Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TSPAN1	10103	broad.mit.edu	37	1	46650927	46650927	+	Nonsense_Mutation	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46650927C>T	uc001cpd.2	+	8	1089	c.625C>T	c.(625-627)CGA>TGA	p.R209*	TSPAN1_uc009vyd.1_Nonsense_Mutation_p.R209*	NM_005727	NP_005718	O60635	TSN1_HUMAN	tetraspan 1	209	Extracellular (Potential).					integral to membrane|lysosomal membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				GTATGACATCCGAACTAATGC	0.542													16	404	---	---	---	---	PASS
DNAJB4	11080	broad.mit.edu	37	1	78481792	78481792	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78481792G>C	uc001dij.2	+	3	1034	c.875G>C	c.(874-876)AGA>ACA	p.R292T	DNAJB4_uc010orn.1_Missense_Mutation_p.R177T	NM_007034	NP_008965	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	292					protein folding|response to heat|response to unfolded protein	cytoplasm|plasma membrane	heat shock protein binding|unfolded protein binding				0						ATGAGGAGAAGAATTATTGGA	0.393													36	108	---	---	---	---	PASS
GBP1	2633	broad.mit.edu	37	1	89523725	89523725	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89523725C>T	uc001dmx.2	-	6	1044	c.824G>A	c.(823-825)AGT>AAT	p.S275N		NM_002053	NP_002044	P32455	GBP1_HUMAN	guanylate binding protein 1,	275					interferon-gamma-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		TTTGGAATTACTAAAGATGTA	0.468													95	261	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103573632	103573632	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103573632C>A	uc001dul.2	-	1	421	c.103G>T	c.(103-105)GGA>TGA	p.G35*	COL11A1_uc001dum.2_Nonsense_Mutation_p.G35*|COL11A1_uc001dun.2_Nonsense_Mutation_p.G35*|COL11A1_uc009weh.2_Nonsense_Mutation_p.G35*	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	35					collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTCTTACCTCCTCTGACCTCT	0.557													3	59	---	---	---	---	PASS
OLFML3	56944	broad.mit.edu	37	1	114523687	114523687	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114523687G>A	uc001eer.1	+	3	626	c.517G>A	c.(517-519)GAT>AAT	p.D173N	OLFML3_uc001ees.1_Missense_Mutation_p.D153N|OLFML3_uc001eet.1_Missense_Mutation_p.D29N	NM_020190	NP_064575	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3 precursor	173	Olfactomedin-like.				multicellular organismal development	extracellular region					0	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTACGTGTTAGATGGGACACA	0.542													11	51	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179562794	179562794	+	Silent	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179562794G>A	uc001gnf.1	+	3	682	c.432G>A	c.(430-432)GCG>GCA	p.A144A	TDRD5_uc010pnp.1_Silent_p.A144A	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	144	Lotus/OST-HTH 2.				DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						ACCTGTTGGCGTTATCTCCTG	0.428													8	254	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190424054	190424054	+	5'UTR	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190424054C>A	uc001gse.1	-	2					FAM5C_uc010pot.1_5'UTR	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TTCATTCTCTCAGCTTTCCCT	0.433													3	43	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198687389	198687389	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198687389C>A	uc001gur.1	+	14	1791	c.1611C>A	c.(1609-1611)TTC>TTA	p.F537L	PTPRC_uc001gus.1_Missense_Mutation_p.F489L|PTPRC_uc001gut.1_Missense_Mutation_p.F376L|PTPRC_uc009wzf.1_Missense_Mutation_p.F425L|PTPRC_uc010ppg.1_Missense_Mutation_p.F473L	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	537	Extracellular (Potential).|Fibronectin type-III 2.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						ATTGCGATTTCCGTGTAAAAG	0.383													13	35	---	---	---	---	PASS
PPFIA4	8497	broad.mit.edu	37	1	203032922	203032922	+	Intron	SNP	C	T	T	rs62816261	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203032922C>T	uc001gyz.2	+						PPFIA4_uc009xaj.2_Intron|PPFIA4_uc010pqf.1_Intron|PPFIA4_uc001gza.2_Intron|PPFIA4_uc001gzb.1_Intron|PPFIA4_uc001gzc.1_5'UTR	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						TACCTTCCTCCCCCATAATAG	0.552													3	69	---	---	---	---	PASS
C1orf198	84886	broad.mit.edu	37	1	230991424	230991424	+	Nonsense_Mutation	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230991424C>T	uc001hub.2	-	2	418	c.374G>A	c.(373-375)TGG>TAG	p.W125*	C1orf198_uc009xfh.1_5'UTR|C1orf198_uc001huc.1_Intron|C1orf198_uc001hud.1_Nonsense_Mutation_p.W87*	NM_032800	NP_116189	Q9H425	CA198_HUMAN	hypothetical protein LOC84886 isoform 1	125											0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				CTTTGTTTCCCAGGAGAAAGG	0.348													31	153	---	---	---	---	PASS
DNAJC27	51277	broad.mit.edu	37	2	25174378	25174378	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25174378G>T	uc002rft.1	-	6	625	c.574C>A	c.(574-576)CGC>AGC	p.R192S	DNAJC27_uc010ykn.1_Missense_Mutation_p.R121S|DNAJC27_uc002rfu.1_RNA|DNAJC27_uc010eyg.1_Intron	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	192					protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						GTGGTAGGGCGTTTCCCGCCA	0.393													10	124	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96940604	96940604	+	3'UTR	SNP	A	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96940604A>G	uc002svu.2	-	45					SNRNP200_uc002svt.2_3'UTR|SNRNP200_uc010yuj.1_RNA	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit							catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						AAGGGAAAGGAAGTGGAGGTA	0.517													9	23	---	---	---	---	PASS
MCM6	4175	broad.mit.edu	37	2	136633848	136633848	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136633848A>T	uc002tuw.2	-	1	164	c.88T>A	c.(88-90)TTC>ATC	p.F30I		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	30					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	AAGTCCAGGAACAGTTTCTGG	0.716													5	29	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198540329	198540329	+	5'UTR	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198540329G>A	uc002uuo.3	-	1						NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2							plasma membrane					0						aaaaaaaaaagcaaaaaccaa	0.234													4	7	---	---	---	---	PASS
