Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ACTL8	81569	broad.mit.edu	37	1	18149661	18149661	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18149661T>C	uc001bat.2	+	2	374	c.158T>C	c.(157-159)CTG>CCG	p.L53P		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	53						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CGTGTGAGCCTGGGCATCGAC	0.587													19	30	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24388573	24388573	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24388573C>T	uc001bin.3	-	33	3960	c.3797G>A	c.(3796-3798)CGG>CAG	p.R1266Q	MYOM3_uc001bil.3_Missense_Mutation_p.R159Q|MYOM3_uc001bim.3_Missense_Mutation_p.R923Q	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1266										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CGTCCTTATCCGATCACCACT	0.527													4	166	---	---	---	---	PASS
ZMPSTE24	10269	broad.mit.edu	37	1	40734185	40734185	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40734185A>G	uc001cfg.2	+	4	663	c.452A>G	c.(451-453)GAA>GGA	p.E151G		NM_005857	NP_005848	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	151						endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity				0	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GTGATAGAAGAAAAACATGGC	0.338													6	401	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103404625	103404625	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103404625C>T	uc001dul.2	-	44	3722	c.3404G>A	c.(3403-3405)GGA>GAA	p.G1135E	COL11A1_uc001duk.2_Missense_Mutation_p.G331E|COL11A1_uc001dum.2_Missense_Mutation_p.G1147E|COL11A1_uc001dun.2_Missense_Mutation_p.G1096E|COL11A1_uc009weh.2_Missense_Mutation_p.G1019E	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1135	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCCTTTTTGTCCCGGCTCACC	0.333													112	289	---	---	---	---	PASS
LOC647121	647121	broad.mit.edu	37	1	121306707	121306707	+	Silent	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121306707C>T	uc009wht.1	+	1	284	c.255C>T	c.(253-255)CAC>CAT	p.H85H	LOC647121_uc001eiu.1_RNA					Homo sapiens cDNA FLJ46881 fis, clone UTERU3015647, moderately similar to Embigin precursor.												0						AAAAGAAGCACTCAGGTGGGA	0.323													18	70	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145293400	145293400	+	5'UTR	SNP	G	A	A	rs57737331	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145293400G>A	uc001end.3	+	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc010oyh.1_RNA|NBPF10_uc001emq.1_5'UTR	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGCCACAAACGTCAGCATGGT	0.488													8	231	---	---	---	---	PASS
XCL1	6375	broad.mit.edu	37	1	168550370	168550370	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168550370G>A	uc001gfo.1	+	3	277	c.257G>A	c.(256-258)AGG>AAG	p.R86K		NM_002995	NP_002986	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	86					CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity				0	all_hematologic(923;0.208)					AGCATGGACAGGAAATCCAAC	0.483													158	469	---	---	---	---	PASS
XCL1	6375	broad.mit.edu	37	1	168550371	168550371	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168550371G>C	uc001gfo.1	+	3	278	c.258G>C	c.(256-258)AGG>AGC	p.R86S		NM_002995	NP_002986	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	86					CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity				0	all_hematologic(923;0.208)					GCATGGACAGGAAATCCAACA	0.483													160	454	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067353	190067353	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067353G>T	uc001gse.1	-	8	2328	c.2096C>A	c.(2095-2097)GCA>GAA	p.A699E	FAM5C_uc010pot.1_Missense_Mutation_p.A597E	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	699						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TTGCAAAAGTGCTGAATCCTG	0.473													56	202	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197097732	197097732	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197097732G>A	uc001gtu.2	-	10	3081	c.2824C>T	c.(2824-2826)CGT>TGT	p.R942C	ASPM_uc001gtv.2_Missense_Mutation_p.R942C|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	942	CH 1.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CCAAGGTGACGGGAAAGGTCA	0.378													5	129	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214549669	214549669	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214549669C>T	uc001hkk.1	-	15	3071	c.2800G>A	c.(2800-2802)GCC>ACC	p.A934T	PTPN14_uc010pty.1_Missense_Mutation_p.A835T	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	934	Tyrosine-protein phosphatase.				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CTGCGCTCGGCGTTTTCTGGC	0.453													147	370	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236925966	236925966	+	3'UTR	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236925966G>A	uc001hyf.2	+	21					ACTN2_uc001hyg.2_3'UTR|ACTN2_uc009xgi.1_3'UTR|ACTN2_uc010pxu.1_3'UTR|ACTN2_uc001hyh.2_3'UTR	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2						focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CAATAAAAGCGGAAGTCACAG	0.448													5	29	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243333027	243333027	+	Silent	SNP	A	G	G	rs147752333	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243333027A>G	uc001hzs.2	-	12	2154	c.1746T>C	c.(1744-1746)CGT>CGC	p.R582R	CEP170_uc001hzt.2_Silent_p.R484R|CEP170_uc001hzu.2_Silent_p.R484R	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	582						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTGAAACCCAACGTTTGCTTC	0.398													7	318	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50149288	50149288	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50149288C>T	uc010fbp.2	-	6	1930	c.1123G>A	c.(1123-1125)GCT>ACT	p.A375T	NRXN1_uc002rxb.3_Missense_Mutation_p.A1109T|NRXN1_uc010fbq.2_Missense_Mutation_p.A1480T|NRXN1_uc002rxe.3_Missense_Mutation_p.A1410T|NRXN1_uc010yon.1_Missense_Mutation_p.A75T|NRXN1_uc002rxa.3_Missense_Mutation_p.A72T	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	375	Poly-Ala.|Helical; (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AGGGCGGCAGCGGCTACTATC	0.567													4	162	---	---	---	---	PASS
CD207	50489	broad.mit.edu	37	2	71060814	71060814	+	Silent	SNP	G	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71060814G>C	uc002shg.2	-	3	575	c.528C>G	c.(526-528)GGC>GGG	p.G176G		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	176	Potential.|Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						TCTCCAAGCTGCCCTGGAGTG	0.448													84	204	---	---	---	---	PASS
ZSWIM2	151112	broad.mit.edu	37	2	187698688	187698688	+	Silent	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187698688C>T	uc002upu.1	-	6	853	c.813G>A	c.(811-813)ACG>ACA	p.T271T		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	271	ZZ-type.				apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			GAAATGTAAACGTGTGGGAAA	0.363													12	306	---	---	---	---	PASS
ASNSD1	54529	broad.mit.edu	37	2	190532647	190532647	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190532647T>A	uc002uqt.2	+	5	2056	c.1622T>A	c.(1621-1623)ATT>AAT	p.I541N		NM_019048	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	541	Asparagine synthetase.				asparagine biosynthetic process|glutamine metabolic process		asparagine synthase (glutamine-hydrolyzing) activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			GACAGAGTTATTGGTGATCAT	0.373													96	216	---	---	---	---	PASS
STAT1	6772	broad.mit.edu	37	2	191864399	191864399	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191864399T>G	uc002usj.2	-	7	882	c.494A>C	c.(493-495)GAT>GCT	p.D165A	STAT1_uc010fse.1_Missense_Mutation_p.D165A|STAT1_uc002usk.2_Missense_Mutation_p.D165A|STAT1_uc002usl.2_Missense_Mutation_p.D167A|STAT1_uc010fsf.1_Missense_Mutation_p.I8L	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription	165					activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	ATCTTGTAAATCTTCCAGGCT	0.388													118	396	---	---	---	---	PASS
STK17B	9262	broad.mit.edu	37	2	197001229	197001229	+	3'UTR	SNP	A	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197001229A>T	uc002utk.2	-	8					STK17B_uc010fsh.2_3'UTR	NM_004226	NP_004217	O94768	ST17B_HUMAN	serine/threonine kinase 17B						apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)			ttttatgcatacttttagaac	0.169													8	11	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47127737	47127737	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47127737C>T	uc003cqs.2	-	11	5398	c.5345G>A	c.(5344-5346)TGG>TAG	p.W1782*	SETD2_uc003cqv.2_Nonsense_Mutation_p.W1849*|SETD2_uc003cqt.1_5'Flank	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1782					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTCTGCCATCCAGATCCACAA	0.478			N|F|S|Mis		clear cell renal carcinoma								12	138	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47164613	47164613	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47164613C>A	uc003cqs.2	-	3	1566	c.1513G>T	c.(1513-1515)GAA>TAA	p.E505*	SETD2_uc003cqv.2_Nonsense_Mutation_p.E494*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	505					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCTCTTCTTTCCATCTCTAAG	0.388			N|F|S|Mis		clear cell renal carcinoma								34	170	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52668817	52668817	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52668817C>A	uc003des.2	-	11	1114	c.1102G>T	c.(1102-1104)GAG>TAG	p.E368*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.E368*|PBRM1_uc003der.2_Nonsense_Mutation_p.E336*|PBRM1_uc003det.2_Nonsense_Mutation_p.E368*|PBRM1_uc003deu.2_Nonsense_Mutation_p.E368*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.E368*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.E368*|PBRM1_uc003dey.2_Nonsense_Mutation_p.E368*|PBRM1_uc003dez.1_Nonsense_Mutation_p.E368*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.E266*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	368					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GACTCTCCCTCTTCATAGCGT	0.373			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								32	64	---	---	---	---	PASS
SPCS1	28972	broad.mit.edu	37	3	52742056	52742056	+	3'UTR	SNP	A	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52742056A>T	uc011bei.1	+	4					GLT8D1_uc003dfj.2_5'Flank|GLT8D1_uc003dfk.2_5'Flank|GLT8D1_uc003dfl.2_5'Flank|GLT8D1_uc003dfm.2_5'Flank|GLT8D1_uc003dfn.2_5'Flank|GLT8D1_uc003dfo.1_5'Flank|GLT8D1_uc010hmm.1_5'Flank	NM_014041	NP_054760	Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	integral to endoplasmic reticulum membrane|microsome|signal peptidase complex	peptidase activity				0				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		CACAAGTATGAAGTTTCTTTC	0.299													4	6	---	---	---	---	PASS
IFT80	57560	broad.mit.edu	37	3	159998570	159998570	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159998570T>C	uc011boy.1	-	15	1982	c.1549A>G	c.(1549-1551)ACA>GCA	p.T517A	IFT80_uc003fda.2_RNA|IFT80_uc003fdb.1_Missense_Mutation_p.T380A|IFT80_uc003fdd.1_Missense_Mutation_p.T200A|IFT80_uc003fde.1_Missense_Mutation_p.T380A	NM_020800	NP_065851	Q9P2H3	IFT80_HUMAN	WD repeat domain 56	517	WD 7.					cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ATATTGCATGTATCGTTCCAT	0.303													5	386	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193052840	193052840	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193052840G>C	uc011bsq.1	-	10	992	c.992C>G	c.(991-993)ACT>AGT	p.T331S		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	331					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CCAAGGCATAGTGTTCTCCAT	0.443													88	271	---	---	---	---	PASS
TAPT1	202018	broad.mit.edu	37	4	16204155	16204155	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16204155A>G	uc010ied.1	-	3	460	c.379T>C	c.(379-381)TTC>CTC	p.F127L	TAPT1_uc011bxe.1_Missense_Mutation_p.F16L|TAPT1_uc003gow.3_Intron	NM_153365	NP_699196	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation	127	Helical; (Potential).					integral to membrane	growth hormone-releasing hormone receptor activity				0						AGCAGGGTGAACACATACAAA	0.353													5	173	---	---	---	---	PASS
GZMK	3003	broad.mit.edu	37	5	54320486	54320486	+	Splice_Site	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54320486A>G	uc003jpl.1	+	2	109	c.65_splice	c.e2-2	p.C22_splice		NM_002104	NP_002095	P49863	GRAK_HUMAN	granzyme K precursor						proteolysis	extracellular region	serine-type endopeptidase activity				0		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CTACTTTTGTAGGTTTCAATA	0.378													4	118	---	---	---	---	PASS
C5orf44	80006	broad.mit.edu	37	5	64960063	64960063	+	Splice_Site	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64960063G>A	uc003jtz.3	+	12	1329	c.999_splice	c.e12-1	p.S333_splice	C5orf44_uc003jua.3_Missense_Mutation_p.S334N|C5orf44_uc003juc.3_Splice_Site_p.S327_splice|C5orf44_uc010iwv.2_Missense_Mutation_p.S328N	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2											ovary(1)	1						TCCTCCAGCAGTGAAAGGACT	0.393													47	180	---	---	---	---	PASS
C5orf44	80006	broad.mit.edu	37	5	64960070	64960070	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64960070G>T	uc003jtz.3	+	12	1335	c.1005G>T	c.(1003-1005)AGG>AGT	p.R335S	C5orf44_uc003jua.3_Missense_Mutation_p.R336S|C5orf44_uc003juc.3_Missense_Mutation_p.R329S|C5orf44_uc010iwv.2_Missense_Mutation_p.R330S	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2	335										ovary(1)	1						GCAGTGAAAGGACTATGGATC	0.398													46	183	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140255005	140255005	+	5'UTR	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140255005C>T	uc003lic.2	+	1					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_5'UTR	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATACCTCAGGCAAGCGATCCC	0.453													29	41	---	---	---	---	PASS
PCYOX1L	78991	broad.mit.edu	37	5	148742273	148742273	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148742273G>C	uc003lqk.2	+	2	224	c.162G>C	c.(160-162)CAG>CAC	p.Q54H	PCYOX1L_uc003lql.2_Missense_Mutation_p.Q37H|PCYOX1L_uc010jgz.2_Missense_Mutation_p.Q37H|PCYOX1L_uc003lqm.2_5'UTR|PCYOX1L_uc003lqn.2_5'UTR	NM_024028	NP_076933	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like precursor	54					prenylcysteine catabolic process	extracellular region	oxidoreductase activity, acting on a sulfur group of donors, oxygen as acceptor			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGGGTGCAGATCGACGTGT	0.622													15	40	---	---	---	---	PASS
STC2	8614	broad.mit.edu	37	5	172755709	172755709	+	5'UTR	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172755709G>T	uc003mco.1	-	1					STC2_uc003mcn.1_5'Flank	NM_003714	NP_003705	O76061	STC2_HUMAN	stanniocalcin 2 precursor						cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGTGCTCCAGGGCAATGGTCG	0.428													3	3	---	---	---	---	PASS
FGFR4	2264	broad.mit.edu	37	5	176520705	176520705	+	Missense_Mutation	SNP	G	T	T	rs141384037		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176520705G>T	uc003mfl.2	+	11	1615	c.1448G>T	c.(1447-1449)CGT>CTT	p.R483L	FGFR4_uc003mfm.2_Missense_Mutation_p.R483L|FGFR4_uc011dfu.1_Missense_Mutation_p.R415L|FGFR4_uc003mfo.2_Missense_Mutation_p.R443L	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	483	Protein kinase.|Cytoplasmic (Potential).				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	CAGGTAGTACGTGCAGAGGCC	0.552										TSP Lung(9;0.080)			7	19	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12164190	12164190	+	Silent	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12164190G>A	uc003nac.2	+	9	7832	c.7653G>A	c.(7651-7653)TTG>TTA	p.L2551L	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2551					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ACATAGCATTGCCCACCTTAA	0.537													10	178	---	---	---	---	PASS
CYP21A2	1589	broad.mit.edu	37	6	31974158	31974158	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31974158A>G	uc010jtp.2	+	3	426	c.308A>G	c.(307-309)AAG>AGG	p.K103R	CYP21A2_uc011dpb.1_Missense_Mutation_p.K73R			P08686	CP21A_HUMAN	SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2; SubName: Full=Cytochrome P450 21-hydroxylase; SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2, isoform CRA_b; SubName: Full=DJ34F7.3 (Cytochrome P450, subfamily XXIA (Steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21, P450c21B)); SubName: Full=cDNA, FLJ95495, Homo sapiens cytochrome P450, family 21, subfamily A, polypeptide 2(CYP21A2), mRNA;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						CTGGTGTCTAAGAACTACCCG	0.607													6	119	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117647553	117647553	+	Silent	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117647553C>T	uc003pxp.1	-	33	5590	c.5391G>A	c.(5389-5391)CAG>CAA	p.Q1797Q	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1797	Fibronectin type-III 9.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AATTCTGGTTCTGTAAATTAT	0.318			T	GOPC|ROS1	glioblastoma|NSCLC								100	232	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143093775	143093775	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143093775T>C	uc003qjd.2	-	5	2844	c.2101A>G	c.(2101-2103)AAG>GAG	p.K701E		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	701					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CCTACGCTCTTCTCTTTCCGG	0.502													6	314	---	---	---	---	PASS
ULBP2	80328	broad.mit.edu	37	6	150267506	150267506	+	Splice_Site	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150267506A>G	uc003qno.2	+	3	423	c.350_splice	c.e3-2	p.E117_splice	ULBP2_uc011eeh.1_Splice_Site_p.E117_splice|ULBP2_uc010kij.2_Splice_Site_p.E117_splice	NM_025217	NP_079493	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2 precursor						antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|cell surface|extracellular space|MHC class I protein complex	MHC class I receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		TGATGGGGGCAGAACCCCTCA	0.512													40	100	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163985877	163985877	+	Intron	SNP	T	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163985877T>A	uc003qui.2	+						QKI_uc003que.2_3'UTR|QKI_uc003quf.2_3'UTR|QKI_uc003qug.2_Intron|QKI_uc003quh.2_3'UTR|QKI_uc003quj.2_Intron	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		GTATATGACCTTGGTGCTGCA	0.323													10	21	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163985878	163985878	+	Intron	SNP	T	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163985878T>A	uc003qui.2	+						QKI_uc003que.2_3'UTR|QKI_uc003quf.2_3'UTR|QKI_uc003qug.2_Intron|QKI_uc003quh.2_3'UTR|QKI_uc003quj.2_Intron	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		TATATGACCTTGGTGCTGCAT	0.328													10	21	---	---	---	---	PASS
RNF216	54476	broad.mit.edu	37	7	5781254	5781254	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5781254C>A	uc003soy.1	-	4	413	c.223G>T	c.(223-225)GGT>TGT	p.G75C	RNF216_uc010ksz.1_5'UTR|RNF216_uc010kta.1_Intron|RNF216_uc011jwj.1_Intron|RNF216_uc003sox.1_Missense_Mutation_p.G132C	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	75					apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		AGAAATTCACCGTAGTCATCC	0.458													5	370	---	---	---	---	PASS
NUPL2	11097	broad.mit.edu	37	7	23235476	23235476	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23235476C>A	uc003svu.2	+	4	723	c.464C>A	c.(463-465)CCA>CAA	p.P155Q	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_Missense_Mutation_p.P32Q|NUPL2_uc011jyw.1_Intron|NUPL2_uc003svx.2_Missense_Mutation_p.P32Q|NUPL2_uc011jyx.1_5'UTR	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	155	Interaction with HIV-1 Vpr.				carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3						GACATTTCACCAGAGGAATTG	0.328													5	420	---	---	---	---	PASS
ZNF3	7551	broad.mit.edu	37	7	99673093	99673093	+	Intron	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99673093G>T	uc003usq.2	-						ZNF3_uc003usp.2_Intron|ZNF3_uc003usr.2_Intron|ZNF3_uc010lgj.2_Intron|ZNF3_uc003uss.2_5'UTR|ZNF3_uc003ust.3_Intron	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2						cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			GGAGATCAGGGTTTAAAGCTC	0.522													13	57	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95538684	95538684	+	Silent	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95538684T>C	uc003ygo.1	-	8	1801	c.1788A>G	c.(1786-1788)AGA>AGG	p.R596R	KIAA1429_uc003ygp.2_Silent_p.R596R|KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	596					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CTGGGTTTGTTCTCTCAAGTC	0.398													6	423	---	---	---	---	PASS
HAS2	3037	broad.mit.edu	37	8	122626384	122626384	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122626384T>C	uc003yph.2	-	4	2162	c.1624A>G	c.(1624-1626)AAG>GAG	p.K542E		NM_005328	NP_005319	Q92819	HAS2_HUMAN	hyaluronan synthase 2	542	Extracellular (Potential).					integral to plasma membrane	hyaluronan synthase activity		HAS2/PLAG1(10)	soft_tissue(10)|ovary(5)	15	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TGTTGTCCCTTCTTCCGCCTG	0.433													5	179	---	---	---	---	PASS
DCAF12	25853	broad.mit.edu	37	9	34088448	34088448	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34088448A>G	uc003ztt.2	-	9	1604	c.1262T>C	c.(1261-1263)GTT>GCT	p.V421A		NM_015397	NP_056212	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	421						centrosome|CUL4 RING ubiquitin ligase complex					0						GTGGGTGTAAACAGCATTGGG	0.478													6	200	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68414556	68414556	+	RNA	SNP	G	T	T	rs145693434		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68414556G>T	uc004aex.2	+	1		c.1111G>T								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		cagcacatctgttaatagcat	0.005													3	8	---	---	---	---	PASS
OGN	4969	broad.mit.edu	37	9	95165751	95165751	+	5'UTR	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95165751A>G	uc004asa.2	-	2					CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|OGN_uc004asb.2_5'UTR|OGN_uc011ltx.1_Intron	NM_014057	NP_054776	P20774	MIME_HUMAN	osteoglycin preproprotein							extracellular space|proteinaceous extracellular matrix	growth factor activity				0						TGTGGGACAAAACTCTCTTTT	0.418													24	83	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135202962	135202962	+	Silent	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135202962T>C	uc004cbk.2	-	10	4206	c.4023A>G	c.(4021-4023)AAA>AAG	p.K1341K	SETX_uc004cbj.2_Silent_p.K960K|SETX_uc010mzt.2_Silent_p.K960K	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1341					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TAGTCAGAAGTTTCTTATTAT	0.353													6	249	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	375379	375379	+	Silent	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:375379G>T	uc001ifp.2	-	30	3837	c.3747C>A	c.(3745-3747)TCC>TCA	p.S1249S		NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	1249						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTACCTTGAGGGACTCTGTTT	0.547													15	53	---	---	---	---	PASS
