Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
FAM171A1	221061	broad.mit.edu	36	10	15296223	15296223	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:15296223T>G	uc001iob.1	-	c.1370A>C	c.(1369-1371)TAC>TCC	p.Y457S		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061	457	Cytoplasmic (Potential).					integral to membrane				ovary(2)|breast(1)	3														0.233333	9.70252	11.665692	7	23	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15296223	15296223	5695	10	T	G	G	57	57	FAM171A1	G	4	4
PTEN	5728	broad.mit.edu	36	10	89643788	89643788	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89643788G>A	uc001kfb.1	+	c.106G>A	c.(106-108)GGA>AGA	p.G36R		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	36	Phosphatase tensin-type.		G -> R (in endometrial hyperplasia).|G -> E (in glioma).		apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.0?(12)|p.Y27_N212>Y(2)|p.G36*(1)|p.G36R(1)|p.A34_G36del(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.735537	295.599674	301.662835	89	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89643788	89643788	13192	10	G	A	A	43	43	PTEN	A	2	2
KIAA1826	84437	broad.mit.edu	36	11	105386503	105386503	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:105386503G>A	uc001piy.1	-	c.352C>T	c.(352-354)CGA>TGA	p.R118*	KIAA1826_uc001piz.1_Nonsense_Mutation_p.R118*	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	118						nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)										0.100402	15.05255	54.727494	25	224	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	105386503	105386503	8571	11	G	A	A	39	39	KIAA1826	A	5	1
UBE4A	9354	broad.mit.edu	36	11	117772364	117772364	+	Nonstop_Mutation	SNP	A	C	C			TCGA-14-1794-01	TCGA-14-1794-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:117772364A>C	uc001psv.1	+	c.3221A>C	c.(3220-3222)TAG>TCG	p.*1074S	UBE4A_uc001psw.1_Nonstop_Mutation_p.*1067S	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A	1074					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|breast(1)|kidney(1)	4	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)										0.195652	9.629938	13.631354	9	37	AA		KEEP	---	---	---	---	capture			Nonstop_Mutation	SNP	117772364	117772364	17440	11	A	C	C	15	15	UBE4A	C	5	4
HINFP	25988	broad.mit.edu	36	11	118502890	118502890	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118502890G>A	uc001pvp.1	+	c.26G>A	c.(25-27)CGA>CAA	p.R9Q	HINFP_uc001pvq.1_Missense_Mutation_p.R9Q	NM_015517	NP_945322	Q9BQA5	HINFP_HUMAN	MBD2 (methyl-CpG-binding protein)-interacting	9					DNA damage checkpoint|DNA repair|establishment of protein localization|in utero embryonic development|myoblast differentiation|negative regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	enzyme binding|histone binding|promoter binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription coactivator activity|zinc ion binding			pancreas(2)|ovary(1)	3														0.09375	11.928907	54.391782	24	232	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118502890	118502890	7395	11	G	A	A	37	37	HINFP	A	1	1
C11orf61	79684	broad.mit.edu	36	11	124148158	124148158	+	Nonsense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:124148158C>A	uc001qba.1	-	c.769G>T	c.(769-771)GAA>TAA	p.E257*	C11orf61_uc001qay.1_Nonsense_Mutation_p.E27*|C11orf61_uc001qaz.1_Nonsense_Mutation_p.E205*	NM_024631	NP_078907	Q6P1R3	CK061_HUMAN	hypothetical protein LOC79684	257											0	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0079)										0.170213	16.270918	21.106867	8	39	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	124148158	124148158	1692	11	C	A	A	29	29	C11orf61	A	5	3
ZP1	22917	broad.mit.edu	36	11	60397528	60397528	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1794-01	TCGA-14-1794-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:60397528A>G	uc001nqd.1	+	c.1345A>G	c.(1345-1347)AAC>GAC	p.N449D	ZP1_uc001nqe.1_Missense_Mutation_p.N156D	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1	449	Extracellular (Potential).|ZP.				single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0														0.272727	11.235581	12.26412	6	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60397528	60397528	18819	11	A	G	G	5	5	ZP1	G	4	4
SHANK2	22941	broad.mit.edu	36	11	70010366	70010367	+	Missense_Mutation	DNP	AT	TC	TC			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:70010366_70010367AT>TC	uc001opz.1	-	c.1894_1895AT>GA	c.(1894-1896)ATG>GAG	p.M632E	SHANK2_uc001opy.1_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	848					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)											0.333333	6.891351	7.18889	4	8	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	70010366	70010367	14757	11	AT	TC	TC	8	8	SHANK2	TC	4	4
TMEM120B	144404	broad.mit.edu	36	12	120672691	120672691	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:120672691G>T	uc001uaz.1	+	c.328G>T	c.(328-330)GGC>TGC	p.G110C	TMEM120B_uc009zxh.1_Missense_Mutation_p.G110C	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B	110	Helical; (Potential).					integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)										0.454545	9.657171	9.678633	5	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	120672691	120672691	16565	12	G	T	T	39	39	TMEM120B	T	3	3
ING4	51147	broad.mit.edu	36	12	6630788	6630788	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6630788C>T	uc001qpw.2	-	c.673G>A	c.(673-675)GCC>ACC	p.A225T	ING4_uc001qpv.2_Missense_Mutation_p.A224T|ING4_uc001qpx.2_Missense_Mutation_p.A222T|ING4_uc001qpy.2_Missense_Mutation_p.A221T|ING4_uc009zes.1_Silent_p.L175L|ING4_uc009zet.1_Missense_Mutation_p.A201T|ING4_uc009zeu.1_Non-coding_Transcript|ING4_uc009zev.1_Non-coding_Transcript	NM_001127582	NP_001121054	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4 isoform 9	225	PHD-type.				apoptosis|cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell proliferation|negative regulation of growth|negative regulation of transcription, DNA-dependent|positive regulation of apoptosis	histone acetyltransferase complex	protein binding|transcription coactivator activity|zinc ion binding			central_nervous_system(3)|ovary(1)	4														0.675532	1149.857839	1165.254628	381	183	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6630788	6630788	8039	12	C	T	T	25	25	ING4	T	2	2
RAB21	23011	broad.mit.edu	36	12	70435258	70435258	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:70435258G>T	uc001swt.1	+	c.82G>T	c.(82-84)GGC>TGC	p.G28C		NM_014999	NP_055814	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	28	GTP.				protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding				0														0.5	8.794636	8.794636	4	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70435258	70435258	13367	12	G	T	T	35	35	RAB21	T	3	3
ATP12A	479	broad.mit.edu	36	13	24183517	24183517	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:24183517C>T	uc010aaa.1	+	c.3079C>T	c.(3079-3081)CGG>TGG	p.R1027W	ATP12A_uc001upp.1_Missense_Mutation_p.R1021W	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	1021	Helical; (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	Pancreas(156;1582 1935 18898 22665 26498)								0.194444	14.306953	17.442195	7	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24183517	24183517	1141	13	C	T	T	27	27	ATP12A	T	1	1
SLC7A1	6541	broad.mit.edu	36	13	29007985	29007985	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:29007985C>A	uc001uso.1	-	c.341G>T	c.(340-342)GGC>GTC	p.G114V		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	114	Helical; (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)									0.161644	98.70789	138.388356	59	306	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29007985	29007985	15189	13	C	A	A	26	26	SLC7A1	A	3	3
PCDH20	64881	broad.mit.edu	36	13	60884369	60884369	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:60884369C>G	uc001vid.2	-	c.1864G>C	c.(1864-1866)GTA>CTA	p.V622L	PCDH20_uc001vie.1_Missense_Mutation_p.V595L	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	595	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)										0.16	72.078167	102.021681	44	231	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60884369	60884369	11935	13	C	G	G	20	20	PCDH20	G	3	3
