Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16946437	16946437	+	RNA	SNP	C	T	T	rs2262202		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946437C>T	uc010ocf.1	-	3		c.461G>A			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						AGCCTTCCGCCGGGCCAGCAG	0.672													4	12	---	---	---	---	PASS
IPO13	9670	broad.mit.edu	37	1	44433044	44433044	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44433044G>T	uc001ckx.2	+	19	3466	c.2671G>T	c.(2671-2673)GCC>TCC	p.A891S	IPO13_uc001cky.2_Missense_Mutation_p.A109S	NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	891					protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TATCCTGTTCGCCCTGAACAA	0.622													4	7	---	---	---	---	PASS
MOBKL2C	148932	broad.mit.edu	37	1	47075867	47075867	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47075867A>T	uc001cqf.3	-	3	659	c.428T>A	c.(427-429)TTC>TAC	p.F143Y	MKNK1_uc010omf.1_Intron|MOBKL2C_uc001cqe.3_Missense_Mutation_p.F195Y	NM_201403	NP_958805	Q70IA8	MOL2C_HUMAN	MOB1, Mps One Binder kinase activator-like 2C	143							metal ion binding			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					GTTCTTAGGGAAGGGAACTCC	0.552													12	31	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76255936	76255936	+	Intron	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76255936G>T	uc001dgy.1	+						RABGGTB_uc009wbt.1_RNA|RABGGTB_uc001dha.1_Intron	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						CACTGGAACAGAGGGGGCCAG	0.423													5	10	---	---	---	---	PASS
PSRC1	84722	broad.mit.edu	37	1	109825408	109825408	+	Intron	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109825408G>A	uc001dxg.2	-						PSRC1_uc001dxb.2_5'Flank|PSRC1_uc001dxc.2_Intron|PSRC1_uc001dxd.2_Intron|PSRC1_uc001dxe.2_Intron|PSRC1_uc001dxf.2_Intron|PSRC1_uc001dxh.2_5'UTR|PSRC1_uc001dxi.2_Intron|PSRC1_uc001dxj.2_Intron	NM_001032290	NP_001027461	Q6PGN9	PSRC1_HUMAN	proline/serine-rich coiled-coil 1 isoform c						cell division|microtubule bundle formation|mitotic metaphase plate congression|negative regulation of cell growth|positive regulation of microtubule polymerization|positive regulation of transcription, DNA-dependent|regulation of mitotic spindle organization	cytosol|midbody|spindle pole	microtubule binding				0		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0286)|Lung(183;0.0658)|COAD - Colon adenocarcinoma(174;0.112)|Epithelial(280;0.188)|all cancers(265;0.213)		CCCAAGGCTCGCAGCTAGATT	0.582													11	26	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120497758	120497758	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120497758G>A	uc001eik.2	-	13	2380	c.2124C>T	c.(2122-2124)TGC>TGT	p.C708C	NOTCH2_uc001eil.2_Silent_p.C708C|NOTCH2_uc001eim.3_Silent_p.C625C	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	708	EGF-like 18; calcium-binding (Potential).|Extracellular (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTCCCTCGGGGCATATACAGC	0.532			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				21	61	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004487	148004487	+	3'UTR	SNP	T	A	A	rs138320683	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004487T>A	uc001eqq.2	-	22					LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_3'UTR|NBPF14_uc010pac.1_3'UTR	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832							cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					TTCATTCAAATCTTCACGTGC	0.498													3	48	---	---	---	---	PASS
GATAD2B	57459	broad.mit.edu	37	1	153782691	153782691	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153782691G>A	uc001fdb.3	-	11	1988	c.1744C>T	c.(1744-1746)CCC>TCC	p.P582S		NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	582						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATAGACCGGGGAGGGATCATG	0.493													22	55	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169524449	169524449	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169524449A>G	uc001ggg.1	-	7	1234	c.1089T>C	c.(1087-1089)TAT>TAC	p.Y363Y	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	363	F5/8 type A 2.|Plastocyanin-like 3.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TTACAGGTGCATAGTCCCAAA	0.458													5	164	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201838749	201838749	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201838749G>T	uc001gwz.2	+	17	2086	c.2036G>T	c.(2035-2037)CGA>CTA	p.R679L		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	679					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						ACAGTAGTACGAAATACAAAG	0.488													5	152	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247463877	247463877	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247463877G>C	uc001ico.2	-	9	2173	c.1708C>G	c.(1708-1710)CGC>GGC	p.R570G	ZNF496_uc009xgv.2_Missense_Mutation_p.R606G|ZNF496_uc001icp.2_Missense_Mutation_p.R570G	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	570	C2H2-type 5.				positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CGCTCGTGGCGGAGGAGGTCA	0.652													6	21	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11767208	11767208	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11767208T>A	uc002rbk.1	+	25	4727	c.4427T>A	c.(4426-4428)ATG>AAG	p.M1476K	GREB1_uc002rbp.1_Missense_Mutation_p.M474K	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1476						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CACCAGTACATGGGCTTCCAC	0.582													5	33	---	---	---	---	PASS
ADCY3	109	broad.mit.edu	37	2	25050900	25050900	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25050900A>T	uc002rfs.3	-	13	2502	c.2303T>A	c.(2302-2304)CTG>CAG	p.L768Q	ADCY3_uc002rfr.3_Intron|ADCY3_uc010ykm.1_Missense_Mutation_p.L768Q	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	768	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GACCTGCACCAGCATGATGGT	0.587											OREG0014498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	32	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73680749	73680749	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73680749A>G	uc002sje.1	+	10	7209	c.7098A>G	c.(7096-7098)GAA>GAG	p.E2366E	ALMS1_uc002sjf.1_Silent_p.E2322E|ALMS1_uc002sjg.2_Silent_p.E1752E|ALMS1_uc002sjh.1_Silent_p.E1752E	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2364					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CTCTACAGGAAGCAGAGAGCA	0.418													4	41	---	---	---	---	PASS
RMND5A	64795	broad.mit.edu	37	2	87113725	87113725	+	Intron	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87113725G>A	uc002srs.3	+						uc010fgu.1_RNA			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						GGTTCATTACGGGTGCAATAT	0.333													4	132	---	---	---	---	PASS
REV1	51455	broad.mit.edu	37	2	100055089	100055089	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100055089C>G	uc002tad.2	-	6	1399	c.1187G>C	c.(1186-1188)AGG>ACG	p.R396T	REV1_uc002tac.2_Missense_Mutation_p.R396T|REV1_uc002tae.1_Missense_Mutation_p.R375T	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	396					DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						AAGTGCAGACCTGCCTGTTTT	0.343								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					15	40	---	---	---	---	PASS
CKAP2L	150468	broad.mit.edu	37	2	113509843	113509843	+	Splice_Site	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113509843C>A	uc002tie.2	-	5	1681	c.1602_splice	c.e5+1	p.G534_splice	CKAP2L_uc002tif.2_Splice_Site_p.G123_splice|CKAP2L_uc010yxp.1_Splice_Site_p.G369_splice	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like							centrosome					0						TCTTCACTTACCCCTTCGATG	0.363													109	220	---	---	---	---	PASS
SCTR	6344	broad.mit.edu	37	2	120204412	120204412	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120204412A>G	uc002tma.2	-	11	1289	c.1063T>C	c.(1063-1065)TAC>CAC	p.Y355H	SCTR_uc002tlz.2_Missense_Mutation_p.Y177H	NM_002980	NP_002971	P47872	SCTR_HUMAN	secretin receptor precursor	355	Helical; Name=6; (Potential).				digestion|excretion	integral to plasma membrane	secretin receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3					Secretin(DB00021)	AAGACGATGTAGTGGATGCCA	0.582													23	58	---	---	---	---	PASS
MGAT5	4249	broad.mit.edu	37	2	135012082	135012082	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135012082G>A	uc002ttv.1	+	1	253	c.108G>A	c.(106-108)CAG>CAA	p.Q36Q		NM_002410	NP_002401	Q09328	MGT5A_HUMAN	N-acetylglucosaminyltransferase V	36	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CCATCCAGCAGCGAACTCAGC	0.512													48	80	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160245882	160245882	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160245882C>G	uc002uao.2	-	21	3542	c.3190G>C	c.(3190-3192)GAA>CAA	p.E1064Q	BAZ2B_uc002uap.2_Missense_Mutation_p.E1028Q	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1064					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CACATGTCTTCATTAGGCTTC	0.333													171	322	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163241253	163241253	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163241253T>G	uc002uch.1	-	13	3119	c.2907A>C	c.(2905-2907)GAA>GAC	p.E969D		NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	969	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TGGGCACTGTTTCTTCAAAAT	0.438													111	157	---	---	---	---	PASS
ABCB11	8647	broad.mit.edu	37	2	169869900	169869900	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169869900T>C	uc002ueo.1	-	5	397	c.271A>G	c.(271-273)ATT>GTT	p.I91V		NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	91	ABC transmembrane type-1 1.|Extracellular (Potential).				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	TCGTAGTCAATAAAAACATCT	0.428													27	73	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219353073	219353073	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219353073G>T	uc002vie.2	-	15	1997	c.1544C>A	c.(1543-1545)CCA>CAA	p.P515Q	USP37_uc010fvs.1_Missense_Mutation_p.P515Q|USP37_uc010zkf.1_Missense_Mutation_p.P515Q|USP37_uc002vif.2_Missense_Mutation_p.P515Q|USP37_uc002vig.2_Missense_Mutation_p.P443Q	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	515					ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		AGGAGGGAGTGGTTTTTTCCT	0.323													94	184	---	---	---	---	PASS
RNF25	64320	broad.mit.edu	37	2	219532706	219532706	+	Splice_Site	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219532706T>C	uc002vit.2	-	5	376	c.288_splice	c.e5-1	p.T96_splice	RNF25_uc010fvw.2_Splice_Site	NM_022453	NP_071898	Q96BH1	RNF25_HUMAN	ring finger protein 25						positive regulation of NF-kappaB transcription factor activity	cytosol|nucleus	NF-kappaB binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTAAGATCCTGGAGGAAGAG	0.517													13	32	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228846442	228846442	+	Silent	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228846442T>C	uc002vpq.2	-	12	5141	c.5094A>G	c.(5092-5094)GAA>GAG	p.E1698E	SPHKAP_uc002vpp.2_Silent_p.E1669E|SPHKAP_uc010zlx.1_3'UTR	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1698						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ATTATCCCAGTTCCAAGAGCC	0.428													4	69	---	---	---	---	PASS
PTMA	5757	broad.mit.edu	37	2	232577877	232577877	+	3'UTR	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232577877A>G	uc002vsc.3	+	5					PTMA_uc002vsb.3_3'UTR|PTMA_uc010zmf.1_RNA|MIR1244_hsa-mir-1244-1|MI0006379_5'Flank	NM_001099285	NP_001092755	P06454	PTMA_HUMAN	prothymosin, alpha isoform 1						transcription, DNA-dependent	nucleus					0		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		AGGGTCAGCCATTTTTAATGA	0.343													8	233	---	---	---	---	PASS
UGT1A7	54577	broad.mit.edu	37	2	234591121	234591121	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234591121G>A	uc002vut.2	+	1	538	c.538G>A	c.(538-540)GGT>AGT	p.G180S	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Missense_Mutation_p.G180S	NM_019077	NP_061950	Q9HAW7	UD17_HUMAN	UDP glycosyltransferase 1 family, polypeptide A7	180					drug metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	drug binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|retinoic acid binding			ovary(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)		TCTTGAAGAAGGTGCACAGTG	0.483													72	131	---	---	---	---	PASS
ZNF621	285268	broad.mit.edu	37	3	40574189	40574189	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40574189C>A	uc003ckm.2	+	5	1144	c.928C>A	c.(928-930)CAG>AAG	p.Q310K	ZNF621_uc003ckn.2_Missense_Mutation_p.Q310K|ZNF621_uc003cko.2_Missense_Mutation_p.Q275K|ZNF621_uc011aze.1_Missense_Mutation_p.Q302K	NM_001098414	NP_001091884	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	310	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		CATTCAGCATCAGAGAGTTCA	0.428													43	34	---	---	---	---	PASS
PLXNB1	5364	broad.mit.edu	37	3	48461366	48461366	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48461366C>G	uc003csw.2	-	11	2599	c.2329G>C	c.(2329-2331)GAC>CAC	p.D777H	PLXNB1_uc003csu.2_Intron|PLXNB1_uc003csx.2_Missense_Mutation_p.D777H|PLXNB1_uc010hjx.1_Intron	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1 precursor	777	Extracellular (Potential).|Pro-rich.				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGTCTGAAGTCAGTGGGGGCA	0.657													2	1	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113128137	113128137	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113128137A>G	uc003eae.1	-	7	752	c.706T>C	c.(706-708)TTT>CTT	p.F236L		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	236	WD 1.									central_nervous_system(1)	1						CTGTAGTTAAAGTCCACATAA	0.383													22	96	---	---	---	---	PASS
LSAMP	4045	broad.mit.edu	37	3	115561356	115561356	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115561356T>C	uc003ebt.2	-	5	1219	c.719A>G	c.(718-720)GAG>GGG	p.E240G	LSAMP_uc011bis.1_Missense_Mutation_p.E240G	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	240	Ig-like C2-type 3.				cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TGCCGAGGCCTCACATTTGAG	0.532													5	160	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130452841	130452841	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130452841T>A	uc003enj.2	-	4	1582	c.1001A>T	c.(1000-1002)GAA>GTA	p.E334V		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	334					fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						AAGAAACGTTTCCTTGGCAAA	0.428													31	29	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195518235	195518235	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195518235A>G	uc011bto.1	-	2	676	c.216T>C	c.(214-216)GCT>GCC	p.A72A	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_5'Flank	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	72					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TCTGAGATGAAGCTGATATGT	0.493													7	352	---	---	---	---	PASS
TBC1D1	23216	broad.mit.edu	37	4	38023333	38023333	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38023333A>T	uc003gtb.2	+	6	1547	c.1204A>T	c.(1204-1206)ATA>TTA	p.I402L	TBC1D1_uc011byd.1_Missense_Mutation_p.I402L|TBC1D1_uc010ifd.2_Missense_Mutation_p.I149L|TBC1D1_uc011byf.1_Missense_Mutation_p.I273L	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,	402	PID.					nucleus	Rab GTPase activator activity			ovary(1)	1						CTGTGAGAGGATAGAGGGTGA	0.557													5	25	---	---	---	---	PASS
TECRL	253017	broad.mit.edu	37	4	65147225	65147225	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65147225A>G	uc003hcv.2	-	10	994	c.885T>C	c.(883-885)TTT>TTC	p.F295F	TECRL_uc010ihi.2_RNA	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	295					lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0						AAACCAGGAAAAACATCCATG	0.338													35	77	---	---	---	---	PASS
ANTXR2	118429	broad.mit.edu	37	4	80990632	80990632	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80990632A>G	uc003hlz.3	-	3	1017	c.254T>C	c.(253-255)TTT>TCT	p.F85S	ANTXR2_uc003hly.3_Missense_Mutation_p.F85S|ANTXR2_uc003hlx.1_RNA|ANTXR2_uc010ijn.2_Missense_Mutation_p.F85S	NM_001145794	NP_001139266	P58335	ANTR2_HUMAN	anthrax toxin receptor 2 isoform 2	85	Extracellular (Potential).|VWFA.					endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity			ovary(1)	1						TTGAGAAGAAAACACAATGAA	0.313									Juvenile_Hyaline_Fibromatosis				5	164	---	---	---	---	PASS
SLC10A6	345274	broad.mit.edu	37	4	87746671	87746671	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87746671A>G	uc003hqd.2	-	5	969	c.821T>C	c.(820-822)CTC>CCC	p.L274P		NM_197965	NP_932069	Q3KNW5	SOAT_HUMAN	sodium-dependent organic anion transporter	274	Helical; (Potential).					integral to membrane|plasma membrane	bile acid:sodium symporter activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		AGATAACTGGAGCATGGTGAT	0.428													4	70	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14474189	14474189	+	Silent	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14474189T>A	uc003jff.2	+	40	6072	c.6066T>A	c.(6064-6066)ATT>ATA	p.I2022I	TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Silent_p.I1671I	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	2022	DH 2.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					TCCATCAGATTTACGACTGGC	0.448													5	127	---	---	---	---	PASS
IL6ST	3572	broad.mit.edu	37	5	55237272	55237272	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55237272C>T	uc003jqq.2	-	17	2650	c.2395G>A	c.(2395-2397)GTA>ATA	p.V799I	uc003jqp.2_5'Flank|IL6ST_uc010iwb.2_Missense_Mutation_p.V738I|IL6ST_uc010iwc.2_3'UTR|IL6ST_uc010iwd.2_Missense_Mutation_p.V118I|IL6ST_uc011cqk.1_Missense_Mutation_p.V510I|IL6ST_uc003jqr.2_3'UTR	NM_002184	NP_002175	P40189	IL6RB_HUMAN	interleukin 6 signal transducer isoform 1	799	Cytoplasmic (Potential).				interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				ACATGATCTACTAATTGTAGA	0.458			O		hepatocellular ca								6	99	---	---	---	---	PASS
FAM151B	167555	broad.mit.edu	37	5	79815678	79815678	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79815678A>G	uc003kgv.1	+	4	627	c.484A>G	c.(484-486)ACG>GCG	p.T162A	FAM151B_uc010jal.1_RNA	NM_205548	NP_991111	Q6UXP7	F151B_HUMAN	hypothetical protein LOC167555	162											0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		TCCAGACGTGACGTTTTCCCT	0.373													6	217	---	---	---	---	PASS
TREML1	340205	broad.mit.edu	37	6	41117371	41117371	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41117371G>T	uc011duc.1	-	6	951	c.907C>A	c.(907-909)CCA>ACA	p.P303T	TREML1_uc003opx.2_3'UTR|TREML1_uc011dud.1_Missense_Mutation_p.P192T	NM_178174	NP_835468	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid	303	Cytoplasmic (Potential).				calcium-mediated signaling|innate immune response|platelet activation	cell surface|integral to membrane|plasma membrane|platelet alpha granule	protein binding|receptor activity			breast(1)	1	Ovarian(28;0.0418)|Colorectal(47;0.196)					TTGTTAGGTGGATTCTGGGCT	0.542													47	132	---	---	---	---	PASS
UBR2	23304	broad.mit.edu	37	6	42656003	42656003	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42656003G>A	uc011dur.1	+	45	4903	c.4903G>A	c.(4903-4905)GTG>ATG	p.V1635M	UBR2_uc011dus.1_Missense_Mutation_p.V1280M|UBR2_uc003osh.2_RNA|UBR2_uc011dut.1_Missense_Mutation_p.V223M|UBR2_uc011duu.1_Missense_Mutation_p.V27M	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	1635					cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TCTGTGCCTTGTGTGCGGATC	0.527													10	167	---	---	---	---	PASS
SLC35B2	347734	broad.mit.edu	37	6	44224429	44224429	+	Silent	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44224429C>T	uc003oxd.2	-	2	334	c.198G>A	c.(196-198)CTG>CTA	p.L66L	SLC35B2_uc011dvt.1_Nonsense_Mutation_p.W21*|SLC35B2_uc011dvu.1_Intron	NM_178148	NP_835361	Q8TB61	S35B2_HUMAN	solute carrier family 35, member B2	66					positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CACCGGTCTCCAGGTAGTTCT	0.547													13	47	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75864169	75864169	+	Silent	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75864169G>C	uc003phs.2	-	17	3694	c.3528C>G	c.(3526-3528)ACC>ACG	p.T1176T	COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1176					cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TGTCGGAAAGGGTTGTCATTT	0.358													88	154	---	---	---	---	PASS
RAET1E	135250	broad.mit.edu	37	6	150211277	150211277	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150211277A>G	uc003qnl.1	-	2	150	c.90T>C	c.(88-90)GGT>GGC	p.G30G	uc003qni.1_Intron|RAET1E_uc003qnj.2_Silent_p.G30G|RAET1E_uc003qnk.1_Intron|RAET1E_uc010kih.1_RNA	NM_139165	NP_631904	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E precursor	30					antigen processing and presentation|immune response|regulation of immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		AAAGAGAGTGACCACCTGTGA	0.507													4	31	---	---	---	---	PASS