SLC4A3	6508	broad.mit.edu	37	2	220493280	220493280	+	Missense_Mutation	SNP	C	T	T	rs150796797	byFrequency	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220493280C>T	uc002vmp.3	+	3	474	c.205C>T	c.(205-207)CGG>TGG	p.R69W	SLC4A3_uc002vmn.2_Missense_Mutation_p.R69W|SLC4A3_uc002vmo.3_Missense_Mutation_p.R69W|SLC4A3_uc010fwm.2_5'UTR	NM_005070	NP_005061	P48751	B3A3_HUMAN	solute carrier family 4, anion exchanger, member	69	Cytoplasmic.				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTACAGCGAGCGGGACTTTGA	0.657													7	14	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38622777	38622777	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38622777T>C	uc003cio.2	-	17	3067	c.2873A>G	c.(2872-2874)AAC>AGC	p.N958S	SCN5A_uc003cin.2_Missense_Mutation_p.N958S|SCN5A_uc003cil.3_Missense_Mutation_p.N958S|SCN5A_uc010hhi.2_Missense_Mutation_p.N958S|SCN5A_uc010hhk.2_Missense_Mutation_p.N958S|SCN5A_uc011ayr.1_Missense_Mutation_p.N958S|SCN5A_uc010hhj.1_Missense_Mutation_p.N569S	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	958					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	CAGCTGGAGGTTGTTCATCTC	0.597													12	12	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52685756	52685756	+	Splice_Site	SNP	A	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52685756A>G	uc003des.2	-	6	726	c.714_splice	c.e6+1	p.Q238_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.Q238_splice|PBRM1_uc003der.2_Splice_Site_p.Q238_splice|PBRM1_uc003det.2_Splice_Site_p.Q238_splice|PBRM1_uc003deu.2_Splice_Site_p.Q238_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.Q238_splice|PBRM1_uc010hmk.1_Splice_Site_p.Q238_splice|PBRM1_uc003dey.2_Splice_Site_p.Q238_splice|PBRM1_uc003dez.1_Splice_Site_p.Q238_splice|PBRM1_uc003dfb.1_Splice_Site_p.Q136_splice	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCATCTTCATACCTGTATCCT	0.378			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								41	85	---	---	---	---	PASS
POPDC2	64091	broad.mit.edu	37	3	119378938	119378938	+	Silent	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119378938G>A	uc003ecx.1	-	1	467	c.333C>T	c.(331-333)CTC>CTT	p.L111L	POPDC2_uc010hqw.1_Silent_p.L111L|POPDC2_uc003ecy.1_Intron	NM_022135	NP_071418	Q9HBU9	POPD2_HUMAN	popeye protein 2	111						integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)		GCGTCTTGTAGAGGAGGTCAA	0.572													71	86	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47538705	47538705	+	Silent	SNP	C	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47538705C>G	uc003gxk.1	+	9	1310	c.1146C>G	c.(1144-1146)GTC>GTG	p.V382V	ATP10D_uc003gxl.1_5'UTR|ATP10D_uc003gxj.3_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	382	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						CTTCTTAGGTCTTGATTCCTA	0.308													37	171	---	---	---	---	PASS
CXCL6	6372	broad.mit.edu	37	4	74702427	74702427	+	5'UTR	SNP	T	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74702427T>C	uc003hhf.2	+	1					IL8_uc011cbh.1_Intron	NM_002993	NP_002984	P80162	CXCL6_HUMAN	chemokine (C-X-C motif) ligand 6 (granulocyte						cell-cell signaling|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding				0	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TCTCCGCGCCTCCACCCAGCT	0.622													2	7	---	---	---	---	PASS
NKD2	85409	broad.mit.edu	37	5	1032288	1032288	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1032288A>C	uc003jbt.1	+	4	168	c.163A>C	c.(163-165)AAG>CAG	p.K55Q	NKD2_uc010itf.1_Missense_Mutation_p.K55Q	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	naked cuticle homolog 2	55	Targeting to the basolateral cell membrane.				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			TGGGGACCCCAAGGAGGGGCC	0.657													48	154	---	---	---	---	PASS
HSPA9	3313	broad.mit.edu	37	5	137902359	137902359	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137902359C>A	uc003ldf.2	-	9	1036	c.928G>T	c.(928-930)GAA>TAA	p.E310*	HSPA9_uc011cyw.1_Nonsense_Mutation_p.E241*	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor	310					anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCAGCAGCTTCCCGTACCCTC	0.433													100	270	---	---	---	---	PASS
ARAP3	64411	broad.mit.edu	37	5	141051674	141051674	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141051674C>A	uc003llm.2	-	10	1658	c.1580G>T	c.(1579-1581)TGT>TTT	p.C527F	ARAP3_uc011dbe.1_Missense_Mutation_p.C189F|ARAP3_uc003lln.2_Missense_Mutation_p.C449F|ARAP3_uc003llo.1_Missense_Mutation_p.C527F	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	527	Arf-GAP.|C4-type.				cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						CTCACCTGCACACTGCTTGCA	0.552													89	276	---	---	---	---	PASS
PECI	10455	broad.mit.edu	37	6	4116161	4116161	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4116161C>T	uc003mwf.2	-	10	1169	c.1132G>A	c.(1132-1134)GAT>AAT	p.D378N	C6orf201_uc003mwa.3_Intron|C6orf201_uc003mvz.3_Intron|C6orf201_uc011dhw.1_Intron|C6orf201_uc003mwb.3_Intron|PECI_uc003mwc.2_Missense_Mutation_p.D211N|PECI_uc003mwd.2_Missense_Mutation_p.D348N|PECI_uc003mwe.2_Missense_Mutation_p.D225N	NM_206836	NP_996667	O75521	ECI2_HUMAN	peroxisomal D3,D2-enoyl-CoA isomerase isoform 2	378					fatty acid metabolic process	mitochondrion|peroxisomal matrix	dodecenoyl-CoA delta-isomerase activity|fatty-acyl-CoA binding				0	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GTGCATTCATCTGATAGCCAT	0.403													10	176	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17637957	17637957	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17637957C>T	uc003ncd.1	-	16	2091	c.1891G>A	c.(1891-1893)GCA>ACA	p.A631T	NUP153_uc011dje.1_Missense_Mutation_p.A662T|NUP153_uc010jpl.1_Missense_Mutation_p.A589T	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	631					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GGGCTTGTTGCGGTGGGCTGA	0.443													5	209	---	---	---	---	PASS
HLA-DPA1	3113	broad.mit.edu	37	6	33036878	33036878	+	Silent	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33036878C>T	uc003ocs.1	-	3	577	c.546G>A	c.(544-546)CTG>CTA	p.L182L	HLA-DPA1_uc010juk.2_Silent_p.L182L|HLA-DPA1_uc003oct.1_Silent_p.L182L	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP	182	Alpha-2.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						GCACAAAGGTCAGGTAATGGA	0.567													10	382	---	---	---	---	PASS
RPS18	6222	broad.mit.edu	37	6	33243970	33243970	+	Silent	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33243970G>T	uc003odp.1	+	5	354	c.309G>T	c.(307-309)CTG>CTT	p.L103L	RPS18_uc010jum.1_RNA|RPS18_uc003odq.1_RNA|B3GALT4_uc003odr.2_5'Flank	NM_022551	NP_072045	P62269	RS18_HUMAN	ribosomal protein S18	103					endocrine pancreas development|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	rRNA binding|structural constituent of ribosome				0						CCAATGGTCTGGACAACAAGC	0.572													4	76	---	---	---	---	PASS
BYSL	705	broad.mit.edu	37	6	41889389	41889389	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41889389G>T	uc003orl.2	+	1	425	c.89G>T	c.(88-90)CGG>CTG	p.R30L	MED20_uc003orj.2_5'Flank|MED20_uc003ork.2_5'Flank|MED20_uc011duh.1_5'Flank|MED20_uc011dui.1_5'Flank|MED20_uc011duj.1_5'Flank	NM_004053	NP_004044	Q13895	BYST_HUMAN	bystin	30					cell adhesion|female pregnancy|ribosome biogenesis	cytoplasm|nucleolus					0	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000473)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AATGCGGTGCGGGCGGGGGTC	0.647											OREG0017436	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	30	---	---	---	---	PASS