OR4N2	390429	broad.mit.edu	36	14	19366226	19366226	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:19366226G>A	uc001vwg.1	+	c.779G>A	c.(778-780)CGC>CAC	p.R260H		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	260	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)										0.23301	174.732394	194.841337	72	237	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19366226	19366226	11487	14	G	A	A	38	38	OR4N2	A	1	1
BDKRB1	623	broad.mit.edu	36	14	95800474	95800474	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:95800474G>A	uc001yfh.1	+	c.702G>A	c.(700-702)GAG>GAA	p.E234E	BDKRB1_uc010avn.1_Silent_p.E234E|BDKRB1_uc010avo.1_Silent_p.E234E	NM_000710	NP_000701	P46663	BKRB1_HUMAN	bradykinin receptor B1	234	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration	endoplasmic reticulum|integral to plasma membrane	bradykinin receptor activity			ovary(3)	3		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)										0.169697	48.810594	65.844624	28	137	GG		KEEP	---	---	---	---	capture			Silent	SNP	95800474	95800474	1414	14	G	A	A	35	35	BDKRB1	A	2	2
BAHD1	22893	broad.mit.edu	36	15	38545605	38545605	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:38545605T>C	uc001zlu.2	+	c.2327T>C	c.(2326-2328)CTT>CCT	p.L776P	BAHD1_uc001zlt.2_Missense_Mutation_p.L775P|BAHD1_uc010bbp.1_Missense_Mutation_p.L772P|BAHD1_uc001zlv.2_Missense_Mutation_p.L773P	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	776	BAH.				heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)										0.411765	14.011961	14.129576	7	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38545605	38545605	1318	15	T	C	C	56	56	BAHD1	C	4	4
AP4E1	23431	broad.mit.edu	36	15	48988299	48988299	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:48988299C>G	uc001zyx.1	+	c.32C>G	c.(31-33)GCG>GGG	p.A11G		NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1	11					intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)										0.6	6.318924	6.36149	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48988299	48988299	762	15	C	G	G	27	27	AP4E1	G	3	3
FAM63B	54629	broad.mit.edu	36	15	56851100	56851101	+	Missense_Mutation	DNP	TC	CT	CT			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:56851100_56851101TC>CT	uc002afj.1	+	c.214_215TC>CT	c.(214-216)TCT>CTT	p.S72L	FAM63B_uc002afi.1_Missense_Mutation_p.S72L|FAM63B_uc002afk.1_Non-coding_Transcript|FAM63B_uc002afl.1_Non-coding_Transcript	NM_001040450	NP_001035540	Q8NBR6	FA63B_HUMAN	hypothetical protein LOC54629 isoform a	72										central_nervous_system(1)	1														0.888889	18.577158	19.229911	8	1	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	56851100	56851101	5820	15	TC	CT	CT	54	54	FAM63B	CT	4	4
FAM63B	54629	broad.mit.edu	36	15	56851103	56851103	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:56851103C>G	uc002afj.1	+	c.217C>G	c.(217-219)CCT>GCT	p.P73A	FAM63B_uc002afi.1_Missense_Mutation_p.P73A|FAM63B_uc002afk.1_Non-coding_Transcript|FAM63B_uc002afl.1_Non-coding_Transcript	NM_001040450	NP_001035540	Q8NBR6	FA63B_HUMAN	hypothetical protein LOC54629 isoform a	73										central_nervous_system(1)	1														0.933333	35.861131	37.65542	14	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56851103	56851103	5820	15	C	G	G	30	30	FAM63B	G	3	3
GLG1	2734	broad.mit.edu	36	16	73198402	73198402	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:73198402G>C	uc002fcx.1	-	c.92C>G	c.(91-93)CCC>CGC	p.P31R	GLG1_uc002fcy.2_Missense_Mutation_p.P31R|GLG1_uc002fcz.2_5'UTR	NM_012201	NP_036333	Q92896	GSLG1_HUMAN	golgi apparatus protein 1	31	Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2										1034				0.209302	10.447258	13.826062	9	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73198402	73198402	6704	16	G	C	C	43	43	GLG1	C	3	3
CDYL2	124359	broad.mit.edu	36	16	79276430	79276430	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:79276430G>A	uc002ffs.1	-	c.122C>T	c.(121-123)CCG>CTG	p.P41L		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	41	Chromo.				chromatin assembly or disassembly	chromatin|nucleus	catalytic activity|chromatin binding|protein binding			central_nervous_system(1)	1														0.158333	102.917882	142.850802	57	303	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	79276430	79276430	3319	16	G	A	A	39	39	CDYL2	A	1	1
ADORA2B	136	broad.mit.edu	36	17	15789343	15789343	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:15789343C>T	uc002gpd.1	+	c.56C>T	c.(55-57)GCG>GTG	p.A19V		NM_000676	NP_000667	P29275	AA2BR_HUMAN	adenosine A2b receptor	19	Helical; Name=1; (By similarity).				activation of MAPK activity|cellular defense response|excretion|JNK cascade	integral to plasma membrane				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Defibrotide(DB04932)|Enprofylline(DB00824)|Pegademase bovine(DB00061)|Theophylline(DB00277)									0.6	6.420683	6.46369	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15789343	15789343	329	17	C	T	T	27	27	ADORA2B	T	1	1
TNFRSF13B	23495	broad.mit.edu	36	17	16784403	16784403	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:16784403C>T	uc002gqs.1	-	c.593G>A	c.(592-594)CGC>CAC	p.R198H	TNFRSF13B_uc002gqt.1_Missense_Mutation_p.R152H	NM_012452	NP_036584	O14836	TR13B_HUMAN	tumor necrosis factor receptor 13B	198	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding|receptor activity			kidney(2)	2										172				0.435897	48.765596	48.905514	17	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16784403	16784403	16828	17	C	T	T	27	27	TNFRSF13B	T	1	1
OR1G1	8390	broad.mit.edu	36	17	2976935	2976935	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:2976935C>T	uc002fvc.1	-	c.661G>A	c.(661-663)GTT>ATT	p.V221I		NM_003555	NP_003546	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						Colon(127;1481 1654 8243 19426 50557)								0.329114	216.657128	222.74925	78	159	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2976935	2976935	11363	17	C	T	T	19	19	OR1G1	T	1	1
AMAC1	146861	broad.mit.edu	36	17	30544746	30544746	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:30544746G>A	uc002hjd.1	-	c.694C>T	c.(694-696)CTG>TTG	p.L232L		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	232	Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)										0.742331	331.972494	340.638046	121	42	GG		KEEP	---	---	---	---	capture			Silent	SNP	30544746	30544746	562	17	G	A	A	34	34	AMAC1	A	2	2
MTMR4	9110	broad.mit.edu	36	17	53927517	53927517	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53927517G>A	uc002iwj.1	-	c.2985C>T	c.(2983-2985)CCC>CCT	p.P995P		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	995						cytoplasm|membrane	protein tyrosine phosphatase activity|zinc ion binding			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)													0.386117	525.687107	530.909125	178	283	GG		KEEP	---	---	---	---	capture			Silent	SNP	53927517	53927517	10339	17	G	A	A	39	39	MTMR4	A	1	1
ITGB4	3691	broad.mit.edu	36	17	71260165	71260165	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71260165G>A	uc002jpg.1	+	c.4020G>A	c.(4018-4020)GGG>GGA	p.G1340G	ITGB4_uc002jph.1_Silent_p.G1340G|ITGB4_uc002jpi.2_Silent_p.G1340G|ITGB4_uc002jpj.1_Silent_p.G1340G	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	1340	Cytoplasmic (Potential).				cell communication|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development	integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)							754				0.166667	6.794183	11.235485	7	35	GG		KEEP	---	---	---	---	capture			Silent	SNP	71260165	71260165	8201	17	G	A	A	43	43	ITGB4	A	2	2