C6orf118	168090	broad.mit.edu	37	6	165715542	165715542	+	Missense_Mutation	SNP	C	T	T	rs143539145		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165715542C>T	uc003qum.3	-	2	305	c.269G>A	c.(268-270)CGC>CAC	p.R90H	C6orf118_uc011egi.1_RNA	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN	hypothetical protein LOC168090	90											0		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CTCAGAGGCGCGCTCCCCCTT	0.652													22	31	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169617847	169617847	+	3'UTR	SNP	C	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169617847C>G	uc003qwt.2	-	23						NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GCCACAAGGACCACAATGAAC	0.473													23	69	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6179726	6179726	+	Intron	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6179726T>C	uc011jwo.1	+						USP42_uc011jwn.1_Intron|USP42_uc010kth.1_Intron|USP42_uc011jwp.1_Intron|USP42_uc011jwq.1_Silent_p.A15A|USP42_uc011jwr.1_Intron	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42						cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TTTGCAAAGCTCTTCTCTCAT	0.413													5	204	---	---	---	---	PASS
ANLN	54443	broad.mit.edu	37	7	36483445	36483445	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36483445A>G	uc003tff.2	+	22	3256	c.3052A>G	c.(3052-3054)ACT>GCT	p.T1018A	ANLN_uc011kaz.1_Missense_Mutation_p.T930A|ANLN_uc003tfg.2_Missense_Mutation_p.T981A|ANLN_uc010kxe.2_Missense_Mutation_p.T980A	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	1018	PH.|Localization to the cleavage furrow.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						ATCTTATTGGACTTATCCAGA	0.388													6	362	---	---	---	---	PASS
CDK13	8621	broad.mit.edu	37	7	40132576	40132576	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40132576C>T	uc003thh.3	+	13	3710	c.3428C>T	c.(3427-3429)ACA>ATA	p.T1143I	CDK13_uc003thi.3_Missense_Mutation_p.T1083I|CDK13_uc003thj.2_Missense_Mutation_p.T194I|CDK13_uc003thk.2_Missense_Mutation_p.T76I	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1143					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						GAAAAACAGACAGATCCATCA	0.443													5	173	---	---	---	---	PASS
NAMPT	10135	broad.mit.edu	37	7	105915408	105915408	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105915408C>T	uc003vdq.2	-	3	610	c.302G>A	c.(301-303)TGG>TAG	p.W101*	NAMPT_uc003vdr.1_Nonsense_Mutation_p.W101*|NAMPT_uc011klu.1_Intron	NM_005746	NP_005737	P43490	NAMPT_HUMAN	nicotinamide phosphoribosyltransferase	101					cell-cell signaling|NAD biosynthetic process|nicotinamide metabolic process|positive regulation of cell proliferation|positive regulation of nitric-oxide synthase biosynthetic process|signal transduction|water-soluble vitamin metabolic process	cytosol	cytokine activity|nicotinamide phosphoribosyltransferase activity|nicotinate phosphoribosyltransferase activity|nicotinate-nucleotide diphosphorylase (carboxylating) activity			large_intestine(1)	1						AATGTAGTTCCATCCCTTTTC	0.303													5	376	---	---	---	---	PASS
CALD1	800	broad.mit.edu	37	7	134618404	134618404	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134618404T>G	uc003vrz.2	+	5	1343	c.884T>G	c.(883-885)ATT>AGT	p.I295S	CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron|CALD1_uc011kpu.1_Intron|CALD1_uc011kpv.1_Intron|CALD1_uc003vse.2_Missense_Mutation_p.I159S	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1	295					cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						CGAGCAAGAATTGAAGCAGAA	0.308													45	157	---	---	---	---	PASS
PABPC1	26986	broad.mit.edu	37	8	101725345	101725345	+	Silent	SNP	T	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101725345T>G	uc003yjs.1	-	5	1212	c.708A>C	c.(706-708)GTA>GTC	p.V236V	PABPC1_uc011lhc.1_Silent_p.V204V|PABPC1_uc011lhd.1_Silent_p.V191V|PABPC1_uc003yjt.1_Silent_p.V233V|PABPC1_uc003yju.2_RNA	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	236	CSDE1-binding.|RRM 3.				mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TTTCAAAGCTTACAAATCCAA	0.368													21	63	---	---	---	---	PASS
PABPC1	26986	broad.mit.edu	37	8	101725366	101725366	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101725366T>A	uc003yjs.1	-	5	1191	c.687A>T	c.(685-687)AAA>AAT	p.K229N	PABPC1_uc011lhc.1_Missense_Mutation_p.K197N|PABPC1_uc011lhd.1_Missense_Mutation_p.K184N|PABPC1_uc003yjt.1_Missense_Mutation_p.K226N|PABPC1_uc003yju.2_RNA	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	229	CSDE1-binding.|RRM 3.				mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ATCCTTTGGATTTTCCACTTT	0.358													22	51	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361373	105361373	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361373A>G	uc003ylx.1	+	2	642	c.593A>G	c.(592-594)TAC>TGC	p.Y198C		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	198					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AGCGTCTTGTACCAGATGGCA	0.547													5	13	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113349913	113349913	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113349913A>C	uc003ynu.2	-	43	6859	c.6700T>G	c.(6700-6702)TTT>GTT	p.F2234V	CSMD3_uc003yns.2_Missense_Mutation_p.F1436V|CSMD3_uc003ynt.2_Missense_Mutation_p.F2194V|CSMD3_uc011lhx.1_Missense_Mutation_p.F2130V|CSMD3_uc003ynw.1_5'UTR	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2234	Extracellular (Potential).|Sushi 12.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCAATTACAAAACCATTTCGA	0.398										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			37	82	---	---	---	---	PASS
FAM91A1	157769	broad.mit.edu	37	8	124792768	124792768	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124792768A>G	uc003yqv.2	+	8	750	c.689A>G	c.(688-690)GAC>GGC	p.D230G	FAM91A1_uc011lik.1_Missense_Mutation_p.D230G|FAM91A1_uc011lil.1_5'UTR	NM_144963	NP_659400	Q658Y4	F91A1_HUMAN	hypothetical protein LOC157769	230										ovary(1)|central_nervous_system(1)	2	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			ATATCTGATGACAGTTGTATA	0.348													6	265	---	---	---	---	PASS
TRIB1	10221	broad.mit.edu	37	8	126448767	126448767	+	3'UTR	SNP	A	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126448767A>T	uc003yrx.2	+	3					TRIB1_uc011lis.1_3'UTR|TRIB1_uc010mdn.2_3'UTR	NM_025195	NP_079471	Q96RU8	TRIB1_HUMAN	G-protein-coupled receptor induced protein						JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			lung(1)	1	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			TTCCATTTCTAAAGATGGACA	0.473													7	23	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131136342	131136342	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131136342C>G	uc003yta.1	-	17	1552	c.1524G>C	c.(1522-1524)AAG>AAC	p.K508N	ASAP1_uc003ysz.1_Missense_Mutation_p.K319N|ASAP1_uc011liw.1_Missense_Mutation_p.K501N	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	508	Arf-GAP.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						TTCCTACATTCTTGGCCAGCT	0.328													52	146	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134030154	134030154	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134030154C>T	uc003ytw.2	+	38	6735	c.6694C>T	c.(6694-6696)CCA>TCA	p.P2232S	TG_uc010mdw.2_Missense_Mutation_p.P991S|TG_uc011ljb.1_Missense_Mutation_p.P601S|TG_uc011ljc.1_Missense_Mutation_p.P365S	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2232					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCTTGGAGTTCCATATGCTGC	0.617													3	7	---	---	---	---	PASS
EEF1D	1936	broad.mit.edu	37	8	144668953	144668953	+	Silent	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144668953T>A	uc011lki.1	-	2	332	c.63A>T	c.(61-63)GCA>GCT	p.A21A	EEF1D_uc003yyp.1_Silent_p.A387A|EEF1D_uc003yyq.1_Silent_p.A437A|EEF1D_uc011lkj.1_Silent_p.A386A|EEF1D_uc003yyr.2_Silent_p.A387A|EEF1D_uc003yyt.2_Silent_p.A387A|EEF1D_uc011lkk.1_Silent_p.A21A|EEF1D_uc003yys.2_Silent_p.A21A|EEF1D_uc003yyv.2_Silent_p.A21A|EEF1D_uc003yyu.2_Silent_p.A21A|EEF1D_uc011lkl.1_Silent_p.A21A	NM_001130057	NP_001123529	P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta	21					positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|signal transducer activity|translation elongation factor activity			ovary(1)|kidney(1)|skin(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			ATCTCCTTTCTGCGTCGTCAT	0.567													11	48	---	---	---	---	PASS
PARP10	84875	broad.mit.edu	37	8	145059205	145059205	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145059205G>A	uc003zal.3	-	5	1073	c.965C>T	c.(964-966)ACA>ATA	p.T322I	PARP10_uc003zak.3_Missense_Mutation_p.T28I|PARP10_uc011lku.1_Missense_Mutation_p.T334I|PARP10_uc011lkv.1_RNA|PARP10_uc003zam.2_Missense_Mutation_p.T322I|PARP10_uc010mfn.1_Missense_Mutation_p.T237I|PARP10_uc010mfo.1_3'UTR	NM_032789	NP_116178	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	322						Golgi apparatus|nucleolus	NAD+ ADP-ribosyltransferase activity|nucleotide binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)|pancreas(1)	6	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCAGAGCCTGTTGTCATAAT	0.622													10	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413565	68413565	+	RNA	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413565G>A	uc004aex.2	+	1		c.120G>A								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		AGCTCCCCCAGTGGCGCCGGA	0.547													7	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413569	68413569	+	RNA	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413569C>T	uc004aex.2	+	1		c.124C>T								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		CCCCCAGTGGCGCCGGATCTA	0.557													6	14	---	---	---	---	PASS
TJP2	9414	broad.mit.edu	37	9	71855060	71855060	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71855060A>G	uc004ahe.2	+	17	2763	c.2563A>G	c.(2563-2565)ACA>GCA	p.T855A	TJP2_uc011lrs.1_Missense_Mutation_p.T832A|TJP2_uc011lrt.1_Missense_Mutation_p.T832A|TJP2_uc004ahd.2_Missense_Mutation_p.T855A|TJP2_uc004ahf.2_Missense_Mutation_p.T855A|TJP2_uc011lru.1_Missense_Mutation_p.T859A|TJP2_uc011lrv.1_Missense_Mutation_p.T877A	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)	855	Guanylate kinase-like.				cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						ACACCTTTTTACAGGTAAGTG	0.313													20	56	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104499650	104499650	+	Silent	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104499650G>T	uc004bbp.1	-	1	1213	c.612C>A	c.(610-612)GGC>GGA	p.G204G	GRIN3A_uc004bbq.1_Silent_p.G204G	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	204	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	CCATCATTTCGCCCTGGCTCT	0.597													8	21	---	---	---	---	PASS
SLC44A1	23446	broad.mit.edu	37	9	108147762	108147762	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108147762T>A	uc004bcn.2	+	15	2150	c.1929T>A	c.(1927-1929)GAT>GAA	p.D643E	SLC44A1_uc010mtk.1_Missense_Mutation_p.D643E|SLC44A1_uc004bco.1_Missense_Mutation_p.D435E	NM_080546	NP_536856	Q8WWI5	CTL1_HUMAN	CDW92 antigen	643	Mitochondrial intermembrane (Potential).					integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)	GCGTCGCTGATTCCAGAGAGC	0.468													28	65	---	---	---	---	PASS
PKN3	29941	broad.mit.edu	37	9	131480826	131480826	+	Splice_Site	SNP	A	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131480826A>C	uc004bvw.2	+	18	2442	c.2049_splice	c.e18-2	p.R683_splice	PKN3_uc010myh.2_Splice_Site_p.R683_splice|PKN3_uc011mbk.1_Splice_Site_p.R233_splice	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta						signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						CCTTGCCCTCAGGGACCTGAA	0.602													8	52	---	---	---	---	PASS
ADAMTSL2	9719	broad.mit.edu	37	9	136412244	136412244	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136412244T>C	uc011mdl.1	+	9	1405	c.848T>C	c.(847-849)GTG>GCG	p.V283A	ADAMTSL2_uc004cei.2_Missense_Mutation_p.V283A	NM_001145320	NP_001138792	Q86TH1	ATL2_HUMAN	ADAMTS-like 2 precursor	283					negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		GCAGGCACGGTGGTCAAGTAC	0.562													8	25	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33199330	33199330	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33199330G>A	uc001iws.3	-	14	2121	c.1985C>T	c.(1984-1986)ACA>ATA	p.T662I	ITGB1_uc001iwp.3_Missense_Mutation_p.T662I|ITGB1_uc001iwq.3_Missense_Mutation_p.T662I|ITGB1_uc001iwr.3_Missense_Mutation_p.T662I|ITGB1_uc001iwt.3_Missense_Mutation_p.T662I|ITGB1_uc001iwu.1_Missense_Mutation_p.T662I	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	662	Extracellular (Potential).				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				ACATTCCTGTGTGCATGTGTC	0.378													16	32	---	---	---	---	PASS
WDFY4	57705	broad.mit.edu	37	10	50034823	50034823	+	Silent	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50034823C>T	uc001jha.3	+	36	6167	c.6090C>T	c.(6088-6090)TCC>TCT	p.S2030S		NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2030						integral to membrane	binding				0						AGTCCCTCTCCGAATGCCTCG	0.493													10	73	---	---	---	---	PASS
KRTAP5-4	387267	broad.mit.edu	37	11	1642604	1642604	+	3'UTR	SNP	A	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1642604A>T	uc009ycy.1	-	4						NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4							keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGACAGGATTAGCAGGACTCA	0.532													7	27	---	---	---	---	PASS
INSC	387755	broad.mit.edu	37	11	15267524	15267524	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15267524G>A	uc001mly.2	+	13	1724	c.1678G>A	c.(1678-1680)GTC>ATC	p.V560I	INSC_uc001mlz.2_Missense_Mutation_p.V513I|INSC_uc001mma.2_3'UTR|INSC_uc010rcs.1_Missense_Mutation_p.V548I|INSC_uc001mmb.2_Missense_Mutation_p.V513I|INSC_uc001mmc.2_Missense_Mutation_p.V471I	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	560					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						TCAGCAGTTGGTCCAGCCTCG	0.542													18	53	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20078104	20078104	+	Silent	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20078104C>T	uc010rdm.1	+	21	5290	c.4929C>T	c.(4927-4929)AAC>AAT	p.N1643N	NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron|NAV2_uc001mpt.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhy.1_Intron|NAV2_uc009yhz.2_Intron|NAV2_uc001mpu.2_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	1643	Ser-rich.					nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						CTGTGGACAACTTTGTCAGCC	0.398													89	292	---	---	---	---	PASS
MUC15	143662	broad.mit.edu	37	11	26582750	26582750	+	Silent	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26582750C>T	uc001mqx.2	-	4	1133	c.867G>A	c.(865-867)CCG>CCA	p.P289P	ANO3_uc010rdr.1_Intron|ANO3_uc001mqt.3_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Silent_p.P316P|MUC15_uc001mqy.2_Silent_p.P266P	NM_145650	NP_663625	Q8N387	MUC15_HUMAN	mucin 15 isoform b	289	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						CATAAGGTTCCGGTGCATTGT	0.383													28	160	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46388175	46388175	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46388175G>A	uc001ncn.1	+	2	494	c.369G>A	c.(367-369)CAG>CAA	p.Q123Q	DGKZ_uc001nch.1_Intron|DGKZ_uc010rgq.1_Intron|DGKZ_uc001ncj.1_Intron|DGKZ_uc010rgr.1_Intron|DGKZ_uc001nck.1_Intron|DGKZ_uc001ncl.2_Intron|DGKZ_uc001ncm.2_Intron|DGKZ_uc009yky.1_Intron|DGKZ_uc010rgs.1_Intron|DGKZ_uc001nci.1_Intron	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	123					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		AGGGTGTCCAGGAGGATGTGG	0.677													3	10	---	---	---	---	PASS
DPF2	5977	broad.mit.edu	37	11	65113420	65113420	+	Silent	SNP	A	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65113420A>C	uc001odm.2	+	8	807	c.795A>C	c.(793-795)GGA>GGC	p.G265G	DPF2_uc001odn.2_Silent_p.G279G|DPF2_uc010roe.1_Intron	NM_006268	NP_006259	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	265					apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						GTCCTGATGGATTGGCCTTGC	0.512													18	67	---	---	---	---	PASS
RAB30	27314	broad.mit.edu	37	11	82693249	82693249	+	Silent	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82693249T>C	uc001ozu.2	-	6	831	c.570A>G	c.(568-570)GAA>GAG	p.E190E	RAB30_uc009yve.2_Silent_p.E188E|RAB30_uc010rst.1_Silent_p.E188E|RAB30_uc001ozv.2_3'UTR	NM_014488	NP_055303	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	190					protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity				0						TGCTTTTCCCTTCTCCAGGTA	0.453													5	142	---	---	---	---	PASS
GPR83	10888	broad.mit.edu	37	11	94113463	94113463	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94113463G>A	uc001pet.2	-	4	1296	c.1124C>T	c.(1123-1125)CCC>CTC	p.P375L		NM_016540	NP_057624	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83 precursor	375	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			central_nervous_system(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AACTGGGGAGGGTGGCCTGTC	0.552													14	49	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103057148	103057148	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103057148G>C	uc001pho.2	+	42	6955	c.6811G>C	c.(6811-6813)GGT>CGT	p.G2271R	DYNC2H1_uc001phn.1_Missense_Mutation_p.G2271R|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2271	AAA 3 (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CATGCAACGAGGTCTAGATTA	0.403													20	67	---	---	---	---	PASS
SLC2A14	144195	broad.mit.edu	37	12	7967042	7967042	+	Missense_Mutation	SNP	C	T	T	rs140568143	byFrequency	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7967042C>T	uc001qtk.2	-	16	2226	c.1433G>A	c.(1432-1434)CGT>CAT	p.R478H	SLC2A14_uc001qtl.2_Missense_Mutation_p.R455H|SLC2A14_uc001qtm.2_Missense_Mutation_p.R455H|SLC2A14_uc010sgg.1_Missense_Mutation_p.R369H|SLC2A14_uc001qtn.2_Missense_Mutation_p.R478H|SLC2A14_uc001qto.2_Missense_Mutation_p.R113H|SLC2A14_uc010sgh.1_Missense_Mutation_p.R493H	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	478	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		AGTCCTGCCACGGGTCTCAGG	0.498													17	52	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49436557	49436557	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49436557T>C	uc001rta.3	-	26	5749	c.5749A>G	c.(5749-5751)AGC>GGC	p.S1917G		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1917					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GGCGTACGGCTGCCTTCTAGG	0.552			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			20	51	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49436558	49436558	+	Silent	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49436558G>C	uc001rta.3	-	26	5748	c.5748C>G	c.(5746-5748)GGC>GGG	p.G1916G		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1916					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCGTACGGCTGCCTTCTAGGC	0.552			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			20	50	---	---	---	---	PASS
LMBR1L	55716	broad.mit.edu	37	12	49495927	49495927	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49495927A>G	uc001rth.3	-	11	1248	c.906T>C	c.(904-906)GCT>GCC	p.A302A	LMBR1L_uc001rtg.3_Silent_p.A297A|LMBR1L_uc001rti.3_Silent_p.A302A|LMBR1L_uc001rtj.1_Silent_p.A146A|LMBR1L_uc009zld.1_Silent_p.A175A	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor	302	Cytoplasmic (Potential).				endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						AGCACAGCATAGCCAGGGGGT	0.607													11	23	---	---	---	---	PASS
NR4A1	3164	broad.mit.edu	37	12	52448382	52448382	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52448382G>A	uc001rzs.2	+	3	584	c.270G>A	c.(268-270)TCG>TCA	p.S90S	NR4A1_uc010sno.1_Silent_p.S103S|NR4A1_uc001rzr.2_Silent_p.S90S|NR4A1_uc009zmb.1_Silent_p.S90S|NR4A1_uc001rzt.2_Silent_p.S90S|NR4A1_uc009zmc.2_5'Flank	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	90	Poly-Ser.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		ccacatcctcgtcctcagcca	0.403													17	37	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53685805	53685805	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53685805T>C	uc001sck.2	+	27	5820	c.5729T>C	c.(5728-5730)CTC>CCC	p.L1910P	ESPL1_uc001scj.2_Missense_Mutation_p.L1585P	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	1910					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						ATGCCCAGCCTCCAAGCACTG	0.572													10	21	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62778038	62778038	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62778038G>A	uc001src.1	+	11	1437	c.1428G>A	c.(1426-1428)TTG>TTA	p.L476L	USP15_uc001srb.1_Silent_p.L447L	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	476					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		AACGCACCTTGGAAGTTTACT	0.318													6	273	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64812728	64812728	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812728A>G	uc001ssb.2	+	6	769	c.343A>G	c.(343-345)ACA>GCA	p.T115A	XPOT_uc009zqm.1_Missense_Mutation_p.T25A	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	115	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		GCTTTTTGTTACAGAGTATCT	0.433													6	220	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64812808	64812808	+	Silent	SNP	C	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812808C>G	uc001ssb.2	+	6	849	c.423C>G	c.(421-423)CTC>CTG	p.L141L	XPOT_uc009zqm.1_Silent_p.L51L	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	141	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		GAGTAGATCTCTACCTGCGAA	0.398													5	234	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66935672	66935672	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66935672A>G	uc001stk.2	-	3	436	c.195T>C	c.(193-195)GGT>GGC	p.G65G	GRIP1_uc010sta.1_Silent_p.G9G|GRIP1_uc001stl.1_Silent_p.G9G|GRIP1_uc001stm.2_Silent_p.G65G	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	65	PDZ 1.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		ATACCGTCAGACCCAGGGTAG	0.463													5	131	---	---	---	---	PASS
