Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
NCOA4	8031	broad.mit.edu	36	10	51249200	51249200	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:51249200T>G	uc009xon.1	+	c.101T>G	c.(100-102)TTG>TGG	p.L34W	PARG_uc001jih.1_Intron|NCOA4_uc001jis.2_Missense_Mutation_p.L18W|NCOA4_uc001jit.1_Missense_Mutation_p.L18W|NCOA4_uc009xoo.1_Missense_Mutation_p.L18W	NM_005437	NP_005428	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4 isoform 3	18					androgen receptor signaling pathway|male gonad development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	androgen receptor binding|transcription coactivator activity			central_nervous_system(1)|kidney(1)	2										48				0.227273	6.856042	8.367286	5	17	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51249200	51249200	10630	10	T	G	G	63	63	NCOA4	G	4	4
PDLIM1	9124	broad.mit.edu	36	10	96988324	96988324	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:96988324G>T	uc001kkh.1	-	c.794C>A	c.(793-795)ACT>AAT	p.T265N	PDLIM1_uc001kki.1_Missense_Mutation_p.T265N|PDLIM1_uc009xuv.1_Intron|PDLIM1_uc001kkj.1_Missense_Mutation_p.T265N	NM_020992	NP_066272	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	265	LIM zinc-binding.				response to oxidative stress	cytoplasm|cytoskeleton	zinc ion binding				0		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)										0.16875	50.152383	66.764852	27	133	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	96988324	96988324	12100	10	G	T	T	36	36	PDLIM1	T	3	3
ATM	472	broad.mit.edu	36	11	107706318	107706318	+	Missense_Mutation	SNP	T	G	G	rs56399857	unknown	TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:107706318T>G	uc001pkb.1	+	c.7475T>G	c.(7474-7476)CTT>CGT	p.L2492R	ATM_uc009yxr.1_Missense_Mutation_p.L2492R|ATM_uc001pke.1_Missense_Mutation_p.L1144R|ATM_uc001pkg.1_Missense_Mutation_p.L849R	NM_000051	NP_612149	Q13315	ATM_HUMAN	ataxia telangiectasia mutated protein isoform 1	2492	FAT.		L -> R.		cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(24)|breast(14)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	238		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)						1073	TSP Lung(14;0.12)			0.304878	65.836072	68.626458	25	57	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107706318	107706318	1128	11	T	G	G	56	56	ATM	G	4	4
C11orf58	10944	broad.mit.edu	36	11	16722746	16722746	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:16722746C>T	uc001mmk.1	+	c.86C>T	c.(85-87)GCA>GTA	p.A29V		NM_014267	NP_055082	O00193	SMAP_HUMAN	small acidic protein isoform a	29											0														0.245902	32.506449	36.089058	15	46	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16722746	16722746	1690	11	C	T	T	25	25	C11orf58	T	2	2
PRRG4	79056	broad.mit.edu	36	11	32814841	32814841	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:32814841T>G	uc001mtx.1	+	c.165T>G	c.(163-165)TTT>TTG	p.F55L		NM_024081	NP_076986	Q9BZD6	TMG4_HUMAN	proline rich Gla (G-carboxyglutamic acid) 4	55	Extracellular (Potential).|Gla.					extracellular region|Golgi apparatus|integral to membrane	calcium ion binding				0	Breast(20;0.206)													0.25	6.755746	7.902265	5	15	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32814841	32814841	13057	11	T	G	G	63	63	PRRG4	G	4	4
OR4X2	119764	broad.mit.edu	36	11	48223669	48223669	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:48223669G>A	uc001ngs.1	+	c.438G>A	c.(436-438)ATG>ATA	p.M146I		NM_001004727	NP_001004727	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.322314	299.674691	309.839703	117	246	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48223669	48223669	11495	11	G	A	A	46	46	OR4X2	A	2	2
INTS5	80789	broad.mit.edu	36	11	62171196	62171196	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62171196C>T	uc001nud.1	-	c.2932G>A	c.(2932-2934)GGA>AGA	p.G978R	GANAB_uc001nub.1_5'Flank|GANAB_uc001nuc.1_5'Flank|GANAB_uc001nua.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	978					snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2														0.4	8.09194	8.180887	4	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62171196	62171196	8082	11	C	T	T	21	21	INTS5	T	2	2
EFEMP2	30008	broad.mit.edu	36	11	65392639	65392640	+	Missense_Mutation	DNP	CT	AA	AA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:65392639_65392640CT>AA	uc001ofy.2	-	c.764_765AG>TT	c.(763-765)CAG>CTT	p.Q255L	EFEMP2_uc001ofz.2_Non-coding_Transcript|EFEMP2_uc001oga.2_Missense_Mutation_p.Q255L	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	255	EGF-like 5; calcium-binding (Potential).				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)										0.5	7.591176	7.591176	4	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	65392639	65392640	5130	11	CT	AA	AA	20	20	EFEMP2	AA	3	3
SPTBN2	6712	broad.mit.edu	36	11	66212089	66212089	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:66212089T>A	uc001ojd.1	-	c.6412A>T	c.(6412-6414)AGT>TGT	p.S2138C	SPTBN2_uc001ojc.1_5'UTR	NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	2138					actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4														0.266667	6.789963	7.531254	4	11	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66212089	66212089	15634	11	T	A	A	55	55	SPTBN2	A	4	4
ALDH3B1	221	broad.mit.edu	36	11	67545859	67545859	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:67545859C>A	uc001omz.1	+	c.892C>A	c.(892-894)CTG>ATG	p.L298M	ALDH3B1_uc001omx.1_Non-coding_Transcript|ALDH3B1_uc001ona.1_Missense_Mutation_p.L261M|ALDH3B1_uc001onb.1_Non-coding_Transcript	NM_000694	NP_000685	P43353	AL3B1_HUMAN	aldehyde dehydrogenase 3B1 isoform a	298					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process|oxidation-reduction process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase				0					NADH(DB00157)									0.6	6.321163	6.364543	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	67545859	67545859	502	11	C	A	A	28	28	ALDH3B1	A	3	3
OAS2	4939	broad.mit.edu	36	12	111927361	111927361	+	Silent	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:111927361C>A	uc001tuj.1	+	c.1419C>A	c.(1417-1419)GTC>GTA	p.V473V	OAS2_uc001tui.1_Silent_p.V473V	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	473	OAS domain 2.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						Pancreas(199;709 2232 18410 33584 35052)								0.099502	11.010345	43.199054	20	181	CC		KEEP	---	---	---	---	capture			Silent	SNP	111927361	111927361	11205	12	C	A	A	30	30	OAS2	A	3	3
ACADS	35	broad.mit.edu	36	12	119660797	119660797	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:119660797A>C	uc001tza.2	+	c.874A>C	c.(874-876)AAC>CAC	p.N292H	ACADS_uc001tzb.2_Intron	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	292						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)									0.315789	8.335541	8.974943	6	13	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119660797	119660797	115	12	A	C	C	9	9	ACADS	C	4	4
ARHGDIB	397	broad.mit.edu	36	12	14994805	14994805	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:14994805C>T	uc001rcq.1	-	c.109G>A	c.(109-111)GAA>AAA	p.E37K	ARHGDIB_uc001rcp.1_5'Flank	NM_001175	NP_001166	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	37					actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0										108				0.220395	150.616826	172.400327	67	237	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14994805	14994805	905	12	C	T	T	30	30	ARHGDIB	T	2	2
SLCO1C1	53919	broad.mit.edu	36	12	20755710	20755710	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:20755710C>T	uc001rej.2	+	c.528C>T	c.(526-528)AAC>AAT	p.N176N	SLCO1C1_uc009zip.1_Silent_p.N10N|SLCO1C1_uc001rei.1_Silent_p.N176N	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	176	Extracellular (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)	6	Esophageal squamous(101;0.149)													0.454545	13.470876	13.490875	5	6	CC		KEEP	---	---	---	---	capture			Silent	SNP	20755710	20755710	15222	12	C	T	T	19	19	SLCO1C1	T	1	1
ITPR2	3709	broad.mit.edu	36	12	26700016	26700016	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:26700016C>T	uc001rhg.1	-	c.2481G>A	c.(2479-2481)ATG>ATA	p.M827I		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	827	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	13	Colorectal(261;0.0847)									1600				0.66129	132.477951	133.900977	41	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26700016	26700016	8225	12	C	T	T	29	29	ITPR2	T	2	2
ALG10B	144245	broad.mit.edu	36	12	36998526	36998526	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:36998526A>C	uc001rln.2	+	c.368A>C	c.(367-369)AAG>ACG	p.K123T	ALG10B_uc001rlo.2_Missense_Mutation_p.K93T	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B	123	Extracellular (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)	2	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)												0.152542	6.625488	13.473487	9	50	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36998526	36998526	515	12	A	C	C	3	3	ALG10B	C	4	4
ITGA7	3679	broad.mit.edu	36	12	54368965	54368965	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:54368965G>A	uc001shh.1	-	c.2900C>T	c.(2899-2901)CCA>CTA	p.P967L	ITGA7_uc001shf.1_5'Flank|ITGA7_uc009znw.1_Missense_Mutation_p.P210L|ITGA7_uc009znx.1_Missense_Mutation_p.P844L|ITGA7_uc001shg.1_Missense_Mutation_p.P963L	NM_002206	NP_002197	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 2 precursor	1007	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4										261				0.307692	6.79036	7.222072	4	9	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54368965	54368965	8185	12	G	A	A	47	47	ITGA7	A	2	2
SUOX	6821	broad.mit.edu	36	12	54683695	54683695	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:54683695C>A	uc001six.1	+	c.255C>A	c.(253-255)TAC>TAA	p.Y85*	SUOX_uc001siy.1_Nonsense_Mutation_p.Y85*|SUOX_uc001siz.1_Nonsense_Mutation_p.Y85*|SUOX_uc001sja.1_Nonsense_Mutation_p.Y85*	NM_000456	NP_001027559	P51687	SUOX_HUMAN	sulfite oxidase	85	Cytochrome b5 heme-binding.				oxidation-reduction process	mitochondrial intermembrane space	electron carrier activity|molybdenum ion binding|sulfite oxidase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)											0.75	6.621539	6.845794	3	1	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	54683695	54683695	15915	12	C	A	A	17	17	SUOX	A	5	3
SUOX	6821	broad.mit.edu	36	12	54683697	54683698	+	Missense_Mutation	DNP	CT	TA	TA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:54683697_54683698CT>TA	uc001six.1	+	c.257_258CT>TA	c.(256-258)ACT>ATA	p.T86I	SUOX_uc001siy.1_Missense_Mutation_p.T86I|SUOX_uc001siz.1_Missense_Mutation_p.T86I|SUOX_uc001sja.1_Missense_Mutation_p.T86I	NM_000456	NP_001027559	P51687	SUOX_HUMAN	sulfite oxidase	86	Cytochrome b5 heme-binding.				oxidation-reduction process	mitochondrial intermembrane space	electron carrier activity|molybdenum ion binding|sulfite oxidase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)											0.8	9.29799	9.712274	4	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	54683697	54683698	15915	12	CT	TA	TA	20	20	SUOX	TA	2	2
SALL2	6297	broad.mit.edu	36	14	21061689	21061689	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:21061689C>T	uc001wbe.1	-	c.2013G>A	c.(2011-2013)AGG>AGA	p.R671R	SALL2_uc001wbf.2_Intron|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	671	C2H2-type 4.						DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)										0.590361	144.559627	145.149094	49	34	CC		KEEP	---	---	---	---	capture			Silent	SNP	21061689	21061689	14291	14	C	T	T	22	22	SALL2	T	2	2
