTH1R	5745	broad.mit.edu	36	3	46915943	46915943	+	Silent	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:46915943C>T	uc003cqm.1	+	c.981C>T	c.(979-981)TTC>TTT	p.F327F	PTH1R_uc003cqn.1_Silent_p.F327F	NM_000316	NP_000307	Q03431	PTH1R_HUMAN	parathyroid hormone receptor 1 precursor	327	Helical; Name=4; (Potential).					cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association				0														0.285714	10.999876	11.573369	4	10	CC		KEEP	---	---	---	---	capture			Silent	SNP	46915943	46915943	13213	3	C	T	T	31	31	PTH1R	T	1	1
MST1	4485	broad.mit.edu	36	3	49699802	49699802	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49699802T>G	uc003cxg.1	-	c.427A>C	c.(427-429)AAG>CAG	p.K143Q	MST1_uc010hkx.1_Missense_Mutation_p.K78Q|RNF123_uc003cxh.1_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	143	Kringle 1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GBM(110;181 1524 8005 22865 46297)								0.5	21.250319	21.250319	6	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49699802	49699802	10283	3	T	G	G	63	63	MST1	G	4	4
MST1	4485	broad.mit.edu	36	3	49699910	49699910	+	Missense_Mutation	SNP	C	T	T	rs2876714	unknown	TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49699910C>T	uc003cxg.1	-	c.319G>A	c.(319-321)GTA>ATA	p.V107I	MST1_uc010hkx.1_Missense_Mutation_p.V42I|RNF123_uc003cxh.1_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	107					proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GBM(110;181 1524 8005 22865 46297)								0.384615	14.273613	14.424655	5	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49699910	49699910	10283	3	C	T	T	19	19	MST1	T	1	1
FEZF2	55079	broad.mit.edu	36	3	62332333	62332334	+	Missense_Mutation	DNP	CC	TT	TT			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:62332333_62332334CC>TT	uc003dlh.2	-	c.901_902GG>AA	c.(901-903)GGA>AAA	p.G301K	FEZF2_uc003dli.2_Missense_Mutation_p.G301K	NM_018008	NP_060478	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	301					transcription, DNA-dependent	nucleus	zinc ion binding			lung(1)	1		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		NSCLC(170;1772 2053 12525 15604 23984)								0.384615	9.362895	9.517353	5	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	62332333	62332334	6063	3	CC	TT	TT	30	30	FEZF2	TT	2	2
MAGI1	9223	broad.mit.edu	36	3	65317570	65317570	+	Silent	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:65317570C>G	uc003dmn.1	-	c.3912G>C	c.(3910-3912)CGG>CGC	p.R1304R	MAGI1_uc003dmm.1_3'UTR	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	1333					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			kidney(1)|pancreas(1)	2		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)										0.174312	18.041483	29.000485	19	90	CC		KEEP	---	---	---	---	capture			Silent	SNP	65317570	65317570	9573	3	C	G	G	30	30	MAGI1	G	3	3
PRSS12	8492	broad.mit.edu	36	4	119478898	119478898	+	Silent	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:119478898G>T	uc003ica.1	-	c.522C>A	c.(520-522)GGC>GGA	p.G174G		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	174	SRCR 1.					membrane	scavenger receptor activity				0														0.149425	21.511886	31.778624	13	74	GG		KEEP	---	---	---	---	capture			Silent	SNP	119478898	119478898	13065	4	G	T	T	38	38	PRSS12	T	3	3
POU4F2	5458	broad.mit.edu	36	4	147780686	147780688	+	Missense_Mutation	TNP	GCA	ATT	ATT			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:147780686_147780688GCA>ATT	uc003ikv.1	+	c.506_508GCA>ATT	c.(505-510)GGCACG>GATTCG	p.169_170GT>DS		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	169_170					negative regulation of transcription from RNA polymerase II promoter	nuclear speck	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			breast(1)	1	all_hematologic(180;0.151)													0.5	13.34428	13.34428	6	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	147780686	147780688	12709	4	GCA	ATT	ATT	42	42	POU4F2	ATT	2	2
FAM198B	51313	broad.mit.edu	36	4	159311276	159311276	+	Silent	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:159311276C>T	uc003ipq.2	-	c.702G>A	c.(700-702)GGG>GGA	p.G234G	FAM198B_uc003ipp.2_Silent_p.G234G|FAM198B_uc003ipr.2_Silent_p.G234G|FAM198B_uc003ips.2_Silent_p.G234G	NM_001031700	NP_001026870	Q6UWH4	F198B_HUMAN	hypothetical protein LOC51313 isoform 1	234	Extracellular (Potential).					Golgi membrane|integral to membrane					0												OREG0016378	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.272727	9.639356	10.66615	6	16	CC		KEEP	---	---	---	---	capture			Silent	SNP	159311276	159311276	5743	4	C	T	T	26	26	FAM198B	T	2	2
MARCH1	55016	broad.mit.edu	36	4	164726506	164726506	+	Nonsense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:164726506C>A	uc003iqs.1	-	c.268G>T	c.(268-270)GAG>TAG	p.E90*	MARCH1_uc003iqr.1_Nonsense_Mutation_p.E73*	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I	90	RING-CH-type.					cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)												0.121951	6.550571	12.285919	5	36	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	164726506	164726506	9681	4	C	A	A	32	32	MARCH1	A	5	3
HTT	3064	broad.mit.edu	36	4	3119569	3119569	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:3119569A>C	uc010icr.1	+	c.3341A>C	c.(3340-3342)GAA>GCA	p.E1114A		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1112					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			ovary(1)|lung(1)	2		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)										0.193548	6.928481	9.656421	6	25	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3119569	3119569	7757	4	A	C	C	9	9	HTT	C	4	4
TMPRSS11B	132724	broad.mit.edu	36	4	68784502	68784502	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:68784502G>T	uc003hdw.2	-	c.202C>A	c.(202-204)CAA>AAA	p.Q68K		NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	68	SEA.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1														0.333333	8.353723	8.843527	6	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68784502	68784502	16780	4	G	T	T	48	48	TMPRSS11B	T	3	3