TAF5	6877	broad.mit.edu	37	10	105139365	105139365	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105139365G>C	uc001kwv.2	+	4	1137	c.1114G>C	c.(1114-1116)GTA>CTA	p.V372L	TAF5_uc010qqq.1_Missense_Mutation_p.V372L	NM_006951	NP_008882	Q15542	TAF5_HUMAN	TBP-associated factor 5	372					histone acetylation|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|transcription factor TFIID complex|transcription factor TFTC complex	protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)	2		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TGACTTGTAGGTATTTTTTGG	0.284													80	182	---	---	---	---	PASS
C10orf118	55088	broad.mit.edu	37	10	115891039	115891039	+	Silent	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115891039T>C	uc001lbb.1	-	12	2620	c.1968A>G	c.(1966-1968)CAA>CAG	p.Q656Q	C10orf118_uc009xyd.1_Silent_p.Q254Q|C10orf118_uc001lbc.1_Silent_p.Q656Q|C10orf118_uc009xye.1_RNA	NM_018017	NP_060487	Q7Z3E2	CJ118_HUMAN	CTCL tumor antigen L14-2	656	Potential.									ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		CGAGTTCAGCTTGCAGAGTTT	0.373													7	548	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068523	5068523	+	Silent	SNP	A	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068523A>T	uc010qyv.1	+	1	768	c.768A>T	c.(766-768)TCA>TCT	p.S256S		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	256	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATATCCCTTCAGTCTTCTCTT	0.458													105	321	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18738394	18738394	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18738394G>T	uc009yht.2	-	10	1317	c.1127C>A	c.(1126-1128)ACG>AAG	p.T376K	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	376										ovary(4)|large_intestine(2)|kidney(1)	7						TTCGGACACCGTGATTTCATA	0.512													62	205	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66476394	66476394	+	Silent	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66476394C>T	uc001ojd.2	-	10	1242	c.1170G>A	c.(1168-1170)CGG>CGA	p.R390R		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	390	Spectrin 1.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CCGAGATGAGCCGGCCCTCGC	0.622													4	77	---	---	---	---	PASS
CWC15	51503	broad.mit.edu	37	11	94699556	94699556	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94699556C>T	uc001pfd.3	-	6	586	c.463G>A	c.(463-465)GAA>AAA	p.E155K		NM_016403	NP_057487	Q9P013	CWC15_HUMAN	CWC15 homolog	155	Potential.				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome	protein binding|RNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATCCTCTCTTCTTCAGCTTTT	0.378													5	635	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	102991435	102991435	+	Silent	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102991435G>T	uc001pho.2	+	8	1296	c.1152G>T	c.(1150-1152)GCG>GCT	p.A384A	DYNC2H1_uc001phn.1_Silent_p.A384A|DYNC2H1_uc009yxe.1_Silent_p.A384A	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	384	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GGAAAGCTGCGGTGTCTCAAT	0.274													5	230	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92119	92119	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92119T>C	uc010sdi.1	-	2	219	c.191A>G	c.(190-192)CAC>CGC	p.H64R	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		CGCCAGGCAGTGGTGCAGCTG	0.592													3	4	---	---	---	---	PASS
B4GALNT3	283358	broad.mit.edu	37	12	657232	657232	+	Silent	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:657232G>A	uc001qii.1	+	8	750	c.750G>A	c.(748-750)AAG>AAA	p.K250K	B4GALNT3_uc001qij.1_Silent_p.K152K	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta	250	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TGCTGCACAAGCAGAATGAGG	0.632													6	15	---	---	---	---	PASS
CLEC4C	170482	broad.mit.edu	37	12	7890118	7890118	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7890118A>T	uc001qtg.1	-	4	462	c.288T>A	c.(286-288)TTT>TTA	p.F96L	CLEC4C_uc001qth.1_Missense_Mutation_p.F96L|CLEC4C_uc001qti.1_Missense_Mutation_p.F65L	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform	96	Extracellular (Potential).|C-type lectin.				innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		CAGTAGAAATAAAGTAGCAAC	0.418													33	116	---	---	---	---	PASS
TAS2R30	259293	broad.mit.edu	37	12	11286335	11286335	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11286335C>T	uc009zhs.1	-	1	509	c.509G>A	c.(508-510)AGT>AAT	p.S170N	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_001097643	NP_001091112			type 2 taste receptor member 30												0						GTACATTGCACTCCTCAATTT	0.373													5	425	---	---	---	---	PASS
GOLT1B	51026	broad.mit.edu	37	12	21660962	21660962	+	Intron	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21660962G>A	uc001rez.2	+						GOLT1B_uc009zis.2_RNA|GOLT1B_uc009zit.2_Intron|GOLT1B_uc009ziu.2_Intron	NM_016072	NP_057156	Q9Y3E0	GOT1B_HUMAN	golgi transport 1 homolog B						positive regulation of I-kappaB kinase/NF-kappaB cascade|protein transport|vesicle-mediated transport	endoplasmic reticulum|Golgi membrane|integral to membrane	signal transducer activity				0						TCCTCTTTATGCCTTGCCAAC	0.428													3	5	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22068794	22068794	+	Silent	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22068794G>T	uc001rfi.1	-	5	644	c.624C>A	c.(622-624)CTC>CTA	p.L208L	ABCC9_uc001rfh.2_Silent_p.L208L|ABCC9_uc001rfj.1_Silent_p.L208L	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	208	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CCAGATCCTGGAGGTCTTCAG	0.368													62	147	---	---	---	---	PASS
TIMELESS	8914	broad.mit.edu	37	12	56814886	56814886	+	Silent	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56814886G>A	uc001slf.2	-	24	3069	c.2901C>T	c.(2899-2901)TGC>TGT	p.C967C		NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog	967					cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						GATCTTCCTGGCAAAAATCTT	0.493													5	222	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88519108	88519108	+	Silent	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88519108G>T	uc001tar.2	-	13	1448	c.1104C>A	c.(1102-1104)ACC>ACA	p.T368T	CEP290_uc001tat.2_Silent_p.T130T|CEP290_uc009zsl.1_RNA	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	368	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						CTACTTGTTCGGTGAGCATCT	0.269													5	460	---	---	---	---	PASS
ALDH2	217	broad.mit.edu	37	12	112221085	112221085	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112221085G>A	uc001tst.2	+	3	784	c.343G>A	c.(343-345)GAC>AAC	p.D115N	ALDH2_uc010syi.1_Intron|ALDH2_uc009zvy.2_Missense_Mutation_p.D115N	NM_000690	NP_000681	P05091	ALDH2_HUMAN	mitochondrial aldehyde dehydrogenase 2	115					carbohydrate metabolic process|ethanol oxidation|neurotransmitter biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase|electron carrier activity			skin(2)|ovary(1)|central_nervous_system(1)	4					Disulfiram(DB00822)|Guanidine(DB00536)|NADH(DB00157)|Nitroglycerin(DB00727)	GATCGAGCGGGACCGGACCTA	0.662			T	HMGA2	leiomyoma								7	7	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120574466	120574466	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120574466G>A	uc001txo.2	-	51	6861	c.6848C>T	c.(6847-6849)GCA>GTA	p.A2283V		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	2283	HEAT 20.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCTTTGGCTGCCTCCTCCTT	0.602													5	22	---	---	---	---	PASS
P2RX4	5025	broad.mit.edu	37	12	121666342	121666342	+	Silent	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121666342T>C	uc001tzr.2	+	6	835	c.531T>C	c.(529-531)GCT>GCC	p.A177A	P2RX4_uc010szr.1_RNA|P2RX4_uc010szs.1_RNA|P2RX4_uc009zxc.2_Silent_p.A150A|P2RX4_uc001tzs.2_Silent_p.A193A|P2RX4_uc009zxb.2_RNA|P2RX4_uc010szt.1_Silent_p.A76A	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4	177	Extracellular (Potential).				endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCAGACCTGCTTTTTTAAAGG	0.284													7	375	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124191585	124191585	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124191585C>T	uc001ufp.2	+	17	2077	c.1949C>T	c.(1948-1950)CCG>CTG	p.P650L	TCTN2_uc009zya.2_Missense_Mutation_p.P649L	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	650	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		GTGTGTTGGCCGCAGCTTCTA	0.328													5	537	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33275559	33275559	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33275559G>A	uc010abf.2	+	17	1998	c.1840G>A	c.(1840-1842)GAT>AAT	p.D614N	PDS5B_uc010abg.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	614					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TGTGCACATAGATACCGAATC	0.388													23	174	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42249387	42249387	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42249387A>G	uc001uyj.2	-	36	4443	c.4373T>C	c.(4372-4374)CTT>CCT	p.L1458P		NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	1458						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		CTTTGATTGAAGATCAGTGAC	0.338													7	701	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45644604	45644604	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45644604A>G	uc001wwd.3	+	14	2746	c.2647A>G	c.(2647-2649)AAT>GAT	p.N883D	FANCM_uc010anf.2_Missense_Mutation_p.N857D|FANCM_uc001wwe.3_Missense_Mutation_p.N419D|FANCM_uc010ang.2_Missense_Mutation_p.N97D	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	883					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						TAATGACAGAAATTCCACTGT	0.269								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	150	---	---	---	---	PASS
TDP1	55775	broad.mit.edu	37	14	90451507	90451507	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90451507T>C	uc001xxy.2	+	10	1383	c.1084T>C	c.(1084-1086)TTT>CTT	p.F362L	TDP1_uc010atm.2_RNA|TDP1_uc001xxz.2_Missense_Mutation_p.F362L|TDP1_uc010atn.2_Missense_Mutation_p.F362L|TDP1_uc001xya.2_Missense_Mutation_p.F123L|TDP1_uc001xyb.2_RNA|TDP1_uc010ato.2_Missense_Mutation_p.F362L|TDP1_uc001xyd.1_5'UTR	NM_018319	NP_060789	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	362					cell death|double-strand break repair|single strand break repair	cytoplasm|nucleus	3'-tyrosyl-DNA phosphodiesterase activity|double-stranded DNA binding|exonuclease activity|protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		CCCAGGACGCTTTCAAGGAAG	0.264								Repair_of_DNA-protein_crosslinks					8	429	---	---	---	---	PASS
IFI27L2	83982	broad.mit.edu	37	14	94594972	94594972	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94594972C>A	uc001ycq.2	-	3	134	c.78G>T	c.(76-78)ATG>ATT	p.M26I		NM_032036	NP_114425	Q9H2X8	I27L2_HUMAN	TLH29 protein precursor	26						integral to membrane					0						CAGTGAAGCCCATGGCACTGA	0.657													8	18	---	---	---	---	PASS
NF1P1	440225	broad.mit.edu	37	15	21134224	21134224	+	RNA	SNP	C	T	T	rs74394645		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21134224C>T	uc001ytv.1	-	2		c.282G>A								Human NF1-related locus DNA in A9 mouse DNA background.												0						ACCACACTGGCCAGAGCCATC	0.378													6	209	---	---	---	---	PASS
OR4N4	283694	broad.mit.edu	37	15	22332432	22332432	+	Translation_Start_Site	SNP	C	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22332432C>T	uc001yuc.1	+	3	239	c.-742C>T	c.(-744--740)AACGT>AATGT		LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		AAGATTCTAACGTGACAGAAC	0.328													36	493	---	---	---	---	PASS
OR4N4	283694	broad.mit.edu	37	15	22332492	22332492	+	5'UTR	SNP	A	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22332492A>C	uc001yuc.1	+	3					LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TATTTCTCTTATTACTATTTT	0.383													8	532	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	62978977	62978977	+	Silent	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62978977A>G	uc002alb.3	+	9	1095	c.1095A>G	c.(1093-1095)TCA>TCG	p.S365S		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	365	FERM.|Interaction with PIP5K1C (By similarity).				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						GGGCAGCCTCACCCAAGAGCT	0.582													7	19	---	---	---	---	PASS
RPGRIP1L	23322	broad.mit.edu	37	16	53690436	53690436	+	Silent	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53690436T>C	uc002ehp.2	-	14	1711	c.1647A>G	c.(1645-1647)GAA>GAG	p.E549E	RPGRIP1L_uc002eho.3_Silent_p.E549E|RPGRIP1L_uc010vgy.1_Silent_p.E549E|RPGRIP1L_uc010cbx.2_Silent_p.E549E|RPGRIP1L_uc010vgz.1_Silent_p.E549E	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	549	Potential.				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				GAACATACTGTTCCACTTTGA	0.363													7	443	---	---	---	---	PASS
SETD6	79918	broad.mit.edu	37	16	58550759	58550759	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58550759C>G	uc002ens.2	+	5	778	c.719C>G	c.(718-720)TCC>TGC	p.S240C	SETD6_uc010cdl.2_Missense_Mutation_p.S240C|SETD6_uc002enr.2_Missense_Mutation_p.S216C|SETD6_uc010cdm.2_RNA|SETD6_uc010vij.1_Missense_Mutation_p.S164C	NM_001160305	NP_001153777	Q8TBK2	SETD6_HUMAN	SET domain containing 6 isoform a	240	SET.				negative regulation of NF-kappaB transcription factor activity|peptidyl-lysine monomethylation|regulation of inflammatory response	nucleus	NF-kappaB binding|protein-lysine N-methyltransferase activity			ovary(1)	1						GAGCCCAACTCCCCCGTGATG	0.532													51	151	---	---	---	---	PASS
ACSF3	197322	broad.mit.edu	37	16	89178505	89178505	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89178505G>A	uc002fmp.2	+	5	1168	c.828G>A	c.(826-828)TGG>TGA	p.W276*	ACSF3_uc010cig.1_Nonsense_Mutation_p.W276*|ACSF3_uc010cih.1_Nonsense_Mutation_p.W11*|ACSF3_uc002fmq.1_RNA|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_Nonsense_Mutation_p.W11*	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor	276					fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CGTAGGTTTGGGAAAAGTTCT	0.522													4	101	---	---	---	---	PASS
CRYBA1	1411	broad.mit.edu	37	17	27581416	27581416	+	3'UTR	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27581416T>C	uc002hdw.2	+	6						NM_005208	NP_005199	P05813	CRBA1_HUMAN	crystallin, beta A3						visual perception	soluble fraction	structural constituent of eye lens				0			BRCA - Breast invasive adenocarcinoma(11;3.3e-05)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			GAGACCTTGCTAAGCACTCTA	0.383													5	68	---	---	---	---	PASS
ZFP112	7771	broad.mit.edu	37	19	44833885	44833885	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44833885G>T	uc010ejj.2	-	5	556	c.443C>A	c.(442-444)CCA>CAA	p.P148Q	ZFP112_uc002ozc.3_Missense_Mutation_p.P142Q|ZFP112_uc010xwy.1_Missense_Mutation_p.P165Q|ZFP112_uc010xwz.1_Missense_Mutation_p.P147Q	NM_001083335	NP_001076804	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 1	148					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						AATCTGAACTGGTATTCCTGC	0.398													4	125	---	---	---	---	PASS
BCAM	4059	broad.mit.edu	37	19	45324077	45324077	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45324077G>A	uc002ozu.2	+	14	1923	c.1879G>A	c.(1879-1881)GAG>AAG	p.E627K		NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	627	Cytoplasmic (Potential).				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CTTCGGAGACGAGGTGGGTGA	0.706													4	4	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53856702	53856702	+	Missense_Mutation	SNP	G	A	A	rs150688663	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53856702G>A	uc010ydv.1	+	4	2891	c.2774G>A	c.(2773-2775)CGT>CAT	p.R925H	ZNF845_uc010ydw.1_Missense_Mutation_p.R925H	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	925	C2H2-type 26.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAACCTTCCGTCACAATTCA	0.363													4	74	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53856730	53856730	+	Silent	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53856730G>A	uc010ydv.1	+	4	2919	c.2802G>A	c.(2800-2802)AAG>AAA	p.K934K	ZNF845_uc010ydw.1_Silent_p.K934K	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	934	C2H2-type 26.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TAATTCATAAGACAATTCATA	0.368													4	65	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1585397	1585397	+	Intron	SNP	T	C	C	rs148754551	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1585397T>C	uc010gai.2	-						SIRPB1_uc002wfk.3_Intron|SIRPB1_uc002wfl.3_Missense_Mutation_p.T248A	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1						cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						CCTCGGATGGTCTCAGACAAG	0.627													7	28	---	---	---	---	PASS
SIRPB1	10326	broad.mit.edu	37	20	1585446	1585446	+	Intron	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1585446G>A	uc010gai.2	-						SIRPB1_uc002wfk.3_Intron|SIRPB1_uc002wfl.3_Silent_p.H231H	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1						cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						GCAAGGTGACGTGGGCCACCT	0.617													7	44	---	---	---	---	PASS
ADAM33	80332	broad.mit.edu	37	20	3655259	3655259	+	Silent	SNP	G	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3655259G>A	uc002wit.2	-	6	579	c.492C>T	c.(490-492)CAC>CAT	p.H164H	ADAM33_uc002wir.1_Silent_p.H164H|ADAM33_uc002wis.2_5'Flank|ADAM33_uc002wiu.2_Silent_p.H164H|ADAM33_uc002wiw.1_Intron|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Intron|ADAM33_uc002wix.1_Intron|ADAM33_uc010zqg.1_Silent_p.H176H|ADAM33_uc010zqh.1_Silent_p.H164H	NM_025220	NP_079496	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33 isoform alpha	164	Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|ovary(1)|skin(1)	4						GAAAGATCTCGTGGGTTGAGA	0.607													12	24	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29632641	29632641	+	Intron	SNP	A	G	G	rs6087298		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29632641A>G	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010ztk.1_Silent_p.K74K					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						AAGACCACAAACTTAAAATAA	0.294													5	86	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29633987	29633987	+	Intron	SNP	T	A	A	rs4006817		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633987T>A	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CTGAATAAAATATTCAGAGGA	0.308													14	221	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11026767	11026767	+	3'UTR	SNP	T	C	C	rs56385395		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11026767T>C	uc002yit.1	-	8					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGCTTTGACCTGCCTCGGCCA	0.473													4	19	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11026782	11026782	+	3'UTR	SNP	G	A	A	rs61196222	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11026782G>A	uc002yit.1	-	8					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CGGCCACCTCGCCCCGACAGT	0.498													4	19	---	---	---	---	PASS
SLC25A18	83733	broad.mit.edu	37	22	18072420	18072420	+	Silent	SNP	C	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18072420C>A	uc002zmp.1	+	10	1289	c.795C>A	c.(793-795)ACC>ACA	p.T265T	SLC25A18_uc002zmq.1_Silent_p.T265T	NM_031481	NP_113669	Q9H1K4	GHC2_HUMAN	solute carrier	265	Solcar 3.					integral to membrane|mitochondrial inner membrane	binding|symporter activity				0				Lung(27;0.124)	L-Glutamic Acid(DB00142)	GTGGGATCACCGACTGTGCCA	0.488													4	132	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24563174	24563174	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24563174C>A	uc002zzi.1	+	32	5702	c.5575C>A	c.(5575-5577)CTT>ATT	p.L1859I	CABIN1_uc002zzj.1_Missense_Mutation_p.L1780I|CABIN1_uc002zzl.1_Missense_Mutation_p.L1859I|CABIN1_uc002zzm.1_Missense_Mutation_p.L284I	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1859					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AGGCAAGACACTTCTGTTGGA	0.627													9	19	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24810575	24810575	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24810575A>G	uc002zzw.2	+	17	3645	c.3338A>G	c.(3337-3339)AAG>AGG	p.K1113R	CYTSA_uc002zzv.3_Missense_Mutation_p.K1113R|CYTSA_uc011ajq.1_Missense_Mutation_p.K1074R	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	1113	CH.				cell cycle|cell division						0						GCGATCTACAAGTACTTTGAG	0.567													4	64	---	---	---	---	PASS
PDK3	5165	broad.mit.edu	37	X	24537120	24537120	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24537120A>C	uc004dbg.2	+	6	895	c.666A>C	c.(664-666)GAA>GAC	p.E222D	PDK3_uc004dbh.2_Missense_Mutation_p.E222D	NM_005391	NP_005382	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase 3 isoform 2	222	Histidine kinase.				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|protein binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						AAGTTGAAGAATTCAATGGTA	0.358													48	44	---	---	---	---	PASS
PGK1	5230	broad.mit.edu	37	X	77373615	77373615	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77373615T>A	uc004ecz.3	+	6	761	c.589T>A	c.(589-591)TTT>ATT	p.F197I	PGK1_uc010nlz.2_RNA|PGK1_uc011mqq.1_Missense_Mutation_p.F169I	NM_000291	NP_000282	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	197					gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			upper_aerodigestive_tract(1)|ovary(1)	2						GCTGAACTACTTTGCAAAGGC	0.468													130	103	---	---	---	---	PASS
KCNE1L	23630	broad.mit.edu	37	X	108868069	108868069	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108868069G>T	uc004eoh.2	-	1	325	c.181C>A	c.(181-183)CTC>ATC	p.L61I		NM_012282	NP_036414	Q9UJ90	KCE1L_HUMAN	potassium voltage-gated channel, Isk-related	61	Helical; (Potential).				regulation of heart contraction	voltage-gated potassium channel complex					0						AGGATGTAGAGATAGGCGTCG	0.662													4	1	---	---	---	---	PASS
FAM45B	55855	broad.mit.edu	37	X	129629308	129629308	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129629308T>C	uc010nrh.2	+	1	394	c.176T>C	c.(175-177)TTT>TCT	p.F59S	uc004evu.2_Intron	NM_207009	NP_996892			hypothetical protein LOC404636											skin(1)	1				all cancers(201;0.0293)		CTCCATCCCTTTGTCTTTGGT	0.398													5	227	---	---	---	---	PASS
MORN1	79906	broad.mit.edu	37	1	2271665	2271665	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2271665delC	uc001ajb.1	-						MORN1_uc009vld.2_Intron	NM_024848	NP_079124	Q5T089	MORN1_HUMAN	MORN repeat containing 1											ovary(2)|central_nervous_system(1)	3	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		GTGGTCACCTCGCTTCCCATG	0.662													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4038985	4038985	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4038985delG								LOC100133612 (205108 upstream) : LOC284661 (433126 downstream)																							tggaggtacaggggattttgc	0.040													4	2	---	---	---	---	
NPHP4	261734	broad.mit.edu	37	1	5923707	5923707	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5923707delA	uc001alq.1	-						NPHP4_uc001alr.1_3'UTR	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TGAGCTGTCTAACATTACCAT	0.507													4	2	---	---	---	---	
ICMT	23463	broad.mit.edu	37	1	6298157	6298157	+	5'Flank	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6298157delA	uc001amk.2	-						ICMT_uc001aml.2_5'Flank|uc001amm.2_Intron	NM_012405	NP_036537	O60725	ICMT_HUMAN	isoprenylcysteine carboxyl methyltransferase						protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane|membrane fraction	protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;2.4e-22)|all_lung(118;2.65e-08)|Lung NSC(185;6.45e-07)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000688)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;5.52e-38)|GBM - Glioblastoma multiforme(13;6.51e-32)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;7.08e-08)|COAD - Colon adenocarcinoma(227;8.35e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GGCGGGAGGGAGAAAGGCTGA	0.632													4	2	---	---	---	---	