SLC29A4	222962	broad.mit.edu	37	7	5330777	5330777	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5330777G>A	uc003sod.2	+	4	485	c.324G>A	c.(322-324)ATG>ATA	p.M108I	SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Missense_Mutation_p.M108I|SLC29A4_uc003soe.2_Missense_Mutation_p.M108I	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	108	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		TGTTTGACATGAGCCTCACCT	0.627													12	60	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43484071	43484071	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43484071G>T	uc003tid.1	+	11	1905	c.1300G>T	c.(1300-1302)GGA>TGA	p.G434*	HECW1_uc011kbi.1_Nonsense_Mutation_p.G434*	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	434					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GGTCTCTGTGGGACCTGAAGG	0.622													9	31	---	---	---	---	PASS
MRPS24	64951	broad.mit.edu	37	7	43906364	43906364	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43906364A>C	uc003tit.1	-	4	489	c.438T>G	c.(436-438)TTT>TTG	p.F146L		NM_032014	NP_114403	Q96EL2	RT24_HUMAN	mitochondrial ribosomal protein S24 precursor	146					translation	mitochondrial large ribosomal subunit|mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						GACATTTGTAAAAGTAGGACA	0.488													36	84	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	82996776	82996776	+	3'UTR	SNP	T	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82996776T>G	uc003uhy.1	-	17						NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TTATAACACCTTCATAGTCAT	0.224													15	52	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100686874	100686874	+	Silent	SNP	T	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100686874T>G	uc003uxp.1	+	3	12230	c.12177T>G	c.(12175-12177)TCT>TCG	p.S4059S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4059	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CAATTACTTCTCACACCATCC	0.537													53	240	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103130250	103130250	+	Silent	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103130250G>T	uc003vca.2	-	60	9862	c.9702C>A	c.(9700-9702)CTC>CTA	p.L3234L	RELN_uc010liz.2_Silent_p.L3234L	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	3234	EGF-like 8.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCCCGCTGCAGAGCTTGGGGC	0.522													11	33	---	---	---	---	PASS
WNT2	7472	broad.mit.edu	37	7	116963052	116963052	+	5'UTR	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116963052C>A	uc003viz.2	-	1					WNT2_uc003vja.2_5'UTR	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family						atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ATATTAACCCCCTTGCGTCTG	0.572													24	47	---	---	---	---	PASS
ZNF800	168850	broad.mit.edu	37	7	127014261	127014261	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127014261G>A	uc003vlx.1	-	5	1392	c.1129C>T	c.(1129-1131)CAT>TAT	p.H377Y	ZNF800_uc003vlw.1_Missense_Mutation_p.H280Y|ZNF800_uc003vly.1_Missense_Mutation_p.H377Y|ZNF800_uc010lla.2_Missense_Mutation_p.H377Y	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800	377	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATTTGCATATGTCTTTTAAGC	0.328													11	290	---	---	---	---	PASS
C7orf45	136263	broad.mit.edu	37	7	129847772	129847772	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129847772T>G	uc003vpp.2	+	1	69	c.22T>G	c.(22-24)TTT>GTT	p.F8V	TMEM209_uc003vpn.2_5'Flank|TMEM209_uc010lmc.1_5'Flank|TMEM209_uc003vpo.2_5'Flank	NM_145268	NP_660311	Q8WWF3	CG045_HUMAN	hypothetical protein LOC136263	8						integral to membrane					0	Melanoma(18;0.0435)					TTTTTCCTTATTTTGGGAGGT	0.423													70	236	---	---	---	---	PASS
AP3M2	10947	broad.mit.edu	37	8	42015561	42015561	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42015561G>A	uc003xop.2	+	4	667	c.376G>A	c.(376-378)GAG>AAG	p.E126K	AP3M2_uc003xoo.2_Missense_Mutation_p.E126K|AP3M2_uc010lxe.2_RNA|AP3M2_uc003xoq.1_Missense_Mutation_p.E11K|AP3M2_uc003xor.1_Missense_Mutation_p.E126K	NM_001134296	NP_001127768	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	126					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus					0	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			ATTGGCTACCGAGTCGAACAT	0.433													38	118	---	---	---	---	PASS
SMU1	55234	broad.mit.edu	37	9	33076657	33076657	+	5'UTR	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33076657G>A	uc003zsf.1	-	1					SMU1_uc010mjo.1_5'UTR|SMU1_uc010mjp.1_5'UTR|SMU1_uc011lnu.1_5'UTR	NM_018225	NP_060695	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog							cytoplasm|nucleus				ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		GGCCAGTCGCGCAACACACCA	0.607													4	78	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77417087	77417087	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77417087T>A	uc004ajl.1	-	16	1974	c.1736A>T	c.(1735-1737)AAG>ATG	p.K579M	TRPM6_uc004ajk.1_Missense_Mutation_p.K574M|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Translation_Start_Site	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	579	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GACTATAGACTTTTCCTGTTG	0.343													15	59	---	---	---	---	PASS
PSAT1	29968	broad.mit.edu	37	9	80923397	80923397	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80923397G>A	uc004ala.2	+	6	706	c.638G>A	c.(637-639)CGT>CAT	p.R213H	PSAT1_uc004alb.2_Missense_Mutation_p.R213H	NM_058179	NP_478059	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1 isoform 1	213					L-serine biosynthetic process|pyridoxine biosynthetic process		O-phospho-L-serine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)	GTGATTGTCCGTGATGACCTG	0.522													37	110	---	---	---	---	PASS
FAM73B	84895	broad.mit.edu	37	9	131804663	131804663	+	Silent	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131804663C>T	uc004bxa.2	+	3	363	c.177C>T	c.(175-177)GCC>GCT	p.A59A	FAM73B_uc004bwy.2_RNA|FAM73B_uc004bwz.2_RNA|FAM73B_uc011mbn.1_Silent_p.A59A	NM_032809	NP_116198	Q7L4E1	FA73B_HUMAN	hypothetical protein LOC84895	59	Helical; (Potential).					integral to membrane				skin(1)	1						TGGCCCTGGCCCTGGCTGCCC	0.657													15	35	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139417569	139417569	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139417569C>A	uc004chz.2	-	4	475	c.475G>T	c.(475-477)GAG>TAG	p.E159*		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	159	Extracellular (Potential).|EGF-like 4.				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TAGGAGGCCTCGAAGGGCAGG	0.672			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			2	0	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73375289	73375289	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73375289C>A	uc001jrx.3	+	10	1238	c.861C>A	c.(859-861)GAC>GAA	p.D287E	CDH23_uc001jrw.3_Missense_Mutation_p.D287E|CDH23_uc009xql.2_Missense_Mutation_p.D332E	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	287	Cadherin 3.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TTGCCCTGGACTACATCAGCG	0.607													3	62	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5968684	5968684	+	Silent	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5968684C>T	uc010qzt.1	+	1	108	c.108C>T	c.(106-108)AGC>AGT	p.S36S		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCCCCTCAGCCTCCTTTTCC	0.587													7	150	---	---	---	---	PASS