PRDM8	56978	broad.mit.edu	36	4	81343558	81343558	+	Silent	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:81343558C>T	uc010ijo.1	+	c.1918C>T	c.(1918-1920)CTG>TTG	p.L640L	PRDM8_uc003hmb.2_Silent_p.L640L|PRDM8_uc003hmc.2_Silent_p.L640L	NM_020226	NP_064611	Q9NQV8	PRDM8_HUMAN	PR domain containing 8	640	C2H2-type 2.			L -> M (in Ref. 4; AAH71584).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.428571	6.620697	6.652376	3	4	CC		KEEP	---	---	---	---	capture			Silent	SNP	81343558	81343558	12905	4	C	T	T	24	24	PRDM8	T	2	2
SH3TC1	54436	broad.mit.edu	36	4	8279744	8279744	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:8279744G>T	uc003gkv.2	+	c.1423G>T	c.(1423-1425)GTG>TTG	p.V475L	SH3TC1_uc003gkw.2_Missense_Mutation_p.V399L|SH3TC1_uc003gkx.2_Non-coding_Transcript|SH3TC1_uc003gky.1_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	475							binding			large_intestine(2)|pancreas(1)	3						NSCLC(145;2298 2623 35616 37297)								0.75	6.822739	7.047115	3	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8279744	8279744	14753	4	G	T	T	40	40	SH3TC1	T	3	3
SH3TC1	54436	broad.mit.edu	36	4	8279746	8279746	+	Silent	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:8279746G>T	uc003gkv.2	+	c.1425G>T	c.(1423-1425)GTG>GTT	p.V475V	SH3TC1_uc003gkw.2_Silent_p.V399V|SH3TC1_uc003gkx.2_Non-coding_Transcript|SH3TC1_uc003gky.1_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	475							binding			large_intestine(2)|pancreas(1)	3						NSCLC(145;2298 2623 35616 37297)								0.75	6.521187	6.745325	3	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	8279746	8279746	14753	4	G	T	T	45	45	SH3TC1	T	3	3
GPRIN3	285513	broad.mit.edu	36	4	90388972	90388972	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:90388972C>G	uc003hsm.1	-	c.1313G>C	c.(1312-1314)GGG>GCG	p.G438A	GPRIN3_uc010iks.1_Missense_Mutation_p.G438A	NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	438										ovary(2)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)										0.195122	9.166189	12.738409	8	33	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	90388972	90388972	7007	4	C	G	G	22	22	GPRIN3	G	3	3
PCDHA13	56136	broad.mit.edu	36	5	140242468	140242469	+	Missense_Mutation	DNP	AA	CC	CC			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140242468_140242469AA>CC	uc003lif.1	+	c.431_432AA>CC	c.(430-432)GAA>GCC	p.E144A	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhq.1_Intron|PCDHA8_uc003lhs.1_Intron|PCDHA9_uc003lhu.1_Intron|PCDHA10_uc003lhx.1_Intron|PCDHA10_uc003lhw.1_Intron|PCDHA11_uc003lia.1_Intron|PCDHA12_uc003lic.1_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.E144A|PCDHA13_uc003lid.1_Missense_Mutation_p.E144A	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	144	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			Melanoma(147;1739 1852 5500 27947 37288)								0.21875	9.70221	12.044173	7	25	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	140242468	140242469	11943	5	AA	CC	CC	9	9	PCDHA13	CC	4	4
PCDHB14	56122	broad.mit.edu	36	5	140584895	140584895	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140584895C>A	uc003ljb.1	+	c.1634C>A	c.(1633-1635)GCG>GAG	p.A545E		NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	545	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			Ovarian(141;50 1831 27899 33809 37648)								0.3125	9.767324	10.269374	5	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140584895	140584895	11959	5	C	A	A	27	27	PCDHB14	A	3	3
MAST4	375449	broad.mit.edu	36	5	66497125	66497125	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:66497125G>C	uc003jut.1	+	c.5795G>C	c.(5794-5796)AGG>ACG	p.R1932T	MAST4_uc003juw.1_Missense_Mutation_p.R1174T|MAST4_uc003jux.2_5'Flank	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	2124					protein phosphorylation	cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)						805				0.361111	32.558459	33.172151	13	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66497125	66497125	9711	5	G	C	C	35	35	MAST4	C	3	3
AGGF1	55109	broad.mit.edu	36	5	76368219	76368219	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:76368219C>A	uc003ket.1	+	c.599C>A	c.(598-600)GCG>GAG	p.A200E	AGGF1_uc003keu.1_Non-coding_Transcript	NM_018046	NP_060516	Q8N302	AGGF1_HUMAN	angiogenic factor VG5Q	200					angiogenesis|cell adhesion|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|RNA processing|vasculogenesis	extracellular region|perinuclear region of cytoplasm	eukaryotic cell surface binding|nucleic acid binding|protein binding			ovary(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)										0.109091	7.810408	16.133078	6	49	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76368219	76368219	385	5	C	A	A	27	27	AGGF1	A	3	3
GPRC6A	222545	broad.mit.edu	36	6	117237474	117237474	+	Splice_Site_SNP	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:117237474C>G	uc003pxj.1	-	c.e2_splice_site			GPRC6A_uc003pxk.1_Splice_Site_SNP|GPRC6A_uc003pxl.1_Splice_Site_SNP	NM_148963	NP_683766			G protein-coupled receptor, family C, group 6,						response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)										0.235294	11.093778	12.181374	4	13	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	117237474	117237474	7004	6	C	G	G	28	28	GPRC6A	G	5	3
RAET1L	154064	broad.mit.edu	36	6	150388222	150388222	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:150388222G>C	uc003qnr.2	-	c.79C>G	c.(79-81)CGA>GGA	p.R27G		NM_130900	NP_570970	Q5VY80	RET1L_HUMAN	retinoic acid early transcript 1L	27					antigen processing and presentation|immune response	anchored to membrane|MHC class I protein complex					0		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.4e-12)										0.416667	17.186559	17.340475	10	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150388222	150388222	13461	6	G	C	C	38	38	RAET1L	C	3	3
FAM8A1	51439	broad.mit.edu	36	6	17710871	17710871	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:17710871T>A	uc003ncc.1	+	c.784T>A	c.(784-786)TTT>ATT	p.F262I		NM_016255	NP_057339	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	262	RDD.|Helical; (Potential).					integral to membrane					0	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)											0.232558	16.819468	19.646427	10	33	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17710871	17710871	5875	6	T	A	A	56	56	FAM8A1	A	4	4