SPSB1	80176	broad.mit.edu	37	1	9388844	9388845	+	Intron	DEL	CC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9388844_9388845delCC	uc010oae.1	+							NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		GCTGgggcttcccaacatggca	0.257													4	2	---	---	---	---	
SPSB1	80176	broad.mit.edu	37	1	9409222	9409222	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9409222delC	uc010oae.1	+							NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		GGGTGTGTATCCCTCTGCAGG	0.607													4	2	---	---	---	---	
KIF1B	23095	broad.mit.edu	37	1	10348765	10348766	+	Intron	INS	-	TTTT	TTTT	rs142049440	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10348765_10348766insTTTT	uc001aqx.3	+						KIF1B_uc001aqv.3_Intron|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTTCATCTTTCTCtttttttta	0.366													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18187776	18187776	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18187776delC								ACTL8 (34220 upstream) : IGSF21 (246464 downstream)																							CTCATGTTCTCCACCTGAACT	0.398													4	2	---	---	---	---	
PAX7	5081	broad.mit.edu	37	1	18983897	18983897	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18983897delA	uc001bay.2	+						PAX7_uc001baz.2_Intron|PAX7_uc010oct.1_Intron	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1						anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		ACCTTCCATGAAAAAAAAAAA	0.488			T	FOXO1A	alveolar rhabdomyosarcoma								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	28628267	28628267	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28628267delA								SESN2 (19266 upstream) : MED18 (27246 downstream)																							ttctaaaactaagtgtggtga	0.005													4	2	---	---	---	---	
LAPTM5	7805	broad.mit.edu	37	1	31225420	31225421	+	Intron	INS	-	CCT	CCT			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31225420_31225421insCCT	uc001bsc.2	-							NM_006762	NP_006753	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5						transport	integral to plasma membrane|lysosomal membrane					0		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		taagactcagacctcctccaag	0.000													4	2	---	---	---	---	
MTF1	4520	broad.mit.edu	37	1	38286018	38286018	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38286018delA	uc001cce.1	-							NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GCCACCCAACAAACCATTAGT	0.289													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39873635	39873635	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39873635delT	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|KIAA0754_uc009vvt.1_5'Flank	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGGGTTGCCCTTTGTACTTTC	0.463													4	2	---	---	---	---	
RLF	6018	broad.mit.edu	37	1	40648426	40648429	+	Intron	DEL	TAGA	-	-	rs57937021		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40648426_40648429delTAGA	uc001cfc.3	+							NM_012421	NP_036553	Q13129	RLF_HUMAN	rearranged L-myc fusion						chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			gatagataggtagatagatagata	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41900901	41900901	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41900901delC								SCMH1 (193113 upstream) : EDN2 (43548 downstream)																							tgtgttctcaccataacatca	0.000													4	2	---	---	---	---	
PTPRF	5792	broad.mit.edu	37	1	44065404	44065405	+	Intron	INS	-	G	G	rs151065860	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44065404_44065405insG	uc001cjr.2	+						PTPRF_uc001cjs.2_Intron|PTPRF_uc001cju.2_Intron|PTPRF_uc009vwt.2_Intron|PTPRF_uc001cjv.2_Intron|PTPRF_uc001cjw.2_Intron	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTTGGAATGCTGGGGGGTTATG	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	44103209	44103209	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44103209delG								PTPRF (13867 upstream) : KDM4A (12588 downstream)																							cagattggaaggggcaggagc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	46965387	46965387	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46965387delG								FAAH (85867 upstream) : DMBX1 (7281 downstream)																							gatctgggctgggggcggggt	0.015													4	2	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49225201	49225201	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49225201delC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crx.3_Intron|BEND5_uc001crw.3_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		acactggtttcccaggcctgc	0.189													4	2	---	---	---	---	
JAK1	3716	broad.mit.edu	37	1	65412055	65412055	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65412055delA	uc001dbu.1	-						JAK1_uc009wam.1_Intron	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		gcaaataagtaaatggtggct	0.114			Mis		ALL								4	2	---	---	---	---	
HIAT1	64645	broad.mit.edu	37	1	100515993	100515993	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100515993delT	uc001dst.2	+							NM_033055	NP_149044	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1						transmembrane transport	integral to membrane|plasma membrane	transporter activity				0		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TCTAAGCTGATTTTACCCAAA	0.383													4	2	---	---	---	---	
GDAP2	54834	broad.mit.edu	37	1	118429438	118429439	+	Intron	INS	-	ACA	ACA	rs143592216	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118429438_118429439insACA	uc001ehf.2	-						GDAP2_uc001ehg.2_Intron	NM_017686	NP_060156	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated											ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CTACTCTGCAGACAACACCTAT	0.307													21	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121122246	121122247	+	Intron	INS	-	A	A	rs144131281	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121122246_121122247insA	uc001eis.2	+							NM_001042758	NP_001036223			SLIT-ROBO Rho GTPase activating protein 2																		cttatggccatatagctGATTT	0.168													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142782988	142782988	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142782988delC	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		ATACCTCTGACCCAGGGGTGC	0.473													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145054268	145054269	+	Intron	INS	-	G	G	rs149978567		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145054268_145054269insG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TGTGGTTACCTTCATTCATTTA	0.386													3	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145230442	145230442	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145230442delA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		attgttttttaaactgcagat	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	150541013	150541013	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150541013delG								ADAMTSL4 (7603 upstream) : MCL1 (6024 downstream)																							AACAGGATCAGGGAGAGTGGA	0.448													4	2	---	---	---	---	
PRUNE	58497	broad.mit.edu	37	1	150996972	150996972	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150996972delA	uc001ewh.1	+						PRUNE_uc001ewi.1_Intron|PRUNE_uc010pco.1_Intron|PRUNE_uc001ewj.1_Intron|PRUNE_uc001ewk.1_5'Flank	NM_021222	NP_067045	Q86TP1	PRUNE_HUMAN	prune							cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			actccgtctcaaaaaaaaaaa	0.209													5	4	---	---	---	---	
IL6R	3570	broad.mit.edu	37	1	154388959	154388959	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154388959delT	uc001fez.1	+						IL6R_uc001ffa.1_Intron	NM_000565	NP_000556	P08887	IL6RA_HUMAN	interleukin 6 receptor isoform 1 precursor						acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CACTGATGTATTTTTAATGCC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159440131	159440132	+	5'Flank	INS	-	AG	AG			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159440131_159440132insAG	uc001fts.3	-											Homo sapiens, clone IMAGE:3917623, mRNA.																		actactttctaagaatacaaga	0.000													7	4	---	---	---	---	
ADAMTS4	9507	broad.mit.edu	37	1	161167500	161167500	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161167500delT	uc001fyt.3	-						ADAMTS4_uc001fyu.2_Intron|NDUFS2_uc001fyv.2_5'Flank	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CAGTAGGAGATGCCATGGCCA	0.572													4	2	---	---	---	---	
PBX1	5087	broad.mit.edu	37	1	164676900	164676900	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164676900delA	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						CCTTTTTGGGAAAAGGGAAAA	0.468			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	2	---	---	---	---	
RXRG	6258	broad.mit.edu	37	1	165375119	165375119	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165375119delG	uc001gda.2	-							NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	AGTCTCTTCTGGACAATTGCT	0.428													4	2	---	---	---	---	
FAM78B	149297	broad.mit.edu	37	1	166132097	166132097	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166132097delT	uc001gdr.2	-						FAM78B_uc010plc.1_Intron	NM_001017961	NP_001017961	Q5VT40	FA78B_HUMAN	hypothetical protein LOC149297											central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					tacctccatatttttgctggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177262807	177262807	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177262807delT								FAM5B (11250 upstream) : SEC16B (634682 downstream)																							cacttgctactttttgctaat	0.000													4	2	---	---	---	---	
FAM163A	148753	broad.mit.edu	37	1	179759090	179759090	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179759090delG	uc009wxj.2	+						FAM163A_uc001gnj.2_Intron|FAM163A_uc009wxk.2_Intron	NM_173509	NP_775780	Q96GL9	F163A_HUMAN	hypothetical protein LOC148753							integral to membrane				ovary(1)	1						TTTATGTAGTGGGCAATAGCA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189471073	189471073	+	IGR	DEL	C	-	-	rs68065353		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189471073delC								None (None upstream) : FAM5C (595724 downstream)																							GTTGTATGAACAAAATCTCAC	0.318													4	3	---	---	---	---	
KIF21B	23046	broad.mit.edu	37	1	200989947	200989948	+	Intron	INS	-	CG	CG			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200989947_200989948insCG	uc001gvs.1	-						KIF21B_uc001gvr.1_Intron|KIF21B_uc009wzl.1_Intron|KIF21B_uc010ppn.1_Intron	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						acacacacacacacacacacac	0.431													4	2	---	---	---	---	
KDM5B	10765	broad.mit.edu	37	1	202764918	202764918	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202764918delT	uc001gyf.2	-						KDM5B_uc009xag.2_Intron|KDM5B_uc001gyg.1_Intron	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B						negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						CCTAATTAACTTTTTTTTTTT	0.289													3	3	---	---	---	---	
PLXNA2	5362	broad.mit.edu	37	1	208326113	208326113	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208326113delT	uc001hgz.2	-							NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TACTCCTCAGTTTGTCATTCA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215416008	215416009	+	IGR	INS	-	C	C	rs72509568		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215416008_215416009insC								KCNK2 (5573 upstream) : KCTD3 (324726 downstream)																							ggaaatcaatgtgaggggatgc	0.040													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229307943	229307944	+	IGR	DEL	CA	-	-	rs35281244		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229307943_229307944delCA								RHOU (425534 upstream) : RAB4A (98935 downstream)																							GCTGCTTTCTCAGTGTCTTCTC	0.470													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245557353	245557353	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245557353delT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			ctcttgagccttttgggggtt	0.000													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245612681	245612681	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245612681delT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TCCCAGTAACTTTTTTTTTTT	0.428													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246877239	246877239	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246877239delT								CNST (45356 upstream) : SCCPDH (10139 downstream)																							TTGGAAATCCTTTAGATGAAG	0.338													4	2	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1111886	1111889	+	Intron	DEL	CTTT	-	-	rs76203657		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1111886_1111889delCTTT	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GGTTTTAGGGCTTTCTTTCTGAGA	0.441													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6136104	6136105	+	IGR	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6136104_6136105insA								LOC400940 (7740 upstream) : CMPK2 (844398 downstream)																							AGGAATACAGGAAAAAAAAGAC	0.262													1	6	---	---	---	---	
RNF144A	9781	broad.mit.edu	37	2	7082712	7082712	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7082712delA	uc002qys.2	+						RNF144A_uc002qyt.2_Intron|RNF144A_uc002qyu.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		gaatatgaggaaaaggggaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8850793	8850793	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8850793delT								ID2 (26212 upstream) : KIDINS220 (14897 downstream)																							TCCAGTTTCCTTTGAAAGACC	0.463													4	2	---	---	---	---	
MBOAT2	129642	broad.mit.edu	37	2	9033826	9033826	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9033826delA	uc002qzg.1	-						MBOAT2_uc010yix.1_Intron	NM_138799	NP_620154	Q6ZWT7	MBOA2_HUMAN	O-acyltransferase (membrane bound) domain						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TAAACTACATAACAAAGTATC	0.428													4	2	---	---	---	---	
ADAM17	6868	broad.mit.edu	37	2	9648440	9648440	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9648440delC	uc002qzu.2	-						ADAM17_uc010ewy.2_Intron|ADAM17_uc010ewz.2_Intron	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17						B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		tgcccccgtgcccctcaccag	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17464983	17464983	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17464983delA								FAM49A (617887 upstream) : RAD51AP2 (227003 downstream)																							aaaggaaaggaaattgagaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18266330	18266330	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18266330delG								KCNS3 (152106 upstream) : NT5C1B (469661 downstream)																							ggcagcaagtggtgacctgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19809451	19809451	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19809451delT								OSR1 (251079 upstream) : TTC32 (287067 downstream)																							ctgcccagcctttacctgttt	0.030													4	2	---	---	---	---	
FOSL2	2355	broad.mit.edu	37	2	28631909	28631910	+	Intron	INS	-	AG	AG	rs111629079		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28631909_28631910insAG	uc002rma.2	+						FOSL2_uc010ymi.1_Intron	NM_005253	NP_005244	P15408	FOSL2_HUMAN	FOS-like antigen 2						cell death|regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(172;0.155)					GTTGATTGAAAAGAGAGAGAGA	0.520													4	2	---	---	---	---	
TTC27	55622	broad.mit.edu	37	2	32902526	32902526	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32902526delT	uc002rom.2	+						TTC27_uc010ymx.1_Intron	NM_017735	NP_060205	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1						tgttttcttctttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34106106	34106107	+	IGR	DEL	AT	-	-	rs58877876		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34106106_34106107delAT								MYADML (152822 upstream) : None (None downstream)																							GAAAGCAGACATGTGCAGGTTC	0.465													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45362658	45362658	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45362658delT								SIX2 (126115 upstream) : SRBD1 (253162 downstream)																							AGCTGAATGGTTTATTGTGTT	0.393													4	2	---	---	---	---	
EML6	400954	broad.mit.edu	37	2	54951255	54951255	+	5'Flank	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54951255delT	uc002ryb.3	+							NM_001039753	NP_001034842	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule					0						GCGCACTCCCTCCGACTGCAC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64841196	64841196	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64841196delT	uc002sdd.2	+											Homo sapiens hypothetical protein LOC339807, mRNA (cDNA clone IMAGE:5272970).																		ttgtcaaccctttttttttct	0.000													4	2	---	---	---	---	
GMCL1	64395	broad.mit.edu	37	2	70061240	70061241	+	Intron	DEL	TT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70061240_70061241delTT	uc002sfu.2	+							NM_178439	NP_848526	Q96IK5	GMCL1_HUMAN	germ cell-less						cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3						GGACAGTGCCTTTTTTTGTATT	0.351													4	2	---	---	---	---	
NOTO	344022	broad.mit.edu	37	2	73435900	73435901	+	Intron	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73435900_73435901insA	uc010yrd.1	+							NM_001134462	NP_001127934	A8MTQ0	NOTO_HUMAN	notochord homeobox							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TCTATATAATGAAAAAAAAAAG	0.401													6	3	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87616950	87616957	+	Intron	DEL	TCTGTCTG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87616950_87616957delTCTGTCTG	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						gttttgtgattctgtctgtctttgtgtt	0.159													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90452688	90452689	+	Intron	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90452688_90452689insC	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		gaagacagagaccttgagactg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91669031	91669035	+	IGR	DEL	AACTT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91669031_91669035delAACTT								None (None upstream) : LOC654342 (136157 downstream)																							AACCCCTAACAACTTAAAGCAAAAC	0.346													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91739761	91739765	+	IGR	DEL	ATTTC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91739761_91739765delATTTC								None (None upstream) : LOC654342 (65427 downstream)																							tcatctcatgatttcatctcatctc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91909723	91909724	+	IGR	INS	-	A	A	rs150101748		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91909723_91909724insA								LOC654342 (61748 upstream) : GGT8P (53644 downstream)																							CCTCTAGGCACAAAAAAAAAAT	0.337													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96617456	96617456	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96617456delT	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																		AAAAATGTACTCATATGTAAT	0.234													21	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96816251	96816251	+	IGR	DEL	G	-	-	rs112969927		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96816251delG								DUSP2 (5072 upstream) : STARD7 (34354 downstream)																							GTGCACTGTTGGGGGGGGGGT	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	102298702	102298702	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102298702delT								RFX8 (207537 upstream) : MAP4K4 (15786 downstream)																							cacagagcagtgggaggatta	0.090													4	2	---	---	---	---	
MAP4K4	9448	broad.mit.edu	37	2	102321697	102321697	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102321697delG	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GAtgtgtgctgggccctgttc	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106085773	106085774	+	IGR	INS	-	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106085773_106085774insT								FHL2 (30543 upstream) : NCK2 (275580 downstream)																							AGCTAGTATTATTTTTTCAGCG	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	107814417	107814417	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107814417delA								ST6GAL2 (310854 upstream) : LOC729121 (625103 downstream)																							CATGATCAATAAAGGGCAGAG	0.463													4	2	---	---	---	---	
ANAPC1	64682	broad.mit.edu	37	2	112607966	112607966	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112607966delT	uc002thi.2	-							NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						gaggctttgattttgccatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	124123871	124123872	+	IGR	INS	-	A	A	rs143522950	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124123871_124123872insA								None (None upstream) : CNTNAP5 (658992 downstream)																							GGAAGAAAAACAAAAAAAAATG	0.282													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127899242	127899243	+	IGR	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127899242_127899243insA								BIN1 (34378 upstream) : CYP27C1 (42169 downstream)																							ACTCTCCCAATGATCACAGCCG	0.302													4	2	---	---	---	---	
UGGT1	56886	broad.mit.edu	37	2	128868163	128868163	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128868163delA	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						TAATTCTTTTAAAAAACTTTA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130652992	130652993	+	IGR	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130652992_130652993insC								None (None upstream) : LOC389033 (27442 downstream)																							TCTCCTCTGAGCCCCCTAACCC	0.624													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133113907	133113907	+	IGR	DEL	G	-	-	rs10928369		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133113907delG								NCRNA00164 (98365 upstream) : GPR39 (60240 downstream)																							CCACGCATCAGTAAGTTGTCT	0.244													2	4	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	134237994	134237994	+	Intron	DEL	T	-	-	rs112531563		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134237994delT	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						ttctcccagcttttggtaaca	0.144													1	5	---	---	---	---	
GTDC1	79712	broad.mit.edu	37	2	144742264	144742265	+	Intron	DEL	AC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144742264_144742265delAC	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		aactcagtggacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	151293932	151293932	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151293932delG								MMADHC (849602 upstream) : RND3 (30780 downstream)																							AAGACAAGGTGGTGATTGCAA	0.368													4	2	---	---	---	---	
CACNB4	785	broad.mit.edu	37	2	152737821	152737821	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152737821delA	uc002tya.2	-						CACNB4_uc002txy.2_Intron|CACNB4_uc002txz.2_Intron|CACNB4_uc010fnz.2_Intron|CACNB4_uc002tyb.2_Intron	NM_000726	NP_000717	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4						axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)	TTTTAAAAAGAAAAAAAAAAA	0.323													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	162149179	162149180	+	IGR	DEL	CT	-	-	rs145809501		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162149179_162149180delCT								TANK (56497 upstream) : PSMD14 (15606 downstream)																							aaatctcacactgtcccactca	0.000													1	5	---	---	---	---	