MAX	4149	broad.mit.edu	36	14	64630253	64630253	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:64630253G>A	uc001xif.1	-	c.97C>T	c.(97-99)CGA>TGA	p.R33*	MAX_uc001xic.1_Nonsense_Mutation_p.R33*|MAX_uc001xie.1_Nonsense_Mutation_p.R33*|MAX_uc010aql.1_Intron|MAX_uc001xig.1_Nonsense_Mutation_p.R24*|MAX_uc001xih.1_Non-coding_Transcript|MAX_uc001xii.1_Nonsense_Mutation_p.R24*|MAX_uc001xij.1_Nonsense_Mutation_p.R33*|MAX_uc001xik.1_Nonsense_Mutation_p.R33*	NM_002382	NP_002373	P61244	MAX_HUMAN	MAX protein isoform a	33	Basic motif.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|MLL1 complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulator activity				0				all cancers(60;0.000776)|OV - Ovarian serous cystadenocarcinoma(108;0.00359)|BRCA - Breast invasive adenocarcinoma(234;0.00999)						99				0.181102	99.785311	124.00075	46	208	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	64630253	64630253	9723	14	G	A	A	40	40	MAX	A	5	1
STON2	85439	broad.mit.edu	36	14	80932093	80932093	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:80932093G>T	uc001xvk.1	-	c.271C>A	c.(271-273)CCC>ACC	p.P91T	STON2_uc001xvm.1_Missense_Mutation_p.P91T|STON2_uc010atc.1_Missense_Mutation_p.P91T	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	91					endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			pancreas(2)	2				BRCA - Breast invasive adenocarcinoma(234;0.0348)										0.228571	10.379444	12.754461	8	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	80932093	80932093	15838	14	G	T	T	42	42	STON2	T	3	3
SLC12A6	9990	broad.mit.edu	36	15	32317733	32317734	+	Missense_Mutation	DNP	GT	TG	TG			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:32317733_32317734GT>TG	uc001zhw.1	-	c.2793_2794AC>CA	c.(2791-2796)AAACAG>AACAAG	p.931_932KQ>NK	SLC12A6_uc001zhu.1_Missense_Mutation_p.743_744KQ>NK|SLC12A6_uc001zhv.1_Missense_Mutation_p.880_881KQ>NK|SLC12A6_uc001zhz.1_Non-coding_Transcript|SLC12A6_uc001zhx.1_Missense_Mutation_p.916_917KQ>NK|SLC12A6_uc001zhy.1_Non-coding_Transcript|SLC12A6_uc001zia.1_Missense_Mutation_p.872_873KQ>NK|SLC12A6_uc001zib.1_Missense_Mutation_p.922_923KQ>NK|SLC12A6_uc001zic.1_Missense_Mutation_p.931_932KQ>NK|SLC12A6_uc010bau.1_Missense_Mutation_p.931_932KQ>NK|SLC12A6_uc001zid.1_Missense_Mutation_p.872_873KQ>NK|SLC12A6_uc001zht.1_Non-coding_Transcript	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	931_932	Cytoplasmic (Potential).				angiogenesis|potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)	6		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)									0.163265	7.758112	13.060947	8	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	32317733	32317734	14882	15	GT	TG	TG	48	48	SLC12A6	TG	3	3
C2CD4A	145741	broad.mit.edu	36	15	60147165	60147165	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:60147165C>T	uc002ahf.2	+	c.61C>T	c.(61-63)CTT>TTT	p.L21F	C2CD4A_uc010bgl.1_Missense_Mutation_p.L21F	NM_207322	NP_997205	Q8NCU7	C2C4A_HUMAN	nuclear localized factor 1	21						nucleus					0														0.545455	12.138612	12.157488	6	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60147165	60147165	2238	15	C	T	T	28	28	C2CD4A	T	2	2
MPI	4351	broad.mit.edu	36	15	72976577	72976578	+	Missense_Mutation	DNP	CC	GT	GT			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:72976577_72976578CC>GT	uc002azc.1	+	c.1017_1018CC>GT	c.(1015-1020)GACCCC>GAGTCC	p.339_340DP>ES	MPI_uc002azd.1_Intron|MPI_uc002aze.1_Missense_Mutation_p.278_279DP>ES	NM_002435	NP_002426	P34949	MPI_HUMAN	mannose-6- phosphate isomerase	339_340					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	mannose-6-phosphate isomerase activity|zinc ion binding			ovary(2)	2														0.216216	10.912717	13.646885	8	29	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	72976577	72976578	10121	15	CC	GT	GT	18	18	MPI	GT	3	3
SOCS1	8651	broad.mit.edu	36	16	11256517	11256518	+	Missense_Mutation	DNP	CG	GT	GT			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:11256517_11256518CG>GT	uc002dar.1	-	c.319_320CG>AC	c.(319-321)CGC>ACC	p.R107T	C16orf75_uc002daq.1_Intron|SOCS1_uc010bur.1_Missense_Mutation_p.R107T	NM_003745	NP_003736	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	107	SH2.				interferon-gamma-mediated signaling pathway|JAK-STAT cascade|negative regulation of insulin receptor signaling pathway|negative regulation of tyrosine phosphorylation of Stat3 protein|regulation of growth|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol	insulin-like growth factor receptor binding|protein kinase binding|protein kinase inhibitor activity	p.R107_I126del(1)|p.Y64fs*1(1)|p.D63_Q108del(1)		haematopoietic_and_lymphoid_tissue(64)|lung(3)|breast(1)|central_nervous_system(1)	69						Colon(177;456 3548 27231)								1	16.161269	16.14556	6	0	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	11256517	11256518	15413	16	CG	GT	GT	27	27	SOCS1	GT	3	3
TMEM204	79652	broad.mit.edu	36	16	1544889	1544889	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1544889T>C	uc002cmc.2	+	c.542T>C	c.(541-543)CTG>CCG	p.L181P	IFT140_uc002cma.1_Intron|IFT140_uc002cmb.1_Intron|IFT140_uc002clz.1_Intron|TMEM204_uc002cmd.2_Missense_Mutation_p.L181P|TMEM204_uc010brr.1_Missense_Mutation_p.L181P	NM_024600	NP_078876	Q9BSN7	TM204_HUMAN	transmembrane protein 204	181	Helical; (Potential).				response to stress	adherens junction|integral to membrane					0		Hepatocellular(780;0.219)												0.5	16.197656	16.197656	8	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1544889	1544889	16664	16	T	C	C	55	55	TMEM204	C	4	4
SULT1A2	6799	broad.mit.edu	36	16	28514454	28514454	+	Silent	SNP	G	A	A	rs1126449	by-cluster	TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:28514454G>A	uc002dqg.1	-	c.192C>T	c.(190-192)GGC>GGT	p.G64G	SULT1A2_uc010byh.1_Silent_p.G64G|SULT1A2_uc002dqh.1_Silent_p.G64G	NM_177528	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A,	64					3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine biosynthetic process|catecholamine metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity				0														0.380952	16.091087	16.352927	8	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	28514454	28514454	15893	16	G	A	A	38	38	SULT1A2	A	1	1
KRT33A	3883	broad.mit.edu	36	17	36756962	36756962	+	Silent	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36756962G>A	uc002hwk.1	-	c.627C>T	c.(625-627)CTC>CTT	p.L209L		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	209	Linker 12.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)												0.3125	7.550393	8.062485	5	11	GG		KEEP	---	---	---	---	capture			Silent	SNP	36756962	36756962	8784	17	G	A	A	45	45	KRT33A	A	2	2
RPS6KB1	6198	broad.mit.edu	36	17	55377547	55377547	+	Splice_Site_SNP	SNP	A	G	G			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:55377547A>G	uc002ixy.1	+	c.e14_splice_site			RPS6KB1_uc010ddj.1_Splice_Site_SNP|RPS6KB1_uc002ixz.1_Non-coding_Transcript	NM_003161	NP_003152			ribosomal protein S6 kinase, 70kDa, polypeptide						apoptosis|G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|negative regulation of apoptosis|phosphatidylinositol-mediated signaling|positive regulation of mitotic cell cycle|positive regulation of translational initiation|TOR signaling cascade	cell junction|cytoplasm|cytosol|mitochondrial outer membrane|nucleus|nucleus|synapse|synaptosome	ATP binding|protein binding|protein kinase activity			large_intestine(1)	1	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)							182				0.346154	48.936736	50.022115	18	34	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	55377547	55377547	14136	17	A	G	G	7	7	RPS6KB1	G	5	4
GH2	2689	broad.mit.edu	36	17	59312596	59312597	+	Missense_Mutation	DNP	AG	GA	GA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:59312596_59312597AG>GA	uc002jcl.1	-	c.25_26CT>TC	c.(25-27)CTG>TCG	p.L9S	GH2_uc002jcj.1_Missense_Mutation_p.L9S|CSH2_uc002jck.1_Intron|GH2_uc002jcm.1_Missense_Mutation_p.L9S|GH2_uc002jcn.1_Missense_Mutation_p.L9S|GH2_uc002jco.1_Missense_Mutation_p.L9S	NM_022557	NP_072051	P01242	SOM2_HUMAN	growth hormone 2 isoform 2	9						extracellular region	hormone activity			pancreas(1)	1														0.4	11.543099	11.674699	6	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	59312596	59312597	6636	17	AG	GA	GA	7	7	GH2	GA	4	4
DDX5	1655	broad.mit.edu	36	17	59927134	59927135	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:59927134_59927135CC>AA	uc010deh.1	-	c.1435_1436GG>TT	c.(1435-1437)GGT>TTT	p.G479F	DDX5_uc002jej.1_5'Flank|DDX5_uc002jek.1_Missense_Mutation_p.G479F	NM_004396	NP_004387	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5	479					cell growth|nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity|transcription cofactor activity			ovary(2)|lung(1)	3	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			NSCLC(22;406 813 4871 19580 40307)								0.428571	6.922891	6.954087	3	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	59927134	59927135	4538	17	CC	AA	AA	18	18	DDX5	AA	3	3
AFMID	125061	broad.mit.edu	36	17	73713385	73713385	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:73713385T>A	uc002juz.2	+	c.751T>A	c.(751-753)TTC>ATC	p.F251I	AFMID_uc002jva.2_Missense_Mutation_p.F251I|AFMID_uc002jvb.2_Intron	NM_001010982	NP_001010982	Q63HM1	AFMID_HUMAN	arylformamidase	251						cytosol|nucleus	arylformamidase activity			large_intestine(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.134)											0.575342	122.441606	122.802633	42	31	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73713385	73713385	363	17	T	A	A	52	52	AFMID	A	4	4
CARD14	79092	broad.mit.edu	36	17	75779241	75779241	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:75779241A>T	uc002jxw.1	+	c.1037A>T	c.(1036-1038)AAG>ATG	p.K346M	CARD14_uc002jxt.1_Non-coding_Transcript|CARD14_uc002jxv.2_Missense_Mutation_p.K346M|CARD14_uc002jxx.1_Missense_Mutation_p.K109M|CARD14_uc010dhu.1_Missense_Mutation_p.K144M	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	caspase recruitment domain protein 14 isoform 1	346	Potential.				activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding			ovary(4)|skin(1)	5	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)							565				0.25	14.263547	16.309166	9	27	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75779241	75779241	2765	17	A	T	T	3	3	CARD14	T	4	4
LPIN2	9663	broad.mit.edu	36	18	2927872	2927873	+	Missense_Mutation	DNP	GG	AA	AA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:2927872_2927873GG>AA	uc002klo.1	-	c.985_986CC>TT	c.(985-987)CCC>TTC	p.P329F		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	329					fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)										0.304348	11.904864	12.697899	7	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	2927872	2927873	9292	18	GG	AA	AA	43	43	LPIN2	AA	2	2
SERPINB10	5273	broad.mit.edu	36	18	59748324	59748324	+	Missense_Mutation	SNP	G	A	A	rs61733368	unknown	TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:59748324G>A	uc010dqi.1	+	c.556G>A	c.(556-558)GCC>ACC	p.A186T	SERPINB10_uc002ljr.1_Missense_Mutation_p.A186T	NM_005024	NP_005015	P48595	SPB10_HUMAN	serine (or cysteine) proteinase inhibitor, clade	186						cytoplasm|nucleus	serine-type endopeptidase inhibitor activity			lung(1)|kidney(1)	2		Esophageal squamous(42;0.131)												0.342857	129.272448	132.319316	48	92	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59748324	59748324	14585	18	G	A	A	38	38	SERPINB10	A	1	1
