Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
MUC5B	727897	broad.mit.edu	36	11	1220472	1220472	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:1220472C>T	uc001ltb.2	+	c.5795C>T	c.(5794-5796)ACC>ATC	p.T1932I		NM_002458	NP_002449	Q9HC84	MUC5B_HUMAN	mucin 5, subtype B, tracheobronchial	1929	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)												0.314433	150.885927	156.841193	61	133	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	Missense_Mutation	SNP	1220472	1220472	10373	11	C	T	T	18	18	MUC5B	T	2	2
OR52N1	79473	broad.mit.edu	36	11	5766379	5766379	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4927-01	TCGA-76-4927-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:5766379T>C	uc001mbw.1	-	c.244A>G	c.(244-246)AAC>GAC	p.N82D	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)												0.245989	121.665634	132.645813	46	141	TT		KEEP	---	---	---	---	capture		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)	Missense_Mutation	SNP	5766379	5766379	11537	11	T	C	C	63	63	OR52N1	C	4	4
NPAS4	266743	broad.mit.edu	36	11	65946530	65946530	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:65946530C>T	uc001ohx.1	+	c.360C>T	c.(358-360)TAC>TAT	p.Y120Y		NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	120	PAS 1.				transcription, DNA-dependent		DNA binding|signal transducer activity				0														0.27451	208.257319	222.28086	84	222	CC		KEEP	---	---	---	---	capture			Silent	SNP	65946530	65946530	10969	11	C	T	T	19	19	NPAS4	T	1	1
TXNRD1	7296	broad.mit.edu	36	12	103245546	103245546	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:103245546G>A	uc001tkn.2	+	c.1509G>A	c.(1507-1509)CTG>CTA	p.L503L	TXNRD1_uc001tkq.1_Silent_p.L353L|TXNRD1_uc001tkr.1_Silent_p.L405L|TXNRD1_uc001tks.1_Silent_p.L353L|TXNRD1_uc001tkt.1_Silent_p.L353L|TXNRD1_uc001tku.1_Non-coding_Transcript|TXNRD1_uc009zun.1_Silent_p.L419L	NM_001093771		Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	503					cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						Ovarian(139;555 1836 9186 9946 10884)								0.321429	47.727621	49.315122	18	38	GG		KEEP	---	---	---	---	capture			Silent	SNP	103245546	103245546	17363	12	G	A	A	47	47	TXNRD1	A	2	2
KITLG	4254	broad.mit.edu	36	12	87463728	87463728	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:87463728G>C	uc001tav.1	-	c.61C>G	c.(61-63)CCT>GCT	p.P21A	KITLG_uc001taw.1_Missense_Mutation_p.P21A	NM_000899	NP_000890	P21583	SCF_HUMAN	KIT ligand isoform b precursor	21					cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding			ovary(1)	1														0.279661	107.327745	112.476407	33	85	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87463728	87463728	8642	12	G	C	C	41	41	KITLG	C	3	3
ESR2	2100	broad.mit.edu	36	14	63819122	63819122	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:63819122G>A	uc001xha.1	-	c.335C>T	c.(334-336)TCG>TTG	p.S112L	ESR2_uc001xgv.1_Missense_Mutation_p.S112L|ESR2_uc001xgw.1_Non-coding_Transcript|ESR2_uc001xgx.1_Missense_Mutation_p.S112L|ESR2_uc001xgu.1_Missense_Mutation_p.S112L|ESR2_uc001xgy.1_Missense_Mutation_p.S112L|ESR2_uc001xgz.1_Missense_Mutation_p.S112L|ESR2_uc010aqb.1_Non-coding_Transcript|ESR2_uc010aqc.1_Missense_Mutation_p.S112L	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	112	Modulating.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3					Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)					196				0.336066	223.870943	229.674036	82	162	GG		KEEP	---	---	---	---	capture		all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Missense_Mutation	SNP	63819122	63819122	5450	14	G	A	A	37	37	ESR2	A	1	1
PAPLN	89932	broad.mit.edu	36	14	72799067	72799067	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:72799067C>T	uc001xnw.2	+	c.2421C>T	c.(2419-2421)GGC>GGT	p.G807G	PAPLN_uc010arm.1_Missense_Mutation_p.A26V|PAPLN_uc010arn.1_Silent_p.G34G	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	834						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2														0.333333	9.413025	9.699794	4	8	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)	Silent	SNP	72799067	72799067	11845	14	C	T	T	27	27	PAPLN	T	1	1