SCN9A	6335	broad.mit.edu	37	2	167138537	167138537	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167138537delC	uc010fpl.2	-						uc002udp.2_Intron|SCN9A_uc002udr.1_Intron|SCN9A_uc002uds.1_Intron|SCN9A_uc002udt.1_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	atagtgcttgcttcatattct	0.104													8	4	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169682051	169682052	+	Intron	DEL	TG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169682051_169682052delTG	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						tgtgctctattgtgtgtgtgtg	0.079													3	3	---	---	---	---	
TMEFF2	23671	broad.mit.edu	37	2	192820810	192820811	+	Intron	INS	-	TGTGTGAATGCT	TGTGTGAATGCT	rs149857491	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192820810_192820811insTGTGTGAATGCT	uc002utc.2	-							NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two							extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TTTTTTTTTAgtgtgtgagtat	0.257													14	7	---	---	---	---	
CASP8	841	broad.mit.edu	37	2	202109054	202109054	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202109054delG	uc002uxr.1	+						CASP8_uc010ftc.1_Intron|CASP8_uc002uxo.1_Intron|CASP8_uc002uxp.1_Intron|CASP8_uc002uxq.1_Intron	NM_033355	NP_203519	Q14790	CASP8_HUMAN	caspase 8 isoform B precursor						activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5						ggaactgcctgggacaggcat	0.000										HNSCC(4;0.00038)			4	2	---	---	---	---	
TRAK2	66008	broad.mit.edu	37	2	202262685	202262686	+	Intron	DEL	TC	-	-	rs3839051		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202262685_202262686delTC	uc002uyb.3	-						TRAK2_uc002uyc.2_Intron	NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2							early endosome|plasma membrane	GABA receptor binding				0						CCTGCTACTATCCACTTTTCAG	0.381													10	12	---	---	---	---	
ADAM23	8745	broad.mit.edu	37	2	207436213	207436214	+	Intron	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207436213_207436214insA	uc002vbq.2	+						ADAM23_uc010ziv.1_Intron	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein						cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		aaacaaaaaggaaaaaaaaaat	0.153													6	3	---	---	---	---	
CCDC108	255101	broad.mit.edu	37	2	219877735	219877735	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219877735delA	uc002vjl.1	-							NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1							integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTGCTAAAGGAAAAAAAAATC	0.264													5	3	---	---	---	---	
KIAA1486	57624	broad.mit.edu	37	2	226444802	226444803	+	Intron	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226444802_226444803insC	uc002voe.2	+						KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_5'Flank	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		GAAAATAGTTTCCCAGAGCCTG	0.441													4	2	---	---	---	---	
PDE6D	5147	broad.mit.edu	37	2	232610535	232610535	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232610535delT	uc002vse.1	-						PDE6D_uc002vsf.1_Intron	NM_002601	NP_002592	O43924	PDE6D_HUMAN	phosphodiesterase 6D						regulation of GTP catabolic process|response to stimulus|visual perception		3',5'-cyclic-nucleotide phosphodiesterase activity|GTPase inhibitor activity|protein binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.142)		Epithelial(121;2.19e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00145)|LUSC - Lung squamous cell carcinoma(224;0.0125)|Lung(119;0.0154)		CCTGGTGTGATTTAGGTGCAG	0.468													4	2	---	---	---	---	
COPS7B	64708	broad.mit.edu	37	2	232670905	232670905	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232670905delC	uc002vsg.1	+						COPS7B_uc010fxy.1_Intron|COPS7B_uc002vsh.1_Intron|COPS7B_uc002vsi.1_Intron|COPS7B_uc002vsj.1_Intron|COPS7B_uc002vsk.1_Intron	NM_022730	NP_073567	Q9H9Q2	CSN7B_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation	cytoplasm|signalosome				ovary(1)|liver(1)|skin(1)	3		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CTGTCTCTTACCCTCAAGCTC	0.353													4	2	---	---	---	---	
SAG	6295	broad.mit.edu	37	2	234229821	234229821	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234229821delA	uc002vuh.2	+						SAG_uc002vug.2_Intron|SAG_uc010zmq.1_Intron	NM_000541	NP_000532	P10523	ARRS_HUMAN	S-arrestin						rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity			ovary(1)	1		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		GGTTCCCTACAGGACAGGAGA	0.498													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236481270	236481272	+	Intron	DEL	CCC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236481270_236481272delCCC	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						TGGGCTTCTGCCCCAGCTAAAAT	0.542													3	3	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236749659	236749660	+	Intron	DEL	GA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236749659_236749660delGA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						CTTGCCTTTTGAAAGAGGGAGA	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237587800	237587800	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237587800delT								CXCR7 (96808 upstream) : COPS8 (406284 downstream)																							CTTCTTCCCCTTTTATAGATT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237816722	237816722	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237816722delT								CXCR7 (325730 upstream) : COPS8 (177362 downstream)																							CAGACCCACATTTTTTGAGTT	0.428													4	2	---	---	---	---	
HDLBP	3069	broad.mit.edu	37	2	242193214	242193214	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242193214delT	uc002waz.2	-						HDLBP_uc002wba.2_Intron|HDLBP_uc002wbb.2_Intron|HDLBP_uc010fzn.1_Intron	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CCATCTGAACTTTTACAAGGC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14843048	14843048	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14843048delA								C3orf20 (28508 upstream) : FGD5 (17421 downstream)																							AATGCTCAGTAAaaaaaatct	0.219													4	2	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37633783	37633786	+	Intron	DEL	GTCA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37633783_37633786delGTCA	uc003chd.2	+						ITGA9_uc003chc.2_Intron	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		ttgctcatgtgtcagtcaaataag	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	42114061	42114062	+	IGR	INS	-	C	C	rs145327250	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42114061_42114062insC								ULK4 (110401 upstream) : TRAK1 (18684 downstream)																							TTTTTTTCTTTCTCTTTTTCTT	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	43113768	43113768	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43113768delG								FAM198A (12065 upstream) : C3orf39 (6961 downstream)																							GTTGGCAAAAGGGGGTCAAAG	0.488													4	2	---	---	---	---	
PHLDB2	90102	broad.mit.edu	37	3	111685348	111685349	+	Intron	DEL	AT	-	-	rs67645066		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111685348_111685349delAT	uc010hqa.2	+						PHLDB2_uc003dyc.2_Intron|PHLDB2_uc003dyd.2_Intron|PHLDB2_uc003dyg.2_Intron|PHLDB2_uc003dyh.2_Intron|PHLDB2_uc003dyi.2_Intron|PHLDB2_uc003dyj.2_Intron	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						CCTTGACCCCAtgtgtgtgtgt	0.282													18	18	---	---	---	---	
LSAMP	4045	broad.mit.edu	37	3	116163562	116163563	+	Intron	DEL	AC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116163562_116163563delAC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron|LSAMP_uc010hqq.1_RNA	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TAAAACAGGGacacacacacac	0.317													5	3	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119012551	119012552	+	5'Flank	DEL	GT	-	-	rs71964788		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119012551_119012552delGT	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						CTTTGCAGTAGTGTGTGTGTGT	0.455													4	3	---	---	---	---	
NR1I2	8856	broad.mit.edu	37	3	119501398	119501403	+	Intron	DEL	AGGAGA	-	-	rs112670229		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119501398_119501403delAGGAGA	uc003edj.2	+						NR1I2_uc003edi.2_Intron|NR1I2_uc003edk.2_5'Flank	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2						drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	AAATCACCACAGGAGAAGCCTTAACT	0.471													6	3	---	---	---	---	
GSK3B	2932	broad.mit.edu	37	3	119748921	119748921	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119748921delA	uc003edo.2	-						GSK3B_uc003edn.2_Intron	NM_001146156	NP_001139628	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta isoform 2						axon guidance|epithelial to mesenchymal transition|ER overload response|glycogen metabolic process|hippocampus development|negative regulation of apoptosis|negative regulation of protein binding|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|positive regulation of cell-matrix adhesion|positive regulation of protein complex assembly|positive regulation of protein export from nucleus|positive regulation of Rac GTPase activity|regulation of microtubule-based process|superior temporal gyrus development	Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|nucleus|plasma membrane	ATP binding|beta-catenin binding|NF-kappaB binding|p53 binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|RNA polymerase II transcription factor binding|tau-protein kinase activity|ubiquitin protein ligase binding			lung(2)	2				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	ATCTAGTTGGAAAAAAAAAAT	0.259													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124140228	124140228	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124140228delA	uc003ehg.2	+						KALRN_uc010hrv.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron|KALRN_uc003ehh.1_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TAGGAGTCAGAAAAGCCACAG	0.343													4	2	---	---	---	---	
OSBPL11	114885	broad.mit.edu	37	3	125284730	125284730	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125284730delC	uc003eic.2	-							NM_022776	NP_073613	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11						lipid transport		lipid binding			ovary(3)|breast(1)|kidney(1)	5						CTTTCCTCTACCTCTCACTCC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125400039	125400039	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125400039delG								OSBPL11 (85658 upstream) : MIR548I1 (109208 downstream)																							ATGGATCTGAGCAAGCATGAC	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	127199650	127199650	+	RNA	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127199650delG	uc003ejk.2	-	8		c.2962delC								Homo sapiens cDNA FLJ25806 fis, clone TST07194.																		AGATAACActggggacaactc	0.204													4	2	---	---	---	---	
EEFSEC	60678	broad.mit.edu	37	3	128012162	128012162	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128012162delA	uc003eki.2	+						EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,							cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						TTCAGAGTAGAAAAGCTTCCT	0.388													4	2	---	---	---	---	
CEP63	80254	broad.mit.edu	37	3	134282792	134282792	+	3'UTR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134282792delC	uc003eqo.1	+	16					CEP63_uc003eql.1_3'UTR|CEP63_uc003eqm.2_Intron|CEP63_uc003eqn.1_3'UTR	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a						cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						ttggcgttttcccccttgcag	0.000													4	2	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134812293	134812293	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134812293delC	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron|EPHB1_uc003equ.2_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						gacacggtggcccacacctgt	0.154													4	2	---	---	---	---	
ZBTB38	253461	broad.mit.edu	37	3	141042294	141042294	+	5'Flank	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141042294delG	uc003etw.2	+							NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38						positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AAAGAAATCTGAAATTCAAGA	0.438													4	2	---	---	---	---	
PCOLCE2	26577	broad.mit.edu	37	3	142580498	142580498	+	Intron	DEL	T	-	-	rs35710742		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142580498delT	uc003evd.2	-							NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2							extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						tgctctgcactgtttctgttg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	153028867	153028867	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153028867delC								RAP2B (142606 upstream) : C3orf79 (173417 downstream)																							ccatccttatcccccaagccc	0.000													4	2	---	---	---	---	
GPR149	344758	broad.mit.edu	37	3	154060566	154060567	+	Intron	DEL	AT	-	-	rs34857511		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154060566_154060567delAT	uc003faa.2	-							NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCCATAAAACATAAACAGAAAA	0.218													0	6	---	---	---	---	
VEPH1	79674	broad.mit.edu	37	3	157015547	157015547	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157015547delA	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TGACAAGCATAAAAGGAGGGA	0.413													4	2	---	---	---	---	
SERPINI2	5276	broad.mit.edu	37	3	167171056	167171056	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167171056delT	uc003fer.1	-						SERPINI2_uc003fes.1_Intron|SERPINI2_uc003fet.1_Intron	NM_006217	NP_006208	O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin),						cellular component movement|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(2)|urinary_tract(1)	3						AGAAATTGCATTTTTTTTTGA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187285915	187285918	+	IGR	DEL	CACA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187285915_187285918delCACA								RTP4 (196548 upstream) : SST (100778 downstream)																							cacacatgtgcacacacacacaca	0.201													4	2	---	---	---	---	
OPA1	4976	broad.mit.edu	37	3	193380453	193380453	+	Intron	DEL	G	-	-	rs3214982		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193380453delG	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TTCATAAGCCGGGGTGCTGTG	0.343													2	7	---	---	---	---	
PIGG	54872	broad.mit.edu	37	4	532607	532607	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:532607delG	uc003gak.3	+						PIGG_uc003gaj.3_Intron|PIGG_uc011bux.1_Intron|PIGG_uc010ibf.2_Intron|PIGG_uc003gal.3_Intron	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						AGGTGTGTGTGGGGGGGGACA	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9240401	9240402	+	5'Flank	INS	-	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9240401_9240402insG	uc011bwo.1	+											RecName: Full=Ubiquitin carboxyl-terminal hydrolase 17-like protein 2;          EC=3.1.2.15; AltName: Full=Ubiquitin thioesterase 17-like protein 2; AltName: Full=Ubiquitin-specific-processing protease 17-like protein 2; AltName: Full=Deubiquitinating enzyme 17-like protein 2; AltName: Full=Deubiquitinating protein 3;          Short=DUB-3;																		cacacacacgccccccccacac	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	11373306	11373306	+	IGR	DEL	G	-	-	rs142503393	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11373306delG								MIR572 (2761 upstream) : HS3ST1 (26683 downstream)																							GAGCAGCAAAGGTGGCGTTCG	0.483													4	2	---	---	---	---	
GABRA2	2555	broad.mit.edu	37	4	46311987	46311988	+	Intron	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46311987_46311988insC	uc003gxc.3	-						GABRA2_uc010igc.2_Intron|GABRA2_uc011bzc.1_Intron|GABRA2_uc003gxe.2_Intron	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2						gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	AAAATAAGTCATAATTGTTTAA	0.307													4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	55087753	55087753	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55087753delA	uc003haa.2	+							NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	ATGCACCcttaaaaaaaagag	0.129			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	77965748	77965749	+	IGR	INS	-	CTAA	CTAA	rs140132209	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77965748_77965749insCTAA								SEPT11 (5981 upstream) : CCNI (3430 downstream)																							AATATGAACTTCTAACTAAGCC	0.441													2	5	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79430319	79430319	+	Intron	DEL	G	-	-	rs34380083		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79430319delG	uc003hlb.2	+						FRAS1_uc003hlc.1_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CATAAGAAAaggttatatgct	0.159													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	84589565	84589566	+	IGR	INS	-	T	T	rs150350975	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84589565_84589566insT								AGPAT9 (62540 upstream) : NKX6-1 (824870 downstream)																							AAGTTTCTTCATTTTCTCCTAA	0.361													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	100082392	100082392	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100082392delC	uc003hum.1	+						PCNAP1_uc011cee.1_RNA					Homo sapiens full length insert cDNA clone ZD94A03.																		ATCTTTTGCACAAGAAATTAT	0.368													4	2	---	---	---	---	
PPA2	27068	broad.mit.edu	37	4	106365413	106365413	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106365413delA	uc003hxl.2	-						PPA2_uc003hxm.2_Intron|PPA2_uc003hxn.2_Intron|PPA2_uc003hxo.2_Intron|PPA2_uc003hxp.2_Intron|PPA2_uc003hxq.2_Intron|PPA2_uc003hxr.2_Intron|PPA2_uc011cfa.1_Intron	NM_176869	NP_789845	Q9H2U2	IPYR2_HUMAN	inorganic pyrophosphatase 2 isoform 1 precursor						diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		tagacgtgagaaagggggaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	109305313	109305313	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109305313delT								LEF1 (215735 upstream) : LOC285456 (154033 downstream)																							GCTAAAGTGGTTTTTTTTATG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	114769944	114769945	+	IGR	INS	-	CTT	CTT	rs137906497	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114769944_114769945insCTT								CAMK2D (86861 upstream) : ARSJ (51495 downstream)																							gtgctctggtccttctacttct	0.000													4	3	---	---	---	---	
SYNPO2	171024	broad.mit.edu	37	4	119981420	119981420	+	3'UTR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119981420delA	uc010inb.2	+	5					SYNPO2_uc011cgh.1_3'UTR|SYNPO2_uc010inc.2_3'UTR	NM_133477	NP_597734	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform a							nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						CATCTGTATTAAGCTATCTGA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	132981410	132981411	+	IGR	DEL	CT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132981410_132981411delCT								None (None upstream) : None (None downstream)																							AACACTCTCCCTCTCTCTCTCT	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	139759192	139759192	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139759192delT								SLC7A11 (595689 upstream) : CCRN4L (177751 downstream)																							CAACGTGGCATTTTTCGCTGT	0.423													4	2	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140710600	140710600	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140710600delG	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					CTAGAAAGCAGAATCTAGAAA	0.388													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	152971304	152971304	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152971304delG								PET112L (289158 upstream) : FBXW7 (271107 downstream)																							atagcctcctggagGACTGGT	0.224													4	2	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154107924	154107924	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154107924delA	uc003ing.2	+							NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TGTTCATATCAAAAAAAGCCT	0.488													4	2	---	---	---	---	
FAM198B	51313	broad.mit.edu	37	4	159093307	159093308	+	Intron	DEL	TC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159093307_159093308delTC	uc003ipp.3	-						uc003ipu.1_5'Flank|FAM198B_uc003ipq.3_Intron|FAM198B_uc003ipr.3_Intron|FAM198B_uc003ips.2_Intron	NM_016613	NP_057697	Q6UWH4	F198B_HUMAN	hypothetical protein LOC51313 isoform 2							Golgi membrane|integral to membrane					0						TTATTCTGTTtctctctctctc	0.282													3	3	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	164467100	164467103	+	Intron	DEL	TGTG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164467100_164467103delTGTG	uc003iqs.1	-						MARCH1_uc003iqr.1_Intron	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TAAATACATAtgtgtgtgtgtgtg	0.127													7	5	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	164475544	164475544	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164475544delA	uc003iqs.1	-						MARCH1_uc003iqr.1_Intron	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GGGAACATAGAAGGTGTTGGA	0.507													4	2	---	---	---	---	
PALLD	23022	broad.mit.edu	37	4	169572502	169572502	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169572502delT	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		AGGTTAGCTCTTTTTTTTTCC	0.194									Pancreatic_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	177222943	177222943	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177222943delC								ASB5 (32668 upstream) : SPCS3 (18147 downstream)																							CCGGTATCTTCCAAAGCAAGT	0.383													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	186401837	186401837	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186401837delG								CCDC110 (8924 upstream) : PDLIM3 (21015 downstream)																							GTGTGCTAAAGGGTCAGACAT	0.403													4	2	---	---	---	---	
SORBS2	8470	broad.mit.edu	37	4	186727119	186727119	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186727119delA	uc003iyl.2	-						SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron|SORBS2_uc003iyp.2_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ATAATCTACCAAAAAGGCTCA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1796640	1796640	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1796640delC								LOC728613 (162520 upstream) : MRPL36 (1860 downstream)																							GGTCAGGTCTCCCCCCAGAGC	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2216217	2216217	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2216217delG								IRX4 (333337 upstream) : IRX2 (530064 downstream)																							TTTGTGTCCTGGAAGTCCAGG	0.507													4	2	---	---	---	---	
LOC340094	340094	broad.mit.edu	37	5	5057795	5057795	+	RNA	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5057795delT	uc003jdg.2	+	3		c.429delT			LOC340094_uc003jdh.2_RNA	NR_026994				Homo sapiens hypothetical protein LOC340094, mRNA (cDNA clone IMAGE:5295461).												0						CCAACACATATTTTTTTTGAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	36391542	36391542	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36391542delA								RANBP3L (89531 upstream) : SLC1A3 (214915 downstream)																							GAGGAGAGGGAAAAAGGGGGC	0.428													4	2	---	---	---	---	