PYROXD1	79912	broad.mit.edu	37	12	21623298	21623298	+	3'UTR	SNP	A	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21623298A>T	uc001rew.2	+	12					RECQL_uc001rex.2_Intron|RECQL_uc001rey.2_Intron|PYROXD1_uc009ziq.2_3'UTR|PYROXD1_uc009zir.2_3'UTR	NM_024854	NP_079130	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			ovary(1)	1						AAAAAAAAAAAAACAAAGCAA	0.318													3	12	---	---	---	---	PASS
ITGA5	3678	broad.mit.edu	37	12	54798566	54798566	+	Silent	SNP	C	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54798566C>G	uc001sga.2	-	13	1406	c.1338G>C	c.(1336-1338)CTG>CTC	p.L446L	ITGA5_uc010sow.1_RNA	NM_002205	NP_002196	P08648	ITA5_HUMAN	integrin alpha 5 precursor	446	Extracellular (Potential).|FG-GAP 7.				angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			ovary(2)	2						TGGCTGCCCACAGGGGCTGCA	0.627											OREG0021554	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	81	---	---	---	---	PASS
MBD6	114785	broad.mit.edu	37	12	57920770	57920770	+	Silent	SNP	T	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57920770T>G	uc001soj.1	+	7	2066	c.1842T>G	c.(1840-1842)CCT>CCG	p.P614P	MBD6_uc001sok.1_Silent_p.P481P|MBD6_uc001sol.1_RNA	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	614	Pro-rich.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						TTCCACCTCCTTCAGCACCTC	0.642													64	192	---	---	---	---	PASS
GEFT	115557	broad.mit.edu	37	12	58010243	58010243	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58010243G>T	uc001spb.2	+	14	2057	c.1597G>T	c.(1597-1599)GAG>TAG	p.E533*	GEFT_uc009zpy.2_Nonsense_Mutation_p.E572*|GEFT_uc001spa.2_Nonsense_Mutation_p.E427*|uc001spc.2_Intron|GEFT_uc001spd.2_Nonsense_Mutation_p.E238*	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1	533					regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					ACCCAAAGGGGAGGTGGCCAG	0.562													18	54	---	---	---	---	PASS
DDX54	79039	broad.mit.edu	37	12	113603652	113603652	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113603652C>A	uc001tup.2	-	13	1628	c.1600G>T	c.(1600-1602)GCC>TCC	p.A534S	DDX54_uc001tuq.3_Missense_Mutation_p.A534S	NM_024072	NP_076977	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	534					estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity			skin(2)|central_nervous_system(1)	3						ATCTCCTTGGCCCTCTTGATG	0.667													7	85	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120196473	120196473	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120196473G>A	uc001txi.1	-	20	2380	c.2327C>T	c.(2326-2328)TCC>TTC	p.S776F	CIT_uc001txh.1_Missense_Mutation_p.S310F|CIT_uc001txj.1_Missense_Mutation_p.S818F	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	776	Potential.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CTGTTCCAGGGATCTGATCTT	0.448													68	233	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124420000	124420000	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124420000G>C	uc001uft.3	+	78	13413	c.13388G>C	c.(13387-13389)GGA>GCA	p.G4463A	DNAH10_uc001ufu.3_Missense_Mutation_p.G376A	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4463					microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTGCTGCAAGGAGTATGCCTC	0.493													63	204	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132445443	132445443	+	Silent	SNP	A	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132445443A>C	uc001ujn.2	+	1	314	c.279A>C	c.(277-279)CCA>CCC	p.P93P	EP400_uc001ujl.2_Silent_p.P93P|EP400_uc001ujm.2_Silent_p.P93P|EP400_uc001ujj.1_Silent_p.P93P|EP400_uc001ujk.2_Silent_p.P93P	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	93					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CACTGGCCCCACTGCCGCTCC	0.622													10	53	---	---	---	---	PASS
PSMB5	5693	broad.mit.edu	37	14	23502782	23502782	+	Silent	SNP	C	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23502782C>G	uc001wii.2	-	2	564	c.300G>C	c.(298-300)CTG>CTC	p.L100L	PSMB5_uc001wij.2_Silent_p.L100L|PSMB5_uc010tni.1_5'UTR	NM_002797	NP_002788	P28074	PSB5_HUMAN	proteasome beta 5 subunit isoform 1	100					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus	protein binding|threonine-type endopeptidase activity			ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)	TGGTGCCTAGCAGGTATGGGT	0.552													3	80	---	---	---	---	PASS
C14orf1	11161	broad.mit.edu	37	14	76117875	76117875	+	3'UTR	SNP	T	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76117875T>G	uc001xrt.2	-	5					C14orf1_uc001xru.2_RNA	NM_007176	NP_009107	Q9UKR5	ERG28_HUMAN	ergosterol biosynthetic protein 28						sterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|transport vesicle					0		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)		AACGAGAAAGTCCTGGAGGTG	0.458													41	132	---	---	---	---	PASS
GOLGA5	9950	broad.mit.edu	37	14	93301996	93301996	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93301996A>G	uc001yaz.1	+	11	2220	c.2038A>G	c.(2038-2040)ATT>GTT	p.I680V	GOLGA5_uc001yba.1_Missense_Mutation_p.I77V	NM_005113	NP_005104	Q8TBA6	GOGA5_HUMAN	Golgi autoantigen, golgin subfamily a, 5	680	Cytoplasmic (Potential).				Golgi organization	cis-Golgi network|integral to membrane	ATP binding|protein homodimerization activity|protein tyrosine kinase activity|Rab GTPase binding			ovary(2)|lung(1)	3		all_cancers(154;0.0934)		COAD - Colon adenocarcinoma(157;0.222)		TGCTAGTTCAATTGATCAGTT	0.423			T	RET	papillary thyroid								23	44	---	---	---	---	PASS
DLL4	54567	broad.mit.edu	37	15	41222315	41222315	+	Splice_Site	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41222315G>T	uc001zng.1	+	2	656	c.336_splice	c.e2+1	p.P112_splice		NM_019074	NP_061947	Q9NR61	DLL4_HUMAN	delta-like 4 protein precursor						blood circulation|cell communication|cell differentiation|Notch receptor processing|Notch signaling pathway	integral to membrane|plasma membrane	calcium ion binding|Notch binding			breast(2)	2		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CACCTGGCCGGTGAGCACAGC	0.652											OREG0023070	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	8	---	---	---	---	PASS
CCNB2	9133	broad.mit.edu	37	15	59407028	59407028	+	Nonsense_Mutation	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59407028C>T	uc002afz.2	+	5	698	c.550C>T	c.(550-552)CAG>TAG	p.Q184*	CCNB2_uc010bge.2_Nonsense_Mutation_p.Q103*	NM_004701	NP_004692	O95067	CCNB2_HUMAN	cyclin B2	184					cell cycle checkpoint|cell division|G2/M transition of mitotic cell cycle|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus	protein kinase binding				0						TAGGCTTCTGCAGGAGACTCT	0.458													94	274	---	---	---	---	PASS