TP53	7157	broad.mit.edu	36	17	7518264	7518264	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7518264G>A	uc002gim.2	-	c.742C>T	c.(742-744)CGG>TGG	p.R248W	TP53_uc002gig.1_Missense_Mutation_p.R248W|TP53_uc002gih.1_Missense_Mutation_p.R248W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116W|TP53_uc010cng.1_Missense_Mutation_p.R116W|TP53_uc002gii.1_Missense_Mutation_p.R116W|TP53_uc010cnh.1_Missense_Mutation_p.R248W|TP53_uc010cni.1_Missense_Mutation_p.R248W|TP53_uc002gij.2_Missense_Mutation_p.R248W|TP53_uc010cnj.1_Non-coding_Transcript|TP53_uc002gin.2_Missense_Mutation_p.R155W|TP53_uc002gio.2_Missense_Mutation_p.R116W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.R248W(438)|p.R248G(11)|p.0?(6)|p.R248Q(4)|p.R248R(2)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)	R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO680N_OESOPHAGUS)|R248W(SW837_LARGE_INTESTINE)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(RD_SOFT_TISSUE)|R248W(VCAP_PROSTATE)|R248W(JIMT1_BREAST)|R248W(GCT_SOFT_TISSUE)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(786O_KIDNEY)|R248W(COLO320_LARGE_INTESTINE)|R248W(LXF289_LUNG)|R248W(LUDLU1_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(HCC2157_BREAST)	111	p.R248W(SW837-Tumor)|p.R248W(786O-Tumor)|p.R248W(LUDLU1-Tumor)|p.R248W(VCAP-Tumor)|p.R248*(DB-Tumor)|p.R248W(MIAPACA2-Tumor)|p.R248W(HCC2157-Tumor)|p.R248W(LXF289-Tumor)|p.R248G(8505C-Tumor)|p.R248A(SF126-Tumor)|p.R248W(SET2-Tumor)|p.R248W(KO52-Tumor)|p.R248W(SNU1040-Tumor)|p.R248W(GCT-Tumor)|p.R248W(JIMT1-Tumor)|p.R248W(COLO320-Tumor)|p.R248W(CAS1-Tumor)|p.R248W(NCIH2106-Tumor)|p.R248W(SNUC5-Tumor)|p.R248W(COLO680N-Tumor)|p.R248W(RD-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.589474	552.211678	554.210149	168	117	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7518264	7518264	16923	17	G	A	A	39	39	TP53	A	1	1
LAMA3	3909	broad.mit.edu	36	18	19746718	19746718	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:19746718C>T	uc002kuq.1	+	c.7204C>T	c.(7204-7206)CGA>TGA	p.R2402*	LAMA3_uc002kur.1_Nonsense_Mutation_p.R2346*|LAMA3_uc002kus.2_Nonsense_Mutation_p.R793*|LAMA3_uc002kut.2_Nonsense_Mutation_p.R737*	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	2402	Laminin G-like 1.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|central_nervous_system(1)	9	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.468619	356.180782	356.384322	112	127	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	19746718	19746718	8930	18	C	T	T	23	23	LAMA3	T	5	1
PDE4A	5141	broad.mit.edu	36	19	10431288	10431288	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:10431288G>A	uc002moj.2	+	c.1218G>A	c.(1216-1218)AAG>AAA	p.K406K	PDE4A_uc002mok.2_Silent_p.K380K|PDE4A_uc002mol.2_Silent_p.K345K|PDE4A_uc002mom.2_Silent_p.K167K|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_Silent_p.K72K	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific isoform 1	406	Catalytic.				signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)									0.09901	9.002121	25.214762	10	91	GG		KEEP	---	---	---	---	capture			Silent	SNP	10431288	10431288	12060	19	G	A	A	33	33	PDE4A	A	2	2
DCAF15	90379	broad.mit.edu	36	19	13930911	13930911	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:13930911C>A	uc002mxt.1	+	c.839C>A	c.(838-840)CCT>CAT	p.P280H	DCAF15_uc002mxu.1_5'Flank	NM_138353	NP_612362	Q66K64	DCA15_HUMAN	hypothetical protein LOC90379	280										central_nervous_system(1)	1														0.3	7.621679	7.978769	3	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13930911	13930911	4438	19	C	A	A	24	24	DCAF15	A	3	3
CELF5	60680	broad.mit.edu	36	19	3235952	3235952	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:3235952G>C	uc002lxm.1	+	c.1092G>C	c.(1090-1092)CAG>CAC	p.Q364H	CELF5_uc002lxl.1_Missense_Mutation_p.Q364H|CELF5_uc010dtj.1_Missense_Mutation_p.Q339H|CELF5_uc002lxn.2_Non-coding_Transcript	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein	364					mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(1)	1														0.454545	17.49737	17.541915	10	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3235952	3235952	3352	19	G	C	C	34	34	CELF5	C	3	3
ZNF285	26974	broad.mit.edu	36	19	49583380	49583380	+	Silent	SNP	T	C	C			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:49583380T>C	uc002ozd.2	-	c.867A>G	c.(865-867)GAA>GAG	p.E289E		NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	289					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2														0.120482	38.397973	73.556253	30	219	TT		KEEP	---	---	---	---	capture			Silent	SNP	49583380	49583380	18414	19	T	C	C	52	52	ZNF285	C	4	4
ZNF180	7733	broad.mit.edu	36	19	49673467	49673467	+	Silent	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:49673467C>T	uc002ozf.2	-	c.1071G>A	c.(1069-1071)CAG>CAA	p.Q357Q	ZNF180_uc002ozh.2_Silent_p.Q14Q|ZNF180_uc002ozi.2_Silent_p.Q330Q|ZNF180_uc002ozg.2_Silent_p.Q356Q|ZNF180_uc010ejm.1_Silent_p.Q332Q	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	357	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				Esophageal Squamous(180;1353 2003 32862 46574 49854)								0.226415	144.900046	163.091305	60	205	CC		KEEP	---	---	---	---	capture			Silent	SNP	49673467	49673467	18339	19	C	T	T	20	20	ZNF180	T	2	2
ZFP28	140612	broad.mit.edu	36	19	61750724	61750724	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61750724C>A	uc002qnj.1	+	c.336C>A	c.(334-336)TTC>TTA	p.F112L	ZFP28_uc002qni.2_Missense_Mutation_p.F112L	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	112	KRAB 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		Ovarian(124;554 1662 19430 21141 52494)								0.103448	10.733695	37.98914	18	156	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61750724	61750724	18230	19	C	A	A	32	32	ZFP28	A	3	3
AMPD1	270	broad.mit.edu	36	1	115017338	115017338	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:115017338G>A	uc001efe.1	-	c.2164C>T	c.(2164-2166)CAA>TAA	p.Q722*	DENND2C_uc001eez.2_5'Flank|AMPD1_uc001eff.1_Nonsense_Mutation_p.Q718*	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	722					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)									0.109756	8.722095	21.081732	9	73	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	115017338	115017338	588	1	G	A	A	47	47	AMPD1	A	5	2
KIAA2013	90231	broad.mit.edu	36	1	11905362	11905362	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1794-01	TCGA-14-1794-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:11905362A>G	uc001atl.1	-	c.1805T>C	c.(1804-1806)ATC>ACC	p.I602T	KIAA2013_uc001atk.1_Missense_Mutation_p.I602T	NM_138346	NP_612355	Q8IYS2	K2013_HUMAN	hypothetical protein LOC90231	602	Helical; (Potential).					integral to membrane				ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)										0.222222	6.723284	8.657836	6	21	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11905362	11905362	8578	1	A	G	G	12	12	KIAA2013	G	4	4
KAZ	23254	broad.mit.edu	36	1	15259267	15259267	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:15259267G>C	uc001avm.2	+	c.929G>C	c.(928-930)AGC>ACC	p.S310T	KAZ_uc009vog.1_Missense_Mutation_p.S310T|KAZ_uc001avo.2_Missense_Mutation_p.S304T|KAZ_uc001avp.2_Missense_Mutation_p.S216T|KAZ_uc001avq.2_Missense_Mutation_p.S216T|KAZ_uc001avr.2_Missense_Mutation_p.S213T	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	310	Interaction with PPL.				keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0														0.2	6.717479	7.97232	3	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15259267	15259267	8292	1	G	C	C	34	34	KAZ	C	3	3
C1orf182	128229	broad.mit.edu	36	1	154581032	154581032	+	Silent	SNP	T	C	C			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:154581032T>C	uc001foo.1	+	c.72T>C	c.(70-72)TGT>TGC	p.C24C	C1orf182_uc009wry.1_Silent_p.C24C|C1orf182_uc001fop.2_Silent_p.C24C	NM_144627	NP_653228	Q96A04	CA182_HUMAN	SSTK-interacting protein	24											0	Hepatocellular(266;0.158)													0.354839	87.141697	88.871027	33	60	TT		KEEP	---	---	---	---	capture			Silent	SNP	154581032	154581032	2085	1	T	C	C	57	57	C1orf182	C	4	4
SPTA1	6708	broad.mit.edu	36	1	156917095	156917095	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:156917095C>T	uc001fst.1	-	c.580G>A	c.(580-582)GAA>AAA	p.E194K		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	194	Spectrin 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|breast(1)	5	all_hematologic(112;0.0378)													0.509934	229.92558	229.937984	77	74	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	156917095	156917095	15630	1	C	T	T	31	31	SPTA1	T	1	1