GPR68	8111	broad.mit.edu	36	14	90770639	90770639	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:90770639C>T	uc001xzh.1	-	c.539G>A	c.(538-540)CGC>CAC	p.R180H	GPR68_uc001xzg.1_Missense_Mutation_p.R170H|GPR68_uc010atx.1_Missense_Mutation_p.R180H	NM_003485	NP_003476	Q15743	OGR1_HUMAN	G protein-coupled receptor 68	170	Extracellular (Potential).				inflammatory response	integral to plasma membrane	G-protein coupled receptor activity			kidney(1)	1		all_cancers(154;0.0555)												0.25	40.714392	44.806579	18	54	CC		KEEP	---	---	---	---	capture		COAD - Colon adenocarcinoma(157;0.21)	Missense_Mutation	SNP	90770639	90770639	6982	14	C	T	T	27	27	GPR68	T	1	1
HDC	3067	broad.mit.edu	36	15	48322144	48322144	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:48322144C>T	uc001zxz.1	-	c.1594G>A	c.(1594-1596)GGT>AGT	p.G532S	HDC_uc001zxy.1_Missense_Mutation_p.G275S	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	532					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|central_nervous_system(1)	3		all_lung(180;0.0138)			L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	GBM(95;1627 1936 6910 9570)								0.253846	81.517784	88.664799	33	97	CC		KEEP	---	---	---	---	capture		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	Missense_Mutation	SNP	48322144	48322144	7298	15	C	T	T	23	23	HDC	T	1	1
ANKS3	124401	broad.mit.edu	36	16	4704085	4704085	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4704085G>A	uc002cxj.1	-	c.677C>T	c.(676-678)CCC>CTC	p.P226L	ANKS3_uc002cxl.1_Missense_Mutation_p.P53L|ANKS3_uc002cxk.1_Missense_Mutation_p.P97L|ANKS3_uc002cxm.1_Missense_Mutation_p.P20L|ANKS3_uc002cxi.1_Missense_Mutation_p.P153L	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain	226											0														0.34188	108.66478	111.249321	40	77	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4704085	4704085	698	16	G	A	A	43	43	ANKS3	A	2	2
FOXF1	2294	broad.mit.edu	36	16	85102626	85102626	+	Missense_Mutation	SNP	A	C	C			TCGA-76-4927-01	TCGA-76-4927-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:85102626A>C	uc002fjl.1	+	c.950A>C	c.(949-951)AAC>ACC	p.N317T		NM_001451	NP_001442	Q12946	FOXF1_HUMAN	forkhead box F1	317					negative regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of gene-specific transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0														0.230769	6.317484	7.181831	3	10	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85102626	85102626	6250	16	A	C	C	2	2	FOXF1	C	4	4
KRTAP4-4	84616	broad.mit.edu	36	17	36570018	36570018	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36570018C>G	uc002hwc.1	-	c.452G>C	c.(451-453)TGT>TCT	p.C151S		NM_032524	NP_115913	Q9BYR3	KRA44_HUMAN	keratin associated protein 4.4	151	26.|26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].					keratin filament					0		Breast(137;0.000496)												0.246479	96.554289	104.863509	35	107	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(17;0.000449)		Missense_Mutation	SNP	36570018	36570018	8875	17	C	G	G	17	17	KRTAP4-4	G	3	3
BRCA1	672	broad.mit.edu	36	17	38498138	38498138	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:38498138C>T	uc002ict.1	-	c.2936G>A	c.(2935-2937)CGT>CAT	p.R979H	BRCA1_uc002ico.1_Missense_Mutation_p.R979H|BRCA1_uc002icp.2_Missense_Mutation_p.R908H|BRCA1_uc002icq.1_Missense_Mutation_p.R979H|BRCA1_uc002icr.1_Missense_Mutation_p.R979H|BRCA1_uc002ics.1_Missense_Mutation_p.R683H|BRCA1_uc002icu.1_Intron|BRCA1_uc010cyx.1_Missense_Mutation_p.R932H|BRCA1_uc002icw.1_Missense_Mutation_p.R979H|BRCA1_uc002icv.1_Intron|BRCA1_uc002icx.1_Intron|BRCA1_uc002icy.1_Missense_Mutation_p.R938H|BRCA1_uc002icz.1_Intron|BRCA1_uc002ida.1_Intron|BRCA1_uc002idb.1_Missense_Mutation_p.R979H|BRCA1_uc002idc.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.R979H|BRCA1_uc002ide.1_Missense_Mutation_p.R810H|BRCA1_uc010cyy.1_Missense_Mutation_p.R979H|BRCA1_uc010cyz.1_Missense_Mutation_p.R932H|BRCA1_uc010cza.1_Missense_Mutation_p.R953H	NM_007296	NP_009227	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	979					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of protein ubiquitination|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription activator activity|transcription coactivator activity|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(17)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)|lung(1)	45		Breast(137;0.000717)								296	TCGA Ovarian(2;0.000030)			0.345609	324.03226	331.46687	122	231	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(366;0.126)	Missense_Mutation	SNP	38498138	38498138	1529	17	C	T	T	19	19	BRCA1	T	1	1