RPL4	6124	broad.mit.edu	37	15	66795006	66795006	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66795006T>A	uc002apv.2	-	4	421	c.365A>T	c.(364-366)TAC>TTC	p.Y122F	RPL4_uc010bhr.2_Missense_Mutation_p.Y28F|RPL4_uc002apw.2_Missense_Mutation_p.Y28F|RPL4_uc002apx.2_Missense_Mutation_p.Y28F|RPL4_uc010ujq.1_Missense_Mutation_p.Y122F|SNORD18C_uc010bhs.1_5'Flank|SNORD18B_uc002apy.1_5'Flank|ZWILCH_uc010bhu.1_5'Flank|ZWILCH_uc002aqb.2_5'Flank|ZWILCH_uc002aqa.2_5'Flank|ZWILCH_uc010bhv.2_5'Flank	NM_000968	NP_000959	P36578	RL4_HUMAN	ribosomal protein L4	122					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						ACAGATGGCGTATCGTTTTTG	0.428													46	147	---	---	---	---	PASS
GOLGA6A	342096	broad.mit.edu	37	15	74365099	74365099	+	Silent	SNP	C	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74365099C>A	uc002axa.1	-	13	1526	c.1485G>T	c.(1483-1485)GTG>GTT	p.V495V		NM_001038640	NP_001033729	Q9NYA3	GOG6A_HUMAN	golgi autoantigen, golgin subfamily a, 6	495	Potential.										0						CAGGGAGAGCCACGAGGCTTA	0.582													9	88	---	---	---	---	PASS
KLHL25	64410	broad.mit.edu	37	15	86312287	86312287	+	Missense_Mutation	SNP	C	T	T	rs142937016		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86312287C>T	uc002bly.2	-	2	958	c.755G>A	c.(754-756)AGC>AAC	p.S252N		NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein	252						cytoplasm				ovary(2)	2						GAGGGCCTCGCTGGAGACGGC	0.647													13	32	---	---	---	---	PASS
CRYM	1428	broad.mit.edu	37	16	21272606	21272606	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21272606G>T	uc002dik.2	-	7	934	c.849C>A	c.(847-849)CAC>CAA	p.H283Q	CRYM_uc010bwq.1_RNA|CRYM_uc002dil.2_Missense_Mutation_p.H241Q|CRYM_uc002dim.2_Missense_Mutation_p.H283Q	NM_001888	NP_001879	Q14894	CRYM_HUMAN	crystallin, mu isoform 1	283					negative regulation of transcription from RNA polymerase II promoter|sensory perception of sound|thyroid hormone transport	cytoplasm|nucleus|plasma membrane	NADP binding|protein homodimerization activity|thyroid hormone binding|transcription corepressor activity				0				GBM - Glioblastoma multiforme(48;0.0573)	Levothyroxine(DB00451)	TCTTCTCACAGTGGGCTGGTT	0.507													24	83	---	---	---	---	PASS
LCMT1	51451	broad.mit.edu	37	16	25189485	25189485	+	3'UTR	SNP	C	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25189485C>T	uc002dnx.1	+	11					LCMT1_uc002dny.1_3'UTR|LCMT1_uc002dnz.1_3'UTR|LCMT1_uc002doa.1_3'UTR	NM_016309	NP_057393	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1 isoform a								protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	CTACAGTGGTCGCACATGTTC	0.577													8	15	---	---	---	---	PASS
CES1	1066	broad.mit.edu	37	16	55846863	55846863	+	Silent	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55846863G>A	uc002eim.2	-	9	1143	c.1035C>T	c.(1033-1035)CCC>CCT	p.P345P	CES1_uc010ccf.2_Silent_p.P20P|CES1_uc002eil.2_Silent_p.P346P|CES1_uc002ein.2_Silent_p.P345P	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	345					response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	CGACCATGTAGGGGACAGTGT	0.522													7	171	---	---	---	---	PASS
USP22	23326	broad.mit.edu	37	17	20931913	20931913	+	Silent	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20931913G>A	uc002gym.3	-	2	450	c.246C>T	c.(244-246)TTC>TTT	p.F82F	USP22_uc002gyn.3_Silent_p.F70F|USP22_uc002gyl.3_5'UTR	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	82	UBP-type.				cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						TGAAACAGCCGAAGAAGACAC	0.552													42	78	---	---	---	---	PASS
FLJ36000	284124	broad.mit.edu	37	17	21904204	21904204	+	RNA	SNP	G	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21904204G>T	uc002gza.2	+	1		c.143G>T				NR_027084				Homo sapiens cDNA FLJ36000 fis, clone TESTI2015180.												0						ctgccaggacggtgttcgggt	0.000													5	53	---	---	---	---	PASS
AFG3L2	10939	broad.mit.edu	37	18	12367034	12367034	+	Nonsense_Mutation	SNP	A	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12367034A>T	uc002kqz.1	-	5	595	c.482T>A	c.(481-483)TTG>TAG	p.L161*		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	161	Helical; (Potential).				cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	CTTGAGCAGCAAGTAAAACAT	0.463													51	129	---	---	---	---	PASS
ZNF653	115950	broad.mit.edu	37	19	11596575	11596575	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11596575T>C	uc002mrz.1	-	7	1519	c.1466A>G	c.(1465-1467)AAT>AGT	p.N489S		NM_138783	NP_620138	Q96CK0	ZN653_HUMAN	zinc finger protein 653	489	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATGCACAAGATTGACGTGGTT	0.562													37	121	---	---	---	---	PASS
LPHN1	22859	broad.mit.edu	37	19	14288449	14288449	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14288449T>G	uc010xnn.1	-	3	474	c.178A>C	c.(178-180)AAT>CAT	p.N60H	LPHN1_uc010xno.1_Missense_Mutation_p.N60H	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	60	SUEL-type lectin.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						TAGTTGGCATTCTCCACCATG	0.632													6	182	---	---	---	---	PASS
TTYH1	57348	broad.mit.edu	37	19	54942314	54942314	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54942314C>G	uc002qfq.2	+	10	1162	c.1070C>G	c.(1069-1071)ACA>AGA	p.T357R	TTYH1_uc010yey.1_Missense_Mutation_p.D387E|TTYH1_uc002qfr.2_Missense_Mutation_p.T357R|TTYH1_uc002qft.2_Missense_Mutation_p.T357R|TTYH1_uc002qfu.1_Missense_Mutation_p.T269R	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1	357	Extracellular (Potential).				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CTGAATGTGACAGAAGGAAAT	0.527													20	75	---	---	---	---	PASS
SLC37A1	54020	broad.mit.edu	37	21	43967224	43967224	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43967224G>A	uc002zbi.2	+	10	1154	c.742G>A	c.(742-744)GTC>ATC	p.V248I	SLC37A1_uc002zbj.2_Missense_Mutation_p.V248I	NM_018964	NP_061837	P57057	GLPT_HUMAN	solute carrier family 37 member 1	248					carbohydrate transport|transmembrane transport	integral to membrane					0						TCCGAACGACGTCAGGTGCTC	0.557													11	209	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6510	6510	+	5'UTR	SNP	G	A	A			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6510G>A	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		TCCCAGTCCTAGCTGCTGGCA	0.507													3	41	---	---	---	---	PASS
NECAP2	55707	broad.mit.edu	37	1	16782519	16782520	+	Intron	INS	-	T	T	rs139186833		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16782519_16782520insT	uc001ayo.2	+						NECAP2_uc001ayp.3_Intron|NECAP2_uc010ocd.1_Intron|NECAP2_uc001ayq.2_Intron	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		Gttttcttttcttttttttttt	0.218													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38733363	38733364	+	IGR	INS	-	CCTTCCTCCTT	CCTTCCTCCTT	rs142813208	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38733363_38733364insCCTTCCTCCTT								POU3F1 (220913 upstream) : RRAGC (571651 downstream)																							tttcctccctcctctctcttcc	0.000													4	2	---	---	---	---	
