Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
AP3M1	26985	broad.mit.edu	37	10	75883629	75883629	+	Missense_Mutation	SNP	T	C	C			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr10:75883629T>C	uc001jwf.2	-	9	1626	c.1196A>G	c.(1195-1197)TAT>TGT	p.Y399C	AP3M1_uc001jwg.2_Missense_Mutation_p.Y399C|AP3M1_uc001jwh.2_Missense_Mutation_p.Y399C|AP3M1_uc010qla.1_Missense_Mutation_p.Y345C	NM_207012	NP_996895	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	399	MHD.				protein targeting to lysosome|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus|lysosome	protein binding				0	Prostate(51;0.0112)					AAATGGCTTATATTTCTCCCC	0.363000													9	189	---	---	---	---	0	0	0.058154	0	0
NUP160	23279	broad.mit.edu	37	11	47833688	47833688	+	Silent	SNP	G	A	A			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr11:47833688G>A	uc001ngm.2	-	17	2254	c.2169C>T	c.(2167-2169)ATC>ATT	p.I723I	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	723					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						GAGTACTGGCGATTTTATGCA	0.423000													4	62	---	---	---	---	0	0	0.009096	0	0
ITPR2	3709	broad.mit.edu	37	12	26572040	26572040	+	Missense_Mutation	SNP	G	A	A			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr12:26572040G>A	uc001rhg.2	-	50	7469	c.7052C>T	c.(7051-7053)GCG>GTG	p.A2351V	ITPR2_uc009zjg.1_Missense_Mutation_p.A502V	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	2351	Extracellular (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CAGGACATACGCCACGTGATA	0.448000													4	59	---	---	---	---	0	0	0.009096	0	0
RPAP3	79657	broad.mit.edu	37	12	48091473	48091473	+	Silent	SNP	G	A	A	rs150350108		TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr12:48091473G>A	uc001rpr.2	-	4	440	c.324C>T	c.(322-324)GAC>GAT	p.D108D	RPAP3_uc010slk.1_Translation_Start_Site|RPAP3_uc001rps.2_Silent_p.D108D	NM_024604	NP_078880	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3 isoform	108							binding			ovary(1)	1	Lung SC(27;0.192)					GGGTACTATCGTCTTTGTCAA	0.353000													8	99	---	---	---	---	0	0	0.058154	0	0
Unknown	0	broad.mit.edu	37	15	102304740	102304740	+	5'Flank	SNP	G	C	C	rs7169420	by1000genomes	TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr15:102304740G>C	uc002cbx.1	-						uc002ccc.1_5'Flank|uc002ccf.3_RNA|uc002ccg.3_5'Flank|uc010uth.1_5'Flank|uc002cci.2_5'Flank|uc002ccj.2_5'Flank|uc002cck.2_5'Flank|uc002ccl.1_5'Flank|uc002ccm.1_5'Flank					DQ582460																		GAAGACACTCGTGGAGGAGTC	0.612000													2	10	---	---	---	---	0	0	0.014758	0	0
Unknown	0	broad.mit.edu	37	16	18442416	18442416	+	Missense_Mutation	SNP	A	G	G			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr16:18442416A>G	uc010bvw.2	-	6	958	c.302T>C	c.(301-303)CTC>CCC	p.L101P						SubName: Full=cDNA FLJ59085, highly similar to Polycystin-1;																		GGGGGCCCCGAGTAGCCCTGG	0.692000													3	23	---	---	---	---	0	0	0.115264	0	0
Unknown	0	broad.mit.edu	37	17	20405838	20405838	+	RNA	SNP	G	T	T			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr17:20405838G>T	uc002gxb.2	-	5		c.1181C>A								Homo sapiens similar to Keratin, type I cytoskeletal 16 (Cytokeratin-16) (CK-16) (Keratin-16) (K16), mRNA (cDNA clone IMAGE:4752428).																		ATTGTGGCTTGTTGAGGGGGT	0.527000													8	37	---	---	---	---	1.3612e-06	1.71411e-06	0.132662	1	0