NNT	23530	broad.mit.edu	37	5	43655419	43655419	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43655419delG	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	GGTGTGTGGAGAAAAACTGCT	0.308													4	2	---	---	---	---	
IPO11	51194	broad.mit.edu	37	5	61808402	61808402	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61808402delT	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtd.1_Intron|IPO11_uc010iwr.2_5'Flank	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		ATGGGAGGACTTTTTTTTGTT	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61942033	61942033	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61942033delC								IPO11 (17618 upstream) : ISCA1P1 (129169 downstream)																							CCTTTCTTCTCCATTCTGCAC	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	67455845	67455845	+	IGR	DEL	T	-	-	rs151055708		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67455845delT								CD180 (963228 upstream) : PIK3R1 (55759 downstream)																							aactggtttgttttttttttt	0.189													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92298856	92298856	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92298856delT								None (None upstream) : FLJ42709 (446209 downstream)																							TGCATATCTGTTTTTTAGCTG	0.348													4	2	---	---	---	---	
C5orf36	285600	broad.mit.edu	37	5	93768294	93768295	+	Intron	INS	-	A	A	rs143838704	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93768294_93768295insA	uc011cuk.1	-							NM_001145678	NP_001139150	Q8IV33	K0825_HUMAN	hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)		AAGAAAGTGACAAAAAAAAAAT	0.366													4	2	---	---	---	---	
C5orf36	285600	broad.mit.edu	37	5	93871281	93871281	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93871281delT	uc011cuk.1	-						C5orf36_uc003kkp.2_Intron	NM_001145678	NP_001139150	Q8IV33	K0825_HUMAN	hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)		ctcggaagactagatatgccg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	125862503	125862503	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125862503delG								GRAMD3 (32652 upstream) : ALDH7A1 (16415 downstream)																							tcctcaacaagggctttgctg	0.040													4	2	---	---	---	---	
CDC42SE2	56990	broad.mit.edu	37	5	130615362	130615362	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130615362delT	uc003kvh.2	+						CDC42SE2_uc003kvi.2_Intron|CDC42SE2_uc003kvj.2_Intron|CDC42SE2_uc003kvk.2_Intron	NM_020240	NP_064625	Q9NRR3	C42S2_HUMAN	CDC42 small effector 2						phagocytosis|regulation of cell shape|regulation of signal transduction	cell projection|cytoplasm|cytoskeleton|phagocytic cup	protein binding|structural molecule activity				0		all_cancers(142;0.0525)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CACCTGGACATTCCAGTCCGT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134414841	134414841	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134414841delT	uc003laj.1	+											Homo sapiens cDNA: FLJ23312 fis, clone HEP11874.																		TTGCCTGTGGTTTGCTTTTGC	0.483													4	2	---	---	---	---	
SIL1	64374	broad.mit.edu	37	5	138310339	138310339	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138310339delA	uc003ldm.2	-						SIL1_uc003ldn.2_Intron|SIL1_uc003ldo.2_Intron|SIL1_uc003ldp.2_Intron|SIL1_uc003ldq.1_Intron	NM_022464	NP_071909	Q9H173	SIL1_HUMAN	SIL1 protein precursor						intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GGAAAGTATGAAAGCTGGAGA	0.483									Marinesco-Sj_gren_syndrome				4	2	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142239472	142239473	+	Intron	DEL	TC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142239472_142239473delTC	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron|uc003lmv.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			attgtcatcttcttgcatctgg	0.000													4	2	---	---	---	---	
LARS	51520	broad.mit.edu	37	5	145524547	145524547	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145524547delA	uc003lnx.1	-						LARS_uc011dbq.1_Intron|LARS_uc011dbr.1_Intron|LARS_uc011dbs.1_Intron	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase						leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	AACAAAAAGGAAAAAAAAACA	0.318													4	2	---	---	---	---	
GRPEL2	134266	broad.mit.edu	37	5	148732934	148732934	+	3'UTR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148732934delT	uc003lqj.2	+	4					GRPEL2_uc011dca.1_3'UTR	NM_152407	NP_689620	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial precursor						protein folding	mitochondrial matrix	adenyl-nucleotide exchange factor activity|chaperone binding|protein homodimerization activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCTGTGTGTTTTTTTATTG	0.308													4	2	---	---	---	---	
SLC6A7	6534	broad.mit.edu	37	5	149573620	149573621	+	Intron	DEL	AT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149573620_149573621delAT	uc003lrr.2	+							NM_014228	NP_055043	Q99884	SC6A7_HUMAN	solute carrier family 6, member 7							integral to plasma membrane|membrane fraction	neurotransmitter:sodium symporter activity|proline:sodium symporter activity				0		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	cagtgggcacatagtaagtgct	0.035													4	2	---	---	---	---	
ARSI	340075	broad.mit.edu	37	5	149677720	149677720	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149677720delC	uc003lrv.2	-	2	1356	c.767delG	c.(766-768)GGCfs	p.G256fs		NM_001012301	NP_001012301	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I precursor	256						endoplasmic reticulum|extracellular region	arylsulfatase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCACATTGCCCATGGTGCG	0.612													41	21	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154305780	154305780	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154305780delA	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CACTGCTAAGAAAAAAAAAAT	0.234													6	3	---	---	---	---	
UBLCP1	134510	broad.mit.edu	37	5	158690740	158690740	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158690740delC	uc003lxq.2	+							NM_145049	NP_659486	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase							nucleus	phosphoprotein phosphatase activity			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTTAGCACAGCCCCCGACCCT	0.547													4	2	---	---	---	---	
CCNJL	79616	broad.mit.edu	37	5	159708072	159708072	+	Intron	DEL	T	-	-	rs35328886		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159708072delT	uc003lyb.1	-						CCNJL_uc011dee.1_Intron|CCNJL_uc003lyc.1_Intron|CCNJL_uc011def.1_Intron	NM_024565	NP_078841	Q8IV13	CCNJL_HUMAN	cyclin J-like							nucleus					0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTCCAAATTCTTTTTTTTTCC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161091601	161091601	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161091601delT								GABRB2 (116471 upstream) : GABRA6 (21057 downstream)																							TGGTTTGAGATTTTTTTTTTC	0.348													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	168731259	168731259	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168731259delA								SLIT3 (3126 upstream) : CCDC99 (279379 downstream)																							GAATCTACAGAAAAAAATGAA	0.398													4	2	---	---	---	---	
ERGIC1	57222	broad.mit.edu	37	5	172290672	172290672	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172290672delA	uc003mbw.3	+						uc003mbx.2_5'Flank	NM_001031711	NP_001026881	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate						ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTGGCTCTTTAAAAAAAAAGA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174244131	174244131	+	IGR	DEL	C	-	-	rs112064176		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174244131delC								MSX2 (86230 upstream) : DRD1 (623545 downstream)																							GGCTTATTTTCCCTCAGAACT	0.433													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175052324	175052325	+	IGR	INS	-	G	G	rs150091575	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175052324_175052325insG								SFXN1 (96703 upstream) : HRH2 (32715 downstream)																							actctacACCTGGGCCCAACAG	0.297													4	3	---	---	---	---	
THOC3	84321	broad.mit.edu	37	5	175390080	175390080	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175390080delA	uc003mdg.3	-						THOC3_uc003mdh.2_Intron	NM_032361	NP_115737	Q96J01	THOC3_HUMAN	THO complex 3						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	transcription export complex	RNA binding				0	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		atgattctttaaaaaaaaaac	0.000													3	3	---	---	---	---	
MAML1	9794	broad.mit.edu	37	5	179203181	179203181	+	3'UTR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179203181delT	uc003mkm.2	+	5					MAML1_uc003mkn.1_Intron	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTGAGACCCTTTTACACAGA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	277939	277940	+	IGR	INS	-	TC	TC	rs139417595	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:277939_277940insTC								None (None upstream) : DUSP22 (14161 downstream)																							accacagacattctctctctct	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	4674457	4674458	+	IGR	INS	-	G	G	rs141248180	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4674457_4674458insG								PECI (538626 upstream) : CDYL (31935 downstream)																							CTCTTGCACCTGCTCCATCACT	0.525													4	2	---	---	---	---	
CDYL	9425	broad.mit.edu	37	6	4734388	4734389	+	Intron	INS	-	C	C	rs150081211	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4734388_4734389insC	uc003mwi.2	+							NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		CTCTGCTGTTTCCCCTCTGGCG	0.277													3	3	---	---	---	---	
PHACTR1	221692	broad.mit.edu	37	6	13160174	13160174	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13160174delA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			tctgtctcagaaaaaaaaaag	0.070													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14882617	14882618	+	IGR	DEL	GG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14882617_14882618delGG								CD83 (745471 upstream) : JARID2 (363116 downstream)																							CTTACTCAATGGGGGTGATGTC	0.475													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20350130	20350130	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20350130delA								MBOAT1 (137460 upstream) : E2F3 (52007 downstream)																							GATTGAACCTAATTAAGTCAA	0.299													4	2	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20801735	20801736	+	Intron	INS	-	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20801735_20801736insG	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			aacttatttttttaacatgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29441022	29441023	+	IGR	DEL	TG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29441022_29441023delTG								OR2H1 (8925 upstream) : MAS1L (13522 downstream)																							GAGTGAATCCTGTGTGAGGATG	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	31363459	31363460	+	IGR	DEL	AC	-	-	rs71723266		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31363459_31363460delAC								HLA-B (38470 upstream) : MICA (4101 downstream)																							aaaaaTACATACACACACACAC	0.302													3	4	---	---	---	---	
CLPS	1208	broad.mit.edu	37	6	35764725	35764726	+	Intron	INS	-	G	G	rs138101300	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35764725_35764726insG	uc003ole.1	-						CLPS_uc003olf.1_Intron	NM_001832	NP_001823	P04118	COL_HUMAN	colipase preproprotein						lipid catabolic process|lipid digestion|retinoid metabolic process|steroid metabolic process	extracellular region					0						gaaaaaaaagaaaaaaaaGGTC	0.277													5	3	---	---	---	---	
ZFAND3	60685	broad.mit.edu	37	6	38121454	38121454	+	3'UTR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38121454delG	uc003onx.2	+	6						NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1						GGGGAAGGGTGGGGGTGGGCC	0.607													4	2	---	---	---	---	
LRFN2	57497	broad.mit.edu	37	6	40404734	40404735	+	Intron	INS	-	GT	GT	rs140423803	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40404734_40404735insGT	uc003oph.1	-							NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					GAGGTGGTTGAgtgtgtgtgtg	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40632433	40632433	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40632433delA								LRFN2 (77307 upstream) : UNC5CL (362339 downstream)																							GCCAGCATCTACCAGTCAACC	0.463													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57372524	57372524	+	Intron	DEL	G	-	-	rs10706124		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57372524delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TGTTACCCTTGACTTTAGGGC	0.323													19	14	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57372526	57372527	+	Intron	INS	-	TTTA	TTTA	rs10635932		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57372526_57372527insTTTA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTACCCTTGACTTTAGGGCACT	0.322													19	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	91397118	91397118	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91397118delC								MAP3K7 (100211 upstream) : None (None downstream)																							GAGGCCTTTTCTGGGCTAGCT	0.303													4	4	---	---	---	---	
AKD1	221264	broad.mit.edu	37	6	109828280	109828280	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109828280delT	uc003ptn.2	-						AKD1_uc011eas.1_5'Flank	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						TGGAGATAGATTTTGGCAGAA	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	111575391	111575391	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111575391delC								SLC16A10 (30787 upstream) : KIAA1919 (5091 downstream)																							tgtgatgggacccccgcacct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130056628	130056628	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130056628delT								ARHGAP18 (25258 upstream) : C6orf191 (95763 downstream)																							attctttgccttttttttttg	0.000													4	3	---	---	---	---	
C6orf217	100131814	broad.mit.edu	37	6	136015605	136015605	+	Intron	DEL	T	-	-	rs144698166		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136015605delT	uc003qgn.2	+						C6orf217_uc003qgo.2_Intron					Homo sapiens cDNA clone IMAGE:4795512.												0						aatggaaagattttttttttt	0.045													6	4	---	---	---	---	
VTA1	51534	broad.mit.edu	37	6	142487118	142487118	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142487118delT	uc003qiw.2	+						VTA1_uc011edt.1_Intron|VTA1_uc011edu.1_Intron	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog						cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		CCTAGTCCTCTTTTTTTTTTT	0.323													4	3	---	---	---	---	
SAMD5	389432	broad.mit.edu	37	6	147830411	147830411	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147830411delC	uc003qmc.1	+	1	349	c.347delC	c.(346-348)GCCfs	p.A116fs		NM_001030060	NP_001025231	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	116											0		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		CACACGACCGCCCCCCGCAGC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	158683839	158683839	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158683839delT								GTF2H5 (63473 upstream) : TULP4 (49853 downstream)																							GTCACCTTGCTTTTCAGGAGT	0.493													4	2	---	---	---	---	
PDE10A	10846	broad.mit.edu	37	6	166067323	166067323	+	Intron	DEL	C	-	-	rs35479314		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166067323delC	uc003qun.2	-						PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	GGACTCAGTGCGTAAGGAAGA	0.562													4	3	---	---	---	---	
FAM120B	84498	broad.mit.edu	37	6	170674269	170674270	+	Intron	DEL	TG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170674269_170674270delTG	uc003qxp.2	+						FAM120B_uc003qxo.1_Intron|FAM120B_uc011ehd.1_Intron|FAM120B_uc010kla.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B						cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		AATACGTATTTGTGTGTGTGTG	0.490													4	3	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945292	945292	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945292delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aagggaaaggagaaaggagaa	0.000													4	2	---	---	---	---	
ELFN1	392617	broad.mit.edu	37	7	1785687	1785688	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1785687_1785688delGG	uc010ksg.2	+	2	1839_1840	c.1455_1456delGG	c.(1453-1458)CAGGGCfs	p.Q485fs		NM_001128636	NP_001122108			extracellular leucine-rich repeat and												0						CGCTGTCCCAGGGCCCGCTGCT	0.713													4	2	---	---	---	---	
GNA12	2768	broad.mit.edu	37	7	2775234	2775234	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2775234delC	uc003smu.2	-						GNA12_uc011jwb.1_Intron|GNA12_uc003smt.2_Intron	NM_007353	NP_031379	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein)						G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		TGCAATCAGTCCCCCAGCTGC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	5620437	5620437	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5620437delA								ACTB (50205 upstream) : FSCN1 (12017 downstream)																							TGGTgctgggaggcacctcag	0.184													4	2	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40341873	40341873	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40341873delT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						ttcccacctgttttttttgtc	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46022009	46022009	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46022009delA								IGFBP3 (61138 upstream) : None (None downstream)																							tgaagaggggaaagagagggt	0.035													4	2	---	---	---	---	
SUN3	256979	broad.mit.edu	37	7	48047096	48047096	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48047096delA	uc003tof.2	-						SUN3_uc010kyq.2_Intron|SUN3_uc003tog.2_Intron|SUN3_uc011kcf.1_Intron	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1							integral to membrane				central_nervous_system(1)	1						ACGCTTCACTAAAAAAAAAAC	0.483													3	3	---	---	---	---	
VWC2	375567	broad.mit.edu	37	7	49927245	49927245	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49927245delA	uc003tot.1	+							NM_198570	NP_940972	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2						negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space					0						TTATGGCAGTAAAATAAGCCC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55408724	55408724	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55408724delC								EGFR (133694 upstream) : LANCL2 (24417 downstream)																							aaaaagctctccctgctgcag	0.000													4	2	---	---	---	---	
FKBP9L	360132	broad.mit.edu	37	7	55774617	55774617	+	5'Flank	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55774617delA	uc010kzl.2	-							NR_003949				SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);												0						accctgtctcaaaaaaaaaga	0.010													3	3	---	---	---	---	
PSPH	5723	broad.mit.edu	37	7	56085251	56085251	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56085251delT	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			tttctttttcttttttttttg	0.154													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56494037	56494037	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56494037delA								PSPH (309947 upstream) : DKFZp434L192 (69879 downstream)																							TAAAACTGTTAAAAAAAAAAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56994143	56994144	+	IGR	DEL	GA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56994143_56994144delGA								DKFZp434L192 (429166 upstream) : ZNF479 (193184 downstream)																							gcccagagtggagaggagtaaa	0.104													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63170323	63170323	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63170323delC								LOC100287704 (358172 upstream) : ZNF727 (335498 downstream)																							TCTGGTTCTTCCTTTTTTTGT	0.294													4	2	---	---	---	---	
TPST1	8460	broad.mit.edu	37	7	65671350	65671350	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65671350delG	uc003tuw.2	+						TPST1_uc010kzy.2_Intron|TPST1_uc010kzz.2_Intron|TPST1_uc010laa.2_Intron	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1						inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						GGCACATGGTGGGTGGTCACG	0.393													4	2	---	---	---	---	
LOC493754	493754	broad.mit.edu	37	7	66019362	66019363	+	Intron	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66019362_66019363insC	uc010lac.1	-						LOC493754_uc010lad.2_Intron|LOC493754_uc011kdx.1_Intron|LOC493754_uc011kdy.1_RNA|LOC493754_uc011kdz.1_RNA|LOC493754_uc011kea.1_RNA|LOC493754_uc003tvc.3_RNA|LOC493754_uc011keb.1_RNA|LOC493754_uc011kec.1_RNA					Homo sapiens cDNA FLJ14309 fis, clone PLACE3000221.												0						CTGTTTCTGTAGGATAAACACA	0.520													4	2	---	---	---	---	
LOC493754	493754	broad.mit.edu	37	7	66019363	66019364	+	Intron	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66019363_66019364insC	uc010lac.1	-						LOC493754_uc010lad.2_Intron|LOC493754_uc011kdx.1_Intron|LOC493754_uc011kdy.1_RNA|LOC493754_uc011kdz.1_RNA|LOC493754_uc011kea.1_RNA|LOC493754_uc003tvc.3_RNA|LOC493754_uc011keb.1_RNA|LOC493754_uc011kec.1_RNA					Homo sapiens cDNA FLJ14309 fis, clone PLACE3000221.												0						TGTTTCTGTAGGATAAACACAA	0.520													4	2	---	---	---	---	
NSUN5P2	260294	broad.mit.edu	37	7	72436916	72436917	+	Intron	DEL	GT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72436916_72436917delGT	uc010lao.2	-						uc003tws.1_Intron	NM_198853	NP_942150			tripartite motif-containing 74												0						ttGAAGATACgtgtgtgtgtgt	0.213													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93004918	93004918	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93004918delC								CCDC132 (16581 upstream) : CALCR (48881 downstream)																							aacttcatgtcctaggtttcc	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	126978612	126978612	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126978612delA								GRM8 (85465 upstream) : ZNF800 (31742 downstream)																							ATCCTCTGAGAAATGACATTG	0.368													4	2	---	---	---	---	
MGAM	8972	broad.mit.edu	37	7	141767394	141767394	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141767394delA	uc003vwy.2	+							NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	tgttcttggcactcagctcct	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142001979	142001979	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142001979delC	uc011kro.1	+											SubName: Full=V_segment translation product; Flags: Fragment;																		CACCTAGAGGCAGAGGCAGGA	0.383													4	2	---	---	---	---	