CBLN2	147381	broad.mit.edu	36	18	68356900	68356900	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:68356900C>T	uc002lku.2	-	c.445G>A	c.(445-447)GTG>ATG	p.V149M	CBLN2_uc002lkv.2_Missense_Mutation_p.V149M	NM_182511	NP_872317	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	149	C1q.					integral to membrane					0		Esophageal squamous(42;0.131)												0.333333	104.388967	107.205123	38	76	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68356900	68356900	2824	18	C	T	T	19	19	CBLN2	T	1	1
LAMA1	284217	broad.mit.edu	36	18	6949484	6949484	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:6949484A>T	uc002knm.1	-	c.7634T>A	c.(7633-7635)TTT>TAT	p.F2545Y	LAMA1_uc002knl.1_5'UTR	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2545	Laminin G-like 3.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|breast(2)|pancreas(2)|central_nervous_system(1)	17		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)					1597				0.454545	10.064863	10.085535	5	6	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6949484	6949484	8928	18	A	T	T	1	1	LAMA1	T	4	4
DNMT1	1786	broad.mit.edu	36	19	10112504	10112504	+	Missense_Mutation	SNP	T	C	C	rs35600922	unknown	TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:10112504T>C	uc002mni.1	-	c.3662A>G	c.(3661-3663)GAT>GGT	p.D1221G	DNMT1_uc002mne.1_5'Flank|DNMT1_uc002mnf.1_Missense_Mutation_p.D67G|DNMT1_uc002mng.1_Missense_Mutation_p.D1143G|DNMT1_uc002mnh.1_Missense_Mutation_p.D1038G|DNMT1_uc002mnj.1_Missense_Mutation_p.D1205G	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	1143	Catalytic.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)					705				1	7.939995	7.821353	3	0	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10112504	10112504	4858	19	T	C	C	50	50	DNMT1	C	4	4
DNMT1	1786	broad.mit.edu	36	19	10112507	10112507	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:10112507A>C	uc002mni.1	-	c.3659T>G	c.(3658-3660)CTG>CGG	p.L1220R	DNMT1_uc002mne.1_5'Flank|DNMT1_uc002mnf.1_Missense_Mutation_p.L66R|DNMT1_uc002mng.1_Missense_Mutation_p.L1142R|DNMT1_uc002mnh.1_Missense_Mutation_p.L1037R|DNMT1_uc002mnj.1_Missense_Mutation_p.L1204R	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	1142	Catalytic.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)					705				1	8.342209	8.223776	3	0	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10112507	10112507	4858	19	A	C	C	7	7	DNMT1	C	4	4
ELAVL3	1995	broad.mit.edu	36	19	11429885	11429886	+	Missense_Mutation	DNP	TG	AT	AT			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:11429885_11429886TG>AT	uc002mry.1	-	c.703_704CA>AT	c.(703-705)CAG>ATG	p.Q235M	ELAVL3_uc002mrx.1_Missense_Mutation_p.Q235M	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1	235					cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)	2														0.4	10.695722	10.810394	6	9	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	11429885	11429886	5242	19	TG	AT	AT	55	55	ELAVL3	AT	4	4
MAST1	22983	broad.mit.edu	36	19	12846257	12846257	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12846257C>G	uc002mvm.1	+	c.4286C>G	c.(4285-4287)GCG>GGG	p.A1429G		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	1429					cytoskeleton organization|intracellular protein kinase cascade|protein phosphorylation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7										239				0.6	7.22426	7.268145	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12846257	12846257	9708	19	C	G	G	27	27	MAST1	G	3	3
MAST1	22983	broad.mit.edu	36	19	12846259	12846259	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12846259G>T	uc002mvm.1	+	c.4288G>T	c.(4288-4290)GGC>TGC	p.G1430C		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	1430					cytoskeleton organization|intracellular protein kinase cascade|protein phosphorylation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7										239				0.75	7.623412	7.84801	3	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12846259	12846259	9708	19	G	T	T	43	43	MAST1	T	3	3
GNA15	2769	broad.mit.edu	36	19	3113981	3113983	+	Missense_Mutation	TNP	GCT	AAA	AAA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:3113981_3113983GCT>AAA	uc002lxf.2	+	c.1089_1091GCT>AAA	c.(1087-1092)GTGCTC>GTAAAC	p.L364N		NM_002068	NP_002059	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein),	364					activation of phospholipase C activity by dopamine receptor signaling pathway|activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)								OREG0025150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1	21.497536	21.493566	8	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	TNP	3113981	3113983	6772	19	GCT	AAA	AAA	46	46	GNA15	AAA	2	2
GNA15	2769	broad.mit.edu	36	19	3113985	3113985	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:3113985G>C	uc002lxf.2	+	c.1093G>C	c.(1093-1095)GCC>CCC	p.A365P		NM_002068	NP_002059	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein),	365					activation of phospholipase C activity by dopamine receptor signaling pathway|activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)								OREG0025150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1	10.455157	10.393867	4	0	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3113985	3113985	6772	19	G	C	C	38	38	GNA15	C	3	3
ARHGAP33	115703	broad.mit.edu	36	19	40963768	40963768	+	Silent	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:40963768G>T	uc002obs.1	+	c.936G>T	c.(934-936)GTG>GTT	p.V312V	ARHGAP33_uc002obr.1_Silent_p.V312V|ARHGAP33_uc002obt.1_Silent_p.V176V|ARHGAP33_uc010eel.1_5'Flank|ARHGAP33_uc002obv.1_5'Flank	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	312					cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			ovary(1)|pancreas(1)|skin(1)	3														0.363636	7.19711	7.376637	4	7	GG		KEEP	---	---	---	---	capture			Silent	SNP	40963768	40963768	894	19	G	T	T	48	48	ARHGAP33	T	3	3
PLIN5	440503	broad.mit.edu	36	19	4474570	4474570	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:4474570C>A	uc002mas.1	-	c.1362G>T	c.(1360-1362)AAG>AAT	p.K454N		NM_001013706	NP_001013728	Q00G26	PLIN5_HUMAN	lipid storage droplet protein 5	454						lipid particle					0												OREG0025168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.173913	7.467967	12.10297	8	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4474570	4474570	12519	19	C	A	A	28	28	PLIN5	A	3	3
ZNF45	7596	broad.mit.edu	36	19	49110903	49110903	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:49110903C>T	uc002oxu.1	-	c.525G>A	c.(523-525)TGG>TGA	p.W175*	ZNF45_uc002oxv.1_Nonsense_Mutation_p.W175*|ZNF45_uc002oxw.1_Nonsense_Mutation_p.W175*	NM_003425	NP_003416	Q02386	ZNF45_HUMAN	zinc finger protein 45	175	C2H2-type 1; degenerate.				multicellular organismal development|regulation of transcription, DNA-dependent	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1														0.205128	9.664615	12.830558	8	31	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	49110903	49110903	18514	19	C	T	T	30	30	ZNF45	T	5	2
RSPH6A	81492	broad.mit.edu	36	19	50991049	50991049	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:50991049G>T	uc002pdm.1	-	c.2072C>A	c.(2071-2073)GCA>GAA	p.A691E	RSPH6A_uc002pdl.1_Missense_Mutation_p.A427E	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	691	Glu-rich.					intracellular				ovary(1)|central_nervous_system(1)	2														0.214286	10.037539	12.148712	6	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50991049	50991049	14187	19	G	T	T	46	46	RSPH6A	T	3	3
ZSCAN1	284312	broad.mit.edu	36	19	63256814	63256814	+	Silent	SNP	T	A	A			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:63256814T>A	uc002qrc.1	+	c.810T>A	c.(808-810)GGT>GGA	p.G270G		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	270					regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)										0.36	15.052696	15.489615	9	16	TT		KEEP	---	---	---	---	capture			Silent	SNP	63256814	63256814	18830	19	T	A	A	59	59	ZSCAN1	A	4	4
CD209	30835	broad.mit.edu	36	19	7716615	7716615	+	Silent	SNP	T	G	G			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:7716615T>G	uc002mht.1	-	c.537A>C	c.(535-537)GCA>GCC	p.A179A	CD209_uc010dvp.1_Silent_p.A155A|CD209_uc002mhs.1_Silent_p.A155A|CD209_uc002mhq.1_Silent_p.A179A|CD209_uc002mhr.1_Silent_p.A155A|CD209_uc002mhu.1_Intron|CD209_uc010dvq.1_Silent_p.A179A|CD209_uc002mhv.1_Silent_p.A155A|CD209_uc002mhw.1_Intron|CD209_uc002mhx.1_Silent_p.A135A|CD209_uc010dvr.1_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	179	4.|Extracellular (Probable).|7 X approximate tandem repeats.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding				0														0.173469	14.897568	24.814952	17	81	TT		KEEP	---	---	---	---	capture			Silent	SNP	7716615	7716615	3111	19	T	G	G	55	55	CD209	G	4	4
SARS	6301	broad.mit.edu	36	1	109580654	109580654	+	Silent	SNP	T	G	G			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:109580654T>G	uc001dwv.1	+	c.1218T>G	c.(1216-1218)CTT>CTG	p.L406L	SARS_uc001dwu.1_Silent_p.L406L|SARS_uc001dww.1_Silent_p.L339L|SARS_uc001dwx.1_Silent_p.L358L|SARS_uc009wfa.1_Intron|SARS_uc001dwy.1_Silent_p.L231L|SARS_uc001dwz.1_Silent_p.L231L	NM_006513	NP_006504	P49591	SYSC_HUMAN	seryl-tRNA synthetase	406					seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)									0.227273	6.858084	8.36774	5	17	TT		KEEP	---	---	---	---	capture			Silent	SNP	109580654	109580654	14325	1	T	G	G	62	62	SARS	G	4	4
PPM1J	333926	broad.mit.edu	36	1	113054407	113054407	+	Silent	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:113054407G>A	uc001ect.1	-	c.1419C>T	c.(1417-1419)CCC>CCT	p.P473P	RHOC_uc001ecq.1_5'Flank|RHOC_uc001ecr.1_5'Flank|RHOC_uc009wgk.1_5'Flank|PPM1J_uc009wgl.1_Intron|PPM1J_uc001ecs.1_Silent_p.P267P	NM_005167	NP_005158	Q5JR12	PPM1J_HUMAN	protein phosphatase 1J (PP2C domain containing)	473	PP2C-like.									central_nervous_system(1)	1	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)										0.444444	7.993586	8.018318	4	5	GG		KEEP	---	---	---	---	capture			Silent	SNP	113054407	113054407	12777	1	G	A	A	43	43	PPM1J	A	2	2
UBE2J2	118424	broad.mit.edu	36	1	1180640	1180640	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:1180640G>A	uc001ado.1	-	c.634C>T	c.(634-636)CAC>TAC	p.H212Y	UBE2J2_uc001adm.1_Missense_Mutation_p.H161Y|UBE2J2_uc001adn.1_Missense_Mutation_p.H196Y|UBE2J2_uc001adp.1_Missense_Mutation_p.H196Y|UBE2J2_uc001adq.1_Missense_Mutation_p.H144Y|UBE2J2_uc001adr.1_Missense_Mutation_p.H144Y|UBE2J2_uc001ads.1_Missense_Mutation_p.H144Y	NM_194315	NP_919440	Q8N2K1	UB2J2_HUMAN	ubiquitin conjugating enzyme E2, J2 isoform 1	196	Cytoplasmic (Potential).				post-translational protein modification|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)										0.1875	7.225984	10.16368	6	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1180640	1180640	17418	1	G	A	A	46	46	UBE2J2	A	2	2
CHRNB2	1141	broad.mit.edu	36	1	152810508	152810508	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152810508C>T	uc001ffg.1	+	c.585C>T	c.(583-585)GAC>GAT	p.D195D		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	195	Extracellular (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)									0.26087	27.079944	29.461893	12	34	CC		KEEP	---	---	---	---	capture			Silent	SNP	152810508	152810508	3525	1	C	T	T	19	19	CHRNB2	T	1	1