NR2C1	7181	broad.mit.edu	37	12	95422176	95422176	+	Silent	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95422176T>C	uc001tdm.3	-	12	1774	c.1518A>G	c.(1516-1518)GTA>GTG	p.V506V	NR2C1_uc010suu.1_3'UTR	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	506					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						GACTGAAGAGTACTATTGCCT	0.259													57	163	---	---	---	---	PASS
PSMA6	5687	broad.mit.edu	37	14	35777199	35777199	+	Splice_Site	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35777199G>C	uc001wtd.2	+	2	186	c.77_splice	c.e2-1	p.E26_splice	KIAA0391_uc001wta.2_Splice_Site|PSMA6_uc010tpt.1_Intron|PSMA6_uc010tpu.1_Splice_Site	NM_002791	NP_002782	P60900	PSA6_HUMAN	proteasome alpha 6 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nuclear matrix|polysome|proteasome core complex, alpha-subunit complex|sarcomere	NF-kappaB binding|purine ribonucleoside triphosphate binding|RNA binding|threonine-type endopeptidase activity				0	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		CTGTTTTCCAGAATATGCTTT	0.348													21	76	---	---	---	---	PASS
NEK9	91754	broad.mit.edu	37	14	75553771	75553771	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75553771T>C	uc001xrl.2	-	21	2921	c.2767A>G	c.(2767-2769)ATT>GTT	p.I923V	NEK9_uc001xrj.2_Missense_Mutation_p.I142V|NEK9_uc001xrk.2_Missense_Mutation_p.I423V	NM_033116	NP_149107	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	923	Potential.				cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TGGGTAAAAATCTGGAGGTTT	0.443													41	89	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	29084045	29084045	+	RNA	SNP	T	G	G	rs75345913	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29084045T>G	uc001zcj.2	+	3		c.396T>G								Homo sapiens, Similar to hect domain and RLD 2, clone IMAGE:4581928, mRNA.																		TTATTCGTATTTTTTGGTAAC	0.229													5	22	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48063502	48063502	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48063502G>A	uc010bek.2	+	19	3102	c.2742G>A	c.(2740-2742)TCG>TCA	p.S914S	SEMA6D_uc001zvw.2_Silent_p.S852S|SEMA6D_uc001zvy.2_Silent_p.S914S|SEMA6D_uc001zvz.2_Silent_p.S858S|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Silent_p.S852S|SEMA6D_uc001zwc.2_Silent_p.S839S	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	914	Cytoplasmic (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CCATGGGATCGATGTCTGAGG	0.517													11	22	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62254726	62254726	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62254726T>C	uc002agz.2	-	34	3521	c.3447A>G	c.(3445-3447)ATA>ATG	p.I1149M	VPS13C_uc002aha.2_Missense_Mutation_p.I1106M|VPS13C_uc002ahb.1_Missense_Mutation_p.I1149M|VPS13C_uc002ahc.1_Missense_Mutation_p.I1106M	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	1149					protein localization					ovary(2)	2						CATTTCCCATTATTGACACAG	0.358													21	56	---	---	---	---	PASS
DIS3L	115752	broad.mit.edu	37	15	66615032	66615032	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66615032A>G	uc010ujm.1	+	10	1349	c.1334A>G	c.(1333-1335)GAG>GGG	p.E445G	DIS3L_uc010ujl.1_Missense_Mutation_p.E75G|DIS3L_uc002app.2_Missense_Mutation_p.E362G|DIS3L_uc002apq.2_Missense_Mutation_p.E445G|DIS3L_uc010bho.2_Missense_Mutation_p.E311G	NM_001143688	NP_001137160	Q8TF46	DI3L1_HUMAN	DIS3 mitotic control homolog (S.	445					rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding			ovary(2)	2						CAGATGTGTGAGATGCCAGTA	0.388													4	89	---	---	---	---	PASS
ARIH1	25820	broad.mit.edu	37	15	72873082	72873082	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72873082C>A	uc002aut.3	+	12	1540	c.1226C>A	c.(1225-1227)GCA>GAA	p.A409E		NM_005744	NP_005735	Q9Y4X5	ARI1_HUMAN	ariadne ubiquitin-conjugating enzyme E2 binding	409					ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding				0						CGATCTAGGGCAGCCCTGCAG	0.353													7	66	---	---	---	---	PASS
HN1L	90861	broad.mit.edu	37	16	1735538	1735538	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1735538T>G	uc002cmg.2	+	2	179	c.143T>G	c.(142-144)TTT>TGT	p.F48C	CRAMP1L_uc002cmf.2_RNA|HN1L_uc010uvi.1_Missense_Mutation_p.F76C|HN1L_uc010brt.2_Intron|HN1L_uc010bru.2_Missense_Mutation_p.F48C|HN1L_uc010uvj.1_Missense_Mutation_p.F76C|HN1L_uc010uvk.1_Missense_Mutation_p.F35C	NM_144570	NP_653171	Q9H910	HN1L_HUMAN	hematological and neurological expressed 1-like	48						cytoplasm|nucleus				upper_aerodigestive_tract(1)	1						TCTAATATTTTTGGACCAACA	0.473													46	88	---	---	---	---	PASS
FAM18A	780776	broad.mit.edu	37	16	10864178	10864178	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10864178C>A	uc010buo.1	-	7	864	c.593G>T	c.(592-594)GGT>GTT	p.G198V	FAM18A_uc010uyr.1_RNA|FAM18A_uc010uys.1_RNA|FAM18A_uc010uyt.1_RNA|FAM18A_uc010bun.2_RNA|FAM18A_uc010uyu.1_RNA|FAM18A_uc002dad.3_RNA|FAM18A_uc002daf.1_RNA|FAM18A_uc002dae.1_Missense_Mutation_p.G134V	NM_001079512	NP_001072980	A6NH52	FA18A_HUMAN	hypothetical protein LOC780776	198						integral to membrane					0						CTGAAAGTCACCTGGGCAGGC	0.537													21	27	---	---	---	---	PASS
QPRT	23475	broad.mit.edu	37	16	29706503	29706503	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29706503G>C	uc002dto.2	+	2	610	c.532G>C	c.(532-534)GCC>CCC	p.A178P	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|QPRT_uc010vdu.1_Intron	NM_014298	NP_055113	Q15274	NADC_HUMAN	quinolinate phosphoribosyltransferase	178				AA -> PP (in Ref. 1; BAA11242).	protein oligomerization|quinolinate catabolic process|water-soluble vitamin metabolic process	cytosol	nicotinate-nucleotide diphosphorylase (carboxylating) activity|protein homodimerization activity				0					Niacin(DB00627)	TGTGGTGGCCGCCGGTGGCGT	0.587													15	22	---	---	---	---	PASS
SEPHS2	22928	broad.mit.edu	37	16	30456187	30456187	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30456187A>G	uc010ves.1	-	2	1038	c.862T>C	c.(862-864)TAT>CAT	p.Y288H	SEPHS2_uc002dyh.1_Missense_Mutation_p.Y231H|SEPHS2_uc010vet.1_Missense_Mutation_p.Y170H	NM_012248	NP_036380	Q99611	SPS2_HUMAN	selenophosphate synthetase 2	288					selenocysteine biosynthetic process		ATP binding|selenide, water dikinase activity			breast(2)	2						GCTTCCTGATAGGCCAGCTCC	0.483													17	35	---	---	---	---	PASS
PRR14	78994	broad.mit.edu	37	16	30667486	30667486	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30667486G>A	uc002dyy.2	+	12	1870	c.1612G>A	c.(1612-1614)GTC>ATC	p.V538I	PRR14_uc002dyz.2_Missense_Mutation_p.V383I|PRR14_uc002dza.2_Missense_Mutation_p.V538I	NM_024031	NP_076936	Q9BWN1	PRR14_HUMAN	proline rich 14	538											0			Colorectal(24;0.103)			GTCCCGTGGGGTCCGGGCTGC	0.642													6	16	---	---	---	---	PASS
IRX6	79190	broad.mit.edu	37	16	55362619	55362619	+	Silent	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55362619T>C	uc002ehy.2	+	5	1262	c.729T>C	c.(727-729)ACT>ACC	p.T243T	IRX6_uc002ehx.2_Silent_p.T243T	NM_024335	NP_077311	P78412	IRX6_HUMAN	iroquois homeobox protein 6	243						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(1)	6						CAGAAGTTACTGCTAGCCAGG	0.453													4	6	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61854956	61854956	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61854956C>G	uc002eog.1	-	6	1149	c.897G>C	c.(895-897)AAG>AAC	p.K299N	CDH8_uc002eoh.2_Missense_Mutation_p.K68N	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	299	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GATCATTGGCCTTCACCCTTC	0.433													40	77	---	---	---	---	PASS
ESRP2	80004	broad.mit.edu	37	16	68264909	68264909	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68264909G>C	uc010cfa.1	-	13	1951	c.1763C>G	c.(1762-1764)ACC>AGC	p.T588S	ESRP2_uc002evp.1_RNA|ESRP2_uc002evq.1_Missense_Mutation_p.T578S	NM_024939	NP_079215	Q9H6T0	ESRP2_HUMAN	RNA binding motif protein 35B	588					mRNA processing|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding|nucleotide binding			ovary(1)	1						TTGGAAGGTGGTGTAGGTAGG	0.627													47	172	---	---	---	---	PASS
FTSJD1	55783	broad.mit.edu	37	16	71318090	71318090	+	Silent	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71318090T>A	uc010cga.2	-	3	2140	c.1734A>T	c.(1732-1734)ATA>ATT	p.I578I	FTSJD1_uc002ezy.3_Silent_p.I578I|FTSJD1_uc002ezz.3_Silent_p.I578I	NM_001099642	NP_001093112	Q8IYT2	FTSJ1_HUMAN	FtsJ methyltransferase domain containing 1	578						integral to membrane	methyltransferase activity|nucleic acid binding			skin(1)	1						GCAGGCACTTTATTTGATTGC	0.423													17	37	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1564002	1564002	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1564002T>A	uc002fte.2	-	29	4742	c.4628A>T	c.(4627-4629)AAT>ATT	p.N1543I		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1543						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		ATTGGCTCGATTAATGGTCGG	0.493													12	62	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3935443	3935443	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3935443A>G	uc002fxe.2	-	42	6933	c.6869T>C	c.(6868-6870)GTC>GCC	p.V2290A	ZZEF1_uc002fxh.2_Missense_Mutation_p.V604A|ZZEF1_uc002fxi.2_Missense_Mutation_p.V525A	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2290							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CCGAGTTTTGACATCAACAAT	0.393													5	166	---	---	---	---	PASS
VMO1	284013	broad.mit.edu	37	17	4689557	4689557	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4689557C>T	uc002fyx.2	-	1	173	c.91G>A	c.(91-93)GGC>AGC	p.G31S	VMO1_uc010vsh.1_Missense_Mutation_p.G31S|VMO1_uc010vsi.1_Missense_Mutation_p.G31S|VMO1_uc002fyy.2_Missense_Mutation_p.G31S|GLTPD2_uc002fza.1_5'Flank	NM_182566	NP_872372	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 isoform 1	31					vitelline membrane formation	extracellular region				ovary(1)	1						GCCGTGTAGCCGTTCCGGCCA	0.562													4	3	---	---	---	---	PASS
CAMTA2	23125	broad.mit.edu	37	17	4877038	4877038	+	Silent	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4877038T>C	uc002gah.1	-	13	2151	c.2043A>G	c.(2041-2043)GAA>GAG	p.E681E	CAMTA2_uc010cku.1_Silent_p.E704E|CAMTA2_uc002gag.1_Silent_p.E680E|CAMTA2_uc002gai.1_Silent_p.E683E|CAMTA2_uc010ckv.1_Silent_p.E328E	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	681					cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						CTACCCGTGCTTCGAACCCAG	0.597													8	33	---	---	---	---	PASS
ZNF232	7775	broad.mit.edu	37	17	5009701	5009701	+	Silent	SNP	A	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5009701A>G	uc002gas.2	-	5	1426	c.672T>C	c.(670-672)ACT>ACC	p.T224T	ZNF232_uc002gar.1_Silent_p.T242T|ZNF232_uc002gat.2_Silent_p.T251T	NM_014519	NP_055334	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	224					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TAGAGGTGTCAGTAGCAAGTT	0.493													35	99	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10356135	10356135	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10356135C>A	uc002gmn.2	-	25	3337	c.3226G>T	c.(3226-3228)GAC>TAC	p.D1076Y	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1076	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TGCTGTTTGTCATTTTCTGTA	0.358													18	390	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10404734	10404734	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10404734G>A	uc002gmo.2	-	27	3525	c.3431C>T	c.(3430-3432)TCC>TTC	p.S1144F	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1144	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CAGCTCCCGGGAGAGATCAGA	0.597													12	21	---	---	---	---	PASS
SLC5A10	125206	broad.mit.edu	37	17	18863863	18863863	+	Silent	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18863863C>T	uc002guu.1	+	5	392	c.351C>T	c.(349-351)ATC>ATT	p.I117I	SLC5A10_uc002gur.1_Silent_p.I61I|SLC5A10_uc002gut.1_Silent_p.I117I|SLC5A10_uc002guv.1_Silent_p.I117I|SLC5A10_uc010vyl.1_Silent_p.I117I	NM_001042450	NP_001035915	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/glucose	117	Helical; (Potential).				sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1						CTTCCCAGATCGTCACCTTAC	0.582											OREG0024231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	39	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27438508	27438508	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27438508C>A	uc002hdt.1	-	17	2992	c.2834G>T	c.(2833-2835)TGG>TTG	p.W945L	MYO18A_uc010wbc.1_Missense_Mutation_p.W487L|MYO18A_uc002hds.2_Missense_Mutation_p.W487L|MYO18A_uc010csa.1_Missense_Mutation_p.W945L|MYO18A_uc002hdu.1_Missense_Mutation_p.W945L|MYO18A_uc010wbd.1_Missense_Mutation_p.W614L	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	945	Myosin head-like.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GTAGTTCAGCCAGCCAGTCAC	0.592											OREG0024287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	103	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27438520	27438520	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27438520T>G	uc002hdt.1	-	17	2980	c.2822A>C	c.(2821-2823)AAT>ACT	p.N941T	MYO18A_uc010wbc.1_Missense_Mutation_p.N483T|MYO18A_uc002hds.2_Missense_Mutation_p.N483T|MYO18A_uc010csa.1_Missense_Mutation_p.N941T|MYO18A_uc002hdu.1_Missense_Mutation_p.N941T|MYO18A_uc010wbd.1_Missense_Mutation_p.N610T	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	941	Myosin head-like.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GCCAGTCACATTGTACTCTAC	0.592											OREG0024287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	48	120	---	---	---	---	PASS
TAF15	8148	broad.mit.edu	37	17	34147197	34147197	+	Silent	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34147197T>C	uc002hkd.2	+	4	215	c.129T>C	c.(127-129)GAT>GAC	p.D43D	TAF15_uc010ctw.1_RNA|TAF15_uc002hkc.2_Silent_p.D43D	NM_139215	NP_631961	Q92804	RBP56_HUMAN	TBP-associated factor 15 isoform 1	43	Gln/Gly/Ser/Tyr-rich.				positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		AAACGACTGATTCCTCTTATG	0.348			T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								52	152	---	---	---	---	PASS
COASY	80347	broad.mit.edu	37	17	40715165	40715165	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40715165G>A	uc002hzz.2	+	2	682	c.525G>A	c.(523-525)AGG>AGA	p.R175R	COASY_uc010cyj.2_Silent_p.R204R|COASY_uc002iab.2_5'UTR|COASY_uc002iad.2_Silent_p.R175R|COASY_uc002iac.2_Silent_p.R175R|COASY_uc002iae.2_5'Flank	NM_001042529	NP_001035994	Q13057	COASY_HUMAN	coenzyme A synthase isoform a	175					coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial outer membrane	ATP binding|dephospho-CoA kinase activity|pantetheine-phosphate adenylyltransferase activity				0		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CCACGATCAGGCCAGCTTCCC	0.642													7	18	---	---	---	---	PASS
TMUB2	79089	broad.mit.edu	37	17	42266658	42266658	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42266658C>A	uc002ifo.2	+	3	461	c.304C>A	c.(304-306)CCA>ACA	p.P102T	C17orf65_uc002ifn.2_5'Flank|TMUB2_uc002ifp.2_Missense_Mutation_p.P82T|TMUB2_uc010wiu.1_Missense_Mutation_p.P82T|TMUB2_uc002ifq.2_Missense_Mutation_p.P102T|TMUB2_uc002ifr.2_Missense_Mutation_p.P82T|TMUB2_uc002ifs.2_Intron|TMUB2_uc002ift.2_Missense_Mutation_p.P82T|TMUB2_uc002ifu.2_Missense_Mutation_p.P82T|TMUB2_uc002ifv.2_Missense_Mutation_p.P82T|TMUB2_uc002ifw.1_Missense_Mutation_p.P82T|TMUB2_uc002ifx.2_Missense_Mutation_p.P82T|TMUB2_uc002ify.2_RNA	NM_001076674	NP_001070142	Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain	102						integral to membrane				lung(1)	1		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		ACTCCCCCATCCATCAGAGGG	0.622													4	18	---	---	---	---	PASS
CLTC	1213	broad.mit.edu	37	17	57746161	57746161	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57746161A>T	uc002ixq.1	+	14	2595	c.2152A>T	c.(2152-2154)ATT>TTT	p.I718F	CLTC_uc002ixp.2_Missense_Mutation_p.I718F|CLTC_uc002ixr.1_Missense_Mutation_p.I722F	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	718	Heavy chain arm.|Proximal segment.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCTGGGATCCATTGTTAACTT	0.333			T	ALK|TFE3	ALCL|renal 								148	384	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78938208	78938208	+	3'UTR	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78938208C>T	uc002jyt.1	+	34					RPTOR_uc010wug.1_3'UTR|RPTOR_uc002jyu.1_3'UTR	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						CACGGGGCGTCGGCTGCTGCG	0.662													3	7	---	---	---	---	PASS
RAC3	5881	broad.mit.edu	37	17	79990881	79990881	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79990881C>T	uc002kdf.2	+	4	390	c.284C>T	c.(283-285)GCC>GTC	p.A95V		NM_005052	NP_005043	P60763	RAC3_HUMAN	ras-related C3 botulinum toxin substrate 3 (rho	95					actin cytoskeleton organization|cell projection assembly|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endomembrane system|filamentous actin|growth cone|lamellipodium|neuronal cell body|plasma membrane	GTP binding|GTPase activity|protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			AATGTTCGTGCCAAGGTAGGG	0.602													12	39	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5396318	5396318	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5396318T>A	uc002kmt.1	-	19	2941	c.2855A>T	c.(2854-2856)AAG>ATG	p.K952M	EPB41L3_uc010wzh.1_Missense_Mutation_p.K783M|EPB41L3_uc002kmu.1_Missense_Mutation_p.K730M|EPB41L3_uc010dkq.1_Missense_Mutation_p.K621M|EPB41L3_uc002kms.1_Missense_Mutation_p.K187M|EPB41L3_uc010wze.1_Missense_Mutation_p.K257M|EPB41L3_uc010wzf.1_Missense_Mutation_p.K249M|EPB41L3_uc010wzg.1_Missense_Mutation_p.K224M|EPB41L3_uc010dkr.2_Missense_Mutation_p.K344M	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	952	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GGTTTCCGTCTTCACCGTTGA	0.453													24	113	---	---	---	---	PASS
FAM59A	64762	broad.mit.edu	37	18	29847906	29847906	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29847906C>A	uc002kxl.2	-	6	2615	c.2559G>T	c.(2557-2559)GAG>GAT	p.E853D	FAM59A_uc002kxk.1_Missense_Mutation_p.E852D	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A	853	SAM.									ovary(1)|skin(1)	2						ATTTGAAATCCTCTGAGAGGA	0.413													9	38	---	---	---	---	PASS
LOXHD1	125336	broad.mit.edu	37	18	44137417	44137417	+	Silent	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44137417C>T	uc010xcw.1	-	21	3252	c.3252G>A	c.(3250-3252)GGG>GGA	p.G1084G	LOXHD1_uc002lcg.1_Silent_p.G806G|LOXHD1_uc002lce.3_5'Flank|LOXHD1_uc002lcf.3_5'UTR|LOXHD1_uc010xcv.1_Silent_p.G17G|LOXHD1_uc010xcx.1_5'Flank	NM_144612	NP_653213	Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1 isoform 1	806	PLAT 6.				sensory perception of sound	stereocilium	protein binding				0						TGGTCAGGGCCCCCAGGTCAA	0.557													36	118	---	---	---	---	PASS
SERPINB8	5271	broad.mit.edu	37	18	61654390	61654390	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61654390G>A	uc002ljv.2	+	7	1172	c.1003G>A	c.(1003-1005)GTC>ATC	p.V335I	SERPINB8_uc002lju.2_Missense_Mutation_p.V335I|SERPINB8_uc010xex.1_Missense_Mutation_p.V153I	NM_198833	NP_942130	P50452	SPB8_HUMAN	serine (or cysteine) proteinase inhibitor, clade	335					regulation of proteolysis	cytosol	protein binding|serine-type endopeptidase inhibitor activity			skin(1)	1		Esophageal squamous(42;0.129)				CACTGCTGTGGTCAGGAATTC	0.517													9	22	---	---	---	---	PASS
OR7D2	162998	broad.mit.edu	37	19	9297415	9297415	+	3'UTR	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9297415G>C	uc002mkz.1	+	1						NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D,						regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|upper_aerodigestive_tract(1)	3						TTGGCCCCAGGACTAAGAAGT	0.388													5	11	---	---	---	---	PASS
SLC27A1	376497	broad.mit.edu	37	19	17611618	17611618	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17611618G>T	uc002ngu.1	+	10	1619	c.1569G>T	c.(1567-1569)GAG>GAT	p.E523D	SLC27A1_uc010xpp.1_Missense_Mutation_p.E344D|SLC27A1_uc002ngv.1_Missense_Mutation_p.E125D	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1	523	Cytoplasmic (Potential).				cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						CCACCACCGAGGTGGAGGGCG	0.657													7	20	---	---	---	---	PASS
PDE4C	5143	broad.mit.edu	37	19	18322678	18322678	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18322678G>A	uc010xqc.1	-	14	2162	c.1682C>T	c.(1681-1683)ACG>ATG	p.T561M	PDE4C_uc002nik.3_Missense_Mutation_p.T561M|PDE4C_uc002nil.3_Missense_Mutation_p.T561M|PDE4C_uc002nif.3_Missense_Mutation_p.T330M|PDE4C_uc002nig.3_Missense_Mutation_p.T276M|PDE4C_uc002nih.3_Missense_Mutation_p.T331M|PDE4C_uc010ebk.2_Missense_Mutation_p.T455M|PDE4C_uc002nii.3_Missense_Mutation_p.T529M|PDE4C_uc010ebl.2_Missense_Mutation_p.T275M	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	561					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	GATGCGGTCCGTCCACTGGCG	0.617													9	11	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22942377	22942377	+	Silent	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22942377G>T	uc010xrh.1	-	4	397	c.397C>A	c.(397-399)CGA>AGA	p.R133R		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTTCTTAATCGTAAATTCTTA	0.328													13	258	---	---	---	---	PASS