NBPF7	343505	broad.mit.edu	37	1	120379730	120379731	+	Intron	INS	-	A	A	rs142246355	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120379730_120379731insA	uc010oxk.1	-							NM_001047980	NP_001041445	P0C2Y1	NBPF7_HUMAN	hypothetical protein LOC343505							cytoplasm				ovary(1)|skin(1)	2	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)		gactccatctcaaaaaagaaaa	0.124													4	3	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151214277	151214277	+	Intron	DEL	A	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151214277delA	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron|PIP5K1A_uc010pcv.1_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			actccatctcaaaaaaaaaaa	0.184													6	3	---	---	---	---	
TBX19	9095	broad.mit.edu	37	1	168262597	168262598	+	Intron	INS	-	G	G	rs145449033	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168262597_168262598insG	uc001gfl.2	+						TBX19_uc001gfj.3_Intron	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					GCAGGATGGGCGGGGGGGGTCC	0.396													6	4	---	---	---	---	
ZBTB41	360023	broad.mit.edu	37	1	197141236	197141237	+	Intron	DEL	TA	-	-	rs10572836		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197141236_197141237delTA	uc001gtx.1	-						ZBTB41_uc009wyz.1_Intron	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						CTGATTACACTATATATATCTC	0.267													6	4	---	---	---	---	
KDM5B	10765	broad.mit.edu	37	1	202697912	202697913	+	3'UTR	DEL	AC	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202697912_202697913delAC	uc001gyf.2	-	27					KDM5B_uc009xag.2_3'UTR	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B						negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						TGCAAAAAAAACAGTCAGCTTT	0.342													2	4	---	---	---	---	
TRIM17	51127	broad.mit.edu	37	1	228601762	228601762	+	Intron	DEL	A	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228601762delA	uc001hsu.2	-						TRIM17_uc001hsv.2_Intron|TRIM17_uc001hsw.2_Intron|TRIM17_uc009xfb.2_Intron	NM_016102	NP_057186	Q9Y577	TRI17_HUMAN	tripartite motif-containing 17 isoform 1						protein autoubiquitination	intracellular	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Prostate(94;0.0724)				ttttgagctgaaggcacttaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	237199267	237199270	+	IGR	DEL	TTCC	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237199267_237199270delTTCC								MTR (131987 upstream) : RYR2 (6432 downstream)																							ccttccctctttccttccttcctt	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4499740	4499741	+	IGR	INS	-	TCC	TCC	rs150102282	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4499740_4499741insTCC								ALLC (749482 upstream) : None (None downstream)																							Gttcttcttcttcctcctcctc	0.104													2	4	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37260027	37260028	+	Intron	INS	-	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37260027_37260028insT	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				Gttttgttttgttttttttttt	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64893259	64893259	+	IGR	DEL	A	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64893259delA								SERTAD2 (12213 upstream) : SLC1A4 (322320 downstream)																							AACTTAAAATAAAAAAAAAAA	0.269													4	2	---	---	---	---	
C2orf65	130951	broad.mit.edu	37	2	74867591	74867591	+	Intron	DEL	T	-	-	rs78940725		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74867591delT	uc002smy.2	-						C2orf65_uc010ysa.1_Intron|C2orf65_uc002smz.2_Intron	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951						chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						GGCCATCCTAttttttttttt	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133018713	133018714	+	IGR	DEL	GG	-	-	rs144729406		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018713_133018714delGG								NCRNA00164 (3171 upstream) : GPR39 (155433 downstream)																							TGGGCGGGGTGGTGGGGGGTGC	0.530													4	3	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10089935	10089936	+	Intron	DEL	TC	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10089935_10089936delTC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GCTCTAAAATTCTCTGTCTGAA	0.322			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	3	---	---	---	---	
DNAJC13	23317	broad.mit.edu	37	3	132169389	132169392	+	Intron	DEL	AGTT	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132169389_132169392delAGTT	uc003eor.2	+						DNAJC13_uc010htq.1_Intron	NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						TTACGATGACAGTTAGATTTTTGG	0.260													5	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13234639	13234642	+	IGR	DEL	AAGA	-	-	rs147074597	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13234639_13234642delAAGA								None (None upstream) : HSP90AB2P (100395 downstream)																							ggaaggaaggaagaaagaaagaaa	0.000													5	3	---	---	---	---	
SLC34A2	10568	broad.mit.edu	37	4	25664605	25664605	+	Intron	DEL	T	-	-	rs34583336		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25664605delT	uc003grr.2	+						SLC34A2_uc003grs.2_Intron|SLC34A2_uc010iev.2_Intron	NM_006424	NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (sodium phosphate),						cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			skin(3)|ovary(1)|kidney(1)	5		Breast(46;0.0503)				CCCTCTCATCttttttttttt	0.269													4	2	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37349361	37349361	+	Intron	DEL	A	-	-	rs74712044		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37349361delA	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAAGTAAGACAAAAAAAAAAA	0.279													5	3	---	---	---	---	
SPINK13	153218	broad.mit.edu	37	5	147649399	147649399	+	Intron	DEL	A	-	-	rs71764680		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147649399delA	uc003lpc.2	+						uc003lpb.1_Intron|SPINK13_uc010jgt.2_Intron	NM_001040129	NP_001035218	Q1W4C9	ISK13_HUMAN	serine PI Kazal type 5-like 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0						TTTTTGGCAGAAAAAAAAAAG	0.393													4	2	---	---	---	---	
ZFAND3	60685	broad.mit.edu	37	6	38120404	38120404	+	3'UTR	DEL	T	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38120404delT	uc003onx.2	+	6						NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1						ATGAAGAATATTTTTTTTTTG	0.378													4	2	---	---	---	---	