ADAM15	8751	broad.mit.edu	36	1	153293302	153293302	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:153293302C>T	uc001fgr.1	+	c.395C>T	c.(394-396)TCC>TTC	p.S132F	ADAM15_uc001fgq.1_5'UTR|ADAM15_uc009wpc.1_Non-coding_Transcript|ADAM15_uc001fgs.1_Missense_Mutation_p.S132F|ADAM15_uc001fgt.1_Missense_Mutation_p.S132F|ADAM15_uc001fgu.1_Missense_Mutation_p.S132F|ADAM15_uc001fgv.1_Missense_Mutation_p.S132F|ADAM15_uc001fgw.1_Missense_Mutation_p.S132F|ADAM15_uc001fgx.1_Missense_Mutation_p.S132F|ADAM15_uc001fgy.1_Non-coding_Transcript|ADAM15_uc001fgz.1_Non-coding_Transcript|ADAM15_uc001fha.1_Non-coding_Transcript	NM_207197	NP_997080	Q13444	ADA15_HUMAN	a disintegrin and metalloproteinase domain 15	132					angiogenesis|cell-matrix adhesion|collagen catabolic process|proteolysis	acrosomal vesicle|adherens junction|endomembrane system|flagellum|integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			central_nervous_system(3)|skin(2)|ovary(1)	6	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)											0.091335	8.136352	80.029794	39	388	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	153293302	153293302	238	1	C	T	T	30	30	ADAM15	T	2	2
SPEN	23013	broad.mit.edu	36	1	16134793	16134793	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:16134793G>C	uc001axk.1	+	c.9471G>C	c.(9469-9471)GAG>GAC	p.E3157D		NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	3157					interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	14		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)						551				0.375	10.634008	10.857427	6	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16134793	16134793	15550	1	G	C	C	35	35	SPEN	C	3	3
C1orf89	79363	broad.mit.edu	36	1	16432739	16432739	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:16432739T>G	uc001ayd.1	-	c.220A>C	c.(220-222)AAG>CAG	p.K74Q		NM_030907	NP_112169	Q9BU20	RSG1_HUMAN	hypothetical protein LOC79363	74	Small GTPase-like.				cellular protein localization|cilium assembly|regulation of exocytosis|regulation of vesicle fusion|small GTPase mediated signal transduction	microtubule basal body	GTP binding				0		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;3.2e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0114)|READ - Rectum adenocarcinoma(331;0.0649)										0.266667	6.393069	7.132524	4	11	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16432739	16432739	2142	1	T	G	G	63	63	C1orf89	G	4	4
ALPL	249	broad.mit.edu	36	1	21762297	21762297	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:21762297G>T	uc001bet.1	+	c.405G>T	c.(403-405)GAG>GAT	p.E135D	ALPL_uc001beu.2_Missense_Mutation_p.E135D	NM_000478	NP_001120973	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase	135					response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)	4		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)									0.75	7.325075	7.548873	3	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21762297	21762297	550	1	G	T	T	34	34	ALPL	T	3	3
NVL	4931	broad.mit.edu	36	1	222485568	222485568	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:222485568A>G	uc001hok.1	-	c.2509T>C	c.(2509-2511)TCA>CCA	p.S837P	NVL_uc009xeg.1_Missense_Mutation_p.S640P|NVL_uc001hol.1_Missense_Mutation_p.S731P	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1	837						aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity				0				GBM - Glioblastoma multiforme(131;0.00501)										0.304348	40.734287	42.304565	14	32	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	222485568	222485568	11185	1	A	G	G	12	12	NVL	G	4	4
LEFTY2	7044	broad.mit.edu	36	1	224191917	224191917	+	Silent	SNP	A	G	G			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:224191917A>G	uc001hpt.1	-	c.948T>C	c.(946-948)TGT>TGC	p.C316C	LEFTY2_uc009xek.1_Non-coding_Transcript	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	316					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					Colon(172;116 2643 9098 43333)								0.24	17.008393	20.175555	12	38	AA		KEEP	---	---	---	---	capture			Silent	SNP	224191917	224191917	9040	1	A	G	G	14	14	LEFTY2	G	4	4
EIF2C1	26523	broad.mit.edu	36	1	36152462	36152462	+	Silent	SNP	A	T	T			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:36152462A>T	uc001bzl.1	+	c.1833A>T	c.(1831-1833)GCA>GCT	p.A611A	EIF2C1_uc001bzk.1_Silent_p.A536A|EIF2C1_uc009vuy.1_Non-coding_Transcript	NM_012199	NP_036331	Q9UL18	AGO1_HUMAN	eukaryotic translation initiation factor 2C, 1	611	Piwi.				negative regulation of translation involved in gene silencing by miRNA|nuclear-transcribed mRNA catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)												0.26087	10.334135	11.529765	6	17	AA		KEEP	---	---	---	---	capture			Silent	SNP	36152462	36152462	5194	1	A	T	T	7	7	EIF2C1	T	4	4
GNL2	29889	broad.mit.edu	36	1	37807280	37807280	+	Missense_Mutation	SNP	A	C	C			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:37807280A>C	uc001cbk.1	-	c.1627T>G	c.(1627-1629)TCT>GCT	p.S543A		NM_013285	NP_037417	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2	543					ribosome biogenesis	nucleolus	GTP binding|GTPase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)												0.206897	12.922817	17.60852	12	46	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37807280	37807280	6805	1	A	C	C	9	9	GNL2	C	4	4
KIAA0467	23334	broad.mit.edu	36	1	43681668	43681668	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:43681668C>A	uc001cjk.1	+	c.5861C>A	c.(5860-5862)GCC>GAC	p.A1954D	KIAA0467_uc001cjl.1_5'Flank	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2853						peroxisome				breast(6)|ovary(4)|pancreas(1)	11	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)												0.264706	12.648572	14.362399	9	25	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43681668	43681668	8485	1	C	A	A	26	26	KIAA0467	A	3	3
ZFYVE9	9372	broad.mit.edu	36	1	52476862	52476862	+	Silent	SNP	A	G	G			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:52476862A>G	uc001cto.1	+	c.1185A>G	c.(1183-1185)GAA>GAG	p.E395E	ZFYVE9_uc001ctn.1_Silent_p.E395E|ZFYVE9_uc001ctp.1_Silent_p.E395E	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	395					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor complex assembly	early endosome membrane	protein binding|receptor activity|serine-type peptidase activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(2)	6										498				0.664557	335.610066	339.417398	105	53	AA		KEEP	---	---	---	---	capture			Silent	SNP	52476862	52476862	18261	1	A	G	G	4	4	ZFYVE9	G	4	4
LPAR3	23566	broad.mit.edu	36	1	85103910	85103910	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:85103910G>A	uc001dkl.2	-	c.482C>T	c.(481-483)GCG>GTG	p.A161V	LPAR3_uc009wcj.1_Missense_Mutation_p.A161V	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	161	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				ovary(2)	2														0.586207	97.914478	98.285699	34	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85103910	85103910	9279	1	G	A	A	38	38	LPAR3	A	1	1
ZNF335	63925	broad.mit.edu	36	20	44029668	44029668	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:44029668G>T	uc002xqw.1	-	c.827C>A	c.(826-828)GCA>GAA	p.A276E	ZNF335_uc002xqx.1_Missense_Mutation_p.A244E|ZNF335_uc002xqy.2_Missense_Mutation_p.A121E	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	276					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)												0.210526	8.773829	11.735999	8	30	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44029668	44029668	18444	20	G	T	T	46	46	ZNF335	T	3	3
TMEM189-UBE2V1	387522	broad.mit.edu	36	20	48179539	48179539	+	Silent	SNP	T	A	A			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr20:48179539T>A	uc002xvf.1	-	c.429A>T	c.(427-429)ACA>ACT	p.T143T	TMEM189_uc002xvg.1_Silent_p.T143T|TMEM189_uc010gif.1_Silent_p.T140T	NM_199203	NP_003340	Q13404	UB2V1_HUMAN	TMEM189-UBE2V1 readthrough transcript isoform 1	Error:Variant_position_missing_in_Q13404_after_alignment					cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|post-translational protein modification|protein polyubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|ubiquitin conjugating enzyme complex	acid-amino acid ligase activity|protein binding|transcription activator activity				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)											0.230769	11.391424	13.966478	9	30	TT		KEEP	---	---	---	---	capture			Silent	SNP	48179539	48179539	16646	20	T	A	A	59	59	TMEM189-UBE2V1	A	4	4
RTEL1	51750	broad.mit.edu	36	20	61767828	61767828	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61767828G>A	uc002yft.1	+	c.566G>A	c.(565-567)AGC>AAC	p.S189N	RTEL1_uc002yfu.1_Missense_Mutation_p.S189N|RTEL1_uc002yfv.1_Missense_Mutation_p.S239N|RTEL1_uc002yfw.1_Non-coding_Transcript	NM_032957	NP_116575	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1	189	Helicase ATP-binding.				DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)											0.21875	47.82603	54.82373	21	75	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61767828	61767828	14200	20	G	A	A	34	34	RTEL1	A	2	2
GART	2618	broad.mit.edu	36	21	33798676	33798676	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:33798676C>A	uc002yrx.1	-	c.2754G>T	c.(2752-2754)TTG>TTT	p.L918F	GART_uc002yry.1_Missense_Mutation_p.L918F|GART_uc002yrz.1_Missense_Mutation_p.L918F|GART_uc010gmd.1_Missense_Mutation_p.L580F	NM_000819	NP_000810	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase,	918	GART.				'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding			ovary(1)	1					Pemetrexed(DB00642)									0.098214	7.061803	25.141092	11	101	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33798676	33798676	6507	21	C	A	A	25	25	GART	A	3	3
ZNF74	7625	broad.mit.edu	36	22	19084984	19084984	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:19084984C>T	uc010gsm.1	+	c.183C>T	c.(181-183)GAC>GAT	p.D61D	ZNF74_uc002zsg.1_5'UTR|ZNF74_uc002zsh.1_Silent_p.D61D|ZNF74_uc002zsi.1_5'UTR|ZNF74_uc010gsn.1_5'UTR	NM_003426	NP_003417	Q16587	ZNF74_HUMAN	zinc finger protein 74	61	KRAB.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)											0.112583	9.760859	32.159496	17	134	CC		KEEP	---	---	---	---	capture			Silent	SNP	19084984	19084984	18725	22	C	T	T	20	20	ZNF74	T	2	2
CRYBB2	1415	broad.mit.edu	36	22	23953952	23953952	+	Silent	SNP	G	C	C			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:23953952G>C	uc003abp.1	+	c.306G>C	c.(304-306)GTG>GTC	p.V102V		NM_000496	NP_000487	P43320	CRBB2_HUMAN	crystallin, beta B2	102	Connecting peptide.				response to stimulus|visual perception		structural constituent of eye lens				0														0.555556	10.768506	10.792167	5	4	GG		KEEP	---	---	---	---	capture			Silent	SNP	23953952	23953952	4050	22	G	C	C	47	47	CRYBB2	C	3	3
CSF2RB	1439	broad.mit.edu	36	22	35658809	35658809	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:35658809C>T	uc003aqc.2	+	c.1087C>T	c.(1087-1089)CGC>TGC	p.R363C	CSF2RB_uc003aqa.2_Missense_Mutation_p.R357C	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	357	Extracellular (Potential).|Fibronectin type-III 2.				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			pancreas(1)	1					Sargramostim(DB00020)									0.342105	102.721963	105.217964	39	75	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35658809	35658809	4076	22	C	T	T	27	27	CSF2RB	T	1	1
IL2RB	3560	broad.mit.edu	36	22	35862310	35862310	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:35862310G>C	uc003aqv.1	-	c.607C>G	c.(607-609)CAG>GAG	p.Q203E		NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor	203	Extracellular (Potential).|Fibronectin type-III.				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)									0.333333	7.590626	7.888524	4	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35862310	35862310	7988	22	G	C	C	47	47	IL2RB	C	3	3
PNPLA5	150379	broad.mit.edu	36	22	42611493	42611493	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:42611493G>A	uc003beg.1	-	c.1015C>T	c.(1015-1017)CAG>TAG	p.Q339*	PNPLA5_uc010gzl.1_Nonsense_Mutation_p.Q339*|PNPLA5_uc003beh.1_Nonsense_Mutation_p.Q225*	NM_138814	NP_620169	Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	339					lipid catabolic process		hydrolase activity				0		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)										OREG0026622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.4	9.598802	9.685807	4	6	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	42611493	42611493	12595	22	G	A	A	48	48	PNPLA5	A	5	2