LENG9	94059	broad.mit.edu	37	19	54973869	54973869	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54973869G>C	uc010yez.1	-	1	1026	c.907C>G	c.(907-909)CCC>GCC	p.P303A		NM_198988	NP_945339	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	303					RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		TTGTCCTCGGGCCAGGCCGCA	0.662													5	9	---	---	---	---	PASS
ZNF256	10172	broad.mit.edu	37	19	58453894	58453894	+	Silent	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58453894T>A	uc002qqu.2	-	3	517	c.282A>T	c.(280-282)ATA>ATT	p.I94I	ZNF256_uc010euj.2_5'UTR	NM_005773	NP_005764	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	94	KRAB.|C2H2-type 1.				multicellular organismal development|negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		CTGGGCCACATATCTCACAGG	0.502													21	101	---	---	---	---	PASS
ZNF256	10172	broad.mit.edu	37	19	58453896	58453896	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58453896T>G	uc002qqu.2	-	3	515	c.280A>C	c.(280-282)ATA>CTA	p.I94L	ZNF256_uc010euj.2_5'UTR	NM_005773	NP_005764	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	94	KRAB.|C2H2-type 1.				multicellular organismal development|negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		GGGCCACATATCTCACAGGGG	0.502													20	99	---	---	---	---	PASS
ANGPT4	51378	broad.mit.edu	37	20	896710	896710	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:896710G>A	uc002wei.2	-	1	251	c.148C>T	c.(148-150)CCC>TCC	p.P50S	ANGPT4_uc010zpn.1_Missense_Mutation_p.P44S	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	50					anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						TCAGACTTGGGCAGCAAGAAG	0.612													17	55	---	---	---	---	PASS
GZF1	64412	broad.mit.edu	37	20	23345603	23345603	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23345603G>T	uc010gdb.2	+	3	757	c.583G>T	c.(583-585)GAT>TAT	p.D195Y	GZF1_uc002wsy.2_Missense_Mutation_p.D195Y|GZF1_uc010zsq.1_Intron|GZF1_uc010zsr.1_Intron|GZF1_uc002wsz.2_Missense_Mutation_p.D195Y	NM_022482	NP_071927	Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	195					transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding			kidney(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CATGTCTTCAGATTTGCCACC	0.542													9	27	---	---	---	---	PASS
PDRG1	81572	broad.mit.edu	37	20	30538174	30538174	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30538174G>A	uc002wxd.2	-	2	223	c.104C>T	c.(103-105)ACT>ATT	p.T35I		NM_030815	NP_110442	Q9NUG6	PDRG1_HUMAN	p53 and DNA damage-regulated protein	35					protein folding	prefoldin complex	unfolded protein binding				0			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ATTCCTTTTAGTGTCCAGGTC	0.527													27	36	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47604916	47604916	+	Silent	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47604916C>T	uc002xtx.3	+	17	2504	c.2352C>T	c.(2350-2352)CAC>CAT	p.H784H	ARFGEF2_uc010zyf.1_Silent_p.H77H	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	784	SEC7.				exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			CAGACTTGCACAGTCCTCAGG	0.348													29	54	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60895846	60895846	+	Silent	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60895846G>A	uc002ycq.2	-	49	6664	c.6597C>T	c.(6595-6597)TCC>TCT	p.S2199S		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2199	Domain II and I.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCCAGGCCATGGAGCTGGCAT	0.662													7	12	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47685911	47685911	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47685911T>A	uc002zir.1	-	11	2995	c.2959A>T	c.(2959-2961)AAC>TAC	p.N987Y	MCM3AP_uc002ziq.1_5'UTR	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	987					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					ATGTACTTGTTCTGGGAGTTG	0.607													8	13	---	---	---	---	PASS
IL2RB	3560	broad.mit.edu	37	22	37539570	37539570	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37539570G>A	uc003aqv.1	-	3	325	c.194C>T	c.(193-195)CCG>CTG	p.P65L		NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor	65	Extracellular (Potential).				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CCGTCTGTCCGGCCAGGCATG	0.537													5	11	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41573737	41573737	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41573737T>C	uc003azl.3	+	31	6417	c.6022T>C	c.(6022-6024)TCT>CCT	p.S2008P		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	2008	Interaction with HTLV-1 Tax.				apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						GCAACTACAGTCTGGGATGCC	0.592			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				4	14	---	---	---	---	PASS
C22orf41	644186	broad.mit.edu	37	22	50994825	50994825	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50994825C>A	uc003bmj.3	-	1	37	c.10G>T	c.(10-12)GCT>TCT	p.A4S	C22orf41_uc010hbe.2_Missense_Mutation_p.A4S	NM_001123225	NP_001116697	A1L190	CV041_HUMAN	hypothetical protein LOC644186	4											0						TCAGGGTCAGCATCATCCATC	0.229													69	156	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107400258	107400258	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107400258C>T	uc004enw.3	-	45	5151	c.5048G>A	c.(5047-5049)CGC>CAC	p.R1683H	COL4A6_uc004env.3_Missense_Mutation_p.R1682H|COL4A6_uc011msn.1_Missense_Mutation_p.R1658H|COL4A6_uc010npk.2_Missense_Mutation_p.R1625H|COL4A6_uc011msm.1_Missense_Mutation_p.R217H|COL4A6_uc010npj.2_Missense_Mutation_p.R162H	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1683	Collagen IV NC1.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CACCTGGCAGCGACTGACTCG	0.572									Alport_syndrome_with_Diffuse_Leiomyomatosis				3	11	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13688	13688	+	RNA	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13688T>C	uc004cox.3	+	1		c.1352T>C			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CCCCACCCTACTAAACCCCAT	0.488													79	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15239	15239	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15239T>C	uc004coy.2	+	1	479	c.404T>C	c.(403-405)CTG>CCG	p.L135P	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		TTCAATGAATCTGAGGAGGCT	0.478											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	10	111	---	---	---	---	PASS
PDIK1L	149420	broad.mit.edu	37	1	26449195	26449196	+	3'UTR	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26449195_26449196insT	uc010oew.1	+	3					PDIK1L_uc001blj.3_3'UTR|PDIK1L_uc009vsb.2_3'UTR	NM_152835	NP_690048	Q8N165	PDK1L_HUMAN	PDLIM1 interacting kinase 1 like							nucleus	ATP binding|protein serine/threonine kinase activity				0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00239)|all_lung(284;0.00366)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000735)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		TTTTTGTGGGATTTTTTTTTTC	0.302													5	3	---	---	---	---	
LAPTM5	7805	broad.mit.edu	37	1	31207777	31207777	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31207777delT	uc001bsc.2	-							NM_006762	NP_006753	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5						transport	integral to plasma membrane|lysosomal membrane					0		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		ggcatcttagttttctctgcg	0.010													6	3	---	---	---	---	
RNF220	55182	broad.mit.edu	37	1	44879467	44879467	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44879467delT	uc001clv.1	+						RNF220_uc001clw.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						ACGAATACCATTTTTTTCCCT	0.433													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	45245946	45245946	+	IGR	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45245946delT								RPS8 (1535 upstream) : BEST4 (3313 downstream)																							cccagctcacttttttttttt	0.164													3	3	---	---	---	---	
MYSM1	114803	broad.mit.edu	37	1	59158900	59158901	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59158900_59158901insA	uc009wab.1	-						MYSM1_uc001czc.2_5'Flank|MYSM1_uc001czd.2_Intron	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					ATTCAAAAAAGGAATCATTTGT	0.272													6	5	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61872216	61872216	+	Intron	DEL	C	-	-	rs71704120		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61872216delC	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron|NFIA_uc001czx.2_Intron|NFIA_uc009wae.2_5'Flank	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						GTGTTTTCTGCCCCCCCCCCC	0.512													8	4	---	---	---	---	
MIER1	57708	broad.mit.edu	37	1	67394273	67394274	+	Intron	DEL	CA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67394273_67394274delCA	uc001dde.2	+						MIER1_uc001dda.3_Intron|MIER1_uc010opf.1_Intron|MIER1_uc009way.2_Intron|MIER1_uc001ddc.2_Intron|MIER1_uc001ddh.2_Intron|MIER1_uc001ddf.2_Intron|MIER1_uc001ddg.2_Intron|MIER1_uc010opg.1_Intron|MIER1_uc001ddj.1_5'Flank|MIER1_uc001ddi.2_5'Flank	NM_001077700	NP_001071168	Q8N108	MIER1_HUMAN	mesoderm induction early response 1 isoform b						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)	1						TCTTTGCCTTCAGCTCTTTTCA	0.366													4	4	---	---	---	---	
MIER1	57708	broad.mit.edu	37	1	67394276	67394277	+	Intron	DEL	CT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67394276_67394277delCT	uc001dde.2	+						MIER1_uc001dda.3_Intron|MIER1_uc010opf.1_Intron|MIER1_uc009way.2_Intron|MIER1_uc001ddc.2_Intron|MIER1_uc001ddh.2_Intron|MIER1_uc001ddf.2_Intron|MIER1_uc001ddg.2_Intron|MIER1_uc010opg.1_Intron|MIER1_uc001ddj.1_5'Flank|MIER1_uc001ddi.2_5'Flank	NM_001077700	NP_001071168	Q8N108	MIER1_HUMAN	mesoderm induction early response 1 isoform b						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)	1						TTGCCTTCAGCTCTTTTCATTA	0.361													4	4	---	---	---	---	
ACADM	34	broad.mit.edu	37	1	76199550	76199551	+	Intron	DEL	TC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76199550_76199551delTC	uc001dgw.3	+						ACADM_uc010orc.1_Intron|ACADM_uc010ord.1_Intron|ACADM_uc009wbp.2_Intron|ACADM_uc009wbr.2_Intron|ACADM_uc010ore.1_Intron|ACADM_uc010orf.1_Intron|ACADM_uc001dgx.3_Intron|ACADM_uc010org.1_Intron	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						GTTCTGACTGTCCTTTGGAGGA	0.450													13	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	83311697	83311697	+	IGR	DEL	T	-	-	rs78971828		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83311697delT								LPHN2 (853591 upstream) : None (None downstream)																							TATTTAAATATTTTTTATCAA	0.358													4	2	---	---	---	---	
GTF2B	2959	broad.mit.edu	37	1	89353293	89353293	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89353293delT	uc001dmo.3	-						GTF2B_uc009wcw.1_Intron	NM_001514	NP_001505	Q00403	TF2B_HUMAN	general transcription factor IIB						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	thyroid hormone receptor binding|translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		AAAACATAAATAGAAAATAAT	0.313													4	3	---	---	---	---	
SASS6	163786	broad.mit.edu	37	1	100550616	100550617	+	3'UTR	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100550616_100550617delAG	uc001dsu.2	-	17					SASS6_uc009wdz.2_3'UTR	NM_194292	NP_919268	Q6UVJ0	SAS6_HUMAN	spindle assembly abnormal protein 6						centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		GAATTTCTAAAGAATAGCTTAA	0.302													5	4	---	---	---	---	
CDC14A	8556	broad.mit.edu	37	1	100920811	100920812	+	Intron	DEL	CA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100920811_100920812delCA	uc001dtg.3	+						CDC14A_uc009web.2_Intron|CDC14A_uc010oui.1_Intron|CDC14A_uc001dte.3_Intron|CDC14A_uc001dtf.2_Intron|CDC14A_uc009wed.1_Intron|CDC14A_uc009wee.2_Intron	NM_003672	NP_003663	Q9UNH5	CC14A_HUMAN	CDC14 homolog A isoform 1						cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TTTTGAGAATCAGGTGCATGTT	0.297													13	6	---	---	---	---	
DPH5	51611	broad.mit.edu	37	1	101467286	101467287	+	Intron	DEL	GG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101467286_101467287delGG	uc001dts.2	-						DPH5_uc001dtr.2_Intron|DPH5_uc001dtq.2_Intron|DPH5_uc001dtt.2_Intron|DPH5_uc001dtu.2_Intron|DPH5_uc001dtv.2_Intron|DPH5_uc001dtw.2_Intron|DPH5_uc001dtx.2_Intron|DPH5_uc001dty.2_Intron|DPH5_uc001dtz.2_Intron	NM_015958	NP_057042	Q9H2P9	DPH5_HUMAN	diphthine synthase isoform a						peptidyl-diphthamide biosynthetic process from peptidyl-histidine		diphthine synthase activity				0		all_epithelial(167;3.1e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0385)|all cancers(265;0.043)|COAD - Colon adenocarcinoma(174;0.151)|Colorectal(144;0.173)|Lung(183;0.198)		CACCAAAAAAGGTAACAGGAAC	0.332													13	6	---	---	---	---	
BCAS2	10286	broad.mit.edu	37	1	115110532	115110533	+	3'UTR	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115110532_115110533delAG	uc001efa.2	-	7					DENND2C_uc001eez.2_Intron	NM_005872	NP_005863	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2						mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding			large_intestine(1)	1	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAAAGCCTAAAGATTTTCTTTT	0.302													16	13	---	---	---	---	
MAN1A2	10905	broad.mit.edu	37	1	118008736	118008737	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118008736_118008737insA	uc001ehd.1	+						MAN1A2_uc009whg.1_Intron	NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2						N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		ttatttttattattgcttgatt	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153964792	153964793	+	IGR	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153964792_153964793insT								RPS27 (161 upstream) : NUP210L (377 downstream)																							GGATAAATTTGTTTTTTTTTTA	0.272													4	2	---	---	---	---	
ATP8B2	57198	broad.mit.edu	37	1	154306330	154306331	+	Intron	INS	-	A	A	rs146039327	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154306330_154306331insA	uc001fey.1	+						ATP8B2_uc001few.2_Intron|ATP8B2_uc001fex.2_Intron	NM_001005855	NP_001005855	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform b						ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			aggctggtctcaaactcctgac	0.035													3	3	---	---	---	---	
PPFIA4	8497	broad.mit.edu	37	1	203025015	203025016	+	Intron	DEL	AC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203025015_203025016delAC	uc001gyz.2	+						PPFIA4_uc009xaj.2_Intron|PPFIA4_uc010pqf.1_Intron|PPFIA4_uc001gza.2_Intron|PPFIA4_uc001gzb.1_5'Flank	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						ATGAGCCCAGACTGCTTAAGAA	0.510													4	2	---	---	---	---	
CD55	1604	broad.mit.edu	37	1	207498723	207498723	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207498723delT	uc001hfq.3	+						CD55_uc001hfp.3_Intron|CD55_uc001hfr.3_Intron|CD55_uc010psf.1_Intron|CD55_uc009xcf.2_Intron|CD55_uc009xce.2_Intron|CD55_uc009xcg.2_5'Flank	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform						complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	ATATCAATGGTTCAGATGATG	0.104													2	5	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217038068	217038069	+	Intron	INS	-	TT	TT	rs141584307	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217038068_217038069insTT	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CGTGGAGTAACAGACCAACTTA	0.495													5	3	---	---	---	---	
EPRS	2058	broad.mit.edu	37	1	220153149	220153149	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220153149delA	uc001hly.1	-							NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase						glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	AATACTATTTACAAGCATTTT	0.264													12	7	---	---	---	---	
CEP170	9859	broad.mit.edu	37	1	243292425	243292425	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243292425delA	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron|CEP170_uc001hzr.2_Intron|CEP170_uc001hzv.1_Intron	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TTTAATTATTACAAGAACAAT	0.299													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2505948	2505948	+	IGR	DEL	A	-	-	rs67348809		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2505948delA								MYT1L (170903 upstream) : TSSC1 (686793 downstream)																							GGAGTGACACAGGGGCAGAGA	0.527													3	3	---	---	---	---	
ATL2	64225	broad.mit.edu	37	2	38542227	38542227	+	Intron	DEL	C	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38542227delC	uc002rqq.2	-						ATL2_uc010ynm.1_Intron|ATL2_uc010ynn.1_Intron|ATL2_uc010yno.1_Intron|ATL2_uc002rqs.2_Intron|ATL2_uc002rqr.2_Intron	NM_001135673	NP_001129145	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2 isoform 2						endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			ovary(1)|kidney(1)|skin(1)	3						aacttcatctccactaaaaat	0.000													4	10	---	---	---	---	
ATL2	64225	broad.mit.edu	37	2	38542230	38542231	+	Intron	DEL	CT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38542230_38542231delCT	uc002rqq.2	-						ATL2_uc010ynm.1_Intron|ATL2_uc010ynn.1_Intron|ATL2_uc010yno.1_Intron|ATL2_uc002rqs.2_Intron|ATL2_uc002rqr.2_Intron	NM_001135673	NP_001129145	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2 isoform 2						endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			ovary(1)|kidney(1)|skin(1)	3						ttcatctccactaaaaatacaa	0.000													4	10	---	---	---	---	
ABCG5	64240	broad.mit.edu	37	2	44041946	44041947	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44041946_44041947insA	uc002rtn.2	-						ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				tttggtaaTATATATAACAtgt	0.005													4	4	---	---	---	---	
ABCG5	64240	broad.mit.edu	37	2	44041954	44041954	+	Intron	DEL	A	-	-	rs78944447		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44041954delA	uc002rtn.2	-						ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TATATATAACAtgtgtgttta	0.005													4	4	---	---	---	---	
ABCG5	64240	broad.mit.edu	37	2	44041956	44041957	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44041956_44041957insA	uc002rtn.2	-						ABCG5_uc002rtm.2_Intron|ABCG5_uc002rto.2_Intron|ABCG5_uc002rtp.2_Intron	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TATATAACAtgtgtgtttaaaa	0.005													4	4	---	---	---	---	
SLC3A1	6519	broad.mit.edu	37	2	44502504	44502504	+	5'Flank	DEL	T	-	-	rs75346091		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44502504delT	uc002ruc.3	+						SLC3A1_uc002rty.2_5'Flank|SLC3A1_uc002rtz.2_5'Flank|SLC3A1_uc002rua.2_5'Flank|SLC3A1_uc002rub.2_5'Flank	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1						carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	AGTCCCGAGATTTTTTTTTTA	0.199													4	2	---	---	---	---	
FANCL	55120	broad.mit.edu	37	2	58426006	58426006	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58426006delT	uc002rzw.3	-						FANCL_uc002rzx.3_Intron|FANCL_uc010fce.2_Intron|FANCL_uc010fcf.1_Intron	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform						DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						tactaaaaaatacaaaaaatt	0.000								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				3	4	---	---	---	---	
PAPOLG	64895	broad.mit.edu	37	2	61021866	61021866	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61021866delT	uc002sai.2	+	20	2242	c.2011delT	c.(2011-2013)TTTfs	p.F671fs	PAPOLG_uc002saj.2_Frame_Shift_Del_p.F360fs|PAPOLG_uc002sak.2_Frame_Shift_Del_p.F206fs|PAPOLG_uc010fch.2_Intron	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	671					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			TGAATCAACATTTAAGGACCC	0.303													315	149	---	---	---	---	
GMCL1	64395	broad.mit.edu	37	2	70092373	70092374	+	Intron	DEL	AG	-	-	rs78263806	byFrequency	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70092373_70092374delAG	uc002sfu.2	+							NM_178439	NP_848526	Q96IK5	GMCL1_HUMAN	germ cell-less						cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3						CCAGAAATTAAGATAAAGAAGA	0.342													6	5	---	---	---	---	
TIA1	7072	broad.mit.edu	37	2	70441765	70441765	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70441765delA	uc002sgj.3	-						TIA1_uc002sgk.3_Intron|TIA1_uc002sgl.3_Intron	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding						apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						GTTGACTGCTaaaaaaaaaaa	0.299													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	70815676	70815677	+	IGR	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70815676_70815677insG								TGFA (34571 upstream) : ADD2 (19073 downstream)																							aatatattattccaatatatta	0.129													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73973636	73973636	+	IGR	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73973636delG								TPRKB (9119 upstream) : DUSP11 (15690 downstream)																							TCTAGAATCTGTGTTTCATAC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92105903	92105904	+	IGR	INS	-	C	C	rs150556462	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92105903_92105904insC								GGT8P (135750 upstream) : FKSG73 (23255 downstream)																							ggaccttgctacaatcactaca	0.000													4	3	---	---	---	---	
ZC3H6	376940	broad.mit.edu	37	2	113057797	113057798	+	Intron	INS	-	AC	AC			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113057797_113057798insAC	uc002thq.1	+						ZC3H6_uc002thr.1_Intron	NM_198581	NP_940983	P61129	ZC3H6_HUMAN	zinc finger CCCH-type domain containing 6								nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4						AAGTTAAATCtttttttttttt	0.089													8	6	---	---	---	---	