RGS4	5999	broad.mit.edu	36	1	161310751	161310751	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:161310751G>A	uc001gcl.2	+	c.686G>A	c.(685-687)TGC>TAC	p.C229Y	RGS4_uc009wuy.1_Missense_Mutation_p.C132Y|RGS4_uc009wuz.1_Silent_p.L76L|RGS4_uc009wva.1_Missense_Mutation_p.C114Y	NM_001102445	NP_001095915	P49798	RGS4_HUMAN	regulator of G-protein signaling 4 isoform 1	132	RGS.				inactivation of MAPK activity|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity			ovary(2)|central_nervous_system(1)	3						Ovarian(76;1257 1738 3039 6086)								0.179487	9.900241	13.676541	7	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	161310751	161310751	13781	1	G	A	A	46	46	RGS4	A	2	2
ARHGEF19	128272	broad.mit.edu	36	1	16403898	16403898	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:16403898C>T	uc001ayc.1	-	c.1850G>A	c.(1849-1851)AGC>AAC	p.S617N	ARHGEF19_uc009voo.1_5'UTR|ARHGEF19_uc001ayb.1_Missense_Mutation_p.S94N	NM_153213	NP_694945	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	617	PH.				regulation of actin cytoskeleton organization	intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)										0.266667	7.760391	8.530991	4	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16403898	16403898	916	1	C	T	T	28	28	ARHGEF19	T	2	2
KIF2C	11004	broad.mit.edu	36	1	44998695	44998695	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:44998695G>T	uc001cmg.2	+	c.1524G>T	c.(1522-1524)CAG>CAT	p.Q508H	KIF2C_uc001cmh.2_Missense_Mutation_p.Q454H	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C	508	Kinesin-motor.				blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)													0.132653	16.709335	29.560647	13	85	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44998695	44998695	8610	1	G	T	T	33	33	KIF2C	T	3	3
RBM39	9584	broad.mit.edu	36	20	33783326	33783326	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:33783326G>A	uc002xeb.1	-	c.247C>T	c.(247-249)CGC>TGC	p.R83C	RBM39_uc002xdz.1_Missense_Mutation_p.R59C|RBM39_uc002xea.1_5'UTR|RBM39_uc010gfn.1_5'UTR|RBM39_uc002xeg.1_Missense_Mutation_p.R83C|RBM39_uc002xec.1_Missense_Mutation_p.R83C|RBM39_uc002xed.1_5'UTR|RBM39_uc002xee.1_5'UTR|RBM39_uc002xef.1_5'UTR	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a	83	Arg/Ser-rich (RS domain).				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)													0.324324	66.786239	68.807062	24	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33783326	33783326	13595	20	G	A	A	39	39	RBM39	A	1	1
APP	351	broad.mit.edu	36	21	26345360	26345360	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:26345360G>A	uc002ylz.1	-	c.489C>T	c.(487-489)ACC>ACT	p.T163T	APP_uc002yma.1_Silent_p.T163T|APP_uc002ymb.1_Silent_p.T163T|APP_uc010glj.1_Silent_p.T107T|APP_uc010glk.1_Silent_p.T158T	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor	163	Extracellular (Potential).				adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)												0.454545	104.211433	104.349999	35	42	GG		KEEP	---	---	---	---	capture			Silent	SNP	26345360	26345360	826	21	G	A	A	47	47	APP	A	2	2
TIAM1	7074	broad.mit.edu	36	21	31414900	31414900	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:31414900C>A	uc002yow.1	-	c.4433G>T	c.(4432-4434)GGG>GTG	p.G1478V		NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1478					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|lung(1)	5										780				0.148936	6.594017	12.164591	7	40	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31414900	31414900	16418	21	C	A	A	22	22	TIAM1	A	3	3
DGCR8	54487	broad.mit.edu	36	22	18459086	18459086	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:18459086G>A	uc002zri.1	+	c.1435G>A	c.(1435-1437)GAG>AAG	p.E479K	DGCR8_uc010grz.1_Missense_Mutation_p.E479K|DGCR8_uc002zrj.1_Missense_Mutation_p.E122K	NM_022720	NP_073557	Q8WYQ5	DGCR8_HUMAN	DiGeorge syndrome critical region gene 8	479	Necessary for heme-binding and pri-miRNA processing.				primary microRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding				0	Colorectal(54;0.0993)													0.702532	357.360823	363.151829	111	47	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18459086	18459086	4643	22	G	A	A	37	37	DGCR8	A	1	1
TCN2	6948	broad.mit.edu	36	22	29352445	29352445	+	Splice_Site_SNP	SNP	A	G	G			TCGA-14-1794-01	TCGA-14-1794-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29352445A>G	uc003aip.1	+	c.e9_splice_site			TCN2_uc003aiq.1_Splice_Site_SNP|TCN2_uc003air.1_Splice_Site_SNP	NM_000355	NP_000346			transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)									0.186047	9.380268	13.357597	8	35	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	29352445	29352445	16233	22	A	G	G	7	7	TCN2	G	5	4
POTEE	445582	broad.mit.edu	36	2	131738282	131738282	+	Silent	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:131738282C>T	uc002tsn.2	+	c.2784C>T	c.(2782-2784)GCC>GCT	p.A928A	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Non-coding_Transcript|POTEE_uc002tsl.2_Non-coding_Transcript|POTEE_uc010fmy.1_Silent_p.A392A	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	928	Actin-like.						ATP binding				0														0.138889	14.37073	23.521755	10	62	CC		KEEP	---	---	---	---	capture			Silent	SNP	131738282	131738282	12694	2	C	T	T	21	21	POTEE	T	2	2
MMADHC	27249	broad.mit.edu	36	2	150140554	150140554	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:150140554G>A	uc010fnu.1	-	c.526C>T	c.(526-528)CTG>TTG	p.L176L	MMADHC_uc002txb.1_Silent_p.L176L|MMADHC_uc002txc.1_Silent_p.L176L	NM_015702	NP_056517	Q9H3L0	MMAD_HUMAN	methylmalonic aciduria (cobalamin deficiency)	176						mitochondrion				skin(1)	1														0.285714	25.918066	27.698515	12	30	GG		KEEP	---	---	---	---	capture			Silent	SNP	150140554	150140554	10032	2	G	A	A	33	33	MMADHC	A	2	2
CRYGB	1419	broad.mit.edu	36	2	208718806	208718806	+	Nonsense_Mutation	SNP	G	C	C			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:208718806G>C	uc002vcp.2	-	c.189C>G	c.(187-189)TAC>TAG	p.Y63*		NM_005210	NP_005201	P07316	CRGB_HUMAN	crystallin, gamma B	63	Beta/gamma crystallin 'Greek key' 2.				visual perception		structural constituent of eye lens				0				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)										0.231884	20.269531	24.826025	16	53	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	208718806	208718806	4054	2	G	C	C	44	44	CRYGB	C	5	3
TMEM198	130612	broad.mit.edu	36	2	220122266	220122267	+	Missense_Mutation	DNP	TT	CG	CG			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:220122266_220122267TT>CG	uc002vme.1	+	c.891_892TT>CG	c.(889-894)GCTTAT>GCCGAT	p.Y298D	TMEM198_uc002vmf.1_Missense_Mutation_p.Y298D	NM_001005209	NP_001005209	Q66K66	TM198_HUMAN	transmembrane protein 198	298	Arg-rich.					integral to membrane				ovary(1)	1		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)										0.590909	52.496534	52.806624	26	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	220122266	220122267	16654	2	TT	CG	CG	56	56	TMEM198	CG	4	4
COL4A4	1286	broad.mit.edu	36	2	227580329	227580329	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:227580329G>A	uc010fxd.1	-	c.5029C>T	c.(5029-5031)CGC>TGC	p.R1677C	COL4A4_uc010fxe.1_Missense_Mutation_p.R1677C	NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1677	Collagen IV NC1.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|breast(1)|pancreas(1)	10		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)										0.209302	18.455835	21.817686	9	34	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	227580329	227580329	3831	2	G	A	A	40	40	COL4A4	A	1	1
LTBP1	4052	broad.mit.edu	36	2	33213464	33213464	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:33213464C>A	uc002ros.1	+	c.1134C>A	c.(1132-1134)AAC>AAA	p.N378K	LTBP1_uc002rot.1_Missense_Mutation_p.N52K|LTBP1_uc002rou.1_Missense_Mutation_p.N52K|LTBP1_uc002rov.1_Missense_Mutation_p.N52K	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	378					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|lung(1)|central_nervous_system(1)	7	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)												0.133136	56.602626	100.656821	45	293	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33213464	33213464	9449	2	C	A	A	17	17	LTBP1	A	3	3