FBF1	85302	broad.mit.edu	36	17	71422481	71422481	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71422481G>C	uc002jqc.2	-	c.2711C>G	c.(2710-2712)GCC>GGC	p.A904G	FBF1_uc002jqa.1_Intron|FBF1_uc002jqb.2_Intron|FBF1_uc010dgr.1_Missense_Mutation_p.A215G	NM_001080542	NP_001074011	A6NLR5	A6NLR5_HUMAN	Fas (TNFRSF6) binding factor 1	904											0														0.333333	6.416992	6.640908	3	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71422481	71422481	5931	17	G	C	C	42	42	FBF1	C	3	3
LRRC30	339291	broad.mit.edu	36	18	7221386	7221386	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:7221386C>T	uc010dku.1	+	c.250C>T	c.(250-252)CGG>TGG	p.R84W		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	84	LRR 1.									ovary(1)|liver(1)	2														0.366197	150.690645	152.914299	52	90	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7221386	7221386	9360	18	C	T	T	23	23	LRRC30	T	1	1
ZNF136	7695	broad.mit.edu	36	19	12159584	12159584	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12159584G>A	uc002mti.1	+	c.1391G>A	c.(1390-1392)CGA>CAA	p.R464Q		NM_003437	NP_003428	P52737	ZN136_HUMAN	zinc finger protein 136	464	C2H2-type 12.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|protein binding|specific RNA polymerase II transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|pancreas(1)	2														0.240602	74.12709	82.299662	32	101	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12159584	12159584	18317	19	G	A	A	37	37	ZNF136	A	1	1
RASAL3	64926	broad.mit.edu	36	19	15435925	15435925	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15435925C>T	uc002nbe.2	-	c.245G>A	c.(244-246)CGC>CAC	p.R82H		NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	82					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0														0.215054	42.69838	49.634473	20	73	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15435925	15435925	13526	19	C	T	T	27	27	RASAL3	T	1	1
USHBP1	83878	broad.mit.edu	36	19	17236061	17236061	+	Silent	SNP	A	C	C			TCGA-76-4927-01	TCGA-76-4927-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17236061A>C	uc002nfs.1	-	c.48T>G	c.(46-48)GCT>GCG	p.A16A	USHBP1_uc002nft.1_Non-coding_Transcript|USHBP1_uc010eam.1_5'UTR	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	16							PDZ domain binding			ovary(1)	1														0.204545	31.95781	39.150575	18	70	AA		KEEP	---	---	---	---	capture			Silent	SNP	17236061	17236061	17599	19	A	C	C	11	11	USHBP1	C	4	4
MAG	4099	broad.mit.edu	36	19	40478578	40478578	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:40478578G>A	uc002nyy.1	+	c.269G>A	c.(268-270)CGC>CAC	p.R90H	MAG_uc002nyz.1_Missense_Mutation_p.R90H|MAG_uc002nyx.1_Missense_Mutation_p.R90H|MAG_uc010eds.1_Missense_Mutation_p.R65H	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	90	Ig-like V-type.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			central_nervous_system(1)	1	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)												0.253076	319.210678	350.670827	144	425	GG		KEEP	---	---	---	---	capture	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		Missense_Mutation	SNP	40478578	40478578	9539	19	G	A	A	38	38	MAG	A	1	1
PSG1	5669	broad.mit.edu	36	19	48064316	48064316	+	Silent	SNP	T	A	A			TCGA-76-4927-01	TCGA-76-4927-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:48064316T>A	uc010eio.1	-	c.1020A>T	c.(1018-1020)TCA>TCT	p.S340S	PSG10_uc002ouv.1_Intron|PSG3_uc002ouf.1_Intron|PSG1_uc002oug.1_Intron|PSG1_uc002oun.1_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG11_uc002ouw.1_Intron|PSG1_uc002our.1_Silent_p.S340S|PSG1_uc002oux.1_Silent_p.S269S|PSG1_uc002ouy.1_Silent_p.S247S|PSG1_uc002ouz.1_Silent_p.S340S|PSG1_uc002ova.1_Silent_p.S247S|PSG1_uc002ovb.2_Silent_p.S340S|PSG1_uc002ovc.2_Silent_p.S247S|PSG1_uc002ovd.1_Silent_p.S340S	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	340	Ig-like C2-type 3.				female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)												0.324324	170.487534	175.581832	60	125	TT		KEEP	---	---	---	---	capture			Silent	SNP	48064316	48064316	13106	19	T	A	A	51	51	PSG1	A	4	4