POTEF	728378	broad.mit.edu	37	2	130859432	130859435	+	Intron	DEL	GAGT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130859432_130859435delGAGT	uc010fmh.2	-							NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on							cell cortex	ATP binding			skin(3)|ovary(2)	5						aatattataagagtattttaaatt	0.211													3	9	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153378772	153378774	+	Intron	DEL	TAT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153378772_153378774delTAT	uc002tye.2	+							NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						aaattgggaatatttgattagtg	0.020													10	7	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	159979762	159979762	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159979762delT	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						CCGATGGTGATTTTTTTCTGT	0.498													4	2	---	---	---	---	
SLC25A12	8604	broad.mit.edu	37	2	172666977	172666977	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172666977delA	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	GTATAATGTCACGTTTTCTTG	0.328													13	6	---	---	---	---	
CIR1	9541	broad.mit.edu	37	2	175215137	175215138	+	Intron	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175215137_175215138delAG	uc002uim.2	-						CIR1_uc002uin.2_Intron|CIR1_uc002uio.2_Intron|CIR1_uc002uip.2_Intron	NM_004882	NP_004873	Q86X95	CIR1_HUMAN	CBF1 interacting corepressor						mRNA processing|negative regulation of transcription, DNA-dependent|RNA splicing	nuclear speck	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			large_intestine(1)	1						GCTATAAATAAGTCTAATTCTA	0.282													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	176621613	176621613	+	IGR	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176621613delG								ATP5G3 (575123 upstream) : KIAA1715 (168797 downstream)																							AATAAAAAGAGGAGCAGCAAA	0.299													4	2	---	---	---	---	
PDE1A	5136	broad.mit.edu	37	2	183094509	183094510	+	Intron	INS	-	C	C	rs34346085		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183094509_183094510insC	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uor.2_Intron|PDE1A_uc002uou.2_Intron	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			TTGGGAAACTTTTTTTTTTTTT	0.277													4	2	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495217	187495218	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495217_187495218insT	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgggttgtgatataaattat	0.084													17	17	---	---	---	---	
ITGAV	3685	broad.mit.edu	37	2	187495222	187495224	+	Intron	DEL	AAA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187495222_187495224delAAA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		gttgtgatataaattataatctt	0.089													19	17	---	---	---	---	
OBFC2A	64859	broad.mit.edu	37	2	192547021	192547022	+	Intron	DEL	TG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192547021_192547022delTG	uc002usx.2	+						OBFC2A_uc002usw.2_Intron|OBFC2A_uc002usy.2_Intron|OBFC2A_uc002usz.2_Intron|OBFC2A_uc002uta.2_Intron	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold						double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			GTTTTAGAAATGTGCATTTTTT	0.396													5	4	---	---	---	---	
ORC2L	4999	broad.mit.edu	37	2	201822439	201822439	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201822439delA	uc002uwr.2	-						ORC2L_uc010zhj.1_Intron	NM_006190	NP_006181	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0						TTATATAGTTAAAAAAAAAAA	0.279													4	2	---	---	---	---	
ABI2	10152	broad.mit.edu	37	2	204267682	204267688	+	Intron	DEL	AGCAGAA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204267682_204267688delAGCAGAA	uc002vaa.2	+						ABI2_uc002uzz.2_Intron|ABI2_uc010zih.1_Intron|ABI2_uc010zii.1_Intron|ABI2_uc010zij.1_Intron|ABI2_uc002vab.2_Intron|ABI2_uc010zik.1_Intron|ABI2_uc010zil.1_Intron|ABI2_uc010zim.1_Intron|ABI2_uc002vac.2_Intron|ABI2_uc010zin.1_Intron	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2						actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0						AGTTTTTCTGAGCAGAATTTTTTTGAA	0.251													8	5	---	---	---	---	
ERBB4	2066	broad.mit.edu	37	2	212252385	212252385	+	Intron	DEL	A	-	-	rs77289701		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212252385delA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CATGACCAATAATCAGGGAAG	0.348										TSP Lung(8;0.080)			4	2	---	---	---	---	
WDR69	164781	broad.mit.edu	37	2	228771261	228771262	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228771261_228771262insC	uc002vpn.1	+						WDR69_uc010zlw.1_Intron|WDR69_uc002vpo.1_Intron	NM_178821	NP_849143	Q8N136	WDR69_HUMAN	WD repeat domain 69											breast(1)	1		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)		TTTGAATTGCTTCAAGTATATT	0.252													9	5	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776125	234776126	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776125_234776126insA	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						ttctttctttctttcttttttt	0.213													4	2	---	---	---	---	
MSL3L2	151507	broad.mit.edu	37	2	234776128	234776129	+	Intron	INS	-	CC	CC			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234776128_234776129insCC	uc010znf.1	-							NR_024322				SubName: Full=cDNA FLJ52683, highly similar to Male-specific lethal 3-like 1; SubName: Full=cDNA, FLJ79271, highly similar to Male-specific lethal 3-like 1; SubName: Full=HCG1642047;												0						tttctttctttctttttttTGT	0.203													4	2	---	---	---	---	
RBM44	375316	broad.mit.edu	37	2	238732446	238732447	+	Intron	INS	-	GTG	GTG			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238732446_238732447insGTG	uc002vxi.3	+							NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44								nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		AGTATGAAAATTCTCTCTTGTA	0.272													8	4	---	---	---	---	
OGG1	4968	broad.mit.edu	37	3	9799703	9799704	+	Intron	INS	-	AC	AC	rs148476977	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9799703_9799704insAC	uc003bsm.2	+						OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bst.2_Intron|CAMK1_uc003bsu.2_Intron|CAMK1_uc003bss.2_Intron|uc003bsv.1_5'Flank	NM_016821	NP_058214	O15527	OGG1_HUMAN	8-oxoguanine DNA-glycosylase 1 isoform 2a						depurination|nucleotide-excision repair|regulation of protein import into nucleus, translocation|regulation of transcription, DNA-dependent|response to oxidative stress|response to radiation	mitochondrion|nuclear matrix|nuclear speck	damaged DNA binding|endonuclease activity|oxidized purine base lesion DNA N-glycosylase activity|protein binding				0	Medulloblastoma(99;0.227)					ATtatatatttacacacacaca	0.173								BER_DNA_glycosylases					4	2	---	---	---	---	
ANKRD28	23243	broad.mit.edu	37	3	15736025	15736026	+	Intron	DEL	TT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15736025_15736026delTT	uc003caj.1	-						ANKRD28_uc003cai.1_Intron|ANKRD28_uc011avz.1_Intron|ANKRD28_uc003cak.1_Intron|ANKRD28_uc011awa.1_Intron|ANKRD28_uc003cal.1_Intron|ANKRD28_uc003cam.2_Intron	NM_015199	NP_056014	O15084	ANR28_HUMAN	ankyrin repeat domain 28							nucleoplasm	protein binding			breast(1)	1						ACTGTCTGTCTTTTTTTTTTTT	0.351													4	2	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44846300	44846300	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44846300delT	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc003cny.1_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TTTTTGCTTGTCAAACACTGA	0.239													2	6	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44846308	44846309	+	Intron	INS	-	GA	GA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44846308_44846309insGA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc003cny.1_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TGTCAAACACTGAAGTTGTAAA	0.213													5	4	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47127749	47127749	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47127749delA	uc003cqs.2	-	11	5386	c.5333delT	c.(5332-5334)TTGfs	p.L1778fs	SETD2_uc003cqv.2_Frame_Shift_Del_p.L1845fs|SETD2_uc003cqt.1_5'Flank	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1778					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GATCCACAACAAAGACAGCCC	0.498			N|F|S|Mis		clear cell renal carcinoma								76	71	---	---	---	---	
ARHGEF3	50650	broad.mit.edu	37	3	56779705	56779705	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56779705delT	uc003dig.2	-						ARHGEF3_uc011bew.1_Intron|ARHGEF3_uc003dih.2_Intron|ARHGEF3_uc011bev.1_Intron|ARHGEF3_uc003dif.2_Intron|ARHGEF3_uc010hmy.1_Intron|ARHGEF3_uc003dii.2_Intron	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CACAAAGCAAttttttttttt	0.224													4	2	---	---	---	---	
CADPS	8618	broad.mit.edu	37	3	62696536	62696538	+	Intron	DEL	TTA	-	-	rs10574989		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62696536_62696538delTTA	uc003dll.2	-						CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TAACCGGAGCTTATTATCGCTGC	0.379													2	4	---	---	---	---	
MYH15	22989	broad.mit.edu	37	3	108177963	108177964	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108177963_108177964insT	uc003dxa.1	-							NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15							myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						GAAGAATTTAAATAGTAATATC	0.351													5	6	---	---	---	---	
CEP70	80321	broad.mit.edu	37	3	138248577	138248578	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138248577_138248578insT	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						tgcctagaaaaagtatggaata	0.094													6	6	---	---	---	---	
CEP70	80321	broad.mit.edu	37	3	138248578	138248579	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138248578_138248579insT	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						gcctagaaaaagtatggaatat	0.094													6	6	---	---	---	---	
PIK3CB	5291	broad.mit.edu	37	3	138433039	138433039	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138433039delA	uc011bmq.1	-						PIK3CB_uc011bmo.1_Intron|PIK3CB_uc011bmp.1_Intron	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						AGTATTACATATATAATAAAA	0.179													5	4	---	---	---	---	
EIF2A	83939	broad.mit.edu	37	3	150281607	150281607	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150281607delT	uc003eya.2	+						SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Intron|EIF2A_uc003eyc.2_Intron|EIF2A_uc011bnv.1_Intron|EIF2A_uc011bnw.1_Intron|EIF2A_uc003eyd.2_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A						regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CAATGttttcttttttttgtt	0.134													4	2	---	---	---	---	
MFSD1	64747	broad.mit.edu	37	3	158545333	158545333	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158545333delA	uc003fcl.1	+						MFSD1_uc003fcm.1_Intron|MFSD1_uc003fcn.1_Intron|MFSD1_uc011bow.1_Intron|MFSD1_uc011box.1_Intron	NM_022736	NP_073573	Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane					0			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			cctcccaagtagctgggacta	0.000													4	2	---	---	---	---	
SI	6476	broad.mit.edu	37	3	164748812	164748813	+	Intron	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164748812_164748813delAG	uc003fei.2	-							NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	AATCATTAATAGTTTTGATAAA	0.193										HNSCC(35;0.089)			8	4	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	169193679	169193679	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169193679delT	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TCATGTTGGGTTTTTTTTTAT	0.328													4	2	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184717851	184717852	+	Intron	INS	-	CA	CA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184717851_184717852insCA	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc010hye.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATTTGAGAGCAACAGATGACA	0.411													3	4	---	---	---	---	
ZNF718	255403	broad.mit.edu	37	4	145016	145016	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145016delA	uc003fzt.3	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc010iaz.2_Intron|ZNF718_uc003fzw.3_Intron	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		cctcccaagtagctgggacta	0.000													11	5	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21133635	21133635	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21133635delG	uc003gqf.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_147183	NP_671712	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 4							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				GTAATGAGGAGGGCGTGTGAT	0.328													4	2	---	---	---	---	
SLC30A9	10463	broad.mit.edu	37	4	42020377	42020378	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42020377_42020378insA	uc003gwl.2	+						SLC30A9_uc011byx.1_Intron	NM_006345	NP_006336	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter),						nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3						AAATTTATTTTGCATTTTTGTC	0.223													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	64217248	64217248	+	IGR	DEL	A	-	-	rs35934382		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:64217248delA								None (None upstream) : TECRL (926937 downstream)																							GTTACTATGGAAAAAAAAAGT	0.289													4	3	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68495076	68495076	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68495076delA	uc003hdg.3	-							NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						AAAAGTACTTATTAGTCAACA	0.318													5	5	---	---	---	---	
TMPRSS11D	9407	broad.mit.edu	37	4	68725036	68725037	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68725036_68725037insC	uc003hdq.2	-						LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_Intron	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D						proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GTAACAATGTTTGGTATACTCA	0.267													2	5	---	---	---	---	
TMPRSS11D	9407	broad.mit.edu	37	4	68725041	68725042	+	Intron	INS	-	CT	CT			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68725041_68725042insCT	uc003hdq.2	-						LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_Intron	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D						proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						AATGTTTGGTATACTCAAAAGG	0.277													2	5	---	---	---	---	
CSN2	1447	broad.mit.edu	37	4	70822234	70822235	+	Intron	DEL	AA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70822234_70822235delAA	uc003hes.3	-						CSN2_uc003het.3_Intron	NM_001891	NP_001882	P05814	CASB_HUMAN	casein beta precursor						calcium ion transport	extracellular region	calcium ion binding|enzyme inhibitor activity|transporter activity				0						ataaataaataaataaataaat	0.282													1	11	---	---	---	---	
DCK	1633	broad.mit.edu	37	4	71895356	71895357	+	3'UTR	INS	-	CT	CT			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71895356_71895357insCT	uc003hfx.2	+	7					DCK_uc011cbb.1_3'UTR	NM_000788	NP_000779	P27707	DCK_HUMAN	deoxycytidine kinase						purine base metabolic process|purine-containing compound salvage|pyrimidine base metabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol|nucleus	ATP binding|deoxycytidine kinase activity|drug binding|phosphotransferase activity, alcohol group as acceptor|protein homodimerization activity			ovary(1)	1			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Decitabine(DB01262)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	tggttccagtatcagcatagtg	0.109													4	4	---	---	---	---	
CXCL9	4283	broad.mit.edu	37	4	76927034	76927035	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76927034_76927035insC	uc003hjh.1	-							NM_002416	NP_002407	Q07325	CXCL9_HUMAN	small inducible cytokine B9 precursor						cell-cell signaling|cellular defense response|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response	extracellular space	chemokine activity			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			caagggtagaattatgcgtgat	0.059													4	2	---	---	---	---	
AGPAT9	84803	broad.mit.edu	37	4	84517784	84517784	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84517784delA	uc003how.2	+						AGPAT9_uc003hox.2_Intron|AGPAT9_uc003hoy.2_Intron	NM_032717	NP_116106	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9						phospholipid biosynthetic process|regulation of TOR signaling cascade|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	glycerol-3-phosphate O-acyltransferase activity			skin(1)	1		Hepatocellular(203;0.114)				cccacccaccaaaaaaaagaa	0.109													4	3	---	---	---	---	
PDLIM5	10611	broad.mit.edu	37	4	95505929	95505930	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95505929_95505930insT	uc003hti.2	+						PDLIM5_uc003htf.2_Intron|PDLIM5_uc003htg.2_Intron|PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_5'UTR	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TTCTAGCAGCATATTGATATTA	0.361													9	4	---	---	---	---	
RRH	10692	broad.mit.edu	37	4	110756944	110756944	+	Intron	DEL	T	-	-	rs71595523		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110756944delT	uc003hzv.2	+							NM_006583	NP_006574	O14718	OPSX_HUMAN	peropsin						phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		cttaaatgtctttttttTTTT	0.159													4	4	---	---	---	---	
TLL1	7092	broad.mit.edu	37	4	166910813	166910814	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166910813_166910814insC	uc003irh.1	+						TLL1_uc011cjn.1_Intron|TLL1_uc011cjo.1_Intron	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTCattttattaattttttttt	0.163													8	6	---	---	---	---	
NEK1	4750	broad.mit.edu	37	4	170327462	170327463	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170327462_170327463insG	uc003isb.1	-						NEK1_uc003isc.1_Intron|NEK1_uc003isd.1_Intron|NEK1_uc003ise.1_Intron|NEK1_uc003isf.1_Intron	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1						cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		GAGGTTAATGATTAAAAAAAAG	0.129													6	5	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186242257	186242258	+	Intron	DEL	AT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186242257_186242258delAT	uc003ixh.2	+						SNX25_uc010ish.2_Intron|SNX25_uc003ixi.2_Intron	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		AAGAGATTGAATTTAGTTTTGG	0.292													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	202697	202697	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:202697delA								LRRC14B (7229 upstream) : CCDC127 (2178 downstream)																							agactgtctcaaaaaaaaaaT	0.234													8	6	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10397692	10397692	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10397692delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CATTTCTGGGTTTTTTTTTTG	0.418													8	4	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13913594	13913595	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13913594_13913595insA	uc003jfd.2	-						DNAH5_uc003jfe.1_Intron	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TGCTACTAATGAAAATGCTTTT	0.208									Kartagener_syndrome				4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29852485	29852485	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29852485delA								None (None upstream) : None (None downstream)																							AGTTAGACGCAAAAAAGAAAT	0.373													4	2	---	---	---	---	
GOLPH3	64083	broad.mit.edu	37	5	32135385	32135386	+	Intron	DEL	AC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32135385_32135386delAC	uc003jhp.1	-							NM_022130	NP_071413	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1						ggggtttgttaccaccacagct	0.119													4	5	---	---	---	---	
CARD6	84674	broad.mit.edu	37	5	40852067	40852067	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40852067delA	uc003jmg.2	+							NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6						apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						catctctattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DDX4	54514	broad.mit.edu	37	5	55059376	55059377	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55059376_55059377insG	uc003jqg.3	+						DDX4_uc010ivz.2_Intron|DDX4_uc003jqh.3_Intron	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform						multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				GCAAAACTTGACGACTTTTTAA	0.282													3	5	---	---	---	---	
RASA1	5921	broad.mit.edu	37	5	86681489	86681490	+	Intron	INS	-	TTT	TTT			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86681489_86681490insTTT	uc003kiw.2	+						RASA1_uc010jav.2_Intron|RASA1_uc003kix.2_Intron|RASA1_uc011ctv.1_Intron|RASA1_uc011ctw.1_Intron|RASA1_uc010jaw.2_Intron	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1						cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CATTTTAATACAAAAAGTCATT	0.248													4	2	---	---	---	---	
SLCO6A1	133482	broad.mit.edu	37	5	101811198	101811199	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101811198_101811199insC	uc003knn.2	-						SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Intron|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		taacagtgctgtactatgcact	0.064													4	2	---	---	---	---	