Unknown	0	broad.mit.edu	37	17	58512596	58512596	+	RNA	SNP	G	A	A			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr17:58512596G>A	uc002iyr.1	-	1		c.762C>T								Homo sapiens cDNA FLJ33664 fis, clone BRAMY2027451, moderately similar to 60S RIBOSOMAL PROTEIN L12.																		TTTTCTGCAGGGCTATTCCCT	0.483000													3	55	---	---	---	---	0	0	0.115264	0	0
C19orf44	84167	broad.mit.edu	37	19	16614022	16614022	+	Silent	SNP	C	T	T	rs138964724	byFrequency	TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr19:16614022C>T	uc002neh.1	+	3	979	c.906C>T	c.(904-906)CAC>CAT	p.H302H	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Silent_p.H302H|C19orf44_uc002neg.2_Silent_p.H302H|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	302											0						CACAGAGTCACGTTTCCAGTG	0.547000													6	90	---	---	---	---	0	0	0.021553	0	0
C22orf40	150383	broad.mit.edu	37	22	46643010	46643010	+	Silent	SNP	G	A	A			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr22:46643010G>A	uc003bhe.2	-	3	263	c.222C>T	c.(220-222)GGC>GGT	p.G74G	C22orf40_uc003bhc.2_Silent_p.G74G|C22orf40_uc003bhd.2_Intron|C22orf40_uc003bhf.2_RNA	NM_207327	NP_997210	Q6NVV7	CV040_HUMAN	hypothetical protein LOC150383	74											0						TACCCACCGGGCCCACACACA	0.617000													3	21	---	---	---	---	0	0	0.115264	0	0
TMEM161B	153396	broad.mit.edu	37	5	87493539	87493539	+	Missense_Mutation	SNP	T	C	C			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr5:87493539T>C	uc003kjc.2	-	11	1258	c.1133A>G	c.(1132-1134)TAT>TGT	p.Y378C	TMEM161B_uc011cty.1_Missense_Mutation_p.Y367C|TMEM161B_uc010jax.2_RNA|TMEM161B_uc011ctx.1_Missense_Mutation_p.Y169C	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	378	Helical; (Potential).					integral to membrane				skin(2)	2		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		AGGCGCCACATACTGCAGTGC	0.423000													4	85	---	---	---	---	0	0	0.014758	0	0
YWHAG	7532	broad.mit.edu	37	7	75959220	75959220	+	Nonsense_Mutation	SNP	C	A	A			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr7:75959220C>A	uc011kgj.1	-	2	635	c.418G>T	c.(418-420)GGA>TGA	p.G140*		NM_012479	NP_036611	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan	140					G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity			ovary(1)|lung(1)	2						CTTTTCTCTCCGGTGGCCACT	0.562000													7	143	---	---	---	---	2.0095e-06	2.4401e-06	0.029380	1	0
LOC442421	442421	broad.mit.edu	37	9	66500839	66500839	+	RNA	SNP	T	C	C			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr9:66500839T>C	uc004aed.1	+	3		c.932T>C								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						AACCACCTGGTGCCCAGGGCT	0.637000													3	33	---	---	---	---	0	0	0.038147	0	0
Unknown	0	broad.mit.edu	37	1	143391935	143391936	+	IGR	INS	-	TG	TG			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr1:143391935_143391936insTG								None (None upstream) : LOC100286793 (255703 downstream)																							ATATATATATATAAAGAGATTG	0.252													4	3	---	---	---	---					
MPZ	4359	broad.mit.edu	37	1	161279666	161279666	+	Frame_Shift_Del	DEL	G	-	-			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr1:161279666delG	uc001gaf.3	-	1	97	c.60delC	c.(58-60)CCCfs	p.P20fs	MPZ_uc010pko.1_RNA	NM_000530	NP_000521	P25189	MYP0_HUMAN	myelin protein zero	10					synaptic transmission	integral to plasma membrane	structural molecule activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)	Breast(1374;0.181)	BRCA - Breast invasive adenocarcinoma(70;0.00376)			GGATAGGGCTGGGGCTGGATG	0.617													2	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	10	42400410	42400410	+	IGR	DEL	C	-	-	rs74186261		TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr10:42400410delC								None (None upstream) : LOC441666 (426905 downstream)																							aacgggatttcttcacataat	0.000													3	3	---	---	---	---					