NLRP5	126206	broad.mit.edu	36	19	61230675	61230675	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61230675G>A	uc002qmj.1	+	c.1264G>A	c.(1264-1266)GTG>ATG	p.V422M	NLRP5_uc002qmi.1_Missense_Mutation_p.V403M	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	422	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)	6		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)												0.3	39.207259	40.993207	15	35	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(193;0.0326)	Missense_Mutation	SNP	61230675	61230675	10883	19	G	A	A	40	40	NLRP5	A	1	1
ZNF470	388566	broad.mit.edu	36	19	61780572	61780572	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61780572C>T	uc002qnl.2	+	c.963C>T	c.(961-963)TTC>TTT	p.F321F	ZNF470_uc010etn.1_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	321	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)												0.30137	111.33491	116.484562	44	102	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(193;0.0294)	Silent	SNP	61780572	61780572	18523	19	C	T	T	29	29	ZNF470	T	2	2
KHSRP	8570	broad.mit.edu	36	19	6371483	6371483	+	Splice_Site_SNP	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:6371483C>T	uc002mer.2	-	c.426_splice	c.e5-1	p.R142_splice		NM_003685	NP_003676			KH-type splicing regulatory protein (FUSE						mRNA processing|mRNA transport|regulation of transcription, DNA-dependent|RNA splicing, via transesterification reactions|transcription, DNA-dependent	cytosol|nucleus	DNA binding|protein binding|RNA binding			skin(1)	1						Colon(55;593 1006 2067 9135 22980)								0.230769	55.326635	61.371789	21	70	CC		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	6371483	6371483	8457	19	C	T	T	24	24	KHSRP	T	5	2
GJA8	2703	broad.mit.edu	36	1	145847069	145847069	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:145847069C>T	uc001epu.1	+	c.363C>T	c.(361-363)AAC>AAT	p.N121N	NBPF11_uc009wjd.1_Intron|NBPF11_uc009wje.1_Intron|GJA8_uc009wjl.1_Silent_p.N121N	NM_005267	NP_005258	P48165	CXA8_HUMAN	connexin 50	121	Cytoplasmic (Potential).				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity			ovary(2)|large_intestine(2)|breast(1)	5	all_hematologic(923;0.0276)					Melanoma(76;1255 1795 8195 52096)								0.352113	123.198814	125.940913	50	92	CC		KEEP	---	---	---	---	capture			Silent	SNP	145847069	145847069	6673	1	C	T	T	19	19	GJA8	T	1	1
UBAP2L	9898	broad.mit.edu	36	1	152473811	152473811	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152473811C>T	uc001fep.2	+	c.400C>T	c.(400-402)CGT>TGT	p.R134C	UBAP2L_uc009wot.1_Missense_Mutation_p.R134C|UBAP2L_uc001fen.1_Missense_Mutation_p.R133C|UBAP2L_uc001feo.1_Missense_Mutation_p.R133C	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	134					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)													0.275	26.439568	28.244078	11	29	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.185)		Missense_Mutation	SNP	152473811	152473811	17395	1	C	T	T	19	19	UBAP2L	T	1	1
CACNA1S	779	broad.mit.edu	36	1	199325097	199325097	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:199325097C>T	uc001gvv.1	-	c.812G>A	c.(811-813)GGC>GAC	p.G271D		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	271	Extracellular (Potential).|I.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)	4					Magnesium Sulfate(DB00653)|Verapamil(DB00661)									0.386667	73.278347	74.114136	29	46	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	199325097	199325097	2663	1	C	T	T	26	26	CACNA1S	T	2	2
SPATA17	128153	broad.mit.edu	36	1	215891141	215891141	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:215891141C>A	uc001hlh.1	+	c.238C>A	c.(238-240)CAG>AAG	p.Q80K	SPATA17_uc009xdr.1_Non-coding_Transcript|SPATA17_uc001hli.1_Missense_Mutation_p.Q80K	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	80	IQ 2.					cytoplasm	calmodulin binding			pancreas(1)	1														0.252809	109.079932	118.963366	45	133	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)	Missense_Mutation	SNP	215891141	215891141	15510	1	C	A	A	25	25	SPATA17	A	3	3
DISC1	27185	broad.mit.edu	36	1	230211206	230211206	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:230211206C>T	uc001huz.1	+	c.2095C>T	c.(2095-2097)CGA>TGA	p.R699*	DISC1_uc009xfr.1_Nonsense_Mutation_p.R654*|DISC1_uc001hva.1_Nonsense_Mutation_p.R699*	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L	699	Necessary and sufficient for interaction with PCNT and localization at the centrosome.|Interaction with ATF4 and ATF5.				microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding				0		all_cancers(173;0.0208)|Prostate(94;0.0975)												0.227273	67.595073	76.528604	30	102	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	230211206	230211206	4717	1	C	T	T	31	31	DISC1	T	5	1