PAM	5066	broad.mit.edu	37	5	102282782	102282782	+	Intron	DEL	C	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102282782delC	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	ggcatgtgttctcacacagag	0.000													14	11	---	---	---	---	
PHAX	51808	broad.mit.edu	37	5	125943843	125943844	+	Intron	DEL	TA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125943843_125943844delTA	uc003kua.1	+							NM_032177	NP_115553	Q9H814	PHAX_HUMAN	RNA U, small nuclear RNA export adaptor						ncRNA metabolic process|protein transport|snRNA export from nucleus|spliceosomal snRNP assembly	Cajal body|cytosol	RNA binding				0						ATAAGCCAATTATGAGAGTTTA	0.356													11	5	---	---	---	---	
PHAX	51808	broad.mit.edu	37	5	125943848	125943848	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125943848delG	uc003kua.1	+							NM_032177	NP_115553	Q9H814	PHAX_HUMAN	RNA U, small nuclear RNA export adaptor						ncRNA metabolic process|protein transport|snRNA export from nucleus|spliceosomal snRNP assembly	Cajal body|cytosol	RNA binding				0						CCAATTATGAGAGTTTAGATG	0.348													11	5	---	---	---	---	
CDC42SE2	56990	broad.mit.edu	37	5	130721104	130721104	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130721104delA	uc003kvh.2	+						CDC42SE2_uc003kvi.2_Intron|CDC42SE2_uc003kvj.2_Intron|CDC42SE2_uc003kvk.2_Intron|CDC42SE2_uc003kvl.2_Intron	NM_020240	NP_064625	Q9NRR3	C42S2_HUMAN	CDC42 small effector 2						phagocytosis|regulation of cell shape|regulation of signal transduction	cell projection|cytoplasm|cytoskeleton|phagocytic cup	protein binding|structural molecule activity				0		all_cancers(142;0.0525)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CATAAGAAGTAATTGTGGCAG	0.299													36	23	---	---	---	---	
TCERG1	10915	broad.mit.edu	37	5	145887057	145887058	+	Intron	DEL	GA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145887057_145887058delGA	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCTTCTTTTGATCCATTTTCA	0.361													5	3	---	---	---	---	
ANXA6	309	broad.mit.edu	37	5	150527677	150527679	+	Intron	DEL	ACA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150527677_150527679delACA	uc003ltl.1	-						ANXA6_uc003ltm.1_Intron|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1							melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGTGTCCAGACATTCACAGCAG	0.552													8	4	---	---	---	---	
PTTG1	9232	broad.mit.edu	37	5	159850243	159850244	+	Intron	INS	-	ACA	ACA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159850243_159850244insACA	uc003lyj.2	+						PTTG1_uc003lyk.2_Intron	NM_004219	NP_004210	O95997	PTTG1_HUMAN	pituitary tumor-transforming protein 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|chromosome organization|chromosome segregation|DNA repair|mitosis|spermatogenesis|transcription from RNA polymerase II promoter	cytosol|nucleus	cysteine-type endopeptidase inhibitor activity|sequence-specific DNA binding transcription factor activity|SH3 domain binding				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.00219)|Epithelial(171;0.00348)|all cancers(165;0.0104)		CACTTACAGATACATACTGAGA	0.470													4	2	---	---	---	---	
CLTB	1212	broad.mit.edu	37	5	175820172	175820173	+	Intron	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175820172_175820173delAG	uc003meh.2	-						CLTB_uc003mei.2_Intron|CLTB_uc011dfn.1_Intron	NM_007097	NP_009028	P09497	CLCB_HUMAN	clathrin, light polypeptide isoform b						intracellular protein transport|vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle	protein binding|structural molecule activity				0	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		cgcttctcccagacctgttcct	0.144													3	4	---	---	---	---	
CLTB	1212	broad.mit.edu	37	5	175824331	175824331	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175824331delT	uc003meh.2	-						CLTB_uc003mei.2_Intron|CLTB_uc011dfn.1_Intron	NM_007097	NP_009028	P09497	CLCB_HUMAN	clathrin, light polypeptide isoform b						intracellular protein transport|vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle	protein binding|structural molecule activity				0	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		CCATAGCCCCTCTCATGTCCC	0.607													8	8	---	---	---	---	
CDHR2	54825	broad.mit.edu	37	5	175993096	175993097	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175993096_175993097insT	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						cccacgctggcttttttttttt	0.243													5	3	---	---	---	---	
C6orf134	79969	broad.mit.edu	37	6	30602469	30602469	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30602469delA	uc003nqu.2	+						C6orf134_uc003nqr.3_Intron|C6orf134_uc003rdc.2_Intron|C6orf134_uc003nqs.3_Intron|C6orf134_uc003rdd.2_Intron|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Intron|C6orf134_uc003nqv.2_Intron	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2								tubulin N-acetyltransferase activity				0						aaCCTTGTTTAAAAAAAAAAA	0.164													8	4	---	---	---	---	
SCUBE3	222663	broad.mit.edu	37	6	35186037	35186038	+	Intron	DEL	GT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35186037_35186038delGT	uc003okf.1	+						SCUBE3_uc003okg.1_Intron	NM_152753	NP_689966	Q8IX30	SCUB3_HUMAN	signal peptide, CUB domain, EGF-like 3						protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1						ATGACTCAGGGTGTGTGTGTGT	0.490													4	2	---	---	---	---	
XPO5	57510	broad.mit.edu	37	6	43499536	43499536	+	Intron	DEL	T	-	-	rs112626043		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43499536delT	uc003ovp.2	-							NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TTTTATCTGCTTTTTTTTTTC	0.413													4	2	---	---	---	---	
DST	667	broad.mit.edu	37	6	56358577	56358578	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56358577_56358578insT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pda.3_5'Flank	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTAACATTTGATCTATATATTT	0.223													9	6	---	---	---	---	
DST	667	broad.mit.edu	37	6	56381760	56381761	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56381760_56381761insA	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TAACCAAGGTCTCAAACCTTAA	0.213													8	6	---	---	---	---	
DST	667	broad.mit.edu	37	6	56381765	56381768	+	Intron	DEL	ACCT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56381765_56381768delACCT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAGGTCTCAAACCTTAATAGCCTT	0.216													9	6	---	---	---	---	
IBTK	25998	broad.mit.edu	37	6	82911439	82911439	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82911439delT	uc003pjl.1	-						IBTK_uc011dyu.1_Intron|IBTK_uc011dyv.1_Intron|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Intron|IBTK_uc003pjm.2_Intron	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CAAGCAACTCttttttttttt	0.134													5	4	---	---	---	---	
HACE1	57531	broad.mit.edu	37	6	105191790	105191791	+	Intron	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105191790_105191791delAG	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron|HACE1_uc010kcx.1_Intron|HACE1_uc003pqt.1_Intron	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CAAATTATAAAGTACAATATAC	0.223													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	113952242	113952242	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113952242delA								None (None upstream) : MARCKS (226285 downstream)																							AAGGGAAGAGAAAAAAAAAAA	0.493													6	4	---	---	---	---	
AHI1	54806	broad.mit.edu	37	6	135726363	135726364	+	Intron	INS	-	GG	GG			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135726363_135726364insGG	uc003qgi.2	-						AHI1_uc003qgf.2_Intron|AHI1_uc003qgg.2_Intron|AHI1_uc003qgh.2_Intron|AHI1_uc003qgj.2_Intron|AHI1_uc003qgk.3_Intron|AHI1_uc003qgl.3_Intron	NM_001134831	NP_001128303	Q8N157	AHI1_HUMAN	Abelson helper integration site 1 isoform a							adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		GTTATCTGCCTCAAGAAAAACT	0.351													6	11	---	---	---	---	
PDE7B	27115	broad.mit.edu	37	6	136490126	136490126	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136490126delG	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	GTAGCACAGAGAAAATTCTTg	0.194													4	2	---	---	---	---	
AIG1	51390	broad.mit.edu	37	6	143643289	143643290	+	Intron	DEL	GA	-	-	rs74585392		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143643289_143643290delGA	uc003qjh.2	+						AIG1_uc003qjf.2_Intron|AIG1_uc003qji.2_Intron	NM_016108	NP_057192	Q9NVV5	AIG1_HUMAN	androgen-induced 1							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		GGTTggtgatgagagagagagg	0.193													5	6	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152489647	152489649	+	Intron	DEL	AAC	-	-	rs71899550		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152489647_152489649delAAC	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGACAGCAAAAACAACATCGGCT	0.433										HNSCC(10;0.0054)			1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	167931436	167931437	+	IGR	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167931436_167931437insC								TCP10 (133438 upstream) : C6orf123 (253784 downstream)																							gcctcccacagactttacatca	0.000													10	7	---	---	---	---	
WIPI2	26100	broad.mit.edu	37	7	5255936	5255936	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5255936delA	uc003snv.2	+						WIPI2_uc003snw.2_Intron|WIPI2_uc003snx.2_Intron|WIPI2_uc003sny.2_Intron|WIPI2_uc010ksv.2_Intron|WIPI2_uc003snz.2_Intron|WIPI2_uc003soa.2_Intron	NM_015610	NP_056425	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		ggtggcagtcacctgtaattc	0.000													4	2	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21639152	21639153	+	Intron	INS	-	AG	AG			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21639152_21639153insAG	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TGTCTGTATCTGAAGATAGCAA	0.248									Kartagener_syndrome				4	3	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21678959	21678960	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21678959_21678960insC	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TGTCGCCAAATCCCCCAGAATT	0.460									Kartagener_syndrome				5	5	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38500684	38500684	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38500684delA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						ACCCTTAATTAAAAAAAAGAT	0.204													4	2	---	---	---	---	
YKT6	10652	broad.mit.edu	37	7	44252191	44252192	+	3'UTR	DEL	TG	-	-	rs3840674		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44252191_44252192delTG	uc003tkm.2	+	7					YKT6_uc011kbv.1_3'UTR	NM_006555	NP_006546	O15498	YKT6_HUMAN	YKT6 v-SNARE protein						ER to Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi|vesicle docking involved in exocytosis|vesicle targeting	cytoplasmic vesicle membrane|cytosol|endoplasmic reticulum|endosome|Golgi membrane|integral to plasma membrane|mitochondrion|SNARE complex	protein-cysteine S-palmitoleyltransferase activity|SNAP receptor activity				0						GGGAAGGCTCTGTGGGAGGGAG	0.470													4	2	---	---	---	---	
MYO1G	64005	broad.mit.edu	37	7	45009805	45009805	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45009805delT	uc003tmh.2	-						MYO1G_uc003tmf.2_5'Flank|MYO1G_uc003tmg.2_Intron|MYO1G_uc010kym.2_Intron|MYO1G_uc003tmi.1_Intron|MYO1G_uc003tmj.2_Intron	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG							myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						GTGGAGTGCATGGTAATGGGT	0.567													38	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55741331	55741340	+	IGR	DEL	AAGGACACAG	-	-	rs57215146		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55741331_55741340delAAGGACACAG								LOC442308 (26689 upstream) : FKBP9L (7428 downstream)																							GAATTCAGTTAAGGACACAGAAGGTATTAT	0.333													4	2	---	---	---	---	
NSUN5P2	260294	broad.mit.edu	37	7	72436891	72436892	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72436891_72436892insA	uc010lao.2	-						uc003tws.1_Intron	NM_198853	NP_942150			tripartite motif-containing 74												0						agactgcagtgaaaaaactggt	0.178													5	3	---	---	---	---	
CD36	948	broad.mit.edu	37	7	80103766	80103766	+	Intron	DEL	C	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80103766delC	uc003uhc.2	+						GNAT3_uc011kgu.1_Intron	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen						cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						tgtatatatacacacatacat	0.164													4	2	---	---	---	---	
ABCB4	5244	broad.mit.edu	37	7	87073977	87073977	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87073977delT	uc003uiv.1	-						ABCB4_uc003uiw.1_Intron|ABCB4_uc003uix.1_Intron	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4						cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					ttatattatctaaagatacat	0.254													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	99553218	99553218	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99553218delA								GJC3 (25975 upstream) : AZGP1 (11134 downstream)																							GGATTATTCCAAAGTCCATCC	0.453													4	2	---	---	---	---	
FBXL13	222235	broad.mit.edu	37	7	102518580	102518581	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102518580_102518581insC	uc003vaq.2	-						FBXL13_uc010liq.1_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform												0						taatttaaatataataatataa	0.356													3	3	---	---	---	---	
DNAJC2	27000	broad.mit.edu	37	7	102963753	102963753	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102963753delA	uc003vbo.2	-						PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_Intron|DNAJC2_uc010lix.2_Intron|DNAJC2_uc003vbp.2_Intron	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2						'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1						GCACACATACAAAAAAAAAAT	0.249													6	3	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103132725	103132726	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103132725_103132726insA	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AAAAAATTAATCACAAATCTGG	0.248													4	3	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126493890	126493891	+	Intron	DEL	CT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126493890_126493891delCT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TTCCTCTTTCCTCTCTCTCCTT	0.480										HNSCC(24;0.065)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	135335837	135335837	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135335837delA								NUP205 (2348 upstream) : PL-5283 (11384 downstream)																							GGACCACATCAAAGGCAGCCT	0.517													17	10	---	---	---	---	
BRAF	673	broad.mit.edu	37	7	140550224	140550225	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140550224_140550225insT	uc003vwc.3	-							NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	ACTATAAAAGATTCAAAGAATA	0.307		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				16	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148609785	148609785	+	IGR	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148609785delT								EZH2 (28371 upstream) : MIR1975 (28795 downstream)																							TTGTGTGTTGTTTTTTTTTTA	0.279													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1153107	1153110	+	IGR	DEL	TTTG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1153107_1153110delTTTG								ERICH1 (471881 upstream) : DLGAP2 (296459 downstream)																							TCTTAGGGTTtttgtttgtttgtt	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7956993	7956993	+	IGR	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7956993delG								MIR548I3 (10382 upstream) : FLJ10661 (129099 downstream)																							GAAGGTTTTTGTGAGTTCCTA	0.512													11	5	---	---	---	---	
ZNF705D	728957	broad.mit.edu	37	8	11952861	11952861	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11952861delA	uc003wva.2	+							NM_001039615	NP_001034704	P0CH99	Z705D_HUMAN	zinc finger protein 705D						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACAGCAGAAGAGGGTTATTGT	0.443													4	4	---	---	---	---	
MSR1	4481	broad.mit.edu	37	8	16000841	16000842	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16000841_16000842insG	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron|MSR1_uc003wxb.2_Intron|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TATTCATCACAAAAACAAAAGA	0.267													15	7	---	---	---	---	
ATP6V1B2	526	broad.mit.edu	37	8	20074479	20074480	+	Intron	INS	-	GTAC	GTAC			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20074479_20074480insGTAC	uc003wzp.2	+						ATP6V1B2_uc003wzq.1_5'Flank	NM_001693	NP_001684	P21281	VATB2_HUMAN	vacuolar H+ATPase B2						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|endomembrane system|Golgi apparatus|melanosome|plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)		AGTTGAGTTTTTTAAAATAGTC	0.292													9	6	---	---	---	---	
EBF2	64641	broad.mit.edu	37	8	25837512	25837512	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25837512delA	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		AATGAAAAGGAAAAAAAAAGC	0.373													4	2	---	---	---	---	
FAM92A1	137392	broad.mit.edu	37	8	94719943	94719944	+	Intron	DEL	GA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94719943_94719944delGA	uc010maq.2	+						FAM92A1_uc003yfv.3_Intron|FAM92A1_uc003yfx.3_5'Flank|FAM92A1_uc003yfw.3_5'Flank|FAM92A1_uc010mar.2_5'Flank	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392												0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AAATGTTTTTGATTCCTGGTTA	0.287													7	10	---	---	---	---	
POP1	10940	broad.mit.edu	37	8	99135895	99135896	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99135895_99135896insT	uc003yij.3	+						POP1_uc011lgv.1_Intron|POP1_uc003yik.2_Intron	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1						tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			gtcccagctacttgggaggctg	0.000													6	3	---	---	---	---	
EFR3A	23167	broad.mit.edu	37	8	132980832	132980833	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132980832_132980833insA	uc003yte.2	+							NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ATGCAATTATTTTCAGGCTTCT	0.307													4	3	---	---	---	---	
MOBKL2B	79817	broad.mit.edu	37	9	27327430	27327430	+	3'UTR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27327430delA	uc003zqn.2	-	4						NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		cagtcttgggaaaaaaaatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	28937710	28937710	+	IGR	DEL	T	-	-	rs1029101	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28937710delT								MIR873 (48757 upstream) : None (None downstream)																							GCCTTGCACCTTTGCATCTGT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66545695	66545695	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66545695delA	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		CTGTAAGAGGAAAAAAAAACA	0.373													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68417570	68417571	+	IGR	INS	-	AA	AA	rs111263548		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68417570_68417571insAA								FAM27B (623381 upstream) : MIR1299 (584668 downstream)																							AGGATAGGAATAAAACATCAGT	0.243													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90460007	90460008	+	IGR	DEL	CT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90460007_90460008delCT								CTSL3 (58208 upstream) : C9orf79 (37733 downstream)																							AAAAGTCTTGCTCtgtgtgtgt	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93975239	93975239	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93975239delA								SYK (314406 upstream) : AUH (860 downstream)																							TTTCAGAATTAAAAAAATGAA	0.353													4	2	---	---	---	---	
HSD17B3	3293	broad.mit.edu	37	9	99059753	99059754	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99059753_99059754insA	uc004awa.1	-						HSD17B3_uc010msc.1_Intron	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3						androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	ctcagcctcccaagtagctggg	0.000													13	9	---	---	---	---	
HSD17B3	3293	broad.mit.edu	37	9	99059758	99059758	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99059758delA	uc004awa.1	-						HSD17B3_uc010msc.1_Intron	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3						androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	cctcccaagtagctgggatta	0.000													13	10	---	---	---	---	
TBC1D2	55357	broad.mit.edu	37	9	100991047	100991048	+	Intron	INS	-	TA	TA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100991047_100991048insTA	uc011lvb.1	-						TBC1D2_uc004ayq.2_Intron|TBC1D2_uc004ayr.2_Intron|TBC1D2_uc004ayo.3_Intron	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2							cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TTTTGTGACTTACTTTGAGTGA	0.490													4	2	---	---	---	---	
TBC1D2	55357	broad.mit.edu	37	9	100991050	100991051	+	Intron	INS	-	CC	CC			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100991050_100991051insCC	uc011lvb.1	-						TBC1D2_uc004ayq.2_Intron|TBC1D2_uc004ayr.2_Intron|TBC1D2_uc004ayo.3_Intron	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2							cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TGTGACTTACTTTGAGTGACAT	0.490													4	2	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136657280	136657281	+	Intron	DEL	TG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136657280_136657281delTG	uc004ces.2	-						VAV2_uc004cer.2_Intron|VAV2_uc004cet.1_5'Flank	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		tgtgtgtgactgtgtgtgtgta	0.134													8	5	---	---	---	---	