Unknown	0	broad.mit.edu	37	17	74591634	74591634	+	IGR	DEL	A	-	-			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr17:74591634delA								ST6GALNAC2 (9489 upstream) : ST6GALNAC1 (29213 downstream)																							actctgtctcaaaaaaaaaaa	0.164													4	3	---	---	---	---					
Unknown	0	broad.mit.edu	37	2	61937783	61937783	+	IGR	DEL	T	-	-			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr2:61937783delT								XPO1 (172365 upstream) : FAM161A (114202 downstream)																							CCTTCATGGCTTTAAAACAAT	0.294													2	4	---	---	---	---					
Unknown	0	broad.mit.edu	37	21	34213736	34213737	+	IGR	INS	-	T	T			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr21:34213736_34213737insT								C21orf62 (27683 upstream) : OLIG2 (184502 downstream)																							atttcttCCTCTTTTTTTTTTG	0.257													4	6	---	---	---	---					
SOX4	6659	broad.mit.edu	37	6	21595266	21595267	+	In_Frame_Ins	INS	-	GGC	GGC			TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr6:21595266_21595267insGGC	uc003ndi.2	+	1	1295_1296	c.501_502insGGC	c.(499-504)insGGC	p.173_174insG		NM_003107	NP_003098	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	173_174					canonical Wnt receptor signaling pathway|cardiac ventricle formation|cellular response to glucose stimulus|DNA damage response, detection of DNA damage|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|glial cell development|glial cell proliferation|limb bud formation|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein export from nucleus|negative regulation of protein ubiquitination|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|positive regulation of insulin secretion|positive regulation of N-terminal peptidyl-lysine acetylation|positive regulation of translation|pro-B cell differentiation|protein stabilization|skeletal system development|spinal cord motor neuron differentiation|sympathetic nervous system development|T cell differentiation	mitochondrion|nucleus	core promoter sequence-specific DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity				0	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			gcggccatgggggcggcggcgg	0.351													3	5	---	---	---	---					
Unknown	0	broad.mit.edu	37	6	160133097	160133113	+	IGR	DEL	CTCGGCTGCTCAGACCT	-	-	rs71551146		TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr6:160133097_160133113delCTCGGCTGCTCAGACCT								SOD2 (18744 upstream) : WTAP (15016 downstream)																							ataaccaccacTCGGCTGCTCAGacctccataaccac	0.074													4	5	---	---	---	---					
Unknown	0	broad.mit.edu	37	7	56193766	56193767	+	IGR	INS	-	T	T	rs149113283	by1000genomes	TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr7:56193766_56193767insT								PSPH (9676 upstream) : DKFZp434L192 (370149 downstream)																							GTTGGTCTTTGTCTCTTAGAAG	0.480													5	11	---	---	---	---					
Unknown	0	broad.mit.edu	37	7	131438391	131438392	+	IGR	INS	-	T	T	rs77696576		TCGA-EL-A3CW-01A-11D-A19J-08	TCGA-EL-A3CW-10A-01D-A19M-08									Somatic	Phase_I	Capture				Illumina GAIIx	3847f72b-5594-44f1-9624-dbbb00aa8ae0	465c59b2-9a7c-4e5b-be9c-5e9a2db9f816	g.chr7:131438391_131438392insT								PODXL (197015 upstream) : PLXNA4 (369700 downstream)																							GGCAAGCTTTCTTTTTTTTTTT	0.173													3	6	---	---	---	---					