NPHP1	4867	broad.mit.edu	36	2	110258420	110258420	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:110258420C>A	uc002tfl.2	-	c.1685G>T	c.(1684-1686)AGA>ATA	p.R562I	NPHP1_uc002tfm.2_Missense_Mutation_p.R506I|NPHP1_uc002tfn.2_Missense_Mutation_p.R561I|NPHP1_uc002tfo.2_Missense_Mutation_p.R443I|NPHP1_uc010fjv.1_Missense_Mutation_p.R505I	NM_000272	NP_000263	O15259	NPHP1_HUMAN	nephrocystin-1 isoform 1	561					actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2														0.162162	9.3258	13.344944	6	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110258420	110258420	10983	2	C	A	A	32	32	NPHP1	A	3	3
TPO	7173	broad.mit.edu	36	2	1438974	1438974	+	Silent	SNP	A	G	G			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:1438974A>G	uc002qwr.1	+	c.732A>G	c.(730-732)ACA>ACG	p.T244T	TPO_uc010ewj.1_Intron|TPO_uc002qwt.1_Silent_p.T244T|TPO_uc002qwu.1_Silent_p.T244T|TPO_uc002qwv.1_Silent_p.T244T|TPO_uc002qww.1_Silent_p.T244T|TPO_uc002qwx.1_Silent_p.T244T	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	244	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process|oxidation-reduction process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(6)|pancreas(6)|skin(3)|lung(1)|kidney(1)	17	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)					723				0.555556	21.333152	21.379674	10	8	AA		KEEP	---	---	---	---	capture			Silent	SNP	1438974	1438974	16954	2	A	G	G	6	6	TPO	G	4	4
COBLL1	22837	broad.mit.edu	36	2	165259247	165259247	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:165259247A>T	uc002ucp.1	-	c.3015T>A	c.(3013-3015)AAT>AAA	p.N1005K	COBLL1_uc002uco.1_Missense_Mutation_p.N736K|COBLL1_uc002ucq.1_Missense_Mutation_p.N967K|COBLL1_uc002ucr.1_Missense_Mutation_p.N1005K|COBLL1_uc002ucn.1_Missense_Mutation_p.N433K	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1	1043										ovary(2)|pancreas(1)	3														0.272727	8.828495	9.862902	6	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	165259247	165259247	3792	2	A	T	T	12	12	COBLL1	T	4	4
PLCL1	5334	broad.mit.edu	36	2	198656725	198656725	+	Splice_Site_SNP	SNP	A	G	G			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:198656725A>G	uc010fsp.1	+	c.e2_splice_site			PLCL1_uc002uuv.2_Splice_Site_SNP|PLCL1_uc002uuw.2_Splice_Site_SNP	NM_001114661	NP_001108133			phospholipase C-like 1 isoform a						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)	1					Quinacrine(DB01103)									0.227273	6.45645	7.968814	5	17	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	198656725	198656725	12465	2	A	G	G	7	7	PLCL1	G	5	4
NCL	4691	broad.mit.edu	36	2	232029666	232029666	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:232029666G>T	uc002vru.1	-	c.1625C>A	c.(1624-1626)TCC>TAC	p.S542Y	SNORA75_uc002vrv.1_5'Flank|SNORD20_uc002vrw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin	542	RRM 3.				angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)										0.144737	7.685118	16.935252	11	65	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	232029666	232029666	10625	2	G	T	T	41	41	NCL	T	3	3
EML4	27436	broad.mit.edu	36	2	42385141	42385141	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:42385141G>T	uc002rsi.1	+	c.1913G>T	c.(1912-1914)TGT>TTT	p.C638F	EML4_uc010fap.1_Missense_Mutation_p.C580F|EML4_uc002rsj.1_Missense_Mutation_p.C327F|EML4_uc010faq.1_Intron	NM_019063	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	638					microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(191)	lung(191)|ovary(2)|central_nervous_system(1)	194										780				0.171429	36.31548	47.009613	18	87	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42385141	42385141	5291	2	G	T	T	48	48	EML4	T	3	3
SPTBN1	6711	broad.mit.edu	36	2	54749098	54749099	+	Missense_Mutation	DNP	CC	GA	GA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:54749098_54749099CC>GA	uc002rxu.1	+	c.6983_6984CC>GA	c.(6982-6984)ACC>AGA	p.T2328R		NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	2328					actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(2)|breast(2)|central_nervous_system(2)	6			Lung(47;0.24)											0.478261	24.130975	24.139277	11	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	54749098	54749099	15633	2	CC	GA	GA	18	18	SPTBN1	GA	3	3
PCBP1	5093	broad.mit.edu	36	2	70168392	70168392	+	Missense_Mutation	SNP	G	C	C			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:70168392G>C	uc002sgf.1	+	c.13G>C	c.(13-15)GTG>CTG	p.V5L	ASPRV1_uc002sga.2_5'Flank	NM_006196	NP_006187	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	5					nuclear mRNA splicing, via spliceosome	cytoplasm|nucleoplasm|ribonucleoprotein complex	protein binding|RNA binding|single-stranded DNA binding				0						Colon(85;1146 1307 3484 18706 25380)								0.333333	9.663886	10.035959	5	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70168392	70168392	11920	2	G	C	C	48	48	PCBP1	C	3	3
CNGA3	1261	broad.mit.edu	36	2	98379790	98379790	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:98379790C>A	uc002syt.1	+	c.1725C>A	c.(1723-1725)GAC>GAA	p.D575E	CNGA3_uc002syu.1_Missense_Mutation_p.D557E|CNGA3_uc010fij.1_Missense_Mutation_p.D579E	NM_001298	NP_001289	Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3 isoform	575	cGMP.				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(5)	5														0.152542	11.751152	25.454334	18	100	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98379790	98379790	3736	2	C	A	A	18	18	CNGA3	A	3	3
CNTN6	27255	broad.mit.edu	36	3	1295172	1295172	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:1295172G>T	uc003boz.1	+	c.434G>T	c.(433-435)GGC>GTC	p.G145V	CNTN6_uc010hbo.1_Missense_Mutation_p.G140V|CNTN6_uc003bpa.1_Missense_Mutation_p.G145V	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6	145	Ig-like C2-type 2.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				lung(2)|breast(2)|pancreas(1)	5		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)						1038				0.238095	6.626273	7.985728	5	16	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1295172	1295172	3783	3	G	T	T	42	42	CNTN6	T	3	3
STAG1	10274	broad.mit.edu	36	3	137579228	137579228	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:137579228C>G	uc003era.1	-	c.2334G>C	c.(2332-2334)CAG>CAC	p.Q778H	STAG1_uc003erb.1_Missense_Mutation_p.Q778H|STAG1_uc003erc.1_Missense_Mutation_p.Q552H	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	778					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2														0.320755	49.057233	50.569484	17	36	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	137579228	137579228	15760	3	C	G	G	20	20	STAG1	G	3	3
FNDC3B	64778	broad.mit.edu	36	3	173451841	173451841	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:173451841C>T	uc010hwt.1	+	c.606C>T	c.(604-606)CGC>CGT	p.R202R	FNDC3B_uc003fhy.1_Silent_p.R198R|FNDC3B_uc003fhz.2_Silent_p.R198R|FNDC3B_uc003fia.2_Silent_p.R133R	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	202						endoplasmic reticulum|integral to membrane				ovary(1)|breast(1)	2	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)										0.12766	6.685353	12.98444	6	41	CC		KEEP	---	---	---	---	capture			Silent	SNP	173451841	173451841	6212	3	C	T	T	26	26	FNDC3B	T	2	2
KAT2B	8850	broad.mit.edu	36	3	20139252	20139252	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:20139252C>T	uc003cbq.1	+	c.1365C>T	c.(1363-1365)AAC>AAT	p.N455N		NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	455					cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.562738	451.469532	452.391311	148	115	CC		KEEP	---	---	---	---	capture			Silent	SNP	20139252	20139252	8286	3	C	T	T	19	19	KAT2B	T	1	1
IMPDH2	3615	broad.mit.edu	36	3	49041725	49041725	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49041725C>T	uc003cvt.1	-	c.63G>A	c.(61-63)CAG>CAA	p.Q21Q	IMPDH2_uc010hkp.1_Silent_p.Q91Q	NM_000884	NP_000875	P12268	IMDH2_HUMAN	inosine monophosphate dehydrogenase 2	21					GMP biosynthetic process|oxidation-reduction process|purine base metabolic process	cytosol	IMP dehydrogenase activity|metal ion binding|protein binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)									0.530612	79.524397	79.563038	26	23	CC		KEEP	---	---	---	---	capture			Silent	SNP	49041725	49041725	8028	3	C	T	T	28	28	IMPDH2	T	2	2
RNF123	63891	broad.mit.edu	36	3	49733496	49733496	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49733496C>G	uc003cxh.1	+	c.3778C>G	c.(3778-3780)CAC>GAC	p.H1260D	RNF123_uc003cxi.1_Non-coding_Transcript|AMIGO3_uc003cxj.1_5'Flank	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	1260	RING-type.					cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)										0.217391	7.156733	8.858306	5	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49733496	49733496	13910	3	C	G	G	21	21	RNF123	G	3	3
CDKN2AIP	55602	broad.mit.edu	36	4	184603106	184603106	+	Silent	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:184603106C>A	uc003ivp.1	+	c.162C>A	c.(160-162)TCC>TCA	p.S54S	CDKN2AIP_uc003ivq.1_5'UTR	NM_017632	NP_060102	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	54					negative regulation of cell growth|positive regulation of signal transduction|regulation of protein stability	granular component|nucleoplasm	double-stranded RNA binding|p53 binding				0		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)										0.363636	6.892453	7.07388	4	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	184603106	184603106	3291	4	C	A	A	23	23	CDKN2AIP	A	3	3
CCDC111	201973	broad.mit.edu	36	4	185830539	185830539	+	Missense_Mutation	SNP	A	T	T			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:185830539A>T	uc003iwk.2	+	c.775A>T	c.(775-777)AGC>TGC	p.S259C	CCDC111_uc010isd.1_Non-coding_Transcript|CCDC111_uc003iwj.2_Missense_Mutation_p.S259C|CCDC111_uc003iwl.2_Missense_Mutation_p.S259C|CCDC111_uc003iwm.2_Missense_Mutation_p.S130C|CCDC111_uc003iwn.2_Missense_Mutation_p.S84C	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111	259					DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)										0.277778	8.059779	8.865795	5	13	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	185830539	185830539	2868	4	A	T	T	3	3	CCDC111	T	4	4
LIMCH1	22998	broad.mit.edu	36	4	41310286	41310286	+	Missense_Mutation	SNP	G	T	T			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:41310286G>T	uc003gvz.2	+	c.56G>T	c.(55-57)GGC>GTC	p.G19V	LIMCH1_uc003gvt.1_Missense_Mutation_p.G19V|LIMCH1_uc003gvu.2_Missense_Mutation_p.G178V|LIMCH1_uc003gvv.2_Missense_Mutation_p.G178V|LIMCH1_uc003gvw.2_Missense_Mutation_p.G178V|LIMCH1_uc003gvx.2_Missense_Mutation_p.G178V|LIMCH1_uc003gwe.2_Missense_Mutation_p.G178V|LIMCH1_uc003gvy.2_Missense_Mutation_p.G19V|LIMCH1_uc003gwa.2_Missense_Mutation_p.G19V|LIMCH1_uc003gwb.1_Missense_Mutation_p.G26V|LIMCH1_uc003gwc.2_Missense_Mutation_p.G24V|LIMCH1_uc003gwd.2_Missense_Mutation_p.G24V	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	178					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)	3														0.333333	8.66262	9.035326	5	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41310286	41310286	9123	4	G	T	T	42	42	LIMCH1	T	3	3
KIAA0232	9778	broad.mit.edu	36	4	6877222	6877222	+	Silent	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:6877222C>A	uc003gjr.2	+	c.141C>A	c.(139-141)CTC>CTA	p.L47L	KIAA0232_uc003gjq.2_Silent_p.L47L	NM_014743	NP_055558	Q92628	K0232_HUMAN	hypothetical protein LOC9778	47							ATP binding			ovary(2)	2														0.096774	7.341215	22.46186	9	84	CC		KEEP	---	---	---	---	capture			Silent	SNP	6877222	6877222	8470	4	C	A	A	31	31	KIAA0232	A	3	3