PROM2	150696	broad.mit.edu	36	2	95314581	95314581	+	Silent	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:95314581C>T	uc002suh.1	+	c.1866C>T	c.(1864-1866)TTC>TTT	p.F622F	PROM2_uc002suk.2_Silent_p.F622F|PROM2_uc002sui.1_Silent_p.F622F|PROM2_uc002suj.1_Silent_p.F276F|PROM2_uc002sul.1_Silent_p.F148F|PROM2_uc002sum.1_Intron	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2	622	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1														0.177778	7.161189	11.587673	8	37	CC		KEEP	---	---	---	---	capture			Silent	SNP	95314581	95314581	12999	2	C	T	T	30	30	PROM2	T	2	2
H1FX	8971	broad.mit.edu	36	3	130517370	130517371	+	Missense_Mutation	DNP	GG	CT	CT			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:130517370_130517371GG>CT	uc003elx.1	-	c.65_66CC>AG	c.(64-66)ACC>AAG	p.T22K	C3orf47_uc003elz.2_5'Flank	NM_006026	NP_006017	Q92522	H1X_HUMAN	H1 histone family, member X	22					nucleosome assembly	nucleosome|nucleus	DNA binding				0														0.4	8.393421	8.482043	4	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	130517370	130517371	7203	3	GG	CT	CT	47	47	H1FX	CT	3	3
MFN1	55669	broad.mit.edu	36	3	180564807	180564807	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:180564807G>A	uc003fjt.1	+	c.649G>A	c.(649-651)GAT>AAT	p.D217N	MFN1_uc003fjs.1_Missense_Mutation_p.D189N|MFN1_uc010hxb.1_Non-coding_Transcript|MFN1_uc010hxc.1_Missense_Mutation_p.D42N	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	189	Cytoplasmic (Potential).				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)											0.135659	52.949779	86.138028	35	223	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	180564807	180564807	9913	3	G	A	A	41	41	MFN1	A	2	2
XIRP1	165904	broad.mit.edu	36	3	39205815	39205815	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:39205815G>A	uc003cjk.1	-	c.126C>T	c.(124-126)TTC>TTT	p.F42F	XIRP1_uc003cji.2_Silent_p.F42F|XIRP1_uc003cjj.2_Intron|XIRP1_uc010hhp.1_Silent_p.F42F	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	42	Interaction with VASP.						actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)										0.666667	29.34931	29.717072	10	5	GG		KEEP	---	---	---	---	capture			Silent	SNP	39205815	39205815	18010	3	G	A	A	33	33	XIRP1	A	2	2
QRFPR	84109	broad.mit.edu	36	4	122470013	122470013	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:122470013C>T	uc010inj.1	-	c.1202G>A	c.(1201-1203)TGT>TAT	p.C401Y	QRFPR_uc010ink.1_Non-coding_Transcript|QRFPR_uc003ids.2_3'UTR	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	401	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity				0														0.325984	570.383048	587.403682	207	428	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	122470013	122470013	13336	4	C	T	T	17	17	QRFPR	T	2	2
ELMOD2	255520	broad.mit.edu	36	4	141680773	141680773	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:141680773T>G	uc003iik.1	+	c.401T>G	c.(400-402)CTT>CGT	p.L134R		NM_153702	NP_714913	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	134	ELMO.				phagocytosis|regulation of defense response to virus|response to virus	cytoskeleton	GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)													0.173077	8.429931	13.708624	9	43	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	141680773	141680773	5261	4	T	G	G	56	56	ELMOD2	G	4	4
ZFP42	132625	broad.mit.edu	36	4	189161781	189161781	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:189161781G>A	uc003izg.1	+	c.826G>A	c.(826-828)GTG>ATG	p.V276M	ZFP42_uc003izh.1_Missense_Mutation_p.V276M|ZFP42_uc003izi.1_Missense_Mutation_p.V276M|ZFP42_uc010isp.1_Missense_Mutation_p.V276M	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	276	C2H2-type 4.				female gonad development|male gonad development|meiosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)										0.511811	197.055949	197.071496	65	62	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	189161781	189161781	18238	4	G	A	A	40	40	ZFP42	A	1	1
APC	324	broad.mit.edu	36	5	112201919	112201919	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:112201919C>A	uc010jby.1	+	c.2729C>A	c.(2728-2730)ACT>AAT	p.T910N	APC_uc003kpz.2_Missense_Mutation_p.T910N|APC_uc003kpy.2_Missense_Mutation_p.T910N|APC_uc010jbz.1_Missense_Mutation_p.T627N|APC_uc010jca.1_Missense_Mutation_p.T210N	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	910	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of protein catabolic process|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity			large_intestine(2012)|stomach(123)|soft_tissue(55)|small_intestine(34)|pancreas(25)|breast(23)|urinary_tract(20)|lung(18)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|upper_aerodigestive_tract(6)|adrenal_gland(6)|NS(5)|bone(5)|skin(4)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2396		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		12		629	TSP Lung(16;0.13)			0.12766	14.318708	27.075939	12	82	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	112201919	112201919	773	5	C	A	A	20	20	APC	A	3	3
DMXL1	1657	broad.mit.edu	36	5	118513089	118513089	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:118513089G>A	uc010jcl.1	+	c.3668G>A	c.(3667-3669)CGG>CAG	p.R1223Q	DMXL1_uc003ksd.2_Missense_Mutation_p.R1223Q	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1223	WD 10.									ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)										0.128472	52.369895	91.033681	37	251	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118513089	118513089	4776	5	G	A	A	39	39	DMXL1	A	1	1
GHR	2690	broad.mit.edu	36	5	42747122	42747122	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1794-01	TCGA-14-1794-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:42747122A>C	uc003jmt.1	+	c.675A>C	c.(673-675)GAA>GAC	p.E225D		NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	225	Extracellular (Potential).|Fibronectin type-III.				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(2)|kidney(1)	3		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)					274				0.694981	605.364648	614.146853	180	79	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42747122	42747122	6639	5	A	C	C	4	4	GHR	C	4	4
HOMER1	9456	broad.mit.edu	36	5	78782668	78782668	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:78782668C>T	uc003kfy.1	-	c.195G>A	c.(193-195)ATG>ATA	p.M65I	HOMER1_uc010jab.1_Missense_Mutation_p.M65I|HOMER1_uc010jac.1_Missense_Mutation_p.M65I|HOMER1_uc010jad.1_Intron	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1	65	WH1.				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)										0.177215	27.00968	34.760891	14	65	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78782668	78782668	7570	5	C	T	T	29	29	HOMER1	T	2	2
GPR6	2830	broad.mit.edu	36	6	110408021	110408021	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:110408021G>A	uc003ptu.1	+	c.1013G>A	c.(1012-1014)CGC>CAC	p.R338H		NM_005284	NP_005275	P46095	GPR6_HUMAN	G protein-coupled receptor 6	338	Cytoplasmic (Potential).					integral to plasma membrane					0		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)										0.220588	70.354533	80.077476	30	106	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110408021	110408021	6976	6	G	A	A	38	38	GPR6	A	1	1