BAT3	7917	broad.mit.edu	36	6	31724477	31724477	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31724477G>A	uc003nvg.2	-	c.508C>T	c.(508-510)CAG>TAG	p.Q170*	BAT3_uc003nvf.2_Nonsense_Mutation_p.Q170*|BAT3_uc003nvh.2_Nonsense_Mutation_p.Q170*|BAT3_uc003nvi.2_Nonsense_Mutation_p.Q170*|BAT3_uc003nvj.1_Nonsense_Mutation_p.Q170*	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a	170					apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0										141				0.1875	19.247662	23.637138	9	39	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	31724477	31724477	1343	6	G	A	A	45	45	BAT3	A	5	2
LY6G6F	259215	broad.mit.edu	36	6	31783821	31783821	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31783821A>G	uc003nwb.1	+	c.577A>G	c.(577-579)AGG>GGG	p.R193G	LY6G6F_uc003nwa.1_Missense_Mutation_p.R193G	NM_001003693	NP_001003693	Q5SQ64	LY66F_HUMAN	G6f protein	193	Extracellular (Potential).					integral to membrane|plasma membrane				breast(1)|central_nervous_system(1)	2														0.176471	6.615609	8.291662	3	14	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31783821	31783821	9473	6	A	G	G	7	7	LY6G6F	G	4	4
IRF4	3662	broad.mit.edu	36	6	338245	338245	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:338245G>T	uc003msz.2	+	c.93G>T	c.(91-93)CAG>CAT	p.Q31H	IRF4_uc010jne.1_Missense_Mutation_p.Q31H|IRF4_uc003mta.2_Non-coding_Transcript|IRF4_uc003mtb.2_Missense_Mutation_p.Q31H	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4	31	IRF tryptophan pentad repeat.				interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)						223				0.5	6.719154	6.719154	3	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	338245	338245	8135	6	G	T	T	33	33	IRF4	T	3	3
ABCC10	89845	broad.mit.edu	36	6	43508502	43508502	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43508502A>G	uc003ouy.1	+	c.806A>G	c.(805-807)GAG>GGG	p.E269G	ABCC10_uc003ouz.1_Missense_Mutation_p.E226G|ABCC10_uc010jyo.1_5'Flank	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	269						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(5)|central_nervous_system(1)	6	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)											0.352941	10.631743	10.96116	6	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43508502	43508502	51	6	A	G	G	11	11	ABCC10	G	4	4
BAI3	577	broad.mit.edu	36	6	69814804	69814805	+	Missense_Mutation	DNP	GT	AA	AA			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:69814804_69814805GT>AA	uc003pev.2	+	c.2114_2115GT>AA	c.(2113-2115)AGT>AAA	p.S705K	BAI3_uc010kak.1_Missense_Mutation_p.S705K	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	705	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(7)|skin(6)|pancreas(4)|central_nervous_system(3)|lung(3)|urinary_tract(1)	24		all_lung(197;0.212)							p.S705N(HS600.T-Tumor)|p.S705N(NCCSTCK140-Tumor)|p.S705N(COLO320-Tumor)|p.S705N(YD8-Tumor)|p.S705N(SNU601-Tumor)|p.S705K(CAL51-Tumor)|p.S705N(PATU8902-Tumor)|p.S705N(PFEIFFER-Tumor)|p.S705N(KASUMI2-Tumor)|p.S705N(CAL62-Tumor)|p.S705N(T3M4-Tumor)|p.S705N(OE33-Tumor)|p.S705N(697-Tumor)|p.S705N(HS742.T-Tumor)|p.S705N(SNU1196-Tumor)|p.S705N(NCIH82-Tumor)|p.S705N(HH-Tumor)|p.S705N(NMCG1-Tumor)|p.S705N(C3A-Tumor)|p.S705N(PECAPJ49-Tumor)|p.S705N(ACCMESO1-Tumor)|p.S705N(TE125.T-Tumor)|p.S705N(SUDHL6-Tumor)|p.S705N(WM793-Tumor)|p.S705N(ECC10-Tumor)|p.S705N(OCIAML5-Tumor)|p.S705N(8305C-Tumor)|p.S705N(HCC2279-Tumor)|p.S705N(HS940.T-Tumor)|p.S705N(HOS-Tumor)|p.S705N(SNU201-Tumor)|p.S705N(CAS1-Tumor)|p.S705N(JHOS2-Tumor)|p.S705N(TE11-Tumor)|p.S705N(WM115-Tumor)|p.S705N(HS604.T-Tumor)|p.S705N(COLO680N-Tumor)|p.S705N(COLO792-Tumor)|p.S705N(DM3-Tumor)|p.S705N(YD10B-Tumor)|p.S705N(LXF289-Tumor)|p.S705N(JHOC5-Tumor)|p.S705N(WM2664-Tumor)|p.S705N(ECGI10-Tumor)|p.S705N(SKBR3-Tumor)|p.S705N(CADOES1-Tumor)|p.S705N(RS5-Tumor)|p.S705N(DMS454-Tumor)|p.S705N(COLO818-Tumor)|p.S705N(NCIH1573-Tumor)|p.S705N(SBC5-Tumor)|p.S705N(T47D-Tumor)|p.S705N(SNU886-Tumor)	992				0.325	28.671299	29.753292	13	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	69814804	69814805	1321	6	GT	AA	AA	36	36	BAI3	AA	2	2
KCNQ5	56479	broad.mit.edu	36	6	73961234	73961234	+	Silent	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:73961234A>C	uc003pgk.1	+	c.2175A>C	c.(2173-2175)GCA>GCC	p.A725A	KCNQ5_uc010kat.1_Silent_p.A716A	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	725					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)	6		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		GBM(142;1375 1859 14391 23261 44706)								0.28	10.299563	11.399373	7	18	AA		KEEP	---	---	---	---	capture			Silent	SNP	73961234	73961234	8391	6	A	C	C	7	7	KCNQ5	C	4	4
SPACA1	81833	broad.mit.edu	36	6	88830560	88830560	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:88830560T>C	uc003pmn.1	+	c.635T>C	c.(634-636)CTA>CCA	p.L212P		NM_030960	NP_112222	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	212	Extracellular (Potential).					integral to membrane					0		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)										0.27027	10.714621	12.664453	10	27	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88830560	88830560	15473	6	T	C	C	53	53	SPACA1	C	4	4
PHF14	9678	broad.mit.edu	36	7	10988848	10988848	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:10988848C>G	uc003srz.1	+	c.437C>G	c.(436-438)GCT>GGT	p.A146G	PHF14_uc003sry.1_Missense_Mutation_p.A146G	NM_001007157	NP_001007158	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 1	146							zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)										0.191304	11.85097	22.542815	22	93	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10988848	10988848	12248	7	C	G	G	28	28	PHF14	G	3	3
FAM40B	57464	broad.mit.edu	36	7	128891149	128891149	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:128891149C>G	uc003vox.1	+	c.1580C>G	c.(1579-1581)GCA>GGA	p.A527G	FAM40B_uc003vow.1_Missense_Mutation_p.A527G	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	527											0														0.166667	7.107414	12.293285	8	40	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128891149	128891149	5782	7	C	G	G	25	25	FAM40B	G	3	3