ACOX3	8310	broad.mit.edu	36	4	8449580	8449580	+	Missense_Mutation	SNP	A	G	G			TCGA-19-1788-01	TCGA-19-1788-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:8449580A>G	uc010idk.1	-	c.1040T>C	c.(1039-1041)CTT>CCT	p.L347P	ACOX3_uc003glc.2_Missense_Mutation_p.L347P|ACOX3_uc003gld.2_Missense_Mutation_p.L347P|ACOX3_uc003gle.1_Missense_Mutation_p.L252P	NM_003501	NP_003492	O15254	ACOX3_HUMAN	acyl-Coenzyme A oxidase 3, pristanoyl isoform a	347					bile acid metabolic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|pristanoyl-CoA oxidase activity			central_nervous_system(1)	1														0.536585	134.854844	134.947861	44	38	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8449580	8449580	161	4	A	G	G	3	3	ACOX3	G	4	4
PJA2	9867	broad.mit.edu	36	5	108700839	108700839	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:108700839C>A	uc003kos.2	-	c.2119G>T	c.(2119-2121)GCA>TCA	p.A707S		NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing	707						cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|zinc ion binding			ovary(1)	1		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)										0.118721	33.964551	65.174818	26	193	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	108700839	108700839	12386	5	C	A	A	28	28	PJA2	A	3	3
MCC	4163	broad.mit.edu	36	5	112417403	112417403	+	Missense_Mutation	SNP	C	A	A			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:112417403C>A	uc003kql.2	-	c.2366G>T	c.(2365-2367)AGC>ATC	p.S789I	MCC_uc003kqj.2_Missense_Mutation_p.S599I|MCC_uc003kqk.2_Non-coding_Transcript	NM_001085377	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers isoform 1	599					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)						12				0.135458	40.093454	72.5011	34	217	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	112417403	112417403	9762	5	C	A	A	28	28	MCC	A	3	3
ADAM19	8728	broad.mit.edu	36	5	156849979	156849979	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:156849979C>T	uc003lxa.1	-	c.2160G>A	c.(2158-2160)CTG>CTA	p.L720L	ADAM19_uc003lww.1_Silent_p.L452L|ADAM19_uc003lwz.1_Silent_p.L719L|ADAM19_uc003lwy.2_Silent_p.L318L	NM_023038	NP_075525	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 isoform 1	719	Helical; (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding	p.L720L(1)		ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	7	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)											0.216216	9.583575	12.341625	8	29	CC		KEEP	---	---	---	---	capture			Silent	SNP	156849979	156849979	241	5	C	T	T	29	29	ADAM19	T	2	2
NAIP	4671	broad.mit.edu	36	5	70342894	70342894	+	Missense_Mutation	SNP	T	C	C			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:70342894T>C	uc003kar.1	-	c.632A>G	c.(631-633)GAT>GGT	p.D211G	NAIP_uc003kat.1_Intron|NAIP_uc003kas.1_Intron	NM_004536	NP_004527	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein isoform	211	BIR 2.				anti-apoptosis|apoptosis|negative regulation of caspase activity|nervous system development	basolateral plasma membrane|cytoplasm	caspase inhibitor activity|metal ion binding|nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)										0.193548	7.622725	10.354586	6	25	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70342894	70342894	10543	5	T	C	C	50	50	NAIP	C	4	4
LAMA2	3908	broad.mit.edu	36	6	129849343	129849343	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:129849343G>A	uc003qbn.1	+	c.7781G>A	c.(7780-7782)CGT>CAT	p.R2594H	LAMA2_uc003qbo.1_Missense_Mutation_p.R2590H|LAMA2_uc010kfe.1_Missense_Mutation_p.R2594H	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2594	Laminin G-like 3.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)										0.212121	8.024508	10.549603	7	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129849343	129849343	8929	6	G	A	A	40	40	LAMA2	A	1	1
C6orf136	221545	broad.mit.edu	36	6	30726793	30726793	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:30726793C>T	uc003nqw.2	+	c.518C>T	c.(517-519)TCC>TTC	p.S173F	C6orf136_uc003nqx.2_Missense_Mutation_p.S30F	NM_001109938	NP_659466	Q5SQH8	CF136_HUMAN	hypothetical protein LOC221545 isoform 1	173											0														0.305389	140.666793	146.306456	51	116	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30726793	30726793	2434	6	C	T	T	30	30	C6orf136	T	2	2
ANKS1A	23294	broad.mit.edu	36	6	35057528	35057528	+	Silent	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:35057528G>A	uc003ojx.2	+	c.519G>A	c.(517-519)ACG>ACA	p.T173T	ANKS1A_uc010jvp.1_5'UTR|ANKS1A_uc010jvr.1_Non-coding_Transcript	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	173	ANK 3.					cytoplasm	protein binding			ovary(3)	3														0.208955	33.036304	38.275066	14	53	GG		KEEP	---	---	---	---	capture			Silent	SNP	35057528	35057528	696	6	G	A	A	39	39	ANKS1A	A	1	1
SLC12A9	56996	broad.mit.edu	36	7	100289850	100289850	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100289850C>T	uc003uwp.1	+	c.95C>T	c.(94-96)GCG>GTG	p.A32V	SLC12A9_uc003uwo.1_Missense_Mutation_p.A32V|SLC12A9_uc003uwq.2_Missense_Mutation_p.A32V|SLC12A9_uc003uwr.1_5'Flank|SLC12A9_uc003uws.1_5'Flank|SLC12A9_uc003uwt.1_5'Flank|SLC12A9_uc003uwu.1_5'Flank	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	32	Cytoplasmic (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)													0.25	8.555642	9.911637	6	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100289850	100289850	14885	7	C	T	T	27	27	SLC12A9	T	1	1
JHDM1D	80853	broad.mit.edu	36	7	139470912	139470912	+	Silent	SNP	T	C	C			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:139470912T>C	uc003vvm.1	-	c.1029A>G	c.(1027-1029)GGA>GGG	p.G343G		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	343	JmjC.				midbrain development|oxidation-reduction process|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)													0.09417	14.760542	51.620506	21	202	TT		KEEP	---	---	---	---	capture			Silent	SNP	139470912	139470912	8252	7	T	C	C	58	58	JHDM1D	C	4	4
CHST12	55501	broad.mit.edu	36	7	2439823	2439824	+	Missense_Mutation	DNP	GC	CT	CT			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:2439823_2439824GC>CT	uc003smc.1	+	c.1023_1024GC>CT	c.(1021-1026)AAGCTG>AACTTG	p.K341N	CHST12_uc003smd.1_Missense_Mutation_p.K341N|CHST12_uc010ksk.1_Missense_Mutation_p.K341N	NM_018641	NP_061111	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase	341	Lumenal (Potential).				dermatan sulfate biosynthetic process	integral to Golgi membrane	3'-phosphoadenosine 5'-phosphosulfate binding|chondroitin 4-sulfotransferase activity|protein binding			kidney(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)										0.666667	9.095405	9.241395	4	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	2439823	2439824	3534	7	GC	CT	CT	34	34	CHST12	CT	3	3
AOAH	313	broad.mit.edu	36	7	36692837	36692837	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:36692837T>G	uc003tfh.2	-	c.215A>C	c.(214-216)TAC>TCC	p.Y72S	AOAH_uc010kxf.1_Missense_Mutation_p.Y72S	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	72	Saposin B-type.				inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity				0														0.170732	10.418635	18.853115	14	68	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36692837	36692837	736	7	T	G	G	57	57	AOAH	G	4	4
AMAC1L2	83650	broad.mit.edu	36	8	11226160	11226160	+	Silent	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:11226160G>A	uc003wtp.1	+	c.135G>A	c.(133-135)CTG>CTA	p.L45L		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	45	Helical; (Potential).					integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)										0.3	10.170594	10.870485	6	14	GG		KEEP	---	---	---	---	capture			Silent	SNP	11226160	11226160	563	8	G	A	A	47	47	AMAC1L2	A	2	2
ATP6V1H	51606	broad.mit.edu	36	8	54886316	54886316	+	Silent	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:54886316G>A	uc003xrl.1	-	c.540C>T	c.(538-540)AGC>AGT	p.S180S	ATP6V1H_uc003xrk.1_Silent_p.S140S|ATP6V1H_uc003xrm.1_Silent_p.S180S|ATP6V1H_uc003xrn.1_Intron|ATP6V1H_uc010lyd.1_Silent_p.S116S	NM_213620	NP_998785	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1	180					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism				0		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)											0.162162	22.458499	30.486401	12	62	GG		KEEP	---	---	---	---	capture			Silent	SNP	54886316	54886316	1208	8	G	A	A	38	38	ATP6V1H	A	1	1
PALM2-AKAP2	445815	broad.mit.edu	36	9	111940447	111940447	+	Silent	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:111940447C>T	uc004bei.2	+	c.3498C>T	c.(3496-3498)GAC>GAT	p.D1166D	PALM2-AKAP2_uc004bek.2_Silent_p.D934D|PALM2-AKAP2_uc004bej.2_Silent_p.D934D|PALM2-AKAP2_uc004bel.1_Silent_p.D744D|AKAP2_uc004bem.1_Silent_p.D792D|PALM2-AKAP2_uc010mtw.1_Silent_p.D752D|PALM2-AKAP2_uc004ben.1_Silent_p.D703D	NM_001004065	NP_001004065	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 1	703							enzyme binding			ovary(3)|central_nervous_system(2)	5														0.25	9.797158	10.703098	4	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	111940447	111940447	11826	9	C	T	T	19	19	PALM2-AKAP2	T	1	1
TNC	3371	broad.mit.edu	36	9	116880206	116880206	+	Silent	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:116880206G>A	uc004bjj.2	-	c.2511C>T	c.(2509-2511)TAC>TAT	p.Y837Y	TNC_uc010mvf.1_Silent_p.Y837Y	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	837	Fibronectin type-III 3.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|ovary(1)	5														0.23176	125.229567	140.538749	54	179	GG		KEEP	---	---	---	---	capture			Silent	SNP	116880206	116880206	16811	9	G	A	A	40	40	TNC	A	1	1
LRRC19	64922	broad.mit.edu	36	9	26985649	26985649	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:26985649G>A	uc003zqh.1	-	c.983C>T	c.(982-984)TCA>TTA	p.S328L	IFT74_uc010mja.1_Intron|IFT74_uc010mjb.1_Intron|IFT74_uc003zqf.2_Intron|IFT74_uc003zqg.2_Intron	NM_022901	NP_075052	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19	328	Cytoplasmic (Potential).					integral to membrane					0		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)										0.352941	30.378942	31.031882	12	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26985649	26985649	9349	9	G	A	A	45	45	LRRC19	A	2	2
TOPORS	10210	broad.mit.edu	36	9	32533402	32533402	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:32533402T>A	uc003zrb.1	-	c.1121A>T	c.(1120-1122)TAT>TTT	p.Y374F	TOPORS_uc003zrc.1_Missense_Mutation_p.Y307F	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	374	Required for DNA-binding.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent|visual perception	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)										0.444444	7.798709	7.822351	4	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32533402	32533402	16912	9	T	A	A	49	49	TOPORS	A	4	4
IARS	3376	broad.mit.edu	36	9	94052877	94052877	+	Missense_Mutation	SNP	G	A	A			TCGA-19-1788-01	TCGA-19-1788-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:94052877G>A	uc004art.1	-	c.2368C>T	c.(2368-2370)CCT>TCT	p.P790S	IARS_uc004ars.1_Missense_Mutation_p.P635S|IARS_uc004aru.2_Missense_Mutation_p.P790S|IARS_uc010mqr.1_Missense_Mutation_p.P680S|IARS_uc010mqs.1_Missense_Mutation_p.P790S|IARS_uc010mqt.1_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	790					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)	1					L-Isoleucine(DB00167)									0.266667	6.788907	7.53048	4	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94052877	94052877	7773	9	G	A	A	43	43	IARS	A	2	2