ZNF282	8427	broad.mit.edu	37	7	148904293	148904294	+	Intron	INS	-	AAGGTTCTTCATAAG	AAGGTTCTTCATAAG	rs147860582	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148904293_148904294insAAGGTTCTTCATAAG	uc003wfm.2	+						ZNF282_uc011kun.1_Intron|ZNF282_uc003wfn.2_Intron|ZNF282_uc003wfo.2_Intron	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		GACTCGTTTTCAGATTACCCGC	0.545													6	3	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	153587605	153587605	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153587605delA	uc003wli.2	+							NM_001039350	NP_001034439	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 3						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ATGTTCTTATAAAATCTTTAA	0.398													4	2	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154657224	154657224	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154657224delA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TTAGTCTCCTAAACATCAGAA	0.393													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3843456	3843456	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3843456delT	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CATAACTCAATTTTTTTTTCT	0.418													4	2	---	---	---	---	
GATA4	2626	broad.mit.edu	37	8	11599224	11599224	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11599224delA	uc003wuc.2	+						GATA4_uc003wub.1_Intron|GATA4_uc011kxc.1_Intron	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4						atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		GACAATGATGAAGGCCAGGAA	0.299													4	2	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12410313	12410313	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12410313delA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						aacaaccaccaaaaaaaacca	0.000													4	2	---	---	---	---	
SGCZ	137868	broad.mit.edu	37	8	15035707	15035707	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15035707delT	uc003wwq.2	-							NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		CAACCATTTCTTTTTTTGTTT	0.353													4	2	---	---	---	---	
TUSC3	7991	broad.mit.edu	37	8	15397351	15397351	+	5'Flank	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15397351delG	uc003wwt.2	+						TUSC3_uc003wwr.2_5'Flank|TUSC3_uc003wws.2_5'Flank|TUSC3_uc003wwu.2_5'Flank|TUSC3_uc003wwv.2_5'Flank|TUSC3_uc003www.2_5'Flank|TUSC3_uc003wwx.2_5'Flank|TUSC3_uc003wwy.2_5'Flank	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a						cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		GTGAAGTTGTGGGGCGGCTTC	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	18930662	18930663	+	IGR	INS	-	C	C	rs143995576	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18930662_18930663insC								PSD3 (59466 upstream) : SH2D4A (240544 downstream)																							CCATTTTTTTTCCCATAAGGCA	0.327													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20466191	20466192	+	IGR	DEL	AC	-	-	rs71970569		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20466191_20466192delAC								LZTS1 (353388 upstream) : None (None downstream)																							agcaagggatacacacacacac	0.000													4	2	---	---	---	---	
BMP1	649	broad.mit.edu	37	8	22029576	22029577	+	Intron	INS	-	GT	GT	rs148107356	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22029576_22029577insGT	uc003xbg.2	+						BMP1_uc011kzb.1_Intron|BMP1_uc003xba.2_Intron|BMP1_uc003xbb.2_Intron|BMP1_uc003xbe.2_Intron|BMP1_uc003xbc.2_Intron|BMP1_uc003xbd.2_Intron|BMP1_uc003xbf.2_Intron|BMP1_uc011kzc.1_Intron|BMP1_uc003xbh.2_Intron|BMP1_uc003xbi.2_Intron	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3						cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		TGATGAAGTCAGTGTGTGTGTG	0.500													4	2	---	---	---	---	
TNFRSF10D	8793	broad.mit.edu	37	8	23017581	23017581	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23017581delG	uc003xcz.1	-							NM_003840	NP_003831	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily,						anti-apoptosis|apoptosis	integral to membrane	TRAIL binding|transmembrane receptor activity				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		CTCTGGAGGAGGGGGAGGCAA	0.527													4	2	---	---	---	---	
HMBOX1	79618	broad.mit.edu	37	8	28908874	28908875	+	3'UTR	INS	-	AACC	AACC	rs147395804	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28908874_28908875insAACC	uc003xhd.3	+	10					HMBOX1_uc003xhc.3_Intron|HMBOX1_uc010lve.2_RNA|HMBOX1_uc003xhe.2_3'UTR|HMBOX1_uc011lay.1_3'UTR|HMBOX1_uc003xhf.2_3'UTR|HMBOX1_uc003xhg.2_3'UTR	NM_001135726	NP_001129198	Q6NT76	HMBX1_HUMAN	homeobox containing 1						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CAGTAAATAATAACCAACCAAC	0.455													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	29250318	29250318	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29250318delT								DUSP4 (42133 upstream) : C8orf75 (328460 downstream)																							actctgatccttttttttttc	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	29949454	29949455	+	IGR	INS	-	CA	CA			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29949454_29949455insCA								TMEM66 (8805 upstream) : LEPROTL1 (3467 downstream)																							acacatgcatgcacacacacat	0.069													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37446494	37446495	+	IGR	INS	-	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37446494_37446495insG								KCNU1 (652853 upstream) : ZNF703 (106806 downstream)																							AAGGAACAACAGGGGAAAAAGC	0.559													4	2	---	---	---	---	
ERLIN2	11160	broad.mit.edu	37	8	37606124	37606124	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37606124delC	uc003xke.3	+						LOC728024_uc010lvx.1_5'Flank	NM_007175	NP_009106	O94905	ERLN2_HUMAN	ER lipid raft associated 2 isoform 1						ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	protein binding				0		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			ACTTTCTCTTCCTCAGAGGCT	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53738821	53738821	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53738821delT								RB1CC1 (111795 upstream) : NPBWR1 (113647 downstream)																							gactcctcccttggctgcacc	0.000													4	2	---	---	---	---	
RGS20	8601	broad.mit.edu	37	8	54787196	54787196	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54787196delT	uc003xrp.2	+						RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			gccaaattccttttgaggtag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55222699	55222699	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55222699delT								MRPL15 (161625 upstream) : SOX17 (147796 downstream)																							TGCCAGAGCATTTTTTTTCTA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57350619	57350619	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57350619delT								SDR16C5 (117378 upstream) : PENK (2894 downstream)																							TTCCACGTGGTTTTCTCTGAG	0.552													4	2	---	---	---	---	
C8orf34	116328	broad.mit.edu	37	8	69699988	69699989	+	Intron	INS	-	A	A	rs146026747	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69699988_69699989insA	uc010lyz.2	+						C8orf34_uc003xyb.2_Intron	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			TAACTTTCTAGAAAAAAAAAGC	0.312													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	73152517	73152517	+	Intron	DEL	A	-	-	rs66533616		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73152517delA	uc010lzg.2	-											Homo sapiens cDNA, FLJ99767.																		ggaactgattatattcatctt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76211303	76211304	+	IGR	INS	-	A	A	rs145938042	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76211303_76211304insA								CRISPLD1 (264512 upstream) : HNF4G (108879 downstream)																							TATTGTTTTCCAGGTGTCATCA	0.396													4	3	---	---	---	---	
FBXO43	286151	broad.mit.edu	37	8	101149283	101149283	+	Intron	DEL	T	-	-	rs11291223		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101149283delT	uc003yjd.2	-						FBXO43_uc003yje.2_Intron|FBXO43_uc010mbp.1_3'UTR	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b						meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			CAAGATGttcttttttttttg	0.194													4	2	---	---	---	---	
ZHX2	22882	broad.mit.edu	37	8	123845856	123845856	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123845856delG	uc003ypk.1	+							NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			tgggtactatggggaatgtgg	0.000													4	2	---	---	---	---	
ZHX2	22882	broad.mit.edu	37	8	123856961	123856962	+	Intron	DEL	TC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123856961_123856962delTC	uc003ypk.1	+							NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			tctctctctttctctctctctc	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126963981	126963981	+	5'Flank	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126963981delT	uc003yry.2	-											Homo sapiens mRNA; cDNA DKFZp686L20185 (from clone DKFZp686L20185).																		TGTGTGTGTGTTTTTTTTTTC	0.234													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127597331	127597331	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127597331delA								FAM84B (26865 upstream) : LOC727677 (704731 downstream)																							AGGTTCAATGAAAATGCCCGT	0.527													4	2	---	---	---	---	
SLC45A4	57210	broad.mit.edu	37	8	142223171	142223172	+	Intron	INS	-	AGAC	AGAC	rs147267835	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142223171_142223172insAGAC	uc003ywd.1	-						SLC45A4_uc003ywc.1_Intron|SLC45A4_uc010meq.1_Intron	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			TTACTACCATTAGCATCTCTGC	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143839325	143839326	+	IGR	DEL	TG	-	-	rs149747106		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143839325_143839326delTG								LYPD2 (5373 upstream) : LYNX1 (6432 downstream)																							TTGATCACACTGAGAACTGGAG	0.495													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	145142498	145142498	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145142498delA								GPAA1 (1380 upstream) : CYC1 (7444 downstream)																							CTCCCATGCTAAATCAGCAAG	0.512													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	9758653	9758656	+	Intron	DEL	CCAA	-	-	rs141592387		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9758653_9758656delCCAA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTCCCTTGCCCCAACCAAGACAGA	0.525										TSP Lung(15;0.13)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	14936563	14936563	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14936563delA								FREM1 (25570 upstream) : LOC389705 (56762 downstream)																							TCTCCTCTCTAAAAAAAATCT	0.363													4	2	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20952694	20952694	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20952694delT	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		GTGGAAAGGGTTTTTTTTTTT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	26710234	26710234	+	IGR	DEL	C	-	-	rs35915354		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26710234delC								None (None upstream) : C9orf82 (130450 downstream)																							ACAGTCACCACTAGTGTTCTC	0.318													9	7	---	---	---	---	
DDX58	23586	broad.mit.edu	37	9	32461639	32461639	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32461639delA	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		agcacagggtaaatgcccaTC	0.189													4	2	---	---	---	---	
B4GALT1	2683	broad.mit.edu	37	9	33161019	33161020	+	Intron	INS	-	TC	TC	rs143620343	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33161019_33161020insTC	uc003zsg.2	-							NM_001497	NP_001488	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-						oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	basolateral plasma membrane|brush border membrane|desmosome|external side of plasma membrane|extracellular region|glycocalyx|Golgi cisterna membrane|Golgi trans cisterna|integral to membrane	alpha-tubulin binding|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|beta-tubulin binding|lactose synthase activity|metal ion binding|N-acetyllactosamine synthase activity|protein binding|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	AGGCAAGTCATtctctctctct	0.436													3	3	---	---	---	---	
C9orf144	389715	broad.mit.edu	37	9	34838900	34838900	+	5'Flank	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34838900delC	uc003zvp.3	-							NR_024481				RecName: Full=Uncharacterized protein C9orf144A;												0						CACTAACTCTCCCACTAGTTT	0.483													4	2	---	---	---	---	
PAX5	5079	broad.mit.edu	37	9	36905714	36905714	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36905714delA	uc003zzo.1	-						PAX5_uc011lpt.1_Intron|PAX5_uc011lpu.1_Intron|PAX5_uc011lpv.1_Intron|PAX5_uc011lpw.1_Intron|PAX5_uc011lpx.1_Intron|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Intron|PAX5_uc011lpz.1_Intron|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_Intron|PAX5_uc011lqb.1_Intron|PAX5_uc010mlo.1_Intron|PAX5_uc010mlp.1_Intron|PAX5_uc011lqc.1_Intron|PAX5_uc010mlr.1_Intron	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5						cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(20)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		TAGGAGAGGGAAAAAAAAGAC	0.368			T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								4	2	---	---	---	---	
MCART1	92014	broad.mit.edu	37	9	37884814	37884814	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37884814delT	uc004aar.1	-						MCART1_uc004aaq.1_Intron|uc004aas.1_5'Flank	NR_024873		Q9H1U9	MCAR1_HUMAN	Homo sapiens cDNA FLJ34088 fis, clone FCBBF3005698.						transport	integral to membrane|mitochondrial inner membrane				ovary(2)|breast(1)	3				GBM - Glioblastoma multiforme(29;0.00559)|Lung(182;0.0422)		TCCCTTCATCTTTTGGCAATG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66466004	66466005	+	RNA	INS	-	A	A	rs71272522		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66466004_66466005insA	uc004aec.2	+	3		c.637_638insA								Homo sapiens, clone IMAGE:5213378, mRNA.																		GATTCTTCAGTAAAAAAAAGTA	0.198													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66529520	66529521	+	Intron	INS	-	A	A	rs148013875	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66529520_66529521insA	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																		CTGATACTGCCAAAAAAAAGAA	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68402587	68402587	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68402587delA								FAM27B (608398 upstream) : MIR1299 (599652 downstream)																							TGTAAAATTTAGGCAGAATTT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68403584	68403586	+	IGR	DEL	CAA	-	-	rs111461517		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68403584_68403586delCAA								FAM27B (609395 upstream) : MIR1299 (598653 downstream)																							TCAGCTGCAGCAACACTTACAAA	0.350													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	72018261	72018262	+	IGR	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72018261_72018262insA								FAM189A2 (10891 upstream) : APBA1 (24187 downstream)																							tgtgttcagggagtattgtggt	0.000													4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79896655	79896656	+	Intron	INS	-	TA	TA	rs146803667	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79896655_79896656insTA	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						gtgtatatgtgtatatatatat	0.213													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	85462578	85462579	+	IGR	INS	-	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85462578_85462579insT								FLJ46321 (852408 upstream) : RASEF (134738 downstream)																							TGCCATTTCTGTTTTTTTACTT	0.327													4	2	---	---	---	---	
GKAP1	80318	broad.mit.edu	37	9	86357182	86357182	+	Intron	DEL	T	-	-	rs3217183		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86357182delT	uc004amy.2	-						GKAP1_uc004amz.2_Intron	NM_025211	NP_079487	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1 isoform a						signal transduction	Golgi apparatus					0						AGATACAGGGTTAAGTTCTAT	0.413													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	88371458	88371459	+	IGR	INS	-	GATA	GATA	rs145059279	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88371458_88371459insGATA								AGTPBP1 (14514 upstream) : NAA35 (184598 downstream)																							atggatagatggatagatagat	0.079													3	3	---	---	---	---	
C9orf47	286223	broad.mit.edu	37	9	91607188	91607189	+	3'UTR	DEL	TC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91607188_91607189delTC	uc004aqd.2	+	3					S1PR3_uc004aqe.2_Intron|C9orf47_uc004aqc.1_3'UTR	NM_001001938	NP_001001938	Q6ZRZ4	CI047_HUMAN	hypothetical protein LOC286223 isoform 1							extracellular region					0						CAATAGTCAGtctctctctctc	0.342													4	2	---	---	---	---	
FAM120A	23196	broad.mit.edu	37	9	96323232	96323232	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96323232delA	uc004atw.2	+						FAM120A_uc004aty.2_Intron|FAM120A_uc004atz.2_Intron|FAM120A_uc010mrg.2_Intron|FAM120A_uc004aua.1_5'Flank	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator							cytoplasm|plasma membrane	RNA binding				0						CAGTGTGCACATAGATACACT	0.313													16	7	---	---	---	---	
GABBR2	9568	broad.mit.edu	37	9	101315502	101315503	+	Intron	INS	-	AC	AC	rs137924837	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101315502_101315503insAC	uc004ays.2	-							NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	ttgtaagggagacattagtgcc	0.020													3	3	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	115024485	115024485	+	Intron	DEL	A	-	-	rs79434908		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115024485delA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						TACCTACAAGAAAAAAAAAAT	0.279													4	2	---	---	---	---	
RGS3	5998	broad.mit.edu	37	9	116267987	116267987	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116267987delT	uc004bhq.2	+						RGS3_uc004bhr.2_Intron|RGS3_uc004bhs.2_Intron|RGS3_uc004bht.2_Intron|RGS3_uc010muy.2_Intron|RGS3_uc004bhu.2_Intron	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6						inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						ATATGCCCACTTTTTTTTTGT	0.318													5	3	---	---	---	---	
GSN	2934	broad.mit.edu	37	9	124027258	124027258	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124027258delG	uc004bld.1	+							NM_198252	NP_937895	P06396	GELS_HUMAN	gelsolin isoform b						actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3						GATGAAAGATGGGGGAGAGAG	0.498													4	2	---	---	---	---	
TTLL11	158135	broad.mit.edu	37	9	124603166	124603166	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124603166delG	uc011lyl.1	-						TTLL11_uc004blr.2_Intron	NM_001139442	NP_001132914	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0						GCTAGGCCCTGGGCCCCAAAC	0.502													4	2	---	---	---	---	
STXBP1	6812	broad.mit.edu	37	9	130439139	130439140	+	Intron	DEL	AG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130439139_130439140delAG	uc004brl.2	+						STXBP1_uc004brk.2_Intron	NM_001032221	NP_001027392	P61764	STXB1_HUMAN	syntaxin binding protein 1 isoform b						axon target recognition|energy reserve metabolic process|glutamate secretion|negative regulation of synaptic transmission, GABAergic|neurotransmitter secretion|platelet aggregation|platelet degranulation|protein transport|regulation of insulin secretion|regulation of synaptic vesicle priming|synaptic vesicle maturation|vesicle docking involved in exocytosis	cytosol|mitochondrion|plasma membrane|platelet alpha granule|protein complex	identical protein binding|syntaxin-1 binding|syntaxin-2 binding			skin(1)	1						TCGTACGTCAAGAGAGAGAGAC	0.490													4	2	---	---	---	---	
FUBP3	8939	broad.mit.edu	37	9	133473043	133473043	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133473043delA	uc004bzr.1	+						FUBP3_uc010mzd.1_Intron|FUBP3_uc004bzs.1_Intron	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		GACAACTGACAAAAAGGGGCT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	135136577	135136578	+	IGR	INS	-	C	C	rs144894946	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135136577_135136578insC								NTNG2 (18357 upstream) : SETX (250 downstream)																							GGGTCACTGTTCATCTGTTCCT	0.495													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138214241	138214241	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138214241delC								OLFM1 (201210 upstream) : KIAA0649 (157407 downstream)																							TTGAAAGAGGCCCCAGCTGTT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3559338	3559338	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3559338delG	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																		CACACAGCTTGGGGAGGGCTC	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	10762596	10762597	+	IGR	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10762596_10762597insA								None (None upstream) : SFTA1P (63805 downstream)																							TATTCTCGGTTAAAAAAATAGA	0.366													4	2	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	14266574	14266574	+	Intron	DEL	T	-	-	rs943365	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14266574delT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imv.2_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						TAAATTTTGATTTTTTTTTTC	0.383													4	2	---	---	---	---	
PTER	9317	broad.mit.edu	37	10	16511513	16511514	+	Intron	INS	-	AG	AG	rs138097420	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16511513_16511514insAG	uc001iog.1	+						PTER_uc001ioh.1_Intron|PTER_uc001ioi.1_Intron|PTER_uc009xjp.1_Intron	NM_030664	NP_109589	Q96BW5	PTER_HUMAN	phosphotriesterase related						catabolic process		hydrolase activity, acting on ester bonds|zinc ion binding			ovary(2)	2						tgaaggggaaaaggaatcaaag	0.050													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	17544121	17544121	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17544121delC								ST8SIA6 (47867 upstream) : PTPLA (87839 downstream)																							ACATTGAAAACCTTTTGTATC	0.333													3	3	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18116345	18116345	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18116345delA	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						aaaaataaccaaaaaaaaaaa	0.343													3	3	---	---	---	---	
GAD2	2572	broad.mit.edu	37	10	26566919	26566919	+	Intron	DEL	T	-	-	rs112835024		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26566919delT	uc001isp.2	+						GAD2_uc001isq.2_Intron	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2						glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	CCTGAGGCTGttttttttttt	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30944244	30944244	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30944244delT								LYZL2 (25597 upstream) : ZNF438 (189323 downstream)																							GATGGTTAGGTTGCAGCACTG	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34072910	34072910	+	IGR	DEL	T	-	-	rs55662658		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34072910delT								NRP1 (448904 upstream) : PARD3 (327188 downstream)																							tatcttctggtggctatgcag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35256166	35256166	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35256166delA								PARD3 (152243 upstream) : CUL2 (42642 downstream)																							ATCAAGGAGGAAAAAAAAGCC	0.428													4	2	---	---	---	---	