HDAC9	9734	broad.mit.edu	36	7	18982049	18982049	+	Silent	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:18982049C>T	uc003sui.1	+	c.3118C>T	c.(3118-3120)CTG>TTG	p.L1040L	HDAC9_uc003sue.1_Silent_p.L1037L|HDAC9_uc003suj.1_Silent_p.L996L|HDAC9_uc003suk.1_Silent_p.L285L	NM_178425	NP_848512	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 5	Error:Variant_position_missing_in_Q9UKV0_after_alignment					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|specific transcriptional repressor activity|transcription corepressor activity|transcription repressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)									0.598765	317.792496	319.173743	97	65	CC		KEEP	---	---	---	---	capture			Silent	SNP	18982049	18982049	7297	7	C	T	T	24	24	HDAC9	T	2	2
MDH2	4191	broad.mit.edu	36	7	75533602	75533602	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:75533602G>T	uc003ueo.1	+	c.955G>T	c.(955-957)GCC>TCC	p.A319S	MDH2_uc003uep.1_Missense_Mutation_p.A212S	NM_005918	NP_005909	P40926	MDHM_HUMAN	mitochondrial malate dehydrogenase precursor	319					gluconeogenesis|malate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus|plasma membrane	binding|L-malate dehydrogenase activity			ovary(1)|central_nervous_system(1)	2					NADH(DB00157)									0.180556	11.905875	18.863195	13	59	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75533602	75533602	9799	7	G	T	T	46	46	MDH2	T	3	3
MTMR7	9108	broad.mit.edu	36	8	17202097	17202097	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:17202097T>C	uc003wxm.1	-	c.1628A>G	c.(1627-1629)GAA>GGA	p.E543G		NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	543							protein tyrosine phosphatase activity				0				Colorectal(111;0.112)										0.223881	10.899205	15.9713	15	52	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17202097	17202097	10341	8	T	C	C	62	62	MTMR7	C	4	4
PALM2-AKAP2	445815	broad.mit.edu	36	9	111940272	111940272	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:111940272C>A	uc004bei.2	+	c.3323C>A	c.(3322-3324)CCT>CAT	p.P1108H	PALM2-AKAP2_uc004bek.2_Missense_Mutation_p.P876H|PALM2-AKAP2_uc004bej.2_Missense_Mutation_p.P876H|PALM2-AKAP2_uc004bel.1_Missense_Mutation_p.P686H|AKAP2_uc004bem.1_Missense_Mutation_p.P734H|PALM2-AKAP2_uc010mtw.1_Missense_Mutation_p.P694H|PALM2-AKAP2_uc004ben.1_Missense_Mutation_p.P645H	NM_001004065	NP_001004065	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 1	645							enzyme binding			ovary(3)|central_nervous_system(2)	5														0.238095	7.057882	8.381845	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111940272	111940272	11826	9	C	A	A	24	24	PALM2-AKAP2	A	3	3
GSN	2934	broad.mit.edu	36	9	123104233	123104233	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:123104233G>T	uc004blf.1	+	c.316G>T	c.(316-318)GGA>TGA	p.G106*	GSN_uc004bld.1_Nonsense_Mutation_p.G55*|GSN_uc010mvq.1_Nonsense_Mutation_p.G66*|GSN_uc010mvr.1_Nonsense_Mutation_p.G66*|GSN_uc010mvs.1_Nonsense_Mutation_p.G55*|GSN_uc010mvt.1_Nonsense_Mutation_p.G55*|GSN_uc010mvu.1_Nonsense_Mutation_p.G55*|GSN_uc004ble.1_Nonsense_Mutation_p.G55*|GSN_uc010mvv.1_Nonsense_Mutation_p.G55*	NM_000177	NP_000168	P06396	GELS_HUMAN	gelsolin isoform a precursor	106	Actin-severing (Potential).|Gelsolin-like 1.				actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3														0.151163	7.395184	17.482612	13	73	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	123104233	123104233	7105	9	G	T	T	39	39	GSN	T	5	3
KIAA0649	9858	broad.mit.edu	36	9	137518743	137518743	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:137518743T>C	uc004cfr.1	+	c.2566T>C	c.(2566-2568)TCA>CCA	p.S856P	KIAA0649_uc010nas.1_Missense_Mutation_p.S856P	NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	856						nucleolus	protein binding			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)										0.647059	25.815433	26.136544	11	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	137518743	137518743	8494	9	T	C	C	62	62	KIAA0649	C	4	4
RANBP6	26953	broad.mit.edu	36	9	6004820	6004821	+	Missense_Mutation	DNP	AA	TT	TT			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:6004820_6004821AA>TT	uc003zjr.1	-	c.787_788TT>AA	c.(787-789)TTA>AAA	p.L263K	RANBP6_uc003zjs.1_Intron	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	263					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)										0.1875	10.133088	14.546299	9	39	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	6004820	6004821	13491	9	AA	TT	TT	13	13	RANBP6	TT	4	4
SUSD3	203328	broad.mit.edu	36	9	94877910	94877910	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:94877910C>A	uc004atb.1	+	c.112C>A	c.(112-114)CCC>ACC	p.P38T	SUSD3_uc004atc.1_Missense_Mutation_p.P25T	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN	sushi domain containing 3	38	Sushi.|Extracellular (Potential).					integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6														0.333333	10.750579	11.190127	6	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94877910	94877910	15929	9	C	A	A	18	18	SUSD3	A	3	3
TRIM14	9830	broad.mit.edu	36	9	99912007	99912007	+	Silent	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:99912007G>A	uc004ayd.1	-	c.288C>T	c.(286-288)GCC>GCT	p.A96A	TRIM14_uc004ayf.1_Missense_Mutation_p.P2L|TRIM14_uc004ayg.1_Silent_p.A96A|TRIM14_uc004ayh.1_Silent_p.A96A|TRIM14_uc004ayi.1_Silent_p.A96A|TRIM14_uc004ayj.1_Missense_Mutation_p.P2L	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha	96	Potential.					cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)				Colon(14;460 597 13826 51781)								0.243697	69.115844	76.242964	29	90	GG		KEEP	---	---	---	---	capture			Silent	SNP	99912007	99912007	17033	9	G	A	A	47	47	TRIM14	A	2	2
KIAA1210	57481	broad.mit.edu	36	X	118105561	118105561	+	Silent	SNP	C	T	T			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:118105561C>T	uc004era.2	-	c.3660G>A	c.(3658-3660)CTG>CTA	p.L1220L		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1220										ovary(4)|skin(1)	5														0.206897	7.426387	9.747598	6	23	CC		KEEP	---	---	---	---	capture			Silent	SNP	118105561	118105561	8522	23	C	T	T	25	25	KIAA1210	T	2	2