FAM47C	442444	broad.mit.edu	36	X	36937183	36937184	+	Missense_Mutation	DNP	TG	CA	CA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:36937183_36937184TG>CA	uc004ddl.1	+	c.779_780TG>CA	c.(778-780)CTG>CCA	p.L260P		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	260										ovary(3)	3														0.3	8.622097	8.978895	3	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	36937183	36937184	5792	23	TG	CA	CA	55	55	FAM47C	CA	4	4
RGN	9104	broad.mit.edu	36	X	46828851	46828852	+	Missense_Mutation	DNP	AA	CC	CC			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:46828851_46828852AA>CC	uc004dgz.1	+	c.254_255AA>CC	c.(253-255)CAA>CCC	p.Q85P	RGN_uc004dha.1_Missense_Mutation_p.Q85P|RGN_uc010nho.1_Missense_Mutation_p.Q32P|RGN_uc010nhp.1_Missense_Mutation_p.Q85P	NM_152869	NP_690608	Q15493	RGN_HUMAN	regucalcin	85					cellular calcium ion homeostasis|positive regulation of ATPase activity|regulation of calcium-mediated signaling	cytoplasm|nucleus	calcium ion binding|enzyme regulator activity|gluconolactonase activity|zinc ion binding				0														0.444444	8.694981	8.719632	4	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	46828851	46828852	13755	23	AA	CC	CC	5	5	RGN	CC	4	4
PORCN	64840	broad.mit.edu	36	X	48253287	48253287	+	Silent	SNP	C	G	G			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:48253287C>G	uc010nie.1	+	c.135C>G	c.(133-135)CTC>CTG	p.L45L	PORCN_uc004djq.1_Silent_p.L158L|PORCN_uc004djr.1_Silent_p.L45L|PORCN_uc004djs.1_Silent_p.L45L|PORCN_uc004djt.1_5'UTR|PORCN_uc004dju.1_5'UTR|PORCN_uc004djv.1_Silent_p.L45L|PORCN_uc004djw.1_Silent_p.L45L	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D	45	Extracellular (Potential).|Leu-rich.				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3										97				0.5	6.34201	6.34201	4	4	CC		KEEP	---	---	---	---	capture			Silent	SNP	48253287	48253287	12687	23	C	G	G	31	31	PORCN	G	3	3
APEX2	27301	broad.mit.edu	36	X	55046223	55046223	+	Missense_Mutation	SNP	C	G	G			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:55046223C>G	uc004dtz.1	+	c.526C>G	c.(526-528)CGT>GGT	p.R176G		NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN	apurinic/apyrimidinic endonuclease 2	176					cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding				0														0.4	7.493451	7.581751	4	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55046223	55046223	780	23	C	G	G	31	31	APEX2	G	3	3
APEX2	27301	broad.mit.edu	36	X	55050387	55050387	+	Missense_Mutation	SNP	T	G	G			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:55050387T>G	uc004dtz.1	+	c.1351T>G	c.(1351-1353)TTA>GTA	p.L451V		NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN	apurinic/apyrimidinic endonuclease 2	451					cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding				0														0.217391	6.857017	8.559449	5	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55050387	55050387	780	23	T	G	G	60	60	APEX2	G	4	4
USP51	158880	broad.mit.edu	36	X	55530909	55530909	+	Nonsense_Mutation	SNP	T	A	A			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:55530909T>A	uc004dun.1	-	c.1189A>T	c.(1189-1191)AAA>TAA	p.K397*	USP51_uc010nke.1_Nonsense_Mutation_p.K397*	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	397					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1														0.363636	6.888427	7.071578	4	7	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	55530909	55530909	17647	23	T	A	A	63	63	USP51	A	5	4
CHM	1121	broad.mit.edu	36	X	85097992	85097992	+	Missense_Mutation	SNP	T	A	A			TCGA-19-1788-01	TCGA-19-1788-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:85097992T>A	uc004eet.1	-	c.988A>T	c.(988-990)ACC>TCC	p.T330S		NM_000390	NP_000381	P24386	RAE1_HUMAN	choroideremia isoform a	330					intracellular protein transport|protein geranylgeranylation|response to stimulus|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity			ovary(1)	1		all_lung(315;5.41e-06)												0.333333	7.390099	7.688261	4	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85097992	85097992	3484	23	T	A	A	60	60	CHM	A	4	4
SYTL4	94121	broad.mit.edu	36	X	99821065	99821065	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:99821065C>T	uc004egd.2	-	c.1559G>A	c.(1558-1560)AGT>AAT	p.S520N	SYTL4_uc004egc.1_5'Flank|SYTL4_uc010nnb.1_Missense_Mutation_p.S192N|SYTL4_uc010nnc.1_Missense_Mutation_p.S520N|SYTL4_uc004ege.2_Missense_Mutation_p.S520N|SYTL4_uc004egf.2_Missense_Mutation_p.S520N	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	520	C2 2.				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									0.352941	12.538002	12.865085	6	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	99821065	99821065	16006	23	C	T	T	18	18	SYTL4	T	2	2
NLGN4Y	22829	broad.mit.edu	36	Y	15243542	15243542	+	Missense_Mutation	SNP	C	T	T			TCGA-19-1788-01	TCGA-19-1788-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrY:15243542C>T	uc004ftg.1	+	c.149C>T	c.(148-150)ACA>ATA	p.T50I	NLGN4Y_uc004fte.1_Intron|NLGN4Y_uc004ftf.1_5'UTR|NLGN4Y_uc004fth.1_Missense_Mutation_p.T50I|NLGN4Y_uc004fti.2_Missense_Mutation_p.T50I	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked	50	Extracellular (Potential).				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of synaptic transmission|social behavior|territorial aggressive behavior|vocalization behavior	integral to membrane|plasma membrane|synapse	carboxylesterase activity|protein binding				0														0.2	6.759126	9.260036	6	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15243542	15243542	10868	24	C	T	T	17	17	NLGN4Y	T	2	2
TALDO1	6888	broad.mit.edu	36	11	753916	753922	+	Frame_Shift_Del	DEL	GCTGGTG	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:753916_753922delGCTGGTG	uc001lqz.1	+	c.807_813delGCTGGTG	c.(805-813)AAGCTGGTGfs	p.K269fs	TALDO1_uc001lra.1_Frame_Shift_Del_p.K269fs	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	269_271					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)										0.75			6	2				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	753916	753922	16064	11	GCTGGTG	-	-	34	34	TALDO1	-	5	5
KDM2B	84678	broad.mit.edu	36	12	120431830	120431832	+	In_Frame_Del	DEL	GTT	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:120431830_120431832delGTT	uc001uat.1	-	c.1568_1570delAAC	c.(1567-1572)AAACTG>ATG	p.523_524KL>M	KDM2B_uc001uas.1_In_Frame_Del_p.492_493KL>M|KDM2B_uc009zxe.1_In_Frame_Del_p.492_493KL>M|KDM2B_uc001uau.1_In_Frame_Del_p.406_407KL>M|KDM2B_uc009zxf.1_In_Frame_Del_p.523_524KL>M|KDM2B_uc001uav.2_In_Frame_Del_p.433_434KL>M|KDM2B_uc001uar.1_In_Frame_Del_p.114_115KL>M	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	523_524					oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)	1														0.50			73	74				---	---	---	---	capture_indel			In_Frame_Del	DEL	120431830	120431832	8431	12	GTT	-	-	36	36	KDM2B	-	5	5
P2RX2	22953	broad.mit.edu	36	12	131707114	131707114	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:131707114_131707114delG	uc001ukk.1	+	c.646_646delG	c.(646-648)GCCfs	p.A216fs	P2RX2_uc001uki.1_Frame_Shift_Del_p.A216fs|P2RX2_uc001ukj.1_Frame_Shift_Del_p.A216fs|P2RX2_uc001ukl.1_Frame_Shift_Del_p.A192fs|P2RX2_uc001ukm.1_Frame_Shift_Del_p.A144fs|P2RX2_uc001ukn.1_Frame_Shift_Del_p.A124fs|P2RX2_uc009zyt.1_Frame_Shift_Del_p.A216fs|P2RX2_uc001uko.1_Frame_Shift_Del_p.R180fs	NM_170683	NP_733783	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X2 isoform D	216	Extracellular (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)										0.64			9	5				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	131707114	131707114	11753	12	G	-	-	38	38	P2RX2	-	5	5
PARP4	143	broad.mit.edu	36	13	23907337	23907344	+	Frame_Shift_Del	DEL	GCTAGAAG	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:23907337_23907344delGCTAGAAG	uc001upl.1	-	c.3935_3942delCTTCTAGC	c.(3934-3942)ACTTCTAGCfs	p.T1312fs		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1312_1314					cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)	3		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)										0.54			95	81				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	23907337	23907344	11880	13	GCTAGAAG	-	-	34	34	PARP4	-	5	5
MYO1E	4643	broad.mit.edu	36	15	57216880	57216880	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:57216880_57216880delG	uc002aga.1	-	c.3318_3318delC	c.(3316-3318)ACCfs	p.T1106fs		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	1106	SH3.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)										0.63			55	32				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	57216880	57216880	10467	15	G	-	-	47	47	MYO1E	-	5	5
SLC4A1	6521	broad.mit.edu	36	17	39683417	39683418	+	Frame_Shift_Ins	INS	-	T	T			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:39683417_39683418insT	uc002igf.2	-	c.2670_2671insA	c.(2668-2673)GATGCCfs	p.D890fs		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	890_891	Membrane (anion exchange).				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)										0.42			5	7				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	39683417	39683418	15147	17	-	T	T	25	25	SLC4A1	T	5	5
C17orf56	146705	broad.mit.edu	36	17	76820351	76820352	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:76820351_76820352delGA	uc002jzu.1	-	c.591_592delTC	c.(589-594)TCTCAGfs	p.S197fs	C17orf56_uc002jzr.1_5'Flank|C17orf56_uc002jzs.1_Frame_Shift_Del_p.S113fs|C17orf56_uc002jzt.1_Frame_Shift_Del_p.S113fs|C17orf56_uc002jzv.1_Frame_Shift_Del_p.S45fs	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705	197_198	Ser-rich.					integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)											0.39			7	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	76820351	76820352	1921	17	GA	-	-	45	45	C17orf56	-	5	5
CYP4F12	66002	broad.mit.edu	36	19	15650158	15650158	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:15650158_15650158delA	uc002nbl.2	+	c.286_286delA	c.(286-288)ATCfs	p.I96fs		NM_023944	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F,	96	Helical; (Potential).				oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|central_nervous_system(2)	4	Acute lymphoblastic leukemia(2;0.0367)													0.61			37	24				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	15650158	15650158	4352	19	A	-	-	8	8	CYP4F12	-	5	5
CGN	57530	broad.mit.edu	36	1	149757963	149757963	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:149757963_149757963delC	uc009wmw.1	+	c.344_344delC	c.(343-345)TCGfs	p.S115fs		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	109	Interacts with ZO-2.|Head.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)											0.59			20	14				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	149757963	149757963	3436	1	C	-	-	31	31	CGN	-	5	5
KIAA1751	85452	broad.mit.edu	36	1	1885124	1885125	+	Frame_Shift_Ins	INS	-	AG	AG			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:1885124_1885125insAG	uc009vkz.1	-	c.1617_1618insCT	c.(1615-1620)TTGGTAfs	p.L539fs	KIAA1751_uc001aim.1_Frame_Shift_Ins_p.L539fs	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	539_540										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)										0.52			38	35				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	1885124	1885125	8567	1	-	AG	AG	18	18	KIAA1751	AG	5	5