GTPBP4	23560	broad.mit.edu	37	10	1061586	1061592	+	Intron	DEL	CTGAGCA	-	-	rs72135483		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1061586_1061592delCTGAGCA	uc001ift.2	+						GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		gtcctgagcgctgagcactgagcctgg	0.101													4	2	---	---	---	---	
FAM171A1	221061	broad.mit.edu	37	10	15318181	15318181	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15318181delT	uc001iob.2	-							NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4						AGAAGttttcttttttttttc	0.149													6	3	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29813159	29813159	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29813159delT	uc001iut.1	-						SVIL_uc010qdw.1_5'Flank|SVIL_uc001iuu.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GGGCATACTATTTTTTTCTCT	0.338													4	2	---	---	---	---	
CCDC7	221016	broad.mit.edu	37	10	32806692	32806693	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32806692_32806693insT	uc001iwj.2	+						CCDC7_uc001iwk.2_Intron|CCDC7_uc009xlv.2_Intron|CCDC7_uc009xlw.1_Intron|CCDC7_uc009xlx.1_Intron|CCDC7_uc009xly.1_Intron	NM_145023	NP_659460	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7												0		Breast(68;0.000207)|Prostate(175;0.0107)				taaaacttaaagtataataata	0.134													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	37045346	37045346	+	IGR	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37045346delT								None (None upstream) : ANKRD30A (369439 downstream)																							tcgtttgttgttttttttttt	0.000													4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61972959	61972960	+	Intron	DEL	CA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61972959_61972960delCA	uc001jky.2	-						ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						CAACAAAAACCACACACACACA	0.327													4	2	---	---	---	---	
P4HA1	5033	broad.mit.edu	37	10	74811167	74811167	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74811167delA	uc010qka.1	-						P4HA1_uc001jtg.2_Intron|P4HA1_uc001jth.2_Intron|P4HA1_uc010qkb.1_Intron|P4HA1_uc001jti.2_Intron	NM_001142595	NP_001136067	P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha I subunit isoform 2							endoplasmic reticulum lumen|mitochondrion	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			ovary(1)	1	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	ataccaaaataataggtataa	0.045													5	4	---	---	---	---	
WAPAL	23063	broad.mit.edu	37	10	88257337	88257338	+	Intron	DEL	AA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88257337_88257338delAA	uc001kdo.2	-						WAPAL_uc001kdn.2_Intron|WAPAL_uc009xsw.2_Intron	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						TGTCAAATGGAAAAATCAAATC	0.381													6	4	---	---	---	---	
HTR7	3363	broad.mit.edu	37	10	92501964	92501965	+	3'UTR	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92501964_92501965insA	uc001kha.2	-	4					HTR7_uc001kgz.2_3'UTR|HTR7_uc001khb.2_3'UTR	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d						blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	CCAGAAACTGCTTCCTTTCTGG	0.446													23	12	---	---	---	---	
ACSL5	51703	broad.mit.edu	37	10	114169879	114169880	+	Intron	INS	-	CG	CG			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114169879_114169880insCG	uc001kzs.2	+						ACSL5_uc001kzt.2_Intron|ACSL5_uc001kzu.2_Intron|ACSL5_uc009xxz.2_Intron|ACSL5_uc010qrj.1_Intron	NM_203379	NP_976313	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(2)|skin(1)	3		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		tagatttctcaggacagtgatg	0.094													3	3	---	---	---	---	
NUP98	4928	broad.mit.edu	37	11	3789505	3789508	+	Intron	DEL	GCTG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3789505_3789508delGCTG	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyj.1_Intron|NUP98_uc001lyk.1_Intron	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		caaaaaattagctggacatggtgg	0.000			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								4	2	---	---	---	---	
ARNTL	406	broad.mit.edu	37	11	13393600	13393601	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13393600_13393601insT	uc001mkr.2	+						ARNTL_uc001mko.2_Intron|ARNTL_uc001mkp.2_Intron|ARNTL_uc001mkq.2_Intron|ARNTL_uc001mks.2_Intron|ARNTL_uc001mkt.2_Intron|ARNTL_uc001mku.2_Intron|ARNTL_uc009ygm.1_Intron|ARNTL_uc001mkv.1_Intron|ARNTL_uc001mkw.2_Intron|ARNTL_uc001mkx.2_Intron	NM_001178	NP_001169	O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear						circadian rhythm|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	aryl hydrocarbon receptor binding|DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0				Epithelial(150;0.0243)		TGAAGCCTTGATTTTTTTTTAT	0.455													4	2	---	---	---	---	
SPTY2D1	144108	broad.mit.edu	37	11	18634317	18634317	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18634317delT	uc001moy.2	-						SPTY2D1_uc010rdi.1_Intron	NM_194285	NP_919261	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1											breast(1)	1						tctttctttcttttttttttt	0.134													3	3	---	---	---	---	
CSTF3	1479	broad.mit.edu	37	11	33163775	33163775	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33163775delG	uc001muh.2	-						CSTF3_uc001mui.2_Intron|CSTF3_uc001muj.2_Intron	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1						mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						aaaaaaaaaagacagcactaa	0.040													3	3	---	---	---	---	
LOC440040	440040	broad.mit.edu	37	11	49597585	49597585	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49597585delT	uc010rhy.1	+						LOC440040_uc009ymb.2_Intron	NR_027044				SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;												0						ACCCATGTTATTTTTTTTTTC	0.338													3	3	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68834849	68834850	+	Intron	DEL	CC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68834849_68834850delCC	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TGCTGGGAGGCCACAGGGAGAT	0.688													4	2	---	---	---	---	
PPFIA1	8500	broad.mit.edu	37	11	70185733	70185733	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70185733delT	uc001opo.2	+						PPFIA1_uc001opn.1_Intron|PPFIA1_uc001opp.2_Intron|PPFIA1_uc001opq.1_Intron	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			gccTCTGTAGTTTTTTTTTTT	0.104													7	4	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72289016	72289016	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72289016delA	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	actccatctcaaaaaaaacaa	0.214													4	2	---	---	---	---	
GDPD4	220032	broad.mit.edu	37	11	76990671	76990671	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76990671delA	uc001oyf.2	-							NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						GTAGGATCTTAAGTTACTTAG	0.343													11	5	---	---	---	---	
ME3	10873	broad.mit.edu	37	11	86158479	86158480	+	Intron	DEL	TT	-	-	rs142148806	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86158479_86158480delTT	uc001pbz.2	-						ME3_uc001pca.2_Intron|ME3_uc009yvk.2_Intron	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor						aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	TCCCTGCCAGTTAAGCTGCTCC	0.550													4	2	---	---	---	---	
RDX	5962	broad.mit.edu	37	11	110102326	110102326	+	3'UTR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110102326delA	uc001pku.2	-	14					RDX_uc009yxx.1_Intron|RDX_uc009yxy.2_Intron|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron|RDX_uc001pks.2_3'UTR|RDX_uc001pkt.2_3'UTR|RDX_uc010rwe.1_3'UTR	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		TCTTCAACAGaaaaaaaaaag	0.308													4	2	---	---	---	---	
ZW10	9183	broad.mit.edu	37	11	113618699	113618700	+	Intron	DEL	TA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113618699_113618700delTA	uc001poe.2	-						ZW10_uc009yyv.2_Intron	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10						cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		AAGGAAACACTAAAAAGAAGCA	0.248													6	3	---	---	---	---	
ZW10	9183	broad.mit.edu	37	11	113618706	113618707	+	Intron	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113618706_113618707insC	uc001poe.2	-						ZW10_uc009yyv.2_Intron	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10						cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		CACTAAAAAGAAGCAAAAAGTA	0.248													6	3	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118247607	118247607	+	Intron	DEL	A	-	-	rs1784239		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118247607delA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		catctctaccaaaaaaaaaaa	0.000													4	3	---	---	---	---	
FEZ1	9638	broad.mit.edu	37	11	125323825	125323825	+	Intron	DEL	A	-	-	rs34707154		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125323825delA	uc001qbx.2	-						FEZ1_uc001qbw.2_Intron	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1						axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		ACTAGAGCTCaaaaaaaaaaa	0.338													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	134924365	134924365	+	IGR	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134924365delT								B3GAT1 (642553 upstream) : None (None downstream)																							gttgttttactttttttatct	0.000													4	2	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	271387	271387	+	Intron	DEL	T	-	-	rs66703624		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:271387delT	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		actgCATCTCTTTTTTTTTTT	0.189													4	6	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	24661499	24661499	+	Intron	DEL	C	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24661499delC	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						gcatctgcagcccagggcatc	0.040													4	2	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26877951	26877952	+	Intron	INS	-	CA	CA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26877951_26877952insCA	uc001rhg.2	-						ITPR2_uc001rhh.1_Intron|ITPR2_uc001rhi.1_Intron	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TAAATGATTATAATATAGTGTG	0.366													8	13	---	---	---	---	
ADAMTS20	80070	broad.mit.edu	37	12	43860813	43860813	+	Intron	DEL	G	-	-	rs35870813		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43860813delG	uc010skx.1	-							NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with							proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCTGGCATCTGAATCTACACA	0.388													4	2	---	---	---	---	
RDH16	8608	broad.mit.edu	37	12	57346330	57346334	+	Intron	DEL	TGTGA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57346330_57346334delTGTGA	uc001smi.3	-						RDH16_uc009zpa.2_Intron	NM_003708	NP_003699	O75452	RDH16_HUMAN	retinol dehydrogenase 16						lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	binding|electron carrier activity|retinol dehydrogenase activity				0						AATGCCAGCTTGTGATCAGCCACCA	0.468													4	2	---	---	---	---	
KIF5A	3798	broad.mit.edu	37	12	57962509	57962509	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57962509delA	uc001sor.1	+						KIF5A_uc010srr.1_Intron	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A						blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						actccatctcaaaaaaaaaaa	0.219													2	4	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66858849	66858850	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66858849_66858850insA	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		ctcagcctcccgagtagctggg	0.000													5	3	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66858854	66858854	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66858854delA	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		cctcccgagtagctgggatta	0.000													6	3	---	---	---	---	
CPM	1368	broad.mit.edu	37	12	69252512	69252512	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69252512delG	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GAATTTTTGTGGTTTTTTTTT	0.323													4	2	---	---	---	---	
CSRP2	1466	broad.mit.edu	37	12	77260253	77260253	+	Intron	DEL	T	-	-	rs34861040		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77260253delT	uc001syl.1	-							NM_001321	NP_001312	Q16527	CSRP2_HUMAN	cysteine and glycine-rich protein 2						multicellular organismal development	nucleus	zinc ion binding			ovary(1)	1						GTGCACAAGATTTTTTTTTTT	0.418													3	3	---	---	---	---	
E2F7	144455	broad.mit.edu	37	12	77458037	77458040	+	Intron	DEL	ACTG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77458037_77458040delACTG	uc001sym.3	-						E2F7_uc001syn.2_Intron	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						ACCCTTGACAACTGTATTATAAAC	0.377													6	11	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79747617	79747618	+	Intron	DEL	TT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79747617_79747618delTT	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						attttccttctttgGAGCCAAA	0.153													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80613335	80613335	+	IGR	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80613335delT								PPP1R12A (284100 upstream) : PTPRQ (224791 downstream)																							GACCTTTGAATTGCTTGAAAG	0.438													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80690470	80690471	+	IGR	DEL	AC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80690470_80690471delAC								PPP1R12A (361235 upstream) : PTPRQ (147655 downstream)																							GTTAAAAATGACTTTTTATTTT	0.213													7	5	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88473719	88473722	+	Intron	DEL	CTTC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88473719_88473722delCTTC	uc001tar.2	-						CEP290_uc001taq.2_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						TTTTTCCTAACTTCATATAGATAA	0.250													11	7	---	---	---	---	
CCDC41	51134	broad.mit.edu	37	12	94707046	94707046	+	Intron	DEL	A	-	-	rs11306319		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94707046delA	uc001tdd.2	-						CCDC41_uc001tde.2_Intron|CCDC41_uc009zsw.1_Intron	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen												0						TAATTGCTGCAAAAAAAAAAT	0.308													4	2	---	---	---	---	
KIAA1033	23325	broad.mit.edu	37	12	105537223	105537224	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105537223_105537224insT	uc001tld.2	+						KIAA1033_uc010swr.1_Intron|KIAA1033_uc010sws.1_Intron	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325						endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						ACTAGGAATTAGGAGATTTTAA	0.252													6	6	---	---	---	---	
POLR3B	55703	broad.mit.edu	37	12	106772430	106772430	+	Intron	DEL	A	-	-	rs71922505		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106772430delA	uc001tlp.2	+						POLR3B_uc001tlq.2_Intron	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						AAGGAGatttaaaaaaaaaaa	0.323													4	2	---	---	---	---	
UBE3B	89910	broad.mit.edu	37	12	109922064	109922065	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109922064_109922065insG	uc001top.2	+						UBE3B_uc001toq.2_Intron|UBE3B_uc001tol.1_Intron|UBE3B_uc001tom.2_Intron|UBE3B_uc001ton.2_Intron|UBE3B_uc001too.1_Intron|UBE3B_uc009zvj.1_Intron|UBE3B_uc001tor.2_Intron	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						TGAGATAAAACATAATACAAAA	0.391													5	5	---	---	---	---	
OAS1	4938	broad.mit.edu	37	12	113368893	113368893	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113368893delT	uc009zwf.2	+							NM_002534	NP_002525	P00973	OAS1_HUMAN	2',5'-oligoadenylate synthetase 1 isoform 2						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(2)	2						AAAGAGAGGCTTTTTCTGAGT	0.433													4	2	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119957682	119957683	+	Intron	DEL	TA	-	-	rs71900111	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119957682_119957683delTA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		tgtgtgtgtgtatacctgtgtg	0.168													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19982320	19982325	+	IGR	DEL	TTGTTT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19982320_19982325delTTGTTT								LOC100101938 (63207 upstream) : TPTE2 (14696 downstream)																							TTTGTTGTTGTTGttttattttttat	0.126													5	3	---	---	---	---	
ZC3H13	23091	broad.mit.edu	37	13	46616065	46616066	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46616065_46616066insG	uc010tfw.1	-						ZC3H13_uc001vas.1_Intron|ZC3H13_uc001vat.1_Intron	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13								nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		AAATCCCTACTAAGTTCAGCTT	0.416													6	3	---	---	---	---	
FNDC3A	22862	broad.mit.edu	37	13	49712704	49712705	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49712704_49712705insG	uc001vcm.2	+						FNDC3A_uc001vcl.1_Intron|FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron|FNDC3A_uc001vcp.1_Intron|FNDC3A_uc001vcq.2_Intron	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AAGATAGAAATAAAAACTAAAG	0.277													5	4	---	---	---	---	
FNDC3A	22862	broad.mit.edu	37	13	49748876	49748877	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49748876_49748877insT	uc001vcm.2	+						FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron|FNDC3A_uc001vcp.1_Intron|FNDC3A_uc001vcq.2_Intron	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		TACATAGGAACCACAGGAAACA	0.287													4	5	---	---	---	---	
FNDC3A	22862	broad.mit.edu	37	13	49748881	49748881	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49748881delG	uc001vcm.2	+						FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron|FNDC3A_uc001vcp.1_Intron|FNDC3A_uc001vcq.2_Intron	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AGGAACCACAGGAAACATTAA	0.299													3	5	---	---	---	---	
FNDC3A	22862	broad.mit.edu	37	13	49748887	49748888	+	Intron	INS	-	AT	AT			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49748887_49748888insAT	uc001vcm.2	+						FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron|FNDC3A_uc001vcp.1_Intron|FNDC3A_uc001vcq.2_Intron	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		CACAGGAAACATTAAACTTACA	0.297													2	4	---	---	---	---	
SDCCAG1	9147	broad.mit.edu	37	14	50281212	50281213	+	Intron	DEL	CT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50281212_50281213delCT	uc001wxc.2	-						SDCCAG1_uc010anj.1_Intron|SDCCAG1_uc010tqi.1_Intron|SDCCAG1_uc001wxe.2_Intron|SDCCAG1_uc001wxd.1_Intron	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		ACTTTGAAGACTGAAAGTTATT	0.302													9	6	---	---	---	---	
TXNDC16	57544	broad.mit.edu	37	14	53009410	53009411	+	Intron	INS	-	ATG	ATG			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53009410_53009411insATG	uc001wzs.2	-						TXNDC16_uc010tqu.1_Intron|TXNDC16_uc010aoe.2_Intron	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16 isoform 1						cell redox homeostasis	extracellular region					0	Breast(41;0.0716)					TAAAACAACAATATAATAAATG	0.282													4	2	---	---	---	---	
ERO1L	30001	broad.mit.edu	37	14	53150337	53150337	+	Intron	DEL	C	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53150337delC	uc001wzv.2	-						ERO1L_uc001wzw.2_Intron|ERO1L_uc010aof.2_Intron	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor						chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					TTAAAATTATCCAATGGATGG	0.269													7	6	---	---	---	---	
DLGAP5	9787	broad.mit.edu	37	14	55637193	55637194	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55637193_55637194insA	uc001xbs.2	-						DLGAP5_uc001xbt.2_Intron	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a						cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						ATTACTTACATCTTTTAAGTTA	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	60028260	60028261	+	IGR	DEL	TC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60028260_60028261delTC								JKAMP (56180 upstream) : RTN1 (34433 downstream)																							ATTAAACAAATCCATAGTGTCA	0.312													4	2	---	---	---	---	
SFRS5	6430	broad.mit.edu	37	14	70236174	70236175	+	Intron	INS	-	GA	GA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70236174_70236175insGA	uc001xll.2	+						SFRS5_uc001xlm.2_Intron|SFRS5_uc001xln.1_3'UTR|SFRS5_uc001xlo.2_Intron|SFRS5_uc001xlp.2_Intron|SFRS5_uc001xlq.2_Intron	NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5						mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		GAGGATATTTTTCTTGTTTTTT	0.292													10	6	---	---	---	---	
RBM25	58517	broad.mit.edu	37	14	73538688	73538688	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73538688delT	uc001xno.2	+						RBM25_uc001xnn.3_Intron|RBM25_uc010ttu.1_Intron|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25						apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		TAAAAAAttcttttttttttt	0.139													6	3	---	---	---	---	
RBM25	58517	broad.mit.edu	37	14	73581247	73581248	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73581247_73581248insT	uc001xno.2	+						RBM25_uc010ttu.1_Intron|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25						apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		CACtattattaatattttaatt	0.158													11	7	---	---	---	---	