ME1	4199	broad.mit.edu	37	6	84056639	84056642	+	Intron	DEL	TCCT	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84056639_84056642delTCCT	uc003pjy.2	-						ME1_uc011dzb.1_Intron|ME1_uc011dzc.1_Intron	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1						carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)	TTTGTCTTTCtccttccttccttc	0.162													4	2	---	---	---	---	
IPCEF1	26034	broad.mit.edu	37	6	154568824	154568824	+	Intron	DEL	A	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154568824delA	uc003qpx.2	-						IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368	Q8WWN9	ICEF1_HUMAN	phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0						GCTGAACCTGAAAAAAAAAAA	0.403													5	3	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14797101	14797102	+	Intron	DEL	AT	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14797101_14797102delAT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron|DGKB_uc011jxv.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	TATGGTGTGCATatatatatat	0.144													4	3	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	33977125	33977126	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33977125_33977126insGTGTGTGTGT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						GGAGAAGTAGGgtgtgtgtgtg	0.391													6	5	---	---	---	---	
MRPL13	28998	broad.mit.edu	37	8	121426426	121426427	+	Intron	DEL	GT	-	-	rs139055716		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121426426_121426427delGT	uc003ypa.2	-						MRPL13_uc010mdf.2_Intron	NM_014078	NP_054797	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13						translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome			central_nervous_system(1)	1	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TACTTCATAAGTGTTAAAAAAA	0.208													2	5	---	---	---	---	
JAK2	3717	broad.mit.edu	37	9	5080889	5080892	+	Intron	DEL	TTTC	-	-	rs146550411	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080889_5080892delTTTC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		AAAAAGACCttttctttttttttt	0.142		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				4	4	---	---	---	---	
TRUB2	26995	broad.mit.edu	37	9	131075834	131075834	+	Intron	DEL	G	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131075834delG	uc004buq.1	-							NM_015679	NP_056494	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase homolog 2						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(1)	1						aaaaaaaaaagaaaagaaaaG	0.209													3	3	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75803109	75803110	+	Intron	INS	-	T	T	rs145684984		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75803109_75803110insT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					TGACATAATAAttttttttttt	0.099													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	91738926	91738926	+	IGR	DEL	A	-	-	rs76395084		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91738926delA								KIF20B (204226 upstream) : HTR7 (761652 downstream)																							TTTCTAGTGGAAAAAAAAAAA	0.353													7	4	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116228179	116228180	+	Intron	INS	-	T	T	rs111922820	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116228179_116228180insT	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc010qsf.1_Intron|ABLIM1_uc009xyn.2_Intron|ABLIM1_uc010qsj.1_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		gactacaggcgccgccaccacc	0.000													4	2	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	Intron	INS	-	T	T	rs11432678		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14101781_14101782insT	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		TAttttttttcttttttttttt	0.163													3	3	---	---	---	---	
MTCH2	23788	broad.mit.edu	37	11	47660119	47660119	+	Intron	DEL	G	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47660119delG	uc010rho.1	-						MTCH2_uc001nge.2_Intron|MTCH2_uc010rhp.1_Intron	NM_014342	NP_055157	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2						transport	integral to membrane|mitochondrial inner membrane					0						aaaaaaaaaagaaaGTGTTTT	0.154													6	3	---	---	---	---	
CD3G	917	broad.mit.edu	37	11	118221617	118221619	+	Intron	DEL	AAC	-	-	rs1963459	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118221617_118221619delAAC	uc001psu.2	+						CD3G_uc009zaa.1_Intron	NM_000073	NP_000064	P09693	CD3G_HUMAN	CD3G antigen, gamma polypeptide precursor						establishment or maintenance of cell polarity|protein complex assembly|protein transport|regulation of apoptosis|T cell activation|T cell costimulation|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	protein heterodimerization activity|receptor signaling complex scaffold activity|T cell receptor binding|transmembrane receptor activity				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		AAAAAAAAAAAACAAAAAcaggc	0.207													4	2	---	---	---	---	
APOBEC1	339	broad.mit.edu	37	12	7806968	7806969	+	Intron	INS	-	T	T	rs148121076		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7806968_7806969insT	uc001qtb.2	-						APOBEC1_uc001qtc.2_Intron|APOBEC1_uc010sgf.1_Intron	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme						cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						TCCACAGTTCCttttttttttt	0.069													3	3	---	---	---	---	
PIP4K2C	79837	broad.mit.edu	37	12	57989486	57989486	+	Intron	DEL	A	-	-	rs72197760		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57989486delA	uc001sou.2	+						PIP4K2C_uc001sot.2_Intron|PIP4K2C_uc010srs.1_Intron|PIP4K2C_uc010srt.1_Intron	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type							cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					actccttgtcaaaaaaaaaaa	0.184													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110072710	110072711	+	IGR	INS	-	CAC	CAC			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072710_110072711insCAC								MVK (37640 upstream) : C12orf34 (79479 downstream)																							atcactaccatcaccaccatca	0.000													4	3	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123107165	123107166	+	Intron	INS	-	A	A	rs55699999		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123107165_123107166insA	uc001ucv.2	+						KNTC1_uc010taf.1_Intron|GPR81_uc001ucw.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GTAAGTTAATTAAAAAAAAAAA	0.208													7	4	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33752160	33752161	+	Intron	INS	-	A	A	rs139657005	by1000genomes	TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33752160_33752161insA	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		aggaaggaaggaaggaaggaag	0.109													4	2	---	---	---	---	
UBAC2	337867	broad.mit.edu	37	13	99890428	99890431	+	Intron	DEL	GTAA	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99890428_99890431delGTAA	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGTTCTGGCTGTAAACTTGGTCTC	0.431													6	3	---	---	---	---	