AIFM1	9131	broad.mit.edu	36	X	129097829	129097829	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:129097829G>A	uc004evg.1	-	c.1177C>T	c.(1177-1179)CAC>TAC	p.H393Y	AIFM1_uc004evh.1_Missense_Mutation_p.H389Y|AIFM1_uc004evi.1_Missense_Mutation_p.H106Y|AIFM1_uc004evj.1_Non-coding_Transcript|AIFM1_uc004evk.1_Non-coding_Transcript|AIFM1_uc004evf.1_Missense_Mutation_p.H54Y	NM_004208	NP_004199	O95831	AIFM1_HUMAN	programmed cell death 8 isoform 1	393	FAD-dependent oxidoreductase (By similarity).				activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|oxidation-reduction process	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(4)|central_nervous_system(1)	5										210				0.555556	10.264263	10.28725	5	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129097829	129097829	429	23	G	A	A	47	47	AIFM1	A	2	2
SLITRK4	139065	broad.mit.edu	36	X	142546575	142546575	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:142546575A>C	uc004fbx.1	-	c.16T>G	c.(16-18)TTT>GTT	p.F6V	SLITRK4_uc004fby.1_Missense_Mutation_p.F6V|SLITRK4_uc010nsn.1_Missense_Mutation_p.F6V	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein	6						integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)													0.590909	19.089602	19.220465	13	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	142546575	142546575	15243	23	A	C	C	2	2	SLITRK4	C	4	4
CETN2	1069	broad.mit.edu	36	X	151747056	151747056	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1458-01	TCGA-14-1458-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:151747056C>G	uc004fgq.1	-	c.504G>C	c.(502-504)AAG>AAC	p.K168N	CETN2_uc004fgr.1_Missense_Mutation_p.K97N	NM_004344	NP_004335	P41208	CETN2_HUMAN	caltractin	168	EF-hand 4.				cell division|centriole replication|G2/M transition of mitotic cell cycle|mitosis|nucleotide-excision repair|regulation of cytokinesis	centriole|cytosol|XPC complex	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding				0	Acute lymphoblastic leukemia(192;6.56e-05)													0.175676	9.889529	17.575222	13	61	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	151747056	151747056	3408	23	C	G	G	32	32	CETN2	G	3	3
FLNA	2316	broad.mit.edu	36	X	153234952	153234952	+	Silent	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153234952T>G	uc004fkk.2	-	c.5928A>C	c.(5926-5928)TCA>TCC	p.S1976S	FLNA_uc004fki.2_Silent_p.S19S|FLNA_uc010nuu.1_Silent_p.S1968S	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1976	Filamin 18.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	actin cytoskeleton|cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)									518				0.307692	6.890724	7.322195	4	9	TT		KEEP	---	---	---	---	capture			Silent	SNP	153234952	153234952	6175	23	T	G	G	55	55	FLNA	G	4	4
ATP6AP2	10159	broad.mit.edu	36	X	40341470	40341470	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:40341470T>G	uc004det.1	+	c.326T>G	c.(325-327)GTT>GGT	p.V109G	ATP6AP2_uc010nhc.1_Non-coding_Transcript|ATP6AP2_uc004deu.1_5'Flank	NM_005765	NP_005756	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory	109	Extracellular (Potential).				angiotensin maturation|positive regulation of transforming growth factor-beta1 production|regulation of MAPKKK cascade	external side of plasma membrane|integral to membrane	protein binding|receptor activity				0														0.217391	7.255886	8.958535	5	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40341470	40341470	1186	23	T	G	G	60	60	ATP6AP2	G	4	4
ZNF41	7592	broad.mit.edu	36	X	47192979	47192979	+	Silent	SNP	T	G	G			TCGA-14-1458-01	TCGA-14-1458-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:47192979T>G	uc004dhs.2	-	c.1260A>C	c.(1258-1260)ACA>ACC	p.T420T	ZNF41_uc004dht.2_Silent_p.T292T|ZNF41_uc004dhu.2_Silent_p.T412T|ZNF41_uc004dhv.2_Silent_p.T388T|ZNF41_uc004dhw.2_Silent_p.T380T|ZNF41_uc004dhy.2_Silent_p.T378T|ZNF41_uc004dhx.2_Silent_p.T378T	NM_153380	NP_700359	P51814	ZNF41_HUMAN	zinc finger protein 41	420					regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3		all_lung(315;0.000129)												0.263158	7.962988	8.931046	5	14	TT		KEEP	---	---	---	---	capture			Silent	SNP	47192979	47192979	18482	23	T	G	G	55	55	ZNF41	G	4	4
HUWE1	10075	broad.mit.edu	36	X	53632127	53632127	+	Silent	SNP	G	A	A			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:53632127G>A	uc004dso.1	-	c.4554C>T	c.(4552-4554)GCC>GCT	p.A1518A	HUWE1_uc004dsn.1_Silent_p.A343A|HUWE1_uc004dsp.1_Silent_p.A1518A	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	1518					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17														0.556	450.631345	451.312139	139	111	GG		KEEP	---	---	---	---	capture			Silent	SNP	53632127	53632127	7761	23	G	A	A	47	47	HUWE1	A	2	2
ZMYM3	9203	broad.mit.edu	36	X	70386253	70386253	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1458-01	TCGA-14-1458-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70386253A>C	uc004dzh.1	-	c.1253T>G	c.(1252-1254)GTC>GGC	p.V418G	ZMYM3_uc004dzi.1_Missense_Mutation_p.V418G|ZMYM3_uc004dzj.1_Missense_Mutation_p.V418G|ZMYM3_uc004dzk.2_Missense_Mutation_p.V418G|ZMYM3_uc004dzl.2_Missense_Mutation_p.V418G|ZMYM3_uc004dzm.2_Missense_Mutation_p.V418G	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	418	MYM-type 2.				multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)													0.363636	6.389097	6.612261	4	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70386253	70386253	18292	23	A	C	C	10	10	ZMYM3	C	4	4
PIN4	5303	broad.mit.edu	36	X	71333380	71333381	+	Missense_Mutation	DNP	AA	GC	GC			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:71333380_71333381AA>GC	uc004eam.1	+	c.213_214AA>GC	c.(211-216)GAAAAA>GAGCAA	p.K72Q	PIN4_uc004eao.1_Missense_Mutation_p.K72Q	NM_006223	NP_006214	Q9Y237	PIN4_HUMAN	protein (peptidyl-prolyl cis/trans isomerase)	47	PpiC.				protein folding|rRNA processing	cytoplasm|mitochondrial matrix|mitochondrial matrix|nucleolus|nucleolus|preribosome|spindle|spindle	bent DNA binding|DNA binding|double-stranded DNA binding|peptidyl-prolyl cis-trans isomerase activity				0	Renal(35;0.156)													0.321429	17.856556	18.654429	9	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	71333380	71333381	12355	23	AA	GC	GC	1	1	PIN4	GC	4	4