GGTLC1	92086	broad.mit.edu	36	20	23914561	23914561	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:23914561C>T	uc002wts.1	-	c.355G>A	c.(355-357)GGC>AGC	p.G119S	GGTLC1_uc002wtt.1_Missense_Mutation_p.G119S|GGTLC1_uc002wtu.1_Missense_Mutation_p.G119S	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	119							gamma-glutamyltransferase activity			ovary(1)	1														0.331878	203.966579	209.679216	76	153	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23914561	23914561	6633	20	C	T	T	23	23	GGTLC1	T	1	1
CDH22	64405	broad.mit.edu	36	20	44275104	44275104	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:44275104G>A	uc002xrm.2	-	c.969C>T	c.(967-969)GGC>GGT	p.G323G	CDH22_uc010ghk.1_Silent_p.G323G|CDH22_uc002xrn.1_Silent_p.G74G	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor	323	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4		Myeloproliferative disorder(115;0.0122)												0.36036	103.5609	105.469541	40	71	GG		KEEP	---	---	---	---	capture			Silent	SNP	44275104	44275104	3236	20	G	A	A	38	38	CDH22	A	1	1
LPIN1	23175	broad.mit.edu	36	2	11828979	11828979	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:11828979C>T	uc002rbt.1	+	c.319C>T	c.(319-321)CCC>TCC	p.P107S	LPIN1_uc002rbs.2_Missense_Mutation_p.P107S	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	107	N-LIP.				fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)	3	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)													0.267717	93.091717	99.279424	34	93	CC		KEEP	---	---	---	---	capture		Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)	Missense_Mutation	SNP	11828979	11828979	9291	2	C	T	T	22	22	LPIN1	T	2	2
SCN1A	6323	broad.mit.edu	36	2	166606109	166606109	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:166606109C>T	uc010fpj.1	-	c.2260G>A	c.(2260-2262)GTG>ATG	p.V754M	SCN1A_uc002udo.2_Missense_Mutation_p.V634M|SCN1A_uc010fpk.1_Missense_Mutation_p.V606M	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	765	Helical; Name=S1 of repeat II; (By similarity).|II.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|large_intestine(1)	7					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)									0.34375	235.741492	241.252963	88	168	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	166606109	166606109	14396	2	C	T	T	17	17	SCN1A	T	2	2
COL6A3	1293	broad.mit.edu	36	2	237968329	237968329	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237968329G>C	uc002vwl.2	-	c.349C>G	c.(349-351)CAG>GAG	p.Q117E	COL6A3_uc002vwk.2_Missense_Mutation_p.Q117E|COL6A3_uc002vwm.2_Missense_Mutation_p.Q117E|COL6A3_uc002vwn.2_Missense_Mutation_p.Q117E|COL6A3_uc002vwo.2_Intron|COL6A3_uc002vwq.2_Intron|COL6A3_uc002vwr.2_Intron	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	117	VWFA 1.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|pancreas(1)	15		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)												0.359589	356.794216	361.863235	105	187	GG		KEEP	---	---	---	---	capture		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	Missense_Mutation	SNP	237968329	237968329	3839	2	G	C	C	45	45	COL6A3	C	3	3
MFSD2B	388931	broad.mit.edu	36	2	24099999	24099999	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:24099999C>T	uc002reo.1	+	c.1212C>T	c.(1210-1212)CAC>CAT	p.H404H		NM_001080473	NP_001073942	A6NFX1	MFS2B_HUMAN	hypothetical protein LOC388931	404					transport	integral to membrane				ovary(2)	2														0.405229	166.707272	167.911487	62	91	CC		KEEP	---	---	---	---	capture			Silent	SNP	24099999	24099999	9921	2	C	T	T	18	18	MFSD2B	T	2	2
PHLDB2	90102	broad.mit.edu	36	3	113086223	113086223	+	Silent	SNP	A	C	C			TCGA-76-4927-01	TCGA-76-4927-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:113086223A>C	uc010hqa.1	+	c.609A>C	c.(607-609)TCA>TCC	p.S203S	PHLDB2_uc003dyc.1_Silent_p.S230S|PHLDB2_uc003dyd.1_Silent_p.S203S|PHLDB2_uc003dyf.2_Silent_p.S203S|PHLDB2_uc003dyg.1_Silent_p.S203S|PHLDB2_uc003dyh.1_Silent_p.S203S|PHLDB2_uc003dye.2_Silent_p.S203S	NM_145753	NP_665696	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	203						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)	4														0.196581	61.066501	71.094848	23	94	AA		KEEP	---	---	---	---	capture			Silent	SNP	113086223	113086223	12276	3	A	C	C	5	5	PHLDB2	C	4	4