CCNY	219771	broad.mit.edu	37	10	35840517	35840521	+	Intron	DEL	ATTTC	-	-	rs142203900		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35840517_35840521delATTTC	uc001iyw.3	+						CCNY_uc001iyu.3_Intron|CCNY_uc001iyv.3_Intron|CCNY_uc001iyx.3_Intron|CCNY_uc009xmb.2_Intron|CCNY_uc010qet.1_Intron	NM_145012	NP_659449	Q8ND76	CCNY_HUMAN	cyclin Y isoform 1						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0						TGTAGTAGTAATTTCATAGTTCAGA	0.317													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36191495	36191495	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36191495delG								FZD8 (261133 upstream) : None (None downstream)																							TAGCTCTGCTGGTGGAAATGT	0.463													4	2	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47023147	47023148	+	Intron	DEL	GT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47023147_47023148delGT	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						ggtgtgtgtagtgtgtgtgtgt	0.000													4	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47062881	47062882	+	Intron	INS	-	T	T	rs142898535		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47062881_47062882insT	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						ttttcccccccgggcccttcaa	0.010													5	6	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55681150	55681151	+	Intron	INS	-	T	T	rs138832650	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55681150_55681151insT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CCTAATATGACTTTTTTTTTAT	0.371										HNSCC(58;0.16)			3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	70576425	70576425	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70576425delT								CCAR1 (25118 upstream) : STOX1 (10869 downstream)																							TTCTGAGAACTAGAAAGAAGC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	72753059	72753059	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72753059delA								PCBD1 (104518 upstream) : UNC5B (219239 downstream)																							tgtgcagaggaggcactcagc	0.229													4	2	---	---	---	---	
USP54	159195	broad.mit.edu	37	10	75344639	75344639	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75344639delT	uc010qkl.1	-							NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54						ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					TTTCATTCTATTTTCACTGCT	0.408													13	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	79445669	79445669	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79445669delT								KCNMA1 (48092 upstream) : DLG5 (104882 downstream)																							CAAACCAACATTTAGCCTGCA	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	79985046	79985046	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79985046delC								RPS24 (168476 upstream) : LOC283050 (718038 downstream)																							gaagttaatgcccagagtgac	0.025													4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87955855	87955855	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87955855delT	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	CATGGACCCCTTCATCCTTTC	0.527										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
C10orf116	10974	broad.mit.edu	37	10	88726347	88726348	+	5'Flank	INS	-	CA	CA			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88726347_88726348insCA	uc001ked.2	+							NM_006829	NP_006820	Q15847	APM2_HUMAN	adipose specific 2												0						aatttaatcttcacacacacac	0.193													4	2	---	---	---	---	
ATAD1	84896	broad.mit.edu	37	10	89565502	89565504	+	Intron	DEL	CCT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89565502_89565504delCCT	uc001key.1	-						ATAD1_uc009xth.1_Intron|ATAD1_uc001kez.1_Intron	NM_032810	NP_116199	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1							peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CCCCTCTCTACCTCCTCCTCCTC	0.438													4	2	---	---	---	---	
RNLS	55328	broad.mit.edu	37	10	90101898	90101898	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90101898delT	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879	Q5VYX0	RNLS_HUMAN	renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1						GCTTCCTCCATTTCTTTCCTA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	92719972	92719972	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92719972delA								ANKRD1 (38940 upstream) : NUDT9P1 (191789 downstream)																							atccaagtctaaatgtaccat	0.000													4	2	---	---	---	---	
EXOC6	54536	broad.mit.edu	37	10	94737028	94737029	+	Intron	DEL	AA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94737028_94737029delAA	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron|EXOC6_uc001kih.2_Intron|EXOC6_uc001kii.2_Intron	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				TGGAATGGGGAAAAAAAAAGGT	0.312													4	2	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100310928	100310928	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100310928delG	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TTGTTGGGAAGCTTGATCTTT	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	101079459	101079459	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101079459delG								HPSE2 (83840 upstream) : CNNM1 (9397 downstream)																							gctgatgattggtgagctcag	0.000													4	2	---	---	---	---	
OBFC1	79991	broad.mit.edu	37	10	105649126	105649126	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105649126delA	uc001kxl.2	-						OBFC1_uc001kxm.2_Intron|OBFC1_uc001kxn.2_Intron	NM_024928	NP_079204	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold						positive regulation of DNA replication|telomere maintenance via telomere lengthening		protein binding|single-stranded telomeric DNA binding			ovary(1)	1		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		AGGTTAAAACAAAAAAAAAGC	0.393													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119544526	119544527	+	IGR	INS	-	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119544526_119544527insT								EMX2 (235470 upstream) : RAB11FIP2 (219902 downstream)																							TGGCGTGAGGCTCCCACACAGC	0.470													4	2	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121092976	121092977	+	Intron	DEL	AG	-	-	rs58167967		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121092976_121092977delAG	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		TCCTTAGCTCAGGGGACTGGAG	0.569													1	5	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	133002292	133002292	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133002292delC	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		gtgatgagagcagagccctca	0.000													4	2	---	---	---	---	
STIM1	6786	broad.mit.edu	37	11	4060380	4060380	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4060380delA	uc001lyv.2	+						STIM1_uc009yef.2_Intron	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		aaaattatagaaaatgttggc	0.154													4	2	---	---	---	---	
OR51B5	282763	broad.mit.edu	37	11	5384688	5384689	+	Intron	DEL	CT	-	-	rs72056860		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5384688_5384689delCT	uc001maq.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		tacacacacactctctctctca	0.257													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13058643	13058643	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13058643delA								RASSF10 (25996 upstream) : ARNTL (240682 downstream)																							TTACAAAGTGAAAAAAAAGAC	0.343													4	2	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	Intron	INS	-	T	T	rs11432678		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14101781_14101782insT	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		TAttttttttcttttttttttt	0.163													9	4	---	---	---	---	
C11orf41	25758	broad.mit.edu	37	11	33676803	33676804	+	Intron	DEL	AC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33676803_33676804delAC	uc001mup.3	+							NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758							integral to membrane				ovary(2)	2						caaaagacatacacacacacac	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34754776	34754777	+	IGR	INS	-	AC	AC	rs140947023	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34754776_34754777insAC								EHF (71695 upstream) : APIP (141937 downstream)																							Tacacacacatacacacacaca	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45312487	45312487	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45312487delG								SYT13 (4603 upstream) : CHST1 (357940 downstream)																							ATGACTGACTGGGTGTTCCCC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45468309	45468309	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45468309delA								SYT13 (160425 upstream) : CHST1 (202118 downstream)																							AATTAGCAGGAAAGAGGAAGC	0.279													4	2	---	---	---	---	
NXF1	10482	broad.mit.edu	37	11	62570386	62570386	+	Intron	DEL	A	-	-	rs35296297		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62570386delA	uc001nvf.1	-						NXF1_uc001nvg.1_Intron|NXF1_uc009yog.1_Intron|NXF1_uc010rmh.1_Intron	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1						gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						TCCCCCAACCAAAATTTTCAT	0.488													4	2	---	---	---	---	
MACROD1	28992	broad.mit.edu	37	11	63809281	63809282	+	Intron	INS	-	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63809281_63809282insG	uc001nyh.2	-							NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1												0						TCTGGCTGTTAGGGGGTGGGTG	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68715428	68715428	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68715428delT								IGHMBP2 (7359 upstream) : MRGPRD (32063 downstream)																							catctcttccttttttaaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	70107239	70107240	+	IGR	INS	-	AA	AA	rs142510174	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70107239_70107240insAA								FADD (53731 upstream) : PPFIA1 (9583 downstream)																							tcagactctggaatgccagcaa	0.064													3	3	---	---	---	---	
CTTN	2017	broad.mit.edu	37	11	70256704	70256705	+	Intron	DEL	CT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70256704_70256705delCT	uc001opv.3	+						CTTN_uc001opu.2_Intron|CTTN_uc001opw.3_Intron	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a							cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GCTTTAGGTCCTCTCTACCTTA	0.525													4	2	---	---	---	---	
AMOTL1	154810	broad.mit.edu	37	11	94530286	94530286	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94530286delA	uc001pfb.2	+						AMOTL1_uc001pfc.2_Intron	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1							cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				TTGTTTTGGGAAAATGATGTG	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95032799	95032799	+	IGR	DEL	T	-	-	rs75314639		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95032799delT								SESN3 (67094 upstream) : FAM76B (469307 downstream)																							GGTTTTGTGATTTTTTTTTTT	0.498													4	3	---	---	---	---	
C11orf1	64776	broad.mit.edu	37	11	111754317	111754317	+	Intron	DEL	A	-	-	rs77138369		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111754317delA	uc001pmd.2	+						C11orf1_uc001pme.2_Intron	NM_022761	NP_073598	Q9H5F2	CK001_HUMAN	hypothetical protein LOC64776							nucleus					0		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		actctatctcaaaaaaaaaaa	0.124													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113900499	113900499	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113900499delG								HTR3A (39467 upstream) : ZBTB16 (29932 downstream)																							AGAGAAAGTCGAAAACCCAGA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116526266	116526266	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116526266delA								None (None upstream) : BUD13 (92622 downstream)																							GGGTAGAAGCAAAAAAAACCT	0.318													4	2	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116856775	116856775	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116856775delA	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						TTCTGGTGGCAAAAAAAAGTC	0.368													4	2	---	---	---	---	
CDON	50937	broad.mit.edu	37	11	125871412	125871413	+	Intron	DEL	AG	-	-	rs34580130		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125871412_125871413delAG	uc009zbw.2	-						CDON_uc001qdb.3_Intron|CDON_uc001qdc.3_Intron	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ATTTTGAGTCAGAGTTAATGAA	0.238													5	5	---	---	---	---	
NINJ2	4815	broad.mit.edu	37	12	755722	755722	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:755722delG	uc001qil.2	-						NINJ2_uc010sdr.1_5'Flank|NINJ2_uc010sds.1_Intron	NM_016533	NP_057617	Q9NZG7	NINJ2_HUMAN	ninjurin 2						nervous system development|neuron cell-cell adhesion|tissue regeneration	integral to plasma membrane				ovary(2)	2	all_cancers(10;0.0101)|all_epithelial(11;0.0174)|Ovarian(42;0.0512)|all_lung(10;0.103)|Lung NSC(10;0.185)		OV - Ovarian serous cystadenocarcinoma(31;3.26e-05)|BRCA - Breast invasive adenocarcinoma(9;0.0508)			GAGAAAAAGAGGGACAGAGGA	0.512													4	2	---	---	---	---	
NDUFA9	4704	broad.mit.edu	37	12	4770168	4770169	+	Intron	INS	-	T	T	rs150083275	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4770168_4770169insT	uc001qnc.2	+						NDUFA9_uc009zei.1_Intron|NDUFA9_uc010ses.1_Intron	NM_005002	NP_004993	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	gagttggtatgtttttttttaa	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	11660277	11660278	+	IGR	DEL	CA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11660277_11660278delCA								PRB2 (111779 upstream) : ETV6 (142510 downstream)																							attactcatgcacacacacaca	0.317													4	2	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	12203987	12203988	+	Intron	INS	-	T	T	rs146295036	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12203987_12203988insT	uc001raa.1	+						uc001rab.1_Intron	NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				ACCTCAAATGCTTTTAGATGAA	0.411			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								2	4	---	---	---	---	
BCL2L14	79370	broad.mit.edu	37	12	12229266	12229280	+	Intron	DEL	TGCATGTAAGTGAAA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12229266_12229280delTGCATGTAAGTGAAA	uc001rac.2	+						ETV6_uc001raa.1_Intron|BCL2L14_uc001raf.1_5'Flank|BCL2L14_uc001rad.2_Intron|BCL2L14_uc001rae.2_Intron	NM_138723	NP_620049	Q9BZR8	B2L14_HUMAN	BCL2-like 14 isoform 1						apoptosis|regulation of apoptosis	cytosol|endomembrane system|intracellular organelle|membrane	protein binding			skin(1)	1		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		GCAAACGATTTGCATGTAAGTGAAATGCATGTAAG	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	17554128	17554128	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17554128delA								LMO3 (791370 upstream) : RERGL (679676 downstream)																							TTTAAATGTCAAAAAAAATAT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	25498917	25498917	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25498917delA								KRAS (95054 upstream) : IFLTD1 (130099 downstream)																							GTCTCCTTCCAAAAGCAAAAC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34473861	34473861	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34473861delT								ALG10 (292627 upstream) : None (None downstream)																							ctgccacgccttttttttccc	0.000													4	2	---	---	---	---	
HDAC7	51564	broad.mit.edu	37	12	48176656	48176657	+	3'UTR	DEL	CA	-	-	rs67892211		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48176656_48176657delCA	uc010slo.1	-	26					HDAC7_uc009zku.2_RNA|HDAC7_uc001rqe.2_3'UTR|HDAC7_uc001rqj.3_3'UTR|HDAC7_uc001rqk.3_3'UTR	NM_015401	NP_056216	Q8WUI4	HDAC7_HUMAN	histone deacetylase 7 isoform a						negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)		acgcctcactcacacacatgct	0.322													3	5	---	---	---	---	
LETMD1	25875	broad.mit.edu	37	12	51442451	51442451	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51442451delC	uc001rxm.2	+						LETMD1_uc010smz.1_Intron|LETMD1_uc010sna.1_Intron|LETMD1_uc001rxl.2_Intron|LETMD1_uc009zlv.2_Intron|LETMD1_uc001rxs.2_Intron|LETMD1_uc009zlw.2_Intron|LETMD1_uc001rxn.2_Intron|LETMD1_uc001rxo.2_Intron|LETMD1_uc001rxp.2_Intron|LETMD1_uc001rxq.2_Intron|LETMD1_uc001rxr.2_Intron|LETMD1_uc001rxt.2_5'Flank	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1							integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						ACTCTCAGTGCCCCATATTGT	0.512											OREG0021818	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
SMAGP	57228	broad.mit.edu	37	12	51644751	51644751	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51644751delC	uc001ryc.1	-						SMAGP_uc001ryd.1_Intron|SMAGP_uc001rye.1_Intron|SMAGP_uc001ryf.1_Intron	NM_001033873	NP_001029045	Q0VAQ4	SMAGP_HUMAN	small trans-membrane and glycosylated protein							cytoplasmic vesicle membrane|integral to membrane|plasma membrane					0						CCCCAAATCGCCCAGGGCTGC	0.358													4	2	---	---	---	---	
PTGES3	10728	broad.mit.edu	37	12	57060420	57060420	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57060420delT	uc001slu.3	-						PTGES3_uc001slw.3_Intron|PTGES3_uc010sqs.1_Intron|PTGES3_uc001slv.3_Intron|PTGES3_uc010sqt.1_Intron|PTGES3_uc009zox.2_Intron	NM_006601	NP_006592	Q15185	TEBP_HUMAN	prostaglandin-E synthase 3						chaperone cofactor-dependent protein refolding|hormone biosynthetic process|prostaglandin biosynthetic process|signal transduction|telomere maintenance	cytosol|telomerase holoenzyme complex	prostaglandin-E synthase activity|telomerase activity|unfolded protein binding				0						TAAGGTAttcttttttttttg	0.184													2	5	---	---	---	---	
NXPH4	11247	broad.mit.edu	37	12	57612447	57612450	+	Intron	DEL	GTGT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57612447_57612450delGTGT	uc010srf.1	+						NXPH4_uc009zpj.2_Intron	NM_007224	NP_009155	O95158	NXPH4_HUMAN	neurexophilin 4 precursor						neuropeptide signaling pathway	extracellular region					0						ATCTATCTGAGTGTGTGTGTGTGA	0.461													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	67589405	67589405	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67589405delG								GRIP1 (391511 upstream) : CAND1 (73656 downstream)																							TTGATCTTTTGTACTAACTAG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80166335	80166335	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80166335delT								PAWR (81545 upstream) : PPP1R12A (1009 downstream)																							TTTAGTGGAGTTTGCTCTGTG	0.363													4	2	---	---	---	---	
TMTC2	160335	broad.mit.edu	37	12	83094370	83094371	+	Intron	DEL	AC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83094370_83094371delAC	uc001szt.2	+						TMTC2_uc001szr.1_Intron|TMTC2_uc001szs.1_Intron|TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						TTACCATTATACACACACACAG	0.287													4	2	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88487980	88487980	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88487980delA	uc001tar.2	-						CEP290_uc001taq.2_Intron|CEP290_uc001tat.2_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						tcaaatgattaaaaaaaaaaa	0.104													6	3	---	---	---	---	
FGD6	55785	broad.mit.edu	37	12	95507184	95507184	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95507184delT	uc001tdp.3	-						FGD6_uc009zsx.2_Intron|FGD6_uc001tdq.1_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						agtttttgtattttttttagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98129553	98129553	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98129553delT	uc001tfc.1	-						uc001tfd.2_Intron					Homo sapiens cDNA FLJ25775 fis, clone TST06543.																		Gagagttgaatttaccatgaa	0.204													4	2	---	---	---	---	
MYBPC1	4604	broad.mit.edu	37	12	102030746	102030746	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102030746delT	uc001tii.2	+						MYBPC1_uc001tif.1_Intron|MYBPC1_uc001tig.2_Intron|MYBPC1_uc010svq.1_Intron|MYBPC1_uc001tih.2_Intron|MYBPC1_uc001tij.2_Intron|MYBPC1_uc010svr.1_Intron|MYBPC1_uc010svs.1_Intron|MYBPC1_uc010svt.1_Intron|MYBPC1_uc010svu.1_Intron|MYBPC1_uc001tik.2_Intron	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3						cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						TCTTCACCTATTTTTTTTTAA	0.323													6	3	---	---	---	---	
RFX4	5992	broad.mit.edu	37	12	106979031	106979031	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106979031delG	uc001tlr.2	+							NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						GGAGGACTGTGGGGCTGTGGA	0.607													4	2	---	---	---	---	
C12orf76	400073	broad.mit.edu	37	12	110506554	110506554	+	5'Flank	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110506554delT	uc001tqd.1	-						C12orf76_uc001tqe.1_Intron|C12orf76_uc010sxx.1_5'Flank|uc001tqf.1_Intron	NM_207435	NP_997318	Q8N812	CL076_HUMAN	hypothetical protein LOC400073											large_intestine(1)	1						CTCTTTATCCTTCCAGCCCCA	0.507													4	2	---	---	---	---	
MAPKAPK5	8550	broad.mit.edu	37	12	112307015	112307015	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112307015delC	uc001tta.2	+						MAPKAPK5_uc001tsz.2_Intron|MAPKAPK5_uc001ttb.2_Intron	NM_139078	NP_620777	Q8IW41	MAPK5_HUMAN	MAP kinase-activated protein kinase 5 isoform 2						signal transduction	cytoplasm|nucleus	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)	3						GCTGCTGATACCACCTGAAAG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114022281	114022282	+	IGR	INS	-	C	C	rs79221245		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114022281_114022282insC								LHX5 (112404 upstream) : RBM19 (232261 downstream)																							ctaccttttttccccccatggc	0.000													4	2	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119420959	119420959	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119420959delC	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						TCTGAACTTTCCAGTGAGTGT	0.428													4	2	---	---	---	---	
DENR	8562	broad.mit.edu	37	12	123254062	123254062	+	3'UTR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123254062delT	uc001uda.2	+	8					DENR_uc010tag.1_Intron|DENR_uc001udb.2_3'UTR	NM_003677	NP_003668	O43583	DENR_HUMAN	density-regulated protein								protein binding|translation initiation factor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.28e-05)|Epithelial(86;6.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.199)		tctctctctcttttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128263903	128263904	+	IGR	DEL	CA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128263903_128263904delCA								None (None upstream) : TMEM132C (635387 downstream)																							tcctcatagtcacaaaatgact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128597513	128597513	+	IGR	DEL	T	-	-	rs77367287		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128597513delT								None (None upstream) : TMEM132C (301778 downstream)																							AAGTCATTGCTTTTTTTTTTT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128705120	128705120	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128705120delT								None (None upstream) : TMEM132C (194171 downstream)																							CTGTTCTTACTTTTTTTTCCT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128729782	128729782	+	IGR	DEL	T	-	-	rs7973883	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128729782delT								None (None upstream) : TMEM132C (169509 downstream)																							AAACTCCTTCTCCAGGGCTCC	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27060774	27060774	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27060774delT								CDK8 (82205 upstream) : WASF3 (71066 downstream)																							ATCTGCTTTCTTTTTTGGCTC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31640215	31640215	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31640215delG								C13orf26 (91064 upstream) : HSPH1 (70550 downstream)																							AAAGAGTGGTGGGAAATACAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	32161942	32161943	+	IGR	INS	-	CA	CA	rs34889370		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32161942_32161943insCA								B3GALTL (255533 upstream) : RXFP2 (151736 downstream)																							aaggctgcatgctgttcatctc	0.000													4	2	---	---	---	---	