CSTF2	1478	broad.mit.edu	36	X	99964032	99964032	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1458-01	TCGA-14-1458-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:99964032G>T	uc010nnd.1	+	c.274G>T	c.(274-276)GCT>TCT	p.A92S	CSTF2_uc004egh.1_Missense_Mutation_p.A92S|CSTF2_uc004egi.1_Missense_Mutation_p.A92S	NM_001325	NP_001316	P33240	CSTF2_HUMAN	cleavage stimulation factor subunit 2	92	RRM.				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	nucleotide binding|protein binding|protein binding|RNA binding				0														0.428571	12.74303	12.805942	6	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99964032	99964032	4125	23	G	T	T	46	46	CSTF2	T	3	3
KRT85	3891	broad.mit.edu	36	12	51047398	51047399	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:51047398_51047399delGA	uc001sag.1	-	c.58_59delTC	c.(58-60)TCCfs	p.S20fs		NM_002283	NP_002274	P78386	KRT85_HUMAN	keratin 85	20	Head.				epidermis development	keratin filament	protein binding|structural molecule activity			ovary(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)										0.58			7	5				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	51047398	51047399	8814	12	GA	-	-	41	41	KRT85	-	5	5
PABPN1	8106	broad.mit.edu	36	14	22863229	22863232	+	Frame_Shift_Del	DEL	GACC	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:22863229_22863232delGACC	uc001wjh.2	+	c.853_856delGACC	c.(853-858)GACCGGfs	p.D285fs	PABPN1_uc001wjj.1_Frame_Shift_Del_p.D258fs|PABPN1_uc001wjk.1_Frame_Shift_Del_p.D258fs	NM_004643	NP_004634	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	258_259	Necessary for homooligomerization.				modification by virus of host mRNA processing|mRNA 3'-end processing|muscle contraction|nuclear mRNA splicing, via spliceosome|poly(A)+ mRNA export from nucleus|termination of RNA polymerase II transcription|viral infectious cycle	cytoplasm|nucleoplasm|ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding			ovary(2)	2	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)						17				0.44			60	77				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	22863229	22863232	11784	14	GACC	-	-	33	33	PABPN1	-	5	5
OSBPL1A	114876	broad.mit.edu	36	18	20211439	20211440	+	In_Frame_Ins	INS	-	AGC	AGC			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:20211439_20211440insAGC	uc002kve.1	-	c.56_57insGCT	c.(55-57)GAA>GAGCTA	p.19_20insL		NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B	19_20					cholesterol metabolic process|lipid transport|vesicle-mediated transport	intracellular	phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)													0.37			68	118				---	---	---	---	capture_indel			In_Frame_Ins	INS	20211439	20211440	11688	18	-	AGC	AGC	56	56	OSBPL1A	AGC	5	5
DEDD2	162989	broad.mit.edu	36	19	47405822	47405823	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:47405822_47405823insG	uc002osu.1	-	c.458_459insC	c.(457-459)CCAfs	p.P153fs	DEDD2_uc002osv.1_Non-coding_Transcript|DEDD2_uc002osw.1_Frame_Shift_Ins_p.P148fs|DEDD2_uc002osx.1_Frame_Shift_Ins_p.Q37fs|DEDD2_uc002osy.1_Frame_Shift_Ins_p.P153fs|DEDD2_uc010eid.1_Non-coding_Transcript	NM_133328	NP_579874	Q8WXF8	DEDD2_HUMAN	death effector domain-containing  DNA binding	153					activation of pro-apoptotic gene products|apoptotic nuclear change|cellular homeostasis|induction of apoptosis via death domain receptors|intracellular signal transduction|negative regulation of transcription, DNA-dependent|RNA processing|rRNA catabolic process|transcription, DNA-dependent	nucleolus	DNA binding|receptor signaling complex scaffold activity				0		Prostate(69;0.0704)												0.33			4	8				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	47405822	47405823	4556	19	-	G	G	63	63	DEDD2	G	5	5
FCAR	2204	broad.mit.edu	36	19	60091391	60091397	+	Frame_Shift_Del	DEL	GATCTAC	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:60091391_60091397delGATCTAC	uc002qhr.1	+	c.567_573delGATCTAC	c.(565-573)GGGATCTACfs	p.G189fs	FCAR_uc002qhq.1_Frame_Shift_Del_p.G189fs|FCAR_uc002qhs.1_Intron|FCAR_uc002qht.1_Frame_Shift_Del_p.G162fs|FCAR_uc010esi.1_Intron|FCAR_uc002qhu.1_Intron|FCAR_uc002qhv.1_Frame_Shift_Del_p.G189fs|FCAR_uc002qhw.1_Frame_Shift_Del_p.G177fs|FCAR_uc002qhx.1_Intron|FCAR_uc002qhy.1_Frame_Shift_Del_p.G177fs|FCAR_uc002qhz.1_Frame_Shift_Del_p.G177fs|FCAR_uc002qia.1_Frame_Shift_Del_p.G80fs	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	189_191	Ig-like C2-type 2.|Extracellular (Potential).				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0443)										0.48			36	39				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	60091391	60091397	6010	19	GATCTAC	-	-	41	41	FCAR	-	5	5
NIT1	4817	broad.mit.edu	36	1	159356577	159356578	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:159356577_159356578insC	uc001fxv.1	+	c.648_649insC	c.(646-651)GCTCAAfs	p.A216fs	PFDN2_uc001fxu.1_5'Flank|NIT1_uc001fxw.2_Frame_Shift_Ins_p.A216fs|NIT1_uc001fxx.1_Frame_Shift_Ins_p.A180fs|NIT1_uc001fxy.1_Frame_Shift_Ins_p.A180fs	NM_005600	NP_005591	Q86X76	NIT1_HUMAN	nitrilase 1	216_217	CN hydrolase.				nitrogen compound metabolic process	mitochondrion	nitrilase activity				0	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)									OREG0013937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.32			31	65				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	159356577	159356578	10834	1	-	C	C	54	54	NIT1	C	5	5
MYOM3	127294	broad.mit.edu	36	1	24267413	24267414	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:24267413_24267414insT	uc001bin.2	-	c.3181_3182insA	c.(3181-3183)GGCfs	p.G1061fs	MYOM3_uc001bil.2_5'Flank|MYOM3_uc001bim.2_Frame_Shift_Ins_p.G718fs|MYOM3_uc001bio.2_Frame_Shift_Ins_p.G1061fs	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1061										ovary(1)	1		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)										0.36			39	68				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	24267413	24267414	10488	1	-	T	T	26	26	MYOM3	T	5	5