FGD5	152273	broad.mit.edu	36	3	14837439	14837439	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:14837439C>T	uc003bzc.1	+	c.1134C>T	c.(1132-1134)TTC>TTT	p.F378F		NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	619					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5														0.442177	186.756708	187.184254	65	82	CC		KEEP	---	---	---	---	capture			Silent	SNP	14837439	14837439	6073	3	C	T	T	31	31	FGD5	T	1	1
SLC6A20	54716	broad.mit.edu	36	3	45787822	45787822	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:45787822C>T	uc003cou.1	-	c.826G>A	c.(826-828)GCC>ACC	p.A276T	SLC6A20_uc003cov.1_Missense_Mutation_p.A239T|SLC6A20_uc003cow.1_5'UTR	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1	276	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2														0.285714	90.201259	95.679573	38	95	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)	Missense_Mutation	SNP	45787822	45787822	15181	3	C	T	T	27	27	SLC6A20	T	1	1
FIP1L1	81608	broad.mit.edu	36	4	53988952	53988952	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4927-01	TCGA-76-4927-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:53988952T>C	uc003gzy.1	+	c.1019T>C	c.(1018-1020)GTC>GCC	p.V340A	PDGFRA_uc003haa.1_Intron|FIP1L1_uc003gzz.1_Missense_Mutation_p.V266A|FIP1L1_uc003hab.1_Missense_Mutation_p.V305A|FIP1L1_uc003hac.1_Missense_Mutation_p.V85A|FIP1L1_uc010ign.1_Non-coding_Transcript|FIP1L1_uc003had.1_5'UTR|FIP1L1_uc003hae.1_5'UTR|FIP1L1_uc003gzx.2_Missense_Mutation_p.V325A	NM_030917	NP_112179	Q6UN15	FIP1_HUMAN	FIP1 like 1 isoform 1	340	Necessary for stimulating PAPOLA activity.	Breakpoint for interstitial deletion to form the FIP1L1-PDGFRA fusion protein.			mRNA processing	nucleus	RNA binding			ovary(1)|skin(1)	2										17				0.288889	80.519185	84.111289	26	64	TT		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)		Missense_Mutation	SNP	53988952	53988952	6134	4	T	C	C	58	58	FIP1L1	C	4	4
ANKRD56	345079	broad.mit.edu	36	4	78037049	78037049	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:78037049G>A	uc003hki.1	-	c.978C>T	c.(976-978)CGC>CGT	p.R326R		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	326											0														0.3	85.845912	90.139377	36	84	GG		KEEP	---	---	---	---	capture			Silent	SNP	78037049	78037049	690	4	G	A	A	38	38	ANKRD56	A	1	1
PCDHA5	56143	broad.mit.edu	36	5	140182907	140182907	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140182907G>A	uc003lhl.1	+	c.1363G>A	c.(1363-1365)GCG>ACG	p.A455T	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.A455T|PCDHA5_uc003lhj.1_Missense_Mutation_p.A455T	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	455	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)	2														0.361963	143.360538	146.100427	59	104	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140182907	140182907	11947	5	G	A	A	38	38	PCDHA5	A	1	1
PLEKHG4B	153478	broad.mit.edu	36	5	216559	216559	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:216559G>A	uc003jak.2	+	c.2304G>A	c.(2302-2304)CCG>CCA	p.P768P		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	768					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1														0.333333	138.214073	142.422824	57	114	GG		KEEP	---	---	---	---	capture	all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)	Silent	SNP	216559	216559	12498	5	G	A	A	38	38	PLEKHG4B	A	1	1
PACRG	135138	broad.mit.edu	36	6	163430331	163430331	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:163430331C>T	uc003qua.1	+	c.514C>T	c.(514-516)CTC>TTC	p.L172F	PACRG_uc003qub.1_Missense_Mutation_p.L172F|PACRG_uc003quc.1_Missense_Mutation_p.L172F	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1	172											0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)												0.307087	225.848062	234.279763	78	176	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)	Missense_Mutation	SNP	163430331	163430331	11786	6	C	T	T	24	24	PACRG	T	2	2