SLC45A3	85414	broad.mit.edu	36	1	203897676	203897680	+	Frame_Shift_Del	DEL	AACCC	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:203897676_203897680delAACCC	uc001hda.1	-	c.1156_1160delGGGTT	c.(1156-1161)GGGTTCfs	p.G386fs		NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	prostein	386_387	Helical; Name=10; (Potential).				transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)							123				0.38			141	233				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	203897676	203897680	15139	1	AACCC	-	-	9	9	SLC45A3	-	5	5
PABPC4	8761	broad.mit.edu	36	1	39803032	39803033	+	Splice_Site_Ins	INS	-	CGAT	CGAT			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:39803032_39803033insCGAT	uc001cdl.1	-	c.e9_splice_site			PABPC4_uc001cdm.1_Splice_Site_Ins|PABPC4_uc001cdn.1_Splice_Site_Ins	NM_003819	NP_003810			poly A binding protein, cytoplasmic 4 isoform 2						blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)											0.56			24	19				---	---	---	---	capture_indel			Splice_Site_Ins	INS	39803032	39803033	11781	1	-	CGAT	CGAT	26	26	PABPC4	CGAT	5	5
PTPRA	5786	broad.mit.edu	36	20	2950788	2950804	+	Frame_Shift_Del	DEL	CGATCGGCATGCTCAAG	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:2950788_2950804delCGATCGGCATGCTCAAG	uc002whj.1	+	c.1250_1266delCGATCGGCATGCTCAAG	c.(1249-1266)CCGATCGGCATGCTCAAGfs	p.P417fs	PTPRA_uc002whk.1_Frame_Shift_Del_p.P408fs|PTPRA_uc002whl.1_Frame_Shift_Del_p.P408fs|PTPRA_uc002whm.1_Frame_Shift_Del_p.P184fs|PTPRA_uc002whn.1_Frame_Shift_Del_p.P408fs|PTPRA_uc002who.1_Frame_Shift_Del_p.P80fs	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	417_422	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity				0														0.37			216	365				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	2950788	2950804	13252	20	CGATCGGCATGCTCAAG	-	-	23	23	PTPRA	-	5	5
FASTKD1	79675	broad.mit.edu	36	2	170119945	170119956	+	In_Frame_Del	DEL	TTGAGTTATCTT	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:170119945_170119956delTTGAGTTATCTT	uc002uev.2	-	c.1138_1149delAAGATAACTCAA	c.(1138-1149)AAGATAACTCAAdel	p.KITQ380del	FASTKD1_uc002uew.2_Non-coding_Transcript|FASTKD1_uc002uex.2_In_Frame_Del_p.KITQ366del	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	380_383					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4														0.30			7	16				---	---	---	---	capture_indel			In_Frame_Del	DEL	170119945	170119956	5921	2	TTGAGTTATCTT	-	-	56	56	FASTKD1	-	5	5
RETSAT	54884	broad.mit.edu	36	2	85432438	85432444	+	Frame_Shift_Del	DEL	AAAGCCA	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:85432438_85432444delAAAGCCA	uc002spd.1	-	c.225_231delTGGCTTT	c.(223-231)AGTGGCTTTfs	p.S75fs	RETSAT_uc010fge.1_5'Flank|RETSAT_uc010fgf.1_Intron	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	75_77	FAD or NAD or NADP (Potential).				oxidation-reduction process|retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(1)	1					Vitamin A(DB00162)									0.30			90	206				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	85432438	85432444	13708	2	AAAGCCA	-	-	5	5	RETSAT	-	5	5
TDO2	6999	broad.mit.edu	36	4	157058839	157058859	+	Splice_Site_Del	DEL	GAGGTAGGTGGGGAAATTCTC	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:157058839_157058859delGAGGTAGGTGGGGAAATTCTC	uc003ipf.1	+	c.e11_splice_site				NM_005651	NP_005642			tryptophan 2,3-dioxygenase						oxidation-reduction process|tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	L-Tryptophan(DB00150)	Colon(57;928 1036 2595 6946 26094)								0.64			115	65				---	---	---	---	capture_indel			Splice_Site_Del	DEL	157058839	157058859	16253	4	GAGGTAGGTGGGGAAATTCTC	-	-	45	45	TDO2	-	5	5
CCKAR	886	broad.mit.edu	36	4	26100171	26100176	+	In_Frame_Del	DEL	GAGTAC	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:26100171_26100176delGAGTAC	uc003gse.1	-	c.141_146delGTACTC	c.(139-147)TTGTACTCC>TTC	p.47_49LYS>F		NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor	47_49	Helical; Name=1; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			pancreas(1)	1		Breast(46;0.0503)			Ceruletide(DB00403)									0.74			17	6				---	---	---	---	capture_indel			In_Frame_Del	DEL	26100171	26100176	3005	4	GAGTAC	-	-	41	41	CCKAR	-	5	5
VPS52	6293	broad.mit.edu	36	6	33343680	33343694	+	In_Frame_Del	DEL	CGTCTCCACATATTC	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:33343680_33343694delCGTCTCCACATATTC	uc003odm.1	-	c.859_873delGAATATGTGGAGACG	c.(859-873)GAATATGTGGAGACGdel	p.EYVET287del	VPS52_uc003odn.1_In_Frame_Del_p.EYVET162del|VPS52_uc003odo.1_In_Frame_Del_p.EYVET212del	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	287_291					protein transport	endosome membrane|Golgi apparatus				ovary(4)	4														0.48			109	118				---	---	---	---	capture_indel			In_Frame_Del	DEL	33343680	33343694	17781	6	CGTCTCCACATATTC	-	-	27	27	VPS52	-	5	5
BYSL	705	broad.mit.edu	36	6	42007250	42007259	+	Frame_Shift_Del	DEL	CAAACCTGGA	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:42007250_42007259delCAAACCTGGA	uc003orl.1	+	c.843_852delCAAACCTGGA	c.(841-852)TTCAAACCTGGAfs	p.F281fs	BYSL_uc010jxs.1_Frame_Shift_Del_p.F130fs	NM_004053	NP_004044	Q13895	BYST_HUMAN	bystin	281_284					cell adhesion|female pregnancy|ribosome biogenesis	cytoplasm|nucleolus					0	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000473)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)											0.54			15	13				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	42007250	42007259	1610	6	CAAACCTGGA	-	-	29	29	BYSL	-	5	5
CUL7	9820	broad.mit.edu	36	6	43125206	43125207	+	Frame_Shift_Ins	INS	-	GC	GC			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:43125206_43125207insGC	uc003otq.1	-	c.1741_1742insGC	c.(1741-1743)TCCfs	p.S581fs	CUL7_uc010jyg.1_5'Flank|CUL7_uc010jyh.1_Intron|KLC4_uc003otr.1_Intron	NM_014780	NP_055595	Q14999	CUL7_HUMAN	cullin 7	581					interspecies interaction between organisms|regulation of mitotic metaphase/anaphase transition|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding			ovary(3)|kidney(1)	4			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)											0.31			97	211				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	43125206	43125207	4220	6	-	GC	GC	41	41	CUL7	GC	5	5
RSPH9	221421	broad.mit.edu	36	6	43732327	43732328	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:43732327_43732328delTA	uc003ovw.1	+	c.559_560delTA	c.(559-561)TACfs	p.Y187fs	RSPH9_uc003ovx.1_Frame_Shift_Del_p.Y172fs	NM_152732	NP_689945	Q9H1X1	RSPH9_HUMAN	radial spoke head 9 homolog	187					cilium axoneme assembly|cilium movement	cilium axoneme|cytoplasm|cytoskeleton|motile cilium					0														0.45			29	35				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	43732327	43732328	14188	6	TA	-	-	53	53	RSPH9	-	5	5
SPATC1	375686	broad.mit.edu	36	8	145167795	145167798	+	Frame_Shift_Del	DEL	CATA	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:145167795_145167798delCATA	uc003zaq.1	+	c.832_835delCATA	c.(832-837)CATAATfs	p.H278fs		NM_198572	NP_940974	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	369_370										ovary(1)|central_nervous_system(1)	2	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)											0.50			15	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	145167795	145167798	15527	8	CATA	-	-	25	25	SPATC1	-	5	5
MYST3	7994	broad.mit.edu	36	8	41911167	41911197	+	Frame_Shift_Del	DEL	TCCTCTTCCTCACCCTCTTCAGCCTCTTCTG	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:41911167_41911197delTCCTCTTCCTCACCCTCTTCAGCCTCTTCTG	uc010lxb.1	-	c.3698_3728delCAGAAGAGGCTGAAGAGGGTGAGGAAGAGGA	c.(3697-3729)GCAGAAGAGGCTGAAGAGGGTGAGGAAGAGGATfs	p.A1233fs	MYST3_uc010lxc.1_Frame_Shift_Del_p.A1233fs|MYST3_uc003xon.2_Frame_Shift_Del_p.A1233fs	NM_001099412	NP_006757	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1233_1243					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription activator activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)							476				0.41			19	27				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	41911167	41911197	10499	8	TCCTCTTCCTCACCCTCTTCAGCCTCTTCTG	-	-	50	50	MYST3	-	5	5
RALGDS	5900	broad.mit.edu	36	9	134965580	134965581	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:134965580_134965581delTG	uc004cco.1	-	c.2464_2465delCA	c.(2464-2466)CAAfs	p.Q822fs	RALGDS_uc004ccs.1_Frame_Shift_Del_p.Q767fs|RALGDS_uc004ccn.1_Frame_Shift_Del_p.Q10fs|RALGDS_uc004ccp.1_Non-coding_Transcript|RALGDS_uc004ccq.1_Frame_Shift_Del_p.Q810fs|RALGDS_uc004ccr.1_Frame_Shift_Del_p.Q821fs|RALGDS_uc004cct.1_5'Flank|RALGDS_uc004ccu.1_3'UTR|RALGDS_uc004ccv.1_3'UTR	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	822	Ras-associating.				nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		Melanoma(189;762 2088 15384 21931 52515)				815				0.32			25	52				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	134965580	134965581	13476	9	TG	-	-	63	63	RALGDS	-	5	5
SUSD3	203328	broad.mit.edu	36	9	94881664	94881676	+	Frame_Shift_Del	DEL	GAGCGGGCCCAGC	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:94881664_94881676delGAGCGGGCCCAGC	uc004atb.1	+	c.516_528delGAGCGGGCCCAGC	c.(514-528)GTGAGCGGGCCCAGCfs	p.V172fs	SUSD3_uc004atc.1_Frame_Shift_Del_p.V159fs	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN	sushi domain containing 3	172_176	Cytoplasmic (Potential).					integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6														0.63			12	7				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	94881664	94881676	15929	9	GAGCGGGCCCAGC	-	-	45	45	SUSD3	-	5	5
ZDHHC9	51114	broad.mit.edu	36	X	128785495	128785496	+	Splice_Site_Ins	INS	-	TAA	TAA			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:128785495_128785496insTAA	uc004euv.1	-	c.e4_splice_site			ZDHHC9_uc004euw.1_Splice_Site_Ins|ZDHHC9_uc004eux.1_Splice_Site_Ins|ZDHHC9_uc004euy.1_Splice_Site_Ins	NM_001008222	NP_057116			zinc finger, DHHC domain containing 9							endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1														0.38			6	10				---	---	---	---	capture_indel			Splice_Site_Ins	INS	128785495	128785496	18210	23	-	TAA	TAA	32	32	ZDHHC9	TAA	5	5
DDX26B	203522	broad.mit.edu	36	X	134541562	134541563	+	Frame_Shift_Ins	INS	-	TCCTG	TCCTG			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:134541562_134541563insTCCTG	uc004eyw.2	+	c.2192_2193insTCCTG	c.(2191-2193)CAAfs	p.Q731fs	DDX26B_uc004eyx.2_Frame_Shift_Ins_p.Q332fs	NM_182540	NP_872346	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	731											0	Acute lymphoblastic leukemia(192;6.56e-05)													0.50			3	3				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	134541562	134541563	4524	23	-	TCCTG	TCCTG	5	5	DDX26B	TCCTG	5	5
AP1S2	8905	broad.mit.edu	36	X	15780472	15780472	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:15780472_15780472delC	uc010nex.1	-	c.223_223delG	c.(223-225)GAAfs	p.E75fs	AP1S2_uc004cxh.1_Frame_Shift_Del_p.E33fs|AP1S2_uc004cxi.1_Frame_Shift_Del_p.E33fs	NM_003916	NP_003907	P56377	AP1S2_HUMAN	adaptor-related protein complex 1 sigma 2	33					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	AP-type membrane coat adaptor complex|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein transporter activity				0	Hepatocellular(33;0.183)													0.83			5	1				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	15780472	15780472	747	23	C	-	-	32	32	AP1S2	-	5	5
MAGEB3	4114	broad.mit.edu	36	X	30164962	30164965	+	Frame_Shift_Del	DEL	AAGT	-	-			TCGA-19-1788-01	TCGA-19-1788-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:30164962_30164965delAAGT	uc004dca.1	+	c.1000_1003delAAGT	c.(1000-1005)AAGTGTfs	p.K334fs	MAGEB3_uc010ngg.1_Frame_Shift_Del_p.K334fs	NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	334_335											0														0.65			11	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	30164962	30164965	9558	23	AAGT	-	-	1	1	MAGEB3	-	5	5