ARID1A	8289	broad.mit.edu	36	1	26973862	26973864	+	In_Frame_Del	DEL	GGG	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:26973862_26973864delGGG	uc001bmv.1	+	c.4557_4559delGGG	c.(4555-4560)CAGGGC>CAC	p.1519_1520QG>H	ARID1A_uc001bmt.1_In_Frame_Del_p.1518_1519QG>H|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_In_Frame_Del_p.1136_1137QG>H|ARID1A_uc001bmx.1_In_Frame_Del_p.365_366QG>H|ARID1A_uc009vsm.1_Intron|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1519_1520					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding|transcription activator activity			ovary(124)|endometrium(3)|kidney(3)|central_nervous_system(2)|pancreas(2)|lung(1)|skin(1)	136		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)						478				0.66			68	35				---	---	---	---	capture_indel			In_Frame_Del	DEL	26973862	26973864	928	1	GGG	-	-	35	35	ARID1A	-	5	5
GPN2	54707	broad.mit.edu	36	1	27085150	27085155	+	In_Frame_Del	DEL	AGCCAG	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:27085150_27085155delAGCCAG	uc001bnd.1	-	c.625_630delCTGGCT	c.(625-630)CTGGCTdel	p.LA209del		NM_018066	NP_060536	Q9H9Y4	GPN2_HUMAN	ATP binding domain 1 family, member B	209_210							GTP binding				0														0.76			247	76				---	---	---	---	capture_indel			In_Frame_Del	DEL	27085150	27085155	6892	1	AGCCAG	-	-	3	3	GPN2	-	5	5
ABCA4	24	broad.mit.edu	36	1	94236216	94236225	+	Frame_Shift_Del	DEL	GATTTGATCT	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:94236216_94236225delGATTTGATCT	uc001dqh.1	-	c.6509_6518delAGATCAAATC	c.(6508-6519)AAGATCAAATCCfs	p.K2170fs		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	2170_2173	Cytoplasmic.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|central_nervous_system(2)|breast(1)	7		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)										0.31			67	147				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	94236216	94236225	35	1	GATTTGATCT	-	-	41	41	ABCA4	-	5	5
ANKRD5	63926	broad.mit.edu	36	20	9978371	9978385	+	In_Frame_Del	DEL	CCCGGGGAGGAGGGG	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:9978371_9978385delCCCGGGGAGGAGGGG	uc002wno.1	+	c.1154_1168delCCCGGGGAGGAGGGG	c.(1153-1170)ACCCGGGGAGGAGGGGTC>ATC	p.385_390TRGGGV>I	ANKRD5_uc002wnp.1_In_Frame_Del_p.385_390TRGGGV>I|ANKRD5_uc010gbz.1_In_Frame_Del_p.196_201TRGGGV>I	NM_022096	NP_942093	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5	385_390							calcium ion binding			ovary(1)|breast(1)	2														0.71			39	16				---	---	---	---	capture_indel			In_Frame_Del	DEL	9978371	9978385	684	20	CCCGGGGAGGAGGGG	-	-	18	18	ANKRD5	-	5	5
MCM3AP	8888	broad.mit.edu	36	21	46522020	46522020	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:46522020_46522020delT	uc002zir.1	-	c.1707_1707delA	c.(1705-1707)CAAfs	p.Q569fs		NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	569					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)									639				0.61			33	21				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	46522020	46522020	9777	21	T	-	-	52	52	MCM3AP	-	5	5
TTL	150465	broad.mit.edu	36	2	112960013	112960019	+	Frame_Shift_Del	DEL	ACAAACT	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:112960013_112960019delACAAACT	uc002thu.1	+	c.206_212delACAAACT	c.(205-213)GACAAACTGfs	p.D69fs		NM_153712	NP_714923	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	69_71	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity				0		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)						130				0.31			69	153				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	112960013	112960019	17276	2	ACAAACT	-	-	10	10	TTL	-	5	5
SPHKAP	80309	broad.mit.edu	36	2	228589810	228589811	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:228589810_228589811delGG	uc002vpq.1	-	c.4003_4004delCC	c.(4003-4005)CCTfs	p.P1335fs	SPHKAP_uc002vpp.1_Frame_Shift_Del_p.P1335fs	NM_030623	NP_085126	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1335						cytoplasm	protein binding			ovary(4)|lung(1)	5		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)										0.53			71	63				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	228589810	228589811	15560	2	GG	-	-	35	35	SPHKAP	-	5	5
CTBP1	1487	broad.mit.edu	36	4	1197343	1197344	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:1197343_1197344insG	uc003gcv.1	-	c.943_944insC	c.(943-945)CATfs	p.H315fs	CTBP1_uc003gct.1_Frame_Shift_Ins_p.H296fs|CTBP1_uc003gcu.1_Frame_Shift_Ins_p.H304fs|CTBP1_uc003gcw.2_De_novo_Start_OutOfFrame	NM_001328	NP_001319	Q13363	CTBP1_HUMAN	C-terminal binding protein 1 isoform 1	315	Interaction with GLIS2 2 (By similarity).|NAD (By similarity).	Proton donor (By similarity).		H->A: Strongly reduces E1A binding; when associated with A-266; A-290 and A-295.	interspecies interaction between organisms|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of histone H4 acetylation|oxidation-reduction process|positive regulation of histone deacetylation|protein phosphorylation|regulation of cell cycle|regulation of transcription by chromatin organization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|viral genome replication|white fat cell differentiation	cytoplasm|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein C-terminus binding|protein domain specific binding|transcription factor binding|transcription repressor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)						261				0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	1197343	1197344	4156	4	-	G	G	51	51	CTBP1	G	5	5
UQCRQ	27089	broad.mit.edu	36	5	132231092	132231096	+	Frame_Shift_Del	DEL	TTATC	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:132231092_132231096delTTATC	uc003kya.1	+	c.168_172delTTATC	c.(166-174)TTTTATCTTfs	p.F56fs	GDF9_uc003kxz.1_5'Flank	NM_014402	NP_055217	O14949	QCR8_HUMAN	ubiquinol-cytochrome c reductase, complex III	56_58					respiratory electron transport chain	mitochondrial inner membrane|respiratory chain	ubiquinol-cytochrome-c reductase activity				0		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)											0.52			14	13				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	132231092	132231096	17585	5	TTATC	-	-	64	64	UQCRQ	-	5	5