TTC8	123016	broad.mit.edu	37	14	89343511	89343511	+	Intron	DEL	A	-	-	rs34301947		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89343511delA	uc010ath.2	+						TTC8_uc001xxl.2_Intron|TTC8_uc010ati.2_Intron|TTC8_uc001xxm.2_Intron|TTC8_uc010atj.2_Intron|TTC8_uc001xxi.2_Intron|TTC8_uc001xxj.2_Intron|TTC8_uc001xxk.2_Intron	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8 isoform B						cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding				0						TGGGTTTGTTAAAAAAAAAAG	0.279									Bardet-Biedl_syndrome				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23145659	23145660	+	IGR	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23145659_23145660insC								NIPA1 (58816 upstream) : WHAMML1 (42071 downstream)																							AAATTTTTAGTCAAATATCCTC	0.307													4	3	---	---	---	---	
HERC2P2	400322	broad.mit.edu	37	15	23326253	23326253	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23326253delA	uc001yvr.2	-						HERC2P2_uc010ayf.1_Intron|HERC2P2_uc001yvp.3_Intron					RecName: Full=Putative HERC2-like protein 3;												0						CTTAATTAAGAAAAAAATATG	0.378													28	15	---	---	---	---	
ATPBD4	89978	broad.mit.edu	37	15	35664071	35664072	+	3'UTR	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35664071_35664072insT	uc001zja.2	-	9					ATPBD4_uc001ziz.2_3'UTR	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1												0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		TACAGAAATGGGGTTTATAGAT	0.347													5	4	---	---	---	---	
CDAN1	146059	broad.mit.edu	37	15	43016540	43016541	+	3'UTR	INS	-	CA	CA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43016540_43016541insCA	uc001zql.2	-	28					CDAN1_uc001zqj.2_RNA|CDAN1_uc001zqk.2_3'UTR	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1							integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GGTGGGATGCCAGGCAGTGACA	0.569													4	2	---	---	---	---	
MYEF2	50804	broad.mit.edu	37	15	48433101	48433102	+	3'UTR	INS	-	C	C			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48433101_48433102insC	uc001zwi.3	-	17					SLC24A5_uc001zwe.2_Intron|SLC24A5_uc010bel.2_Intron|MYEF2_uc001zwg.3_3'UTR|MYEF2_uc001zwh.3_3'UTR|MYEF2_uc001zwj.3_3'UTR|SLC24A5_uc001zwk.2_5'Flank	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		TAGATATGTCATTAAAAATCTG	0.342													8	6	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50935921	50935922	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50935921_50935922insA	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TAAATGATTTTAAAGTTGAAAA	0.252													4	3	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50935926	50935927	+	Intron	DEL	TT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50935926_50935927delTT	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GATTTTAAAGTTGAAAAAATCA	0.252													3	3	---	---	---	---	
CLN6	54982	broad.mit.edu	37	15	68515469	68515469	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68515469delA	uc002arf.2	-						CLN6_uc010ujy.1_Intron|CLN6_uc010ujz.1_Intron	NM_017882	NP_060352	Q9NWW5	CLN6_HUMAN	CLN6 protein						cell death|cholesterol metabolic process|ganglioside metabolic process|glycosaminoglycan metabolic process|lysosomal lumen acidification|positive regulation of proteolysis|protein catabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	protein homodimerization activity				0						ataaatactgaaaaaaaaaaa	0.229													6	3	---	---	---	---	
CSPG4	1464	broad.mit.edu	37	15	75983268	75983269	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75983268_75983269insT	uc002baw.2	-							NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor						angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						gtaatcctagcactttgggagg	0.178													4	2	---	---	---	---	
CSPG4	1464	broad.mit.edu	37	15	75983274	75983274	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75983274delG	uc002baw.2	-							NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor						angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						ctagcactttgggaggccaag	0.159													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15198324	15198325	+	Intron	DEL	AC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198324_15198325delAC	uc002ddc.2	+						uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	GAGTGAGCAGACACACTCGGGA	0.564													8	4	---	---	---	---	
C16orf45	89927	broad.mit.edu	37	16	15600157	15600158	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15600157_15600158insA	uc002ddo.2	+						C16orf45_uc002ddp.2_Intron	NM_033201	NP_149978	Q96MC5	CP045_HUMAN	hypothetical protein LOC89927 isoform 1											ovary(1)	1						ctcagcctcccaagtagctggg	0.000													4	3	---	---	---	---	
C16orf45	89927	broad.mit.edu	37	16	15600162	15600162	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15600162delA	uc002ddo.2	+						C16orf45_uc002ddp.2_Intron	NM_033201	NP_149978	Q96MC5	CP045_HUMAN	hypothetical protein LOC89927 isoform 1											ovary(1)	1						cctcccaagtagctgggacta	0.000													4	3	---	---	---	---	
ITGAD	3681	broad.mit.edu	37	16	31436100	31436101	+	Intron	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31436100_31436101delAG	uc002ebv.1	+						ITGAD_uc010cap.1_Intron	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor						cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						ttgtatttttagtagagatgga	0.000													4	2	---	---	---	---	
IRX3	79191	broad.mit.edu	37	16	54317976	54317977	+	Intron	DEL	CC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54317976_54317977delCC	uc002eht.1	-							NM_024336	NP_077312	P78415	IRX3_HUMAN	iroquois homeobox 3						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTGGGCTGGACCTGGAGAGCTG	0.668													4	2	---	---	---	---	
LOC283867	283867	broad.mit.edu	37	16	65377869	65377870	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65377869_65377870insG	uc010cdo.1	-						LOC283867_uc010cdp.1_Intron|LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)		aaaataaattagccaggcatgg	0.000													3	6	---	---	---	---	
ZC3H18	124245	broad.mit.edu	37	16	88690882	88690883	+	Intron	INS	-	AGC	AGC	rs143096278	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88690882_88690883insAGC	uc002fky.2	+						ZC3H18_uc010voz.1_Intron|ZC3H18_uc010chw.2_Intron|ZC3H18_uc002fkz.2_5'Flank	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18							nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GTCCAGGCACGAGCGTGCTCAC	0.653													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6994000	6994000	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6994000delA								CLEC10A (10400 upstream) : ASGR2 (10641 downstream)																							gaacagagagaaaaaaaaaat	0.000													4	2	---	---	---	---	
FXR2	9513	broad.mit.edu	37	17	7506847	7506847	+	Intron	DEL	A	-	-	rs113673039		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7506847delA	uc002gia.1	-						FXR2_uc010vud.1_Intron	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related							cytosolic large ribosomal subunit	protein binding|RNA binding	p.?(1)			0				READ - Rectum adenocarcinoma(115;0.17)		ctctgtctccaaaaaaaaaaa	0.129													4	3	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8408461	8408461	+	Intron	DEL	C	-	-	rs67610561		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8408461delC	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						tagattccagccccagccccc	0.234													6	4	---	---	---	---	
USP22	23326	broad.mit.edu	37	17	20912779	20912780	+	Intron	DEL	CC	-	-	rs60477432		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20912779_20912780delCC	uc002gym.3	-						USP22_uc002gyn.3_Intron|USP22_uc002gyl.3_Intron	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22						cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						AAAGTGGGGACCCGGGTGCACT	0.530													2	4	---	---	---	---	
MYO1D	4642	broad.mit.edu	37	17	30983405	30983406	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30983405_30983406insA	uc002hho.1	-						MYO1D_uc002hhp.1_Intron	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CCAGCTGATGGGGAAGCGGCTC	0.465													4	2	---	---	---	---	
RPL27	6155	broad.mit.edu	37	17	41154524	41154524	+	Intron	DEL	A	-	-	rs76067241		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41154524delA	uc002icj.2	+						RPL27_uc002ick.2_Intron	NM_000988	NP_000979	P61353	RL27_HUMAN	ribosomal protein L27						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	structural constituent of ribosome				0		Breast(137;0.000717)|Ovarian(249;0.0776)		BRCA - Breast invasive adenocarcinoma(366;0.157)		actccgtctcaaaaaaaaaaa	0.204													2	4	---	---	---	---	
MPP2	4355	broad.mit.edu	37	17	41957523	41957523	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41957523delT	uc010wip.1	-						MPP2_uc002ien.1_Intron|MPP2_uc010wim.1_Intron|MPP2_uc002ieo.1_Intron|MPP2_uc010win.1_Intron|MPP2_uc010wio.1_Intron	NM_005374	NP_005365	Q14168	MPP2_HUMAN	palmitoylated membrane protein 2						signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity				0		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		ACTCTCCCCATTGGCACACAC	0.602											OREG0024443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CALCOCO2	10241	broad.mit.edu	37	17	46928215	46928216	+	Intron	INS	-	CT	CT			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46928215_46928216insCT	uc002iof.2	+						CALCOCO2_uc010wlp.1_Intron|CALCOCO2_uc010wlq.1_Intron|CALCOCO2_uc010wlr.1_Intron|CALCOCO2_uc010wls.1_Intron	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2						response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						gggcgacagaggttgcagtgag	0.035													4	3	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925032	47925033	+	Intron	INS	-	AC	AC			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925032_47925033insAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						aagtattTCTTacacacacaca	0.134													4	2	---	---	---	---	
SRP68	6730	broad.mit.edu	37	17	74051723	74051723	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74051723delT	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron|SRP68_uc002jqj.1_5'Flank	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						tagtcccagctactctggagg	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10147	10147	+	IGR	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10147delT								None (None upstream) : USP14 (148336 downstream)																							accctaacccttaaccctaac	0.000													4	2	---	---	---	---	
LPIN2	9663	broad.mit.edu	37	18	2929429	2929429	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2929429delA	uc002klo.2	-							NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2						fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		AAAAATACATACAGATGTGGC	0.274													0	6	---	---	---	---	
LPIN2	9663	broad.mit.edu	37	18	2929432	2929432	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2929432delG	uc002klo.2	-							NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2						fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		AATACATACAGATGTGGCTAG	0.284													0	6	---	---	---	---	
DSC3	1825	broad.mit.edu	37	18	28611852	28611854	+	Intron	DEL	CAG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28611852_28611854delCAG	uc002kwj.3	-						DSC3_uc002kwi.3_Intron	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein						homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			AATTACTACTCAGTTAAGAAAAG	0.320													4	2	---	---	---	---	
DSC3	1825	broad.mit.edu	37	18	28611858	28611859	+	Intron	DEL	AG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28611858_28611859delAG	uc002kwj.3	-						DSC3_uc002kwi.3_Intron	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein						homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TACTCAGTTAAGAAAAGACCTC	0.307													4	2	---	---	---	---	
KIAA1468	57614	broad.mit.edu	37	18	59958503	59958504	+	Intron	DEL	CG	-	-	rs140675120	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59958503_59958504delCG	uc002lil.2	+						KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				ttaattgttacgctcactttat	0.000													5	3	---	---	---	---	
ZNF799	90576	broad.mit.edu	37	19	12501322	12501322	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12501322delA	uc010dyt.2	-	4	2040	c.1890delT	c.(1888-1890)TTTfs	p.F630fs	ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN	zinc finger protein 799	630	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						TGAGAGAAGCAAATGCTTTCC	0.368													163	76	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13345550	13345551	+	Intron	INS	-	TCTC	TCTC			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13345550_13345551insTCTC	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GCACGTCCCCTACCGGAAGAGA	0.619											OREG0025293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
ZNF781	163115	broad.mit.edu	37	19	38161187	38161188	+	5'UTR	INS	-	GA	GA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38161187_38161188insGA	uc002ogy.2	-	4					ZNF781_uc002ogz.2_5'UTR	NM_152605	NP_689818	Q8N8C0	ZN781_HUMAN	zinc finger protein 781						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATAGAGTTTCTTTCCAGTATGA	0.332													5	4	---	---	---	---	
ZNF781	163115	broad.mit.edu	37	19	38161190	38161191	+	5'UTR	DEL	CC	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38161190_38161191delCC	uc002ogy.2	-	4					ZNF781_uc002ogz.2_5'UTR	NM_152605	NP_689818	Q8N8C0	ZN781_HUMAN	zinc finger protein 781						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGTTTCTTTCCAGTATGAATT	0.332													5	4	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40761346	40761347	+	Intron	DEL	GT	-	-	rs34588635		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40761346_40761347delGT	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			tcagggtctagtgtgtgtgtgt	0.000			A		ovarian|pancreatic 								6	3	---	---	---	---	
KLC3	147700	broad.mit.edu	37	19	45844782	45844783	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45844782_45844783insA	uc002pbf.1	+						KLC3_uc002pbe.2_Intron|KLC3_uc010ejy.1_Intron	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		ACCAAGAGGCTGTGCGGCTGTG	0.356													4	2	---	---	---	---	
KPTN	11133	broad.mit.edu	37	19	47983311	47983312	+	Intron	DEL	GA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47983311_47983312delGA	uc002pgy.2	-						KPTN_uc010xys.1_Intron	NM_007059	NP_008990	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)						actin filament organization|cellular component movement|sensory perception of sound	actin cytoskeleton|growth cone|microtubule organizing center|nucleus|perinuclear region of cytoplasm|stereocilium	actin binding			ovary(1)	1		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		ccgcccctctgaagccctcaac	0.193													4	3	---	---	---	---	
EHD2	30846	broad.mit.edu	37	19	48222058	48222058	+	Intron	DEL	T	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48222058delT	uc002phj.3	+						EHD2_uc010xyu.1_Intron	NM_014601	NP_055416	Q9NZN4	EHD2_HUMAN	EH-domain containing 2						blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding			ovary(1)|skin(1)	2		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		gggcccagactcctgggtctg	0.000													6	6	---	---	---	---	
EHD2	30846	broad.mit.edu	37	19	48222061	48222062	+	Intron	INS	-	G	G			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48222061_48222062insG	uc002phj.3	+						EHD2_uc010xyu.1_Intron	NM_014601	NP_055416	Q9NZN4	EHD2_HUMAN	EH-domain containing 2						blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding			ovary(1)|skin(1)	2		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		cccagactcctgggtctgaggg	0.000													5	6	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50295450	50295452	+	Intron	DEL	GCA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50295450_50295452delGCA	uc002ppn.2	+						AP2A1_uc010enj.1_Intron|AP2A1_uc002ppo.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CTCAGCCCACGCACCCCCTGGAT	0.734													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29650349	29650349	+	Intron	DEL	C	-	-	rs138887197		TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29650349delC	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						atagggtattctttctctgct	0.000													3	3	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	33059532	33059532	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33059532delA	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						TCAGGTTTCCATTTCTAAACT	0.294													7	4	---	---	---	---	
ADA	100	broad.mit.edu	37	20	43270538	43270538	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43270538delA	uc002xmj.2	-						ADA_uc010ggt.2_Intron	NM_000022	NP_000013	P00813	ADA_HUMAN	adenosine deaminase						adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	cctcccaagtagctgggatta	0.000									Adenosine_Deaminase_Deficiency				4	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11039939	11039941	+	Intron	DEL	GTT	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11039939_11039941delGTT	uc002yit.1	-						TPTE_uc002yis.1_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGATATAATCGTTGTTCTTCATC	0.320													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11048049	11048049	+	Intron	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11048049delA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ctgtgtcactaaacaacttag	0.055													3	3	---	---	---	---	
GABPA	2551	broad.mit.edu	37	21	27121587	27121588	+	Intron	INS	-	A	A			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27121587_27121588insA	uc002ylx.3	+						GABPA_uc002yly.3_Intron	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha						positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						TATTTGACAGGGTgaaacagat	0.149													5	4	---	---	---	---	
RWDD2B	10069	broad.mit.edu	37	21	30379155	30379157	+	Intron	DEL	AAA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30379155_30379157delAAA	uc002yms.2	-						RWDD2B_uc002ymt.2_Intron|RWDD2B_uc002ymu.2_Intron|RWDD2B_uc002ymv.2_Intron	NM_016940	NP_058636	P57060	RWD2B_HUMAN	RWD domain containing 2B												0						tgctggtttcaaactcctggctg	0.089													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30808608	30808608	+	IGR	DEL	A	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30808608delA								BACH1 (74391 upstream) : GRIK1 (100648 downstream)																							gattaagactaacagaggagc	0.035													4	2	---	---	---	---	
CLTCL1	8218	broad.mit.edu	37	22	19217152	19217155	+	Intron	DEL	CCCT	-	-	rs140225894	by1000genomes	TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19217152_19217155delCCCT	uc002zpb.2	-						CLTCL1_uc011agv.1_Intron|CLTCL1_uc011agw.1_Intron	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1						anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					AGAAATGCTGCCCTAATTAGAACT	0.221			T	?	ALCL								4	3	---	---	---	---	
CLTCL1	8218	broad.mit.edu	37	22	19217161	19217161	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19217161delG	uc002zpb.2	-						CLTCL1_uc011agv.1_Intron|CLTCL1_uc011agw.1_Intron	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1						anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					GCCCTAATTAGAACTGTTTCC	0.244			T	?	ALCL								4	5	---	---	---	---	
MFNG	4242	broad.mit.edu	37	22	37877112	37877113	+	Intron	DEL	CA	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37877112_37877113delCA	uc003ass.1	-						MFNG_uc011ani.1_Intron|MFNG_uc011anj.1_Intron|CARD10_uc003ast.1_Intron	NM_002405	NP_002396	O00587	MFNG_HUMAN	O-fucosylpeptide						pattern specification process	extracellular space|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity			lung(1)	1	Melanoma(58;0.0574)					CCTCTTCTATcacacacacaca	0.426													6	3	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1408900	1408900	+	Intron	DEL	G	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1408900delG	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tttgtgttttgtgttttgttt	0.000													4	3	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1409004	1409005	+	Intron	DEL	TG	-	-			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1409004_1409005delTG	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	gtttttgttttgtgttttgtgt	0.000													14	8	---	---	---	---	
DCAF8L2	347442	broad.mit.edu	37	X	27765420	27765421	+	In_Frame_Ins	INS	-	ATACAA	ATACAA			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27765420_27765421insATACAA	uc011mjy.1	+	1	495_496	c.408_409insATACAA	c.(406-411)insATACAA	p.136_137insIQ		NM_001136533	NP_001130005			DDB1 and CUL4 associated factor 8-like 2											central_nervous_system(1)|pancreas(1)	2						aggaggaggaggaggaggagga	0.243													4	2	---	---	---	---	
SYTL4	94121	broad.mit.edu	37	X	99934109	99934110	+	Intron	INS	-	T	T			TCGA-B0-4811-01A-01D-1501-10	TCGA-B0-4811-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99934109_99934110insT	uc004egd.3	-						SYTL4_uc004egc.2_5'Flank|SYTL4_uc010nnb.2_Intron|SYTL4_uc010nnc.2_Intron|SYTL4_uc004ege.3_Intron|SYTL4_uc004egf.3_Intron	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4						exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCTGTCTGCAGCCCTCCTCTTT	0.436													7	7	---	---	---	---	