CITED2	10370	broad.mit.edu	36	6	139736154	139736154	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:139736154G>A	uc003qip.1	-	c.621C>T	c.(619-621)CAC>CAT	p.H207H	CITED2_uc010khb.1_Silent_p.H207H	NM_006079	NP_006070	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with	207					anti-apoptosis|cell proliferation|determination of left/right symmetry|heart development|liver development|negative regulation of cell migration|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell cycle|positive regulation of cell-cell adhesion|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of peroxisome proliferator activated receptor signaling pathway|positive regulation of transcription regulator activity|positive regulation of transforming growth factor beta receptor signaling pathway|response to estrogen stimulus|response to fluid shear stress|response to hypoxia	cytoplasm|nuclear chromatin|nucleus	LBD domain binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription coactivator activity|transcription corepressor activity|transcription repressor activity				0	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		NSCLC(98;1219 1550 33720 43229 49330)								0.186667	15.394089	22.323065	14	61	GG		KEEP	---	---	---	---	capture			Silent	SNP	139736154	139736154	3575	6	G	A	A	40	40	CITED2	A	1	1
SYNE1	23345	broad.mit.edu	36	6	152510930	152510930	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:152510930C>T	uc010kiw.1	-	c.24919G>A	c.(24919-24921)GAT>AAT	p.D8307N	SYNE1_uc003qor.2_Missense_Mutation_p.D1207N|SYNE1_uc010kiv.1_Missense_Mutation_p.D2831N|SYNE1_uc003qos.2_Missense_Mutation_p.D2831N|SYNE1_uc003qot.2_Missense_Mutation_p.D8236N|SYNE1_uc003qou.2_Missense_Mutation_p.D8307N|SYNE1_uc003qop.2_Missense_Mutation_p.D469N|SYNE1_uc003qoq.2_Missense_Mutation_p.D509N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8307	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|ovary(8)|large_intestine(5)|pancreas(2)	30		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)										0.254658	99.951532	108.714937	41	120	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152510930	152510930	15966	6	C	T	T	30	30	SYNE1	T	2	2
TRIM31	11074	broad.mit.edu	36	6	30179354	30179354	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:30179354C>A	uc003npg.1	-	c.1216G>T	c.(1216-1218)GCG>TCG	p.A406S	TRIM31_uc003npi.2_Non-coding_Transcript	NM_007028	NP_008959	Q9BZY9	TRI31_HUMAN	tripartite motif protein 31	406						mitochondrion	ligase activity|zinc ion binding			lung(1)	1														0.18	8.33072	13.17557	9	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30179354	30179354	17049	6	C	A	A	25	25	TRIM31	A	3	3
EEF1E1	9521	broad.mit.edu	36	6	8035498	8035498	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:8035498G>C	uc003mxz.1	-	c.304C>G	c.(304-306)CTT>GTT	p.L102V		NM_004280	NP_004271	O43324	MCA3_HUMAN	eukaryotic translation elongation factor 1	102	GST C-terminal.				negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of DNA damage response, signal transduction by p53 class mediator|tRNA aminoacylation for protein translation	cytosol|nucleus					0	Ovarian(93;0.0398)													0.12069	7.407782	15.572901	7	51	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8035498	8035498	5114	6	G	C	C	33	33	EEF1E1	C	3	3
EPHA7	2045	broad.mit.edu	36	6	94038750	94038750	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:94038750T>C	uc003poe.1	-	c.1436A>G	c.(1435-1437)AAG>AGG	p.K479R	EPHA7_uc003pof.1_Missense_Mutation_p.K479R	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7	479	Extracellular (Potential).|Fibronectin type-III 2.				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(7)|lung(6)|central_nervous_system(3)|large_intestine(2)|skin(2)|pancreas(1)	21		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)						635				0.201681	111.4782	131.153242	48	190	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94038750	94038750	5365	6	T	C	C	56	56	EPHA7	C	4	4
GRM8	2918	broad.mit.edu	36	7	125960700	125960700	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:125960700C>T	uc003vlr.2	-	c.1972G>A	c.(1972-1974)GGC>AGC	p.G658S	GRM8_uc003vls.2_3'UTR|GRM8_uc003vlt.2_Missense_Mutation_p.G658S|GRM8_uc010lkz.1_Non-coding_Transcript	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	658	Helical; Name=3; (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				ovary(5)|pancreas(1)	6		Prostate(267;0.186)			L-Glutamic Acid(DB00142)									0.700809	813.974863	827.309017	260	111	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	125960700	125960700	7082	7	C	T	T	21	21	GRM8	T	2	2
OR2A25	392138	broad.mit.edu	36	7	143402436	143402436	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1794-01	TCGA-14-1794-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:143402436A>G	uc003wdv.1	+	c.191A>G	c.(190-192)CAC>CGC	p.H64R		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)													0.261745	93.18213	100.82449	39	110	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	143402436	143402436	11384	7	A	G	G	6	6	OR2A25	G	4	4
ASNS	440	broad.mit.edu	36	7	97336237	97336237	+	Silent	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:97336237C>T	uc003uot.2	-	c.168G>A	c.(166-168)CTG>CTA	p.L56L	ASNS_uc003uou.2_Silent_p.L56L|ASNS_uc003uov.2_Silent_p.L56L|ASNS_uc003uow.2_Silent_p.L35L|ASNS_uc003uox.2_Intron	NM_133436	NP_899199	P08243	ASNS_HUMAN	asparagine synthetase	56	Glutamine amidotransferase type-2.				asparagine biosynthetic process|cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)								0.175439	33.436984	44.76852	20	94	CC		KEEP	---	---	---	---	capture			Silent	SNP	97336237	97336237	1067	7	C	T	T	17	17	ASNS	T	2	2
ARC	23237	broad.mit.edu	36	8	143691921	143691921	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:143691921C>A	uc003ywn.1	-	c.714G>T	c.(712-714)TGG>TGT	p.W238C	ARC_uc010mev.1_Missense_Mutation_p.W238C	NM_015193	NP_056008	Q7LC44	ARC_HUMAN	activity-regulated cytoskeleton-associated	238					endocytosis	acrosomal vesicle|cell junction|dendritic spine|endosome|postsynaptic density|postsynaptic membrane				breast(1)	1	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)												0.294118	8.564684	9.212679	5	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	143691921	143691921	852	8	C	A	A	26	26	ARC	A	3	3
PEBP4	157310	broad.mit.edu	36	8	22638393	22638393	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:22638393G>A	uc003xcn.1	-	c.425C>T	c.(424-426)CCG>CTG	p.P142L		NM_144962	NP_659399	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4	142						lysosome				ovary(1)|large_intestine(1)|breast(1)	3		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)										0.174699	109.80853	142.9179	58	274	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22638393	22638393	12135	8	G	A	A	39	39	PEBP4	A	1	1
RUNX1T1	862	broad.mit.edu	36	8	93086557	93086557	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:93086557C>T	uc003yfd.2	-	c.703G>A	c.(703-705)GAT>AAT	p.D235N	RUNX1T1_uc003yfb.1_Missense_Mutation_p.D198N|RUNX1T1_uc003yfc.1_Missense_Mutation_p.D208N|RUNX1T1_uc003yfe.1_Missense_Mutation_p.D198N|RUNX1T1_uc010mao.1_Missense_Mutation_p.D208N|RUNX1T1_uc003yff.1_Missense_Mutation_p.D198N	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	235					generation of precursor metabolites and energy|regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|central_nervous_system(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(11;0.0141)							213				0.223684	77.791674	88.44964	34	118	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	93086557	93086557	14227	8	C	T	T	31	31	RUNX1T1	T	1	1
RAD54B	25788	broad.mit.edu	36	8	95461683	95461683	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:95461683C>T	uc003ygk.1	-	c.2113G>A	c.(2113-2115)GGC>AGC	p.G705S	RAD54B_uc010may.1_Missense_Mutation_p.G512S	NM_012415	NP_036547	Q9Y620	RA54B_HUMAN	RAD54 homolog B	705	Helicase C-terminal.				mitotic recombination|reciprocal meiotic recombination	nucleus	ATP binding|DNA binding|DNA helicase activity|RNA helicase activity			kidney(2)|lung(1)	3	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)											0.147651	36.972693	54.906485	22	127	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95461683	95461683	13452	8	C	T	T	21	21	RAD54B	T	2	2
DPY19L4	286148	broad.mit.edu	36	8	95816048	95816048	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:95816048C>T	uc003ygx.2	+	c.142C>T	c.(142-144)CGC>TGC	p.R48C	DPY19L4_uc003ygy.2_De_novo_Start_OutOfFrame	NM_181787	NP_861452	Q7Z388	D19L4_HUMAN	dpy-19-like 4	48						integral to membrane				ovary(2)	2	Breast(36;3.85e-06)													0.529412	56.754887	56.781071	18	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95816048	95816048	4927	8	C	T	T	19	19	DPY19L4	T	1	1