DBN1	1627	broad.mit.edu	36	5	176817768	176817769	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:176817768_176817769insG	uc003mgx.2	-	c.1678_1679insC	c.(1678-1680)CAGfs	p.Q560fs	DBN1_uc003mgy.2_Frame_Shift_Ins_p.Q558fs|DBN1_uc010jkn.1_Frame_Shift_Ins_p.Q508fs|DBN1_uc003mgz.1_Frame_Shift_Ins_p.Q541fs	NM_080881	NP_543157	Q16643	DREB_HUMAN	drebrin 1 isoform b	558					actin filament organization|regulation of dendrite development|regulation of neuronal synaptic plasticity	actomyosin|cytoplasm|dendrite	actin binding|profilin binding			breast(3)	3	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)						p.Q560fs(TOV21G-Tumor)	168				0.33			4	8				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	176817768	176817769	4423	5	-	G	G	55	55	DBN1	G	5	5
MAPK9	5601	broad.mit.edu	36	5	179598007	179598008	+	Frame_Shift_Ins	INS	-	AA	AA			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:179598007_179598008insAA	uc003mls.2	-	c.1062_1063insTT	c.(1060-1065)GAGCTAfs	p.E354fs	MAPK9_uc003mlt.2_Frame_Shift_Ins_p.E354fs|MAPK9_uc003mlv.2_Frame_Shift_Ins_p.E354fs|MAPK9_uc003mlu.2_Frame_Shift_Ins_p.E354fs|MAPK9_uc010jlc.1_Frame_Shift_Ins_p.E354fs	NM_002752	NP_002743	P45984	MK09_HUMAN	mitogen-activated protein kinase 9 isoform JNK2	354_355					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|protein binding|protein binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)	4	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)							167				0.67			40	20				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	179598007	179598008	9670	5	-	AA	AA	34	34	MAPK9	AA	5	5
RAD17	5884	broad.mit.edu	36	5	68720617	68720617	+	Frame_Shift_Del	DEL	A	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:68720617_68720617delA	uc003jwo.1	+	c.928_928delA	c.(928-930)AATfs	p.N310fs	RAD17_uc003jwg.1_Frame_Shift_Del_p.N299fs|RAD17_uc003jwi.1_Frame_Shift_Del_p.N299fs|RAD17_uc003jwh.1_Frame_Shift_Del_p.N299fs|RAD17_uc003jwj.1_Frame_Shift_Del_p.N299fs|RAD17_uc003jwk.1_Frame_Shift_Del_p.N299fs|RAD17_uc003jwl.1_Frame_Shift_Del_p.N299fs|RAD17_uc003jwm.1_Frame_Shift_Del_p.N134fs|RAD17_uc003jwn.1_Frame_Shift_Del_p.N213fs	NM_133339	NP_579917	O75943	RAD17_HUMAN	RAD17 homolog isoform 2	310					cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)										0.45			10	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	68720617	68720617	13438	5	A	-	-	9	9	RAD17	-	5	5
SYNJ2	8871	broad.mit.edu	36	6	158427996	158427997	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:158427996_158427997insC	uc003qqx.1	+	c.3330_3331insC	c.(3328-3333)AGACCCfs	p.R1110fs	SYNJ2_uc003qqw.1_Frame_Shift_Ins_p.R1110fs|SYNJ2_uc003qqy.1_Frame_Shift_Ins_p.R870fs|SYNJ2_uc003qqz.1_Frame_Shift_Ins_p.R727fs|SYNJ2_uc003qra.1_Frame_Shift_Ins_p.R453fs|SYNJ2_uc010kjp.1_5'UTR	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	1110_1111	Pro-rich.|Catalytic (By similarity).						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)										0.32			7	15				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	158427996	158427997	15974	6	-	C	C	10	10	SYNJ2	C	5	5
CCHCR1	54535	broad.mit.edu	36	6	31226541	31226543	+	In_Frame_Del	DEL	AGG	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:31226541_31226543delAGG	uc003nsp.2	-	c.1039_1041delCCT	c.(1039-1041)CCTdel	p.P347del	CCHCR1_uc003nsq.2_In_Frame_Del_p.P311del|CCHCR1_uc003nsr.2_In_Frame_Del_p.P258del|CCHCR1_uc010jsk.1_In_Frame_Del_p.P258del	NM_001105564	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	258	Potential.				cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding				0														0.41			79	112				---	---	---	---	capture_indel			In_Frame_Del	DEL	31226541	31226543	3002	6	AGG	-	-	3	3	CCHCR1	-	5	5
BAT3	7917	broad.mit.edu	36	6	31723413	31723441	+	Frame_Shift_Del	DEL	TTCTGGGCTGGGGCACGCTCCTCCACTTC	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:31723413_31723441delTTCTGGGCTGGGGCACGCTCCTCCACTTC	uc003nvg.2	-	c.712_740delGAAGTGGAGGAGCGTGCCCCAGCCCAGAA	c.(712-741)GAAGTGGAGGAGCGTGCCCCAGCCCAGAACfs	p.E238fs	BAT3_uc003nvf.2_Frame_Shift_Del_p.E232fs|BAT3_uc003nvh.2_Frame_Shift_Del_p.E232fs|BAT3_uc003nvi.2_Frame_Shift_Del_p.E232fs|BAT3_uc003nvj.1_Frame_Shift_Del_p.E232fs	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a	238_247	1.|4 X 29 AA approximate repeats.|Pro-rich.				apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0										141				0.48			13	14				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	31723413	31723441	1343	6	TTCTGGGCTGGGGCACGCTCCTCCACTTC	-	-	60	60	BAT3	-	5	5
TBC1D2	55357	broad.mit.edu	36	9	100005458	100005465	+	Frame_Shift_Del	DEL	CACCAGAA	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:100005458_100005465delCACCAGAA	uc004ayq.1	-	c.2197_2204delTTCTGGTG	c.(2197-2205)TTCTGGTGCfs	p.F733fs	TBC1D2_uc004ayo.2_Frame_Shift_Del_p.F733fs|TBC1D2_uc004ayp.1_Frame_Shift_Del_p.F273fs|TBC1D2_uc004ayr.1_Frame_Shift_Del_p.F515fs	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	733_735	Rab-GAP TBC.					cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)										0.57			8	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	100005458	100005465	16130	9	CACCAGAA	-	-	25	25	TBC1D2	-	5	5
GOLM1	51280	broad.mit.edu	36	9	87845480	87845481	+	Frame_Shift_Ins	INS	-	A	A			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:87845480_87845481insA	uc004aol.1	-	c.590_591insT	c.(589-591)AGAfs	p.R197fs	GOLM1_uc010mqd.1_Non-coding_Transcript|GOLM1_uc004aom.1_Frame_Shift_Ins_p.R197fs	NM_016548	NP_808800	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	197	Potential.|Lumenal (Potential).					Golgi apparatus|integral to plasma membrane					0														0.73			106	40				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	87845480	87845481	6840	9	-	A	A	58	58	GOLM1	A	5	5
FANCC	2176	broad.mit.edu	36	9	96903949	96903957	+	Splice_Site_Del	DEL	GCCATCTGC	-	-			TCGA-14-1458-01	TCGA-14-1458-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:96903949_96903957delGCCATCTGC	uc004avh.1	-	c.e15_splice_site				NM_000136	NP_000127			Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)								456				0.64			204	116				---	---	---	---	capture_indel			Splice_Site_Del	DEL	96903949	96903957	5900	9	GCCATCTGC	-	-	34	34	FANCC	-	5	5