CDHR3	222256	broad.mit.edu	36	7	105429152	105429152	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:105429152G>A	uc003vdl.2	+	c.722G>A	c.(721-723)CGA>CAA	p.R241Q	CDHR3_uc003vdk.1_Intron|CDHR3_uc003vdm.2_Missense_Mutation_p.R228Q|CDHR3_uc003vdn.1_5'UTR	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256	241	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1														0.204787	157.823939	188.196259	77	299	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	105429152	105429152	3249	7	G	A	A	37	37	CDHR3	A	1	1
INTS1	26173	broad.mit.edu	36	7	1488784	1488784	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:1488784C>T	uc003skn.2	-	c.3627G>A	c.(3625-3627)TCG>TCA	p.S1209S	INTS1_uc003skp.1_3'UTR	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	1209					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)												0.238095	162.940637	180.044365	65	208	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)	Silent	SNP	1488784	1488784	8076	7	C	T	T	23	23	INTS1	T	1	1
LMBR1	64327	broad.mit.edu	36	7	156249200	156249200	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:156249200C>T	uc010lqn.1	-	c.474G>A	c.(472-474)GCG>GCA	p.A158A	LMBR1_uc003wmv.2_Silent_p.A6A|LMBR1_uc003wmw.2_Silent_p.A158A|LMBR1_uc003wmx.2_Silent_p.A6A	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein	158	Helical; (Potential).					integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)												0.222543	174.795142	199.293867	77	269	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)	Silent	SNP	156249200	156249200	9169	7	C	T	T	19	19	LMBR1	T	1	1
TXNDC3	51314	broad.mit.edu	36	7	37856863	37856863	+	Splice_Site_SNP	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:37856863G>A	uc003tfn.1	+	c.198_splice	c.e5+1	p.V66_splice		NM_016616	NP_057700			thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						Ovarian(108;903 1537 27096 29907 47400)								0.225926	134.02063	152.658704	61	209	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	37856863	37856863	17354	7	G	A	A	40	40	TXNDC3	A	5	1
TXNDC3	51314	broad.mit.edu	36	7	37891295	37891295	+	Nonsense_Mutation	SNP	T	A	A			TCGA-76-4927-01	TCGA-76-4927-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:37891295T>A	uc003tfn.1	+	c.1163T>A	c.(1162-1164)TTA>TAA	p.L388*		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	388	NDK 2.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						Ovarian(108;903 1537 27096 29907 47400)								0.167785	42.882468	58.466404	25	124	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	37891295	37891295	17354	7	T	A	A	61	61	TXNDC3	A	5	4
PKD1L1	168507	broad.mit.edu	36	7	47821467	47821467	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:47821467G>A	uc003tny.1	-	c.7079C>T	c.(7078-7080)CCG>CTG	p.P2360L	C7orf69_uc003tnz.2_Intron|C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_Missense_Mutation_p.P87L	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2360	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(7)|breast(1)	8														0.196262	90.93602	109.328738	42	172	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47821467	47821467	12388	7	G	A	A	39	39	PKD1L1	A	1	1
EGFR	1956	broad.mit.edu	36	7	55187768	55187768	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55187768C>T	uc003tqk.1	+	c.664C>T	c.(664-666)CGC>TGC	p.R222C	EGFR_uc003tqh.1_Missense_Mutation_p.R222C|EGFR_uc003tqi.1_Missense_Mutation_p.R222C|EGFR_uc003tqj.1_Missense_Mutation_p.R222C|EGFR_uc010kzg.1_Missense_Mutation_p.R177C|EGFR_uc003tql.1_Non-coding_Transcript	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	222	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(10)|p.R222C(2)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)				Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.516495	1396.11865	1396.355782	501	469	CC		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Missense_Mutation	SNP	55187768	55187768	5156	7	C	T	T	27	27	EGFR	T	1	1
TAC1	6863	broad.mit.edu	36	7	97202081	97202081	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:97202081C>T	uc003uop.2	+	c.273C>T	c.(271-273)GGC>GGT	p.G91G	TAC1_uc003uoq.2_Silent_p.G91G|TAC1_uc003uor.2_Silent_p.G76G|TAC1_uc003uos.2_Silent_p.G76G	NM_003182	NP_003173	P20366	TKN1_HUMAN	tachykinin 1 isoform beta precursor	91					detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space					0	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)				Bacitracin(DB00626)									0.135338	26.55313	43.69762	18	115	CC		KEEP	---	---	---	---	capture			Silent	SNP	97202081	97202081	16019	7	C	T	T	26	26	TAC1	T	2	2