SPTAN1	6709	broad.mit.edu	36	9	130434359	130434359	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:130434359T>C	uc004bvm.2	+	c.6895T>C	c.(6895-6897)TGG>CGG	p.W2299R	SPTAN1_uc004bvl.2_Missense_Mutation_p.W2294R|SPTAN1_uc004bvn.2_Missense_Mutation_p.W2274R|SPTAN1_uc004bvo.2_Missense_Mutation_p.W61R|SPTAN1_uc004bvp.2_Missense_Mutation_p.W37R	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	2294	Spectrin 23.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						NSCLC(120;833 1744 2558 35612 37579)				1105				0.3	9.025291	9.752015	6	14	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	130434359	130434359	15631	9	T	C	C	59	59	SPTAN1	C	4	4
ZDHHC21	340481	broad.mit.edu	36	9	14609681	14609681	+	Splice_Site_SNP	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:14609681C>T	uc003zli.1	-	c.e9_splice_site			ZDHHC21_uc003zlg.1_Intron	NM_178566	NP_848661			zinc finger, DHHC-type containing 21						nitric oxide metabolic process|regulation of nitric-oxide synthase activity	Golgi membrane|integral to membrane	palmitoyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(50;4.31e-06)										0.25	7.421295	8.101934	3	9	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	14609681	14609681	18200	9	C	T	T	24	24	ZDHHC21	T	5	2
STOML2	30968	broad.mit.edu	36	9	35091153	35091153	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:35091153C>T	uc003zwi.1	-	c.703G>A	c.(703-705)GAA>AAA	p.E235K	STOML2_uc003zwh.1_Missense_Mutation_p.E126K|STOML2_uc003zwj.1_Missense_Mutation_p.E126K|STOML2_uc003zwk.1_Missense_Mutation_p.E184K	NM_013442	NP_038470	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2	235						cytoskeleton	receptor binding				0			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)											0.357798	102.271598	104.221867	39	70	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35091153	35091153	15834	9	C	T	T	29	29	STOML2	T	2	2
TSTD2	158427	broad.mit.edu	36	9	99408341	99408341	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1794-01	TCGA-14-1794-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:99408341A>G	uc004axn.1	-	c.859T>C	c.(859-861)TTT>CTT	p.F287L	TSTD2_uc004axo.1_Missense_Mutation_p.F61L|TSTD2_uc004axp.1_Missense_Mutation_p.F61L	NM_139246	NP_640339	Q5T7W7	TSTD2_HUMAN	hypothetical protein LOC158427	287										ovary(2)	2														0.225806	8.79409	10.952712	7	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99408341	99408341	17229	9	A	G	G	4	4	TSTD2	G	4	4
LONRF3	79836	broad.mit.edu	36	X	118008472	118008472	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:118008472G>A	uc004eqw.1	+	c.1336G>A	c.(1336-1338)GAT>AAT	p.D446N	LONRF3_uc004eqx.1_Missense_Mutation_p.D405N|LONRF3_uc004eqy.1_Non-coding_Transcript|LONRF3_uc004eqz.1_Missense_Mutation_p.D190N	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger	446					proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2														0.133333	6.680736	10.593688	4	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118008472	118008472	9268	23	G	A	A	45	45	LONRF3	A	2	2
SLC25A5	292	broad.mit.edu	36	X	118487837	118487837	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1794-01	TCGA-14-1794-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:118487837C>A	uc004erh.2	+	c.297C>A	c.(295-297)TTC>TTA	p.F99L		NM_001152	NP_001143	P05141	ADT2_HUMAN	solute carrier family 25, member 5	99	Helical; Name=2; (By similarity).				chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)									0.177273	70.831625	92.400299	39	181	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118487837	118487837	15009	23	C	A	A	30	30	SLC25A5	A	3	3
MAGEA5	4104	broad.mit.edu	36	X	151034572	151034573	+	Missense	DNP	TA	GT	GT			TCGA-14-1794-01	TCGA-14-1794-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:151034572T>G	uc004ffj.1	-	c.97A>C	c.(97-99)ACT>CCT	p.T33P	MAGEA5_uc010nti.1_Missense_Mutation_p.T33P	NM_021049	NP_066387	P43359	MAGA5_HUMAN	melanoma antigen family A, 5	33	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)													0.6	7.023098	7.066556	3	2	TT		KEEP	---	---	---	---	capture			Missense	DNP	151034572	151034573	9548	23	TA	GT	GT	57	57	MAGEA5	GT	4	4
FOXR2	139628	broad.mit.edu	36	X	55666954	55666954	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:55666954G>A	uc004duo.1	+	c.85G>A	c.(85-87)GAG>AAG	p.E29K		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	29					embryo development|negative regulation of gene-specific transcription from RNA polymerase II promoter|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3														0.222222	74.92607	85.149737	32	112	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55666954	55666954	6278	23	G	A	A	45	45	FOXR2	A	2	2
HDAC8	55869	broad.mit.edu	36	X	71625606	71625606	+	Silent	SNP	G	A	A			TCGA-14-1794-01	TCGA-14-1794-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:71625606G>A	uc004eau.1	-	c.639C>T	c.(637-639)GAC>GAT	p.D213D	HDAC8_uc010nlk.1_Silent_p.D84D|HDAC8_uc004eav.2_Silent_p.D213D|HDAC8_uc004eaw.2_Non-coding_Transcript	NM_018486	NP_060956	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	213	Histone deacetylase.				chromatin assembly or disassembly|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|nuclear chromosome	histone deacetylase activity (H3-K16 specific)|metal ion binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding				0	Renal(35;0.156)				Vorinostat(DB02546)					97				0.287582	119.243032	125.432286	44	109	GG		KEEP	---	---	---	---	capture			Silent	SNP	71625606	71625606	7296	23	G	A	A	40	40	HDAC8	A	1	1
C2CD2L	9854	broad.mit.edu	36	11	118489563	118489564	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:118489563_118489564delGT	uc001pvn.1	+	c.1420_1421delGT	c.(1420-1422)GTGfs	p.V474fs	C2CD2L_uc001pvo.1_Frame_Shift_Del_p.V474fs	NM_014807	NP_055622	O14523	C2C2L_HUMAN	transmembrane protein 24	474						integral to membrane					0														0.33			6	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	118489563	118489564	2236	11	GT	-	-	44	44	C2CD2L	-	5	5
MTA2	9219	broad.mit.edu	36	11	62124680	62124687	+	Frame_Shift_Del	DEL	TCCTCAAT	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:62124680_62124687delTCCTCAAT	uc001ntq.1	-	c.79_86delATTGAGGA	c.(79-87)ATTGAGGAGfs	p.I27fs		NM_004739	NP_004730	O94776	MTA2_HUMAN	metastasis-associated protein 2	27_29	BAH.				chromatin assembly or disassembly	NuRD complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1														0.39			77	119				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	62124680	62124687	10302	11	TCCTCAAT	-	-	54	54	MTA2	-	5	5
IRF9	10379	broad.mit.edu	36	14	23701272	23701289	+	In_Frame_Del	DEL	GGAGTGTGCTGGGATGAT	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:23701272_23701289delGGAGTGTGCTGGGATGAT	uc001wmq.1	+	c.79_96delGGAGTGTGCTGGGATGAT	c.(79-96)GGAGTGTGCTGGGATGATdel	p.GVCWDD27del	RNF31_uc001wmp.1_Non-coding_Transcript|IRF9_uc010ali.1_In_Frame_Del_p.GVCWDD27del|IRF9_uc010alj.1_5'Flank	NM_006084	NP_006075	Q00978	IRF9_HUMAN	interferon-stimulated transcription factor 3,	27_32	IRF tryptophan pentad repeat.				interferon-gamma-mediated signaling pathway|regulation of transcription, DNA-dependent|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)										0.40			41	61				---	---	---	---	capture_indel			In_Frame_Del	DEL	23701272	23701289	8140	14	GGAGTGTGCTGGGATGAT	-	-	39	39	IRF9	-	5	5
TBC1D24	57465	broad.mit.edu	36	16	2486245	2486246	+	In_Frame_Ins	INS	-	GAG	GAG			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2486245_2486246insGAG	uc002cql.1	+	c.95_96insGAG	c.(94-96)CTG>CTGAGG	p.32_33insR	TBC1D24_uc002cqk.1_In_Frame_Ins_p.32_33insR|TBC1D24_uc002cqm.1_In_Frame_Ins_p.32_33insR|TBC1D24_uc010bsm.1_5'Flank	NM_020705	NP_065756	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	32_33					neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0														0.57			12	9				---	---	---	---	capture_indel			In_Frame_Ins	INS	2486245	2486246	16136	16	-	GAG	GAG	55	55	TBC1D24	GAG	5	5