METT11D1	64745	broad.mit.edu	37	14	21462442	21462443	+	Intron	INS	-	T	T			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21462442_21462443insT	uc001vyn.2	+						METT11D1_uc001vym.2_Intron|METT11D1_uc001vyo.2_Intron|METT11D1_uc001vyp.2_Intron|METT11D1_uc001vyq.2_Intron	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	methyltransferase 11 domain containing 1 isoform						translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity				0	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TCTCCCTGCCCTTttttttttt	0.233													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20263577	20263578	+	IGR	INS	-	A	A	rs58110116		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20263577_20263578insA								None (None upstream) : GOLGA6L6 (473516 downstream)																							aggaaggaaggaggaaggaagg	0.000													4	2	---	---	---	---	
NEO1	4756	broad.mit.edu	37	15	73570283	73570286	+	Intron	DEL	AGAA	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73570283_73570286delAGAA	uc002avm.3	+						NEO1_uc010ukx.1_Intron|NEO1_uc010uky.1_Intron|NEO1_uc010ukz.1_Intron|NEO1_uc002avn.3_Intron	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						CTCATTACATAGAAAGCTATACCT	0.397													4	3	---	---	---	---	
OTOA	146183	broad.mit.edu	37	16	21725621	21725622	+	Intron	INS	-	CTTCCTTC	CTTCCTTC	rs34598445		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21725621_21725622insCTTCCTTC	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron|OTOA_uc002dji.2_Intron|OTOA_uc010vbk.1_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		tcttttcctttcttccttcctt	0.000													3	3	---	---	---	---	
C17orf48	56985	broad.mit.edu	37	17	10609586	10609587	+	Intron	DEL	AT	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10609586_10609587delAT	uc002gmt.2	+						C17orf48_uc002gmu.2_Intron|C17orf48_uc002gmv.2_Intron|C17orf48_uc010vvg.1_Intron	NM_020233	NP_064618	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol pyrophosphatase								ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0						ATGCAGTGTGATATATATATAT	0.337													9	4	---	---	---	---	
SRCIN1	80725	broad.mit.edu	37	17	36696976	36696977	+	Intron	DEL	GT	-	-	rs67872749		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36696976_36696977delGT	uc002hqd.2	-							NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						GCTGGCAGGGgtgtgtgtgtgt	0.465													4	2	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80878412	80878413	+	Intron	INS	-	TT	TT	rs34134407		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80878412_80878413insTT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kgb.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TGCGTCTATCCTTTTTTTTTTT	0.441													5	3	---	---	---	---	
TSPAN16	26526	broad.mit.edu	37	19	11422999	11422999	+	Intron	DEL	A	-	-	rs149530459		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11422999delA	uc002mqv.1	+						TSPAN16_uc002mqu.1_Intron|uc002mqw.1_Intron	NM_012466	NP_036598	Q9UKR8	TSN16_HUMAN	transmembrane 4 superfamily member 16							integral to membrane				skin(1)	1						gaacaaaactaaaaaaaAAAA	0.090													6	5	---	---	---	---	
ZNF98	148198	broad.mit.edu	37	19	22583761	22583761	+	Intron	DEL	C	-	-	rs2957849		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22583761delC	uc002nqt.2	-							NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				tctcaaaaaacaaaacaaaac	0.000													6	4	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56755967	56755971	+	Intron	DEL	CAAGG	-	-	rs57532903		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56755967_56755971delCAAGG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttgttgtcacaagggggaggacag	0.117													6	3	---	---	---	---	
ZCCHC3	85364	broad.mit.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	-	-	rs5839847		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:278688_278690delCGG	uc002wdf.2	+	1	485_487	c.461_463delCGG	c.(460-465)CCGGCG>CCG	p.A158del	ZCCHC3_uc002wdg.2_Intron	NM_033089	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	158	Poly-Ala.						nucleic acid binding|zinc ion binding				0		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.635													2	4	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47870567	47870567	+	Intron	DEL	T	-	-	rs11353174		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47870567delT	uc002xui.2	-							NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ttcttttttcttttttttttt	0.194													5	6	---	---	---	---	
WRB	7485	broad.mit.edu	37	21	40768626	40768631	+	Intron	DEL	AAAAAG	-	-	rs61440258		TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40768626_40768631delAAAAAG	uc002yxs.2	+						WRB_uc002yxt.3_Intron|WRB_uc010goj.2_Intron	NM_004627	NP_004618	O00258	WRB_HUMAN	tryptophan rich basic protein isoform 1							integral to membrane|nucleolus					0		Prostate(19;1.2e-06)				aaaaaaaaaaaaaaagaaaGTGACAA	0.180													4	2	---	---	---	---	
SEPT5	5413	broad.mit.edu	37	22	19711569	19711570	+	3'UTR	DEL	CG	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19711569_19711570delCG	uc002zpv.1	+	12					SEPT5_uc002zpx.1_RNA|SEPT5_uc002zpy.1_Frame_Shift_Del_p.T68fs|SEPT5_uc002zpz.1_Frame_Shift_Del_p.T68fs	NM_002688	NP_002679	Q99719	SEPT5_HUMAN	septin 5						cell cycle|cytokinesis|regulation of exocytosis|synaptic vesicle targeting	plasma membrane|septin complex|synaptic vesicle	GTP binding|GTPase activity|protein binding|structural molecule activity			lung(1)	1	Colorectal(54;0.0993)					AACAACCTGACGGCGCTGCCGC	0.748													4	2	---	---	---	---	
KDM5C	8242	broad.mit.edu	37	X	53240782	53240782	+	Frame_Shift_Del	DEL	T	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53240782delT	uc004drz.2	-	10	1831	c.1298delA	c.(1297-1299)GAGfs	p.E433fs	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Frame_Shift_Del_p.E366fs|KDM5C_uc004dsa.2_Frame_Shift_Del_p.E432fs	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	433					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						CACATCTTCCTCAATGCTATT	0.512			N|F|S		clear cell renal carcinoma								27	32	---	---	---	---	
PAK3	5063	broad.mit.edu	37	X	110459554	110459554	+	Intron	DEL	A	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110459554delA	uc004epa.2	+						PAK3_uc010npt.1_Intron|PAK3_uc010npu.1_Intron|PAK3_uc004eoy.1_Intron|PAK3_uc004eoz.2_Intron|PAK3_uc011mst.1_Intron|PAK3_uc010npv.1_Intron|PAK3_uc010npw.1_Intron	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d						multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						TAAGACCCAGAATGTAAACCA	0.269										TSP Lung(19;0.15)			41	56	---	---	---	---	
CT45A4	441520	broad.mit.edu	37	X	134932623	134932623	+	Intron	DEL	A	-	-			TCGA-A3-3323-01A-01D-0966-08	TCGA-A3-3323-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134932623delA	uc004ezd.2	-							NM_001017436	NP_001017436	Q8N7B7	CT454_HUMAN	cancer/testis antigen family 45, member A4												0						ACAAGaaattaaaaaaaaaaa	0.119													5	3	---	---	---	---	