TG	7038	broad.mit.edu	36	8	134176614	134176614	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:134176614C>T	uc003ytw.1	+	c.7384C>T	c.(7384-7386)CTC>TTC	p.L2462F	TG_uc010mdw.1_Missense_Mutation_p.L1221F|SLA_uc003ytz.1_Intron|SLA_uc003yua.1_Intron|SLA_uc010mea.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin	2462					hormone biosynthetic process|regulation of synaptic transmission|signal transduction		carboxylesterase activity|hormone activity			ovary(8)|breast(4)|pancreas(1)	13	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)								1778				0.246418	233.676382	254.105928	86	263	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)	Missense_Mutation	SNP	134176614	134176614	16341	8	C	T	T	24	24	TG	T	2	2
UBXN8	7993	broad.mit.edu	36	8	30728555	30728555	+	Missense_Mutation	SNP	A	C	C			TCGA-76-4927-01	TCGA-76-4927-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:30728555A>C	uc003xii.1	+	c.189A>C	c.(187-189)AAA>AAC	p.K63N	UBXN8_uc010lvi.1_Intron|UBXN8_uc003xij.1_Non-coding_Transcript	NM_005671	NP_005662	O00124	UBXN8_HUMAN	reproduction 8	63					single fertilization						0						Colon(169;855 1943 17895 39459 47884)								0.278689	50.848735	53.53619	17	44	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30728555	30728555	17477	8	A	C	C	4	4	UBXN8	C	4	4
INSL6	11172	broad.mit.edu	36	9	5175468	5175468	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:5175468G>A	uc003zix.1	-	c.135C>T	c.(133-135)TGC>TGT	p.C45C		NM_007179	NP_009110	Q9Y581	INSL6_HUMAN	insulin-like 6 precursor	45						extracellular region	hormone activity				0	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)												0.368159	193.60166	196.670222	74	127	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)	Silent	SNP	5175468	5175468	8071	9	G	A	A	38	38	INSL6	A	1	1
CTSL2	1515	broad.mit.edu	36	9	98840039	98840039	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:98840039G>C	uc004awt.1	-	c.108C>G	c.(106-108)CAC>CAG	p.H36Q	CTSL2_uc010msi.1_Missense_Mutation_p.H36Q|CTSL2_uc004awu.1_5'UTR|CTSL2_uc010msj.1_5'UTR|CTSL2_uc010msk.1_5'UTR	NM_001333	NP_001324	O60911	CATL2_HUMAN	cathepsin L2 preproprotein	36						lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)							p.H36H(BEN-Tumor)	95				0.307317	197.049972	203.834111	63	142	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	98840039	98840039	4198	9	G	C	C	48	48	CTSL2	C	3	3
PHKA1	5255	broad.mit.edu	36	X	71812715	71812715	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4927-01	TCGA-76-4927-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:71812715A>G	uc004eax.2	-	c.548T>C	c.(547-549)ATA>ACA	p.I183T	PHKA1_uc004eay.2_Missense_Mutation_p.I183T	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	183					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)	3	Renal(35;0.156)													0.552941	169.638096	169.846236	47	38	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71812715	71812715	12267	23	A	G	G	16	16	PHKA1	G	4	4
MUC4	4585	broad.mit.edu	36	3	196993194	196993241	+	In_Frame_Del	DEL	GCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	-	-			TCGA-76-4927-01	TCGA-76-4927-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:196993194_196993241delGCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	uc010hzt.1	-	c.9605_9652delATGTCACCAGCCCTTCCTCAGCATCCACAGGTGACACCACCCCTGTGC	c.(9604-9654)CATGTCACCAGCCCTTCCTCAGCATCCACAGGTGACACCACCCCTGTGCCT>CCT	p.HVTSPSSASTGDTTPV3202del	MUC4_uc003fvo.1_Intron|MUC4_uc003fvp.1_Intron|MUC4_uc010hzu.1_Intron|MUC4_uc003fva.1_5'Flank|MUC4_uc003fvb.1_5'Flank|MUC4_uc003fvd.1_5'Flank|MUC4_uc003fve.1_5'Flank|MUC4_uc003fvc.1_5'Flank|MUC4_uc010hzr.1_5'Flank|MUC4_uc003fvm.1_5'Flank|MUC4_uc003fvg.1_5'Flank|MUC4_uc003fvf.1_5'Flank|MUC4_uc003fvh.1_5'Flank|MUC4_uc010hzs.1_5'Flank|MUC4_uc003fvi.1_5'Flank|MUC4_uc003fvj.1_5'Flank|MUC4_uc003fvk.1_5'Flank|MUC4_uc003fvl.1_5'Flank	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	139_154					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)										0.33			2	4				---	---	---	---	capture_indel			In_Frame_Del	DEL	196993194	196993241	10372	3	GCACAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGGGCTGGTGACAT	-	-	42	42	MUC4	-	5	5