SUPT6H	6830	broad.mit.edu	36	17	24040510	24040531	+	Frame_Shift_Del	DEL	ATATTGAAGTCCTTGATGGTTC	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:24040510_24040531delATATTGAAGTCCTTGATGGTTC	uc002hby.1	+	c.3146_3167delATATTGAAGTCCTTGATGGTTC	c.(3145-3168)TATATTGAAGTCCTTGATGGTTCCfs	p.Y1049fs	SUPT6H_uc010crt.1_Frame_Shift_Del_p.Y1049fs|SUPT6H_uc002hbz.1_5'UTR	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	1049_1056					chromatin remodeling|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity|transcription elongation regulator activity			ovary(2)	2	Lung NSC(42;0.00431)													0.33			266	541				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	24040510	24040531	15920	17	ATATTGAAGTCCTTGATGGTTC	-	-	16	16	SUPT6H	-	5	5
LHX1	3975	broad.mit.edu	36	17	32369773	32369777	+	Frame_Shift_Del	DEL	TTCCG	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:32369773_32369777delTTCCG	uc002hnh.1	+	c.166_170delTTCCG	c.(166-171)TTCCGGfs	p.F56fs	LHX1_uc010cux.1_5'Flank	NM_005568	NP_005559	P48742	LHX1_HUMAN	LIM homeobox protein 1	56_57					organ morphogenesis|regulation of transcription, DNA-dependent	nucleus	RNA polymerase II transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(25;0.00607)												0.65			164	87				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	32369773	32369777	9096	17	TTCCG	-	-	56	56	LHX1	-	5	5
SEMA6C	10500	broad.mit.edu	36	1	149381669	149381670	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:149381669_149381670delGA	uc001ewv.1	-	c.52_53delTC	c.(52-54)TCAfs	p.S18fs	SEMA6C_uc001ewu.1_Frame_Shift_Del_p.S18fs|SEMA6C_uc001eww.1_Frame_Shift_Del_p.S18fs|SEMA6C_uc009wml.1_Intron	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y	18						integral to membrane	receptor activity			ovary(1)	1	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)											0.37			91	157				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	149381669	149381670	14527	1	GA	-	-	45	45	SEMA6C	-	5	5
TDRKH	11022	broad.mit.edu	36	1	150022097	150022101	+	Frame_Shift_Del	DEL	GTCCA	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:150022097_150022101delGTCCA	uc009wnb.1	-	c.22_26delTGGAC	c.(22-27)TGGACAfs	p.W8fs	TDRKH_uc001eyy.2_5'UTR|TDRKH_uc001ezb.2_Frame_Shift_Del_p.W8fs|TDRKH_uc001ezc.2_Frame_Shift_Del_p.W8fs|TDRKH_uc001eza.2_Frame_Shift_Del_p.W8fs|TDRKH_uc001ezd.2_Frame_Shift_Del_p.W8fs	NM_006862	NP_006853	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing isoform a	8_9							RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)											0.46			138	161				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	150022097	150022101	16264	1	GTCCA	-	-	48	48	TDRKH	-	5	5
CCDC108	255101	broad.mit.edu	36	2	219586534	219586541	+	Frame_Shift_Del	DEL	GTACCGAT	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219586534_219586541delGTACCGAT	uc002vjl.1	-	c.3790_3797delATCGGTAC	c.(3790-3798)ATCGGTACTfs	p.I1264fs		NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	1264_1266						integral to membrane	structural molecule activity			ovary(2)|pancreas(1)	3		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.32			19	41				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	219586534	219586541	2863	2	GTACCGAT	-	-	36	36	CCDC108	-	5	5
RETSAT	54884	broad.mit.edu	36	2	85425258	85425260	+	In_Frame_Del	DEL	TAG	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:85425258_85425260delTAG	uc002spd.1	-	c.1224_1226delCTA	c.(1222-1227)TACTAT>TAT	p.408_409YY>Y	RETSAT_uc010fge.1_Non-coding_Transcript|RETSAT_uc010fgf.1_In_Frame_Del_p.199_200YY>Y	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	408_409					oxidation-reduction process|retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(1)	1					Vitamin A(DB00162)									0.33			106	216				---	---	---	---	capture_indel			In_Frame_Del	DEL	85425258	85425260	13708	2	TAG	-	-	49	49	RETSAT	-	5	5
FAHD2A	51011	broad.mit.edu	36	2	95436563	95436564	+	Frame_Shift_Ins	INS	-	AG	AG			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:95436563_95436564insAG	uc002sur.1	+	c.393_394insAG	c.(391-396)ATCATCfs	p.I131fs	FAHD2A_uc002sus.1_Frame_Shift_Ins_p.I131fs	NM_016044	NP_057128	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing	131_132							hydrolase activity|metal ion binding			ovary(1)	1														0.32			33	69				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	95436563	95436564	5570	2	-	AG	AG	29	29	FAHD2A	AG	5	5
NUP210	23225	broad.mit.edu	36	3	13382449	13382468	+	Frame_Shift_Del	DEL	GAGGGGCAGGTAGGCAGCAA	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:13382449_13382468delGAGGGGCAGGTAGGCAGCAA	uc003bxv.1	-	c.1910_1929delTTGCTGCCTACCTGCCCCTC	c.(1909-1929)ATTGCTGCCTACCTGCCCCTCfs	p.I637fs	NUP210_uc003bxx.2_Frame_Shift_Del_p.I309fs	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210	637_643	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(2)|pancreas(1)|liver(1)	10	all_neural(104;0.187)								p.L641V(LN229-Tumor)	587				0.74			20	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	13382449	13382468	11165	3	GAGGGGCAGGTAGGCAGCAA	-	-	45	45	NUP210	-	5	5
ZNF35	7584	broad.mit.edu	36	3	44667650	44667661	+	In_Frame_Del	DEL	CCCAGGTCAGGC	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:44667650_44667661delCCCAGGTCAGGC	uc003cnq.1	+	c.87_98delCCCAGGTCAGGC	c.(85-99)TTCCCAGGTCAGGCA>TTA	p.29_33FPGQA>L	ZNF35_uc003cnr.1_5'UTR	NM_003420	NP_003411	P13682	ZNF35_HUMAN	zinc finger protein 35	29_33	Globular domain.				cellular response to retinoic acid|regulation of transcription, DNA-dependent|spermatogenesis	nucleus|perinuclear region of cytoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)										0.67			346	174				---	---	---	---	capture_indel			In_Frame_Del	DEL	44667650	44667661	18454	3	CCCAGGTCAGGC	-	-	30	30	ZNF35	-	5	5
ANKRD56	345079	broad.mit.edu	36	4	78037114	78037119	+	In_Frame_Del	DEL	GCTGCT	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:78037114_78037119delGCTGCT	uc003hki.1	-	c.908_913delAGCAGC	c.(907-915)CAGCAGCGC>CGC	p.QQ303del		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	303_304	Poly-Gln.										0														0.33			2	4				---	---	---	---	capture_indel			In_Frame_Del	DEL	78037114	78037119	690	4	GCTGCT	-	-	38	38	ANKRD56	-	5	5
GLA	2717	broad.mit.edu	36	X	100539459	100539460	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:100539459_100539460delTA	uc004ehl.1	-	c.1283_1284delTA	c.(1282-1284)TTAfs	p.L428fs		NM_000169	NP_000160	P06280	AGAL_HUMAN	alpha-galactosidase A precursor	428					glycoside catabolic process|glycosphingolipid catabolic process|glycosylceramide catabolic process|negative regulation of nitric oxide biosynthetic process|negative regulation of nitric-oxide synthase activity|oligosaccharide metabolic process	extracellular region|Golgi apparatus|lysosome	alpha-galactosidase activity|cation binding|protein homodimerization activity|receptor binding				0					Agalsidase beta(DB00103)	Colon(193;776 2816 31189 44474)								0.33			77	157				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	100539459	100539460	6694	23	TA	-	-	57	57	GLA	-	5	5
BMP15	9210	broad.mit.edu	36	X	50670843	50670848	+	In_Frame_Del	DEL	CTCACA	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:50670843_50670848delCTCACA	uc004dpg.1	+	c.320_325delCTCACA	c.(319-327)CCTCACAGA>CGA	p.PH107del		NM_005448	NP_005439	O95972	BMP15_HUMAN	bone morphogenetic protein 15 precursor	107_108					female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity			ovary(2)	2	Ovarian(276;0.236)													0.38			3	5				---	---	---	---	capture_indel			In_Frame_Del	DEL	50670843	50670848	1483	23	CTCACA	-	-	24	24	BMP15	-	5	5
ACRC	93953	broad.mit.edu	36	X	70748995	70749000	+	In_Frame_Del	DEL	CATGAT	-	-			TCGA-14-1794-01	TCGA-14-1794-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:70748995_70749000delCATGAT	uc004eae.1	+	c.1816_1821delCATGAT	c.(1816-1821)CATGATdel	p.HD606del		NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	606_607						nucleus				ovary(3)	3	Renal(35;0.156)													0.86			205	32				---	---	---	---	capture_indel			In_Frame_Del	DEL	70748995	70749000	172	23	CATGAT	-	-	21	21	ACRC	-	5	5