CCDC122	160857	broad.mit.edu	37	13	44434368	44434370	+	Intron	DEL	ATT	-	-	rs72274241		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44434368_44434370delATT	uc010acf.2	-						CCDC122_uc010tfn.1_Intron	NM_144974	NP_659411	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122												0		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		AATAAACACAATTATTTTATAAT	0.192													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	52613471	52613471	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52613471delC								UTP14C (5737 upstream) : NEK5 (25431 downstream)																							tgccagtcatcatggaggacc	0.100													4	2	---	---	---	---	
PIBF1	10464	broad.mit.edu	37	13	73410605	73410605	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73410605delA	uc001vjc.2	+						PIBF1_uc001vja.1_Intron|PIBF1_uc010aeo.1_Intron|PIBF1_uc001vjb.2_Intron|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		CAATTCCAGGAAAAAAAAGCT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	73715701	73715701	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73715701delG								KLF5 (64026 upstream) : KLF12 (544449 downstream)																							CTTTACCCTTGCCTCCGAGGA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	82788931	82788931	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82788931delT								None (None upstream) : None (None downstream)																							cttctaaaacttctattatgt	0.000													4	2	---	---	---	---	
GPC5	2262	broad.mit.edu	37	13	92931753	92931753	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92931753delA	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				tactcctgataagactttaag	0.000													4	2	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95927867	95927867	+	Intron	DEL	G	-	-	rs35693009		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95927867delG	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	TCTTGGCGGTGACTCTAGAAC	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	99830364	99830366	+	IGR	DEL	CCA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99830364_99830366delCCA								DOCK9 (91704 upstream) : UBAC2 (22313 downstream)																							tgttgtgcagccaccaccaccac	0.005													4	2	---	---	---	---	
UBAC2	337867	broad.mit.edu	37	13	99860129	99860129	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99860129delT	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					cctgaggctcttttttttgtg	0.169													4	2	---	---	---	---	
UBAC2	337867	broad.mit.edu	37	13	99897092	99897092	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99897092delT	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					tttattttacttttttttttt	0.080													9	4	---	---	---	---	
FGF14	2259	broad.mit.edu	37	13	102735690	102735690	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102735690delT	uc001vpf.2	-							NM_175929	NP_787125	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1B						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					actctgaccgttttttttctt	0.010													4	2	---	---	---	---	
ARHGEF7	8874	broad.mit.edu	37	13	111806689	111806689	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111806689delA	uc001vrs.2	+						ARHGEF7_uc001vrr.2_Intron|ARHGEF7_uc001vrt.2_Intron|ARHGEF7_uc010tjn.1_Intron|ARHGEF7_uc001vru.1_Intron|ARHGEF7_uc001vrv.3_Intron|ARHGEF7_uc001vrw.3_Intron	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c						apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CACCTGCCTCAGCATGAACTC	0.512											OREG0022521	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112797352	112797352	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112797352delG								SOX1 (71332 upstream) : C13orf28 (233317 downstream)																							CGCCCCTCATGGGGGGATCAG	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20966479	20966479	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20966479delT								PNP (21233 upstream) : RNASE10 (7217 downstream)																							AATGTTTGAAttttttttttc	0.124													4	2	---	---	---	---	
EFS	10278	broad.mit.edu	37	14	23833340	23833340	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23833340delA	uc001wjo.2	-						EFS_uc001wjp.2_Intron|EFS_uc010tnm.1_Intron	NM_005864	NP_005855	O43281	EFS_HUMAN	embryonal Fyn-associated substrate isoform 1						cell adhesion|intracellular signal transduction	cytoplasm	SH3 domain binding			large_intestine(1)	1	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		AAGAGGGTGGAAAGGGAACAA	0.547													4	2	---	---	---	---	
SLC25A21	89874	broad.mit.edu	37	14	37235348	37235350	+	Intron	DEL	CAA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37235348_37235350delCAA	uc001wtz.1	-							NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)		ctctttctctcaaccatgatcta	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38333603	38333603	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38333603delT	uc001wug.2	+											Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		TGCTCACCCCTCCTATGGGTC	0.522													4	2	---	---	---	---	
TXNDC16	57544	broad.mit.edu	37	14	53017396	53017397	+	Intron	INS	-	C	C	rs139353406	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53017396_53017397insC	uc001wzs.2	-						TXNDC16_uc010tqu.1_Intron|TXNDC16_uc010aoe.2_Intron|GPR137C_uc001wzu.3_5'Flank|GPR137C_uc001wzt.3_5'Flank	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16 isoform 1						cell redox homeostasis	extracellular region					0	Breast(41;0.0716)					AAAAAGAAAAACCTTTTAAAGT	0.401													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	59298777	59298777	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59298777delT								DACT1 (183741 upstream) : DAAM1 (356622 downstream)																							TCTCTTCTCCTTTTTTTGCAC	0.488													4	2	---	---	---	---	
C14orf149	112849	broad.mit.edu	37	14	59946234	59946234	+	Intron	DEL	G	-	-	rs111912500		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59946234delG	uc001xee.1	-						C14orf149_uc010trx.1_Intron	NM_144581	NP_653182	Q96EM0	PRCM_HUMAN	proline racemase-like								proline racemase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.14)	L-Proline(DB00172)	AGCATCGAGTGAATAATAGCT	0.274													6	5	---	---	---	---	
SPTB	6710	broad.mit.edu	37	14	65232540	65232541	+	Intron	DEL	GT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65232540_65232541delGT	uc001xhr.2	-						SPTB_uc001xhs.2_Intron|SPTB_uc010aqi.2_Intron	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		gtgtgtgtgagtgtgtgtgtgt	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66469621	66469621	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66469621delG								FUT8 (259660 upstream) : C14orf53 (483488 downstream)																							TACAGACTCTGAATGTCAACT	0.448													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	68583064	68583064	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68583064delA	uc001xkf.1	+						RAD51L1_uc001xkd.2_Intron|RAD51L1_uc010aqr.2_Intron|RAD51L1_uc001xke.2_Intron|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		TTAAAAGGTTAAAAAAAAAAA	0.294			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					4	4	---	---	---	---	
GALC	2581	broad.mit.edu	37	14	88442994	88442994	+	Intron	DEL	C	-	-	rs112016425		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88442994delC	uc001xvt.2	-						GALC_uc010tvw.1_Intron|GALC_uc010tvx.1_Intron|GALC_uc010tvy.1_Intron|GALC_uc010tvz.1_Intron|GALC_uc001xvu.1_Intron	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor						carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						aggcttctctcgtcgcccagg	0.100													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	89450417	89450417	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89450417delA								TTC8 (106083 upstream) : FOXN3 (172100 downstream)																							gttggtggggaaaaaaaaatt	0.144													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	90692810	90692810	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90692810delC								KCNK13 (40615 upstream) : PSMC1 (30084 downstream)																							GGCTGACTCTCCAAGATGGCT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	90906923	90906923	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90906923delT								CALM1 (32313 upstream) : TTC7B (100010 downstream)																							ATTGCAAATGTTTTTTTTTTC	0.493													3	3	---	---	---	---	
CLMN	79789	broad.mit.edu	37	14	95775371	95775371	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95775371delG	uc001yef.2	-							NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)		TGAAGATTGTGGGGCTAATCC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99482462	99482462	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99482462delT								C14orf177 (298365 upstream) : BCL11B (153165 downstream)																							TCTCCAGCCCTTTTTTTCCAG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102004138	102004138	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102004138delG								MIR656 (471000 upstream) : DIO3OS (14422 downstream)																							GGAGGGCTGCGGGTTGCAGAG	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102427147	102427147	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102427147delG								PPP2R5C (32821 upstream) : DYNC1H1 (3718 downstream)																							aaaaaatctaggagagagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104870512	104870512	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104870512delG								KIF26A (223278 upstream) : C14orf180 (175544 downstream)																							AGAGGATGCTGGGGGAGCAGG	0.408													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107173399	107173399	+	Intron	DEL	G	-	-	rs76524779		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107173399delG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						taatctgtaaggacatctact	0.000													5	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107183258	107183259	+	Intron	INS	-	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107183258_107183259insG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						AGACCATCACAGGAAGCCAGCC	0.559													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22488189	22488189	+	IGR	DEL	T	-	-	rs112177113		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22488189delT								OR4N3P (73804 upstream) : MIR1268 (25040 downstream)																							TGTCTCCAGATAACAATAATG	0.433													6	3	---	---	---	---	
BUB1B	701	broad.mit.edu	37	15	40477243	40477243	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40477243delT	uc001zkx.3	+						BUB1B_uc010ucl.1_Intron	NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		ttaaaatttcttttttttttt	0.249			Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	40614224	40614225	+	5'Flank	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40614224_40614225insA	uc001zlf.1	+											Homo sapiens cDNA FLJ41776 fis, clone IMR322013053.																		TCTCAGAAAGTAAAAAAAACAG	0.465													4	3	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43398407	43398407	+	5'Flank	DEL	T	-	-	rs78412725		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43398407delT	uc001zqq.2	-						UBR1_uc010udk.1_5'Flank	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GGACTGGAGATTTTTTTTTTC	0.512													3	3	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48052328	48052329	+	Intron	INS	-	AAAAG	AAAAG	rs75506472		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48052328_48052329insAAAAG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TATTTTGAGTTAAAAAGACCAT	0.337													15	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	49376618	49376618	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49376618delC								SECISBP2L (37988 upstream) : COPS2 (40855 downstream)																							AAAAGAGCTGCCTTTGTCAAA	0.433													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	51409390	51409390	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51409390delA								TNFAIP8L3 (11917 upstream) : CYP19A1 (90865 downstream)																							atgtgatgctaaaagggcata	0.070													4	2	---	---	---	---	
RAB27A	5873	broad.mit.edu	37	15	55551660	55551660	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55551660delT	uc002aco.2	-						RAB27A_uc002acr.2_Intron|RAB27A_uc002acp.2_Intron|RAB27A_uc002acq.2_Intron	NM_183234	NP_899057	P51159	RB27A_HUMAN	Ras-related protein Rab-27A						small GTPase mediated signal transduction	dendrite|exocytic vesicle|late endosome|lysosome|melanosome	GTP binding|GTPase activity			ovary(1)	1				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		ttttcttttcttttttgtaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	58651933	58651934	+	IGR	INS	-	AC	AC	rs10571225		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58651933_58651934insAC								ALDH1A2 (80471 upstream) : LIPC (50841 downstream)																							GCTTTCTGGTAacacacacaca	0.406													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60042477	60042477	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60042477delA								BNIP2 (60835 upstream) : FOXB1 (253944 downstream)																							TTGGCCAAATAAAAAAAAATC	0.249													3	3	---	---	---	---	
ANXA2	302	broad.mit.edu	37	15	60673906	60673906	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60673906delA	uc002agn.2	-						ANXA2_uc002agk.2_Intron|ANXA2_uc002agl.2_Intron|ANXA2_uc002agm.2_Intron|ANXA2_uc010uhd.1_Intron|ANXA2_uc010bgj.2_Intron	NM_001136015	NP_001129487	P07355	ANXA2_HUMAN	annexin A2 isoform 2						angiogenesis|positive regulation of vesicle fusion|skeletal system development	basement membrane|melanosome|midbody|soluble fraction	calcium ion binding|calcium-dependent phospholipid binding|cytoskeletal protein binding|phospholipase inhibitor activity			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Tenecteplase(DB00031)	ACCGGGGTTTAAAAAAAACAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70037563	70037563	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70037563delG								LOC145837 (173784 upstream) : C15orf50 (90010 downstream)																							GAGTGCTGATGGGGTGCATCT	0.463													4	2	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	71633456	71633456	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71633456delT	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						tctctctcccttttttttttc	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73140251	73140251	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73140251delT								ADPGK (63584 upstream) : NEO1 (204624 downstream)																							ggctttatccttcattactct	0.104													4	2	---	---	---	---	
ADAMTSL3	57188	broad.mit.edu	37	15	84363903	84363904	+	Intron	DEL	TG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84363903_84363904delTG	uc002bjz.3	+						ADAMTSL3_uc002bjy.1_Intron|ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			ggtgtaggtatgtgtgtgtgta	0.084													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89885400	89885400	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89885400delT								POLG (7374 upstream) : LOC254559 (19410 downstream)																							aggccaggggttctgtctgga	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90002771	90002771	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90002771delC								LOC254559 (61053 upstream) : RHCG (11867 downstream)																							CCACCCTGCACCCCAGCCTCC	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90044892	90044892	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90044892delG								RHCG (5093 upstream) : LOC283761 (3270 downstream)																							gtgaacaaatgaagcaacaat	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94005850	94005851	+	Intron	DEL	TT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94005850_94005851delTT	uc002bsu.1	+											Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																		TCCTCATCTGTTTCTACTCTCC	0.554													4	2	---	---	---	---	
ADAMTS17	170691	broad.mit.edu	37	15	100744982	100744982	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100744982delA	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GGAAAATCCTAACCTCTTACA	0.313													4	2	---	---	---	---	
MLST8	64223	broad.mit.edu	37	16	2257828	2257828	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2257828delT	uc002coz.2	+						MLST8_uc002coy.2_Intron|MLST8_uc002cpa.2_Intron|MLST8_uc002cpb.2_Intron|MLST8_uc010uvx.1_Intron|MLST8_uc002cpc.2_Intron|MLST8_uc002cpd.2_Intron|MLST8_uc002cpe.2_Intron|MLST8_uc002cpg.2_Intron|MLST8_uc002cph.2_Intron|MLST8_uc002cpf.2_Intron	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						TCCAGCCTCATTTTTTTTCAT	0.557													4	2	---	---	---	---	
ZNF213	7760	broad.mit.edu	37	16	3189333	3189333	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3189333delT	uc010uws.1	+						ZNF213_uc002cud.2_Intron|ZNF213_uc010btf.2_3'UTR|ZNF213_uc010bth.2_Intron|ZNF213_uc010uwt.1_Intron	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						caacttctcctttgagtctca	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5555080	5555080	+	Intron	DEL	T	-	-	rs71404526		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5555080delT	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																		caaacaccacttgagatgggc	0.070													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	11332356	11332356	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11332356delG								CLEC16A (56312 upstream) : C16orf75 (11150 downstream)																							acatcaaggtggacttcaggc	0.020													4	2	---	---	---	---	
ARL6IP1	23204	broad.mit.edu	37	16	18810349	18810349	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18810349delT	uc002dfl.1	-						ARL6IP1_uc010van.1_Intron|ARL6IP1_uc010bvz.1_Intron	NM_015161	NP_055976	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting							integral to membrane	protein binding				0						gttttttgtgttttttttttt	0.119													4	2	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18821302	18821302	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18821302delA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron|SMG1_uc010bwa.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						ACGGTTTCTTAAAAAAAAAAA	0.299													4	3	---	---	---	---	
SIAH1	6477	broad.mit.edu	37	16	48411623	48411623	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48411623delA	uc002efo.1	-						SIAH1_uc002efl.2_Intron	NM_003031	NP_003022	Q8IUQ4	SIAH1_HUMAN	seven in absentia homolog 1 isoform a						axon guidance|cell cycle|neuron apoptosis|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	beta-catenin destruction complex|cytosol|nucleus	protein C-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				AGATTTAAGGAAAAAAAAAAT	0.149													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49458695	49458695	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49458695delT								C16orf78 (25378 upstream) : ZNF423 (65827 downstream)																							CGTCCTGAGCTTTTTGCTCAG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49469232	49469232	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49469232delG								C16orf78 (35915 upstream) : ZNF423 (55290 downstream)																							ggtatttcctgggggccagat	0.234													4	2	---	---	---	---	
CYLD	1540	broad.mit.edu	37	16	50779240	50779240	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50779240delT	uc002egp.1	+						CYLD_uc002egn.1_Intron|CYLD_uc002ego.2_Intron|CYLD_uc010cbs.1_Intron|CYLD_uc002egq.1_Intron|CYLD_uc002egr.1_Intron	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD						cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				TGATGTTGGGTTTTTTTTTGT	0.254			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				4	2	---	---	---	---	
GNAO1	2775	broad.mit.edu	37	16	56304332	56304333	+	Intron	DEL	AC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56304332_56304333delAC	uc002eit.3	+						GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				CCCCACCCTGacacacacacac	0.381													5	4	---	---	---	---	
TMCO7	79613	broad.mit.edu	37	16	69060536	69060537	+	Intron	INS	-	G	G			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69060536_69060537insG	uc002ewi.3	+							NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		GCCTGCTAGCTGGGGGAAATGG	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80246736	80246736	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80246736delA								MAF (612114 upstream) : DYNLRB2 (328118 downstream)																							CTGAGCACACAAAAAAAACAA	0.443													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87138763	87138763	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87138763delA	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		tatgtgttctattgacccata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88459019	88459019	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88459019delT								BANP (348096 upstream) : ZNF469 (34860 downstream)																							GCTCTGGTGATTTTTATGTTG	0.353													4	2	---	---	---	---	
SLC13A5	284111	broad.mit.edu	37	17	6588299	6588300	+	3'UTR	INS	-	C	C	rs144527508	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6588299_6588300insC	uc002gdj.2	-	12					SLC13A5_uc010vtf.1_3'UTR|SLC13A5_uc010clq.2_3'UTR|SLC13A5_uc002gdk.2_3'UTR	NM_177550	NP_808218	Q86YT5	S13A5_HUMAN	solute carrier family 13, member 5 isoform a							integral to membrane	citrate transmembrane transporter activity				0						TTACAGGGGGGTTCTGAAGATT	0.505													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	12334164	12334164	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12334164delC								MAP2K4 (287114 upstream) : MYOCD (235043 downstream)																							cttcacttctctcttctggtc	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14692240	14692240	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14692240delA								HS3ST3B1 (442748 upstream) : PMP22 (440857 downstream)																							CAATCTGCCTAAAACTCcacg	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14911323	14911323	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14911323delC								HS3ST3B1 (661831 upstream) : PMP22 (221774 downstream)																							AATCTGCAATCCCCTGAGCCT	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	15329450	15329451	+	IGR	INS	-	AC	AC	rs58724086		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15329450_15329451insAC								TEKT3 (84492 upstream) : CDRT4 (9887 downstream)																							cacagacacagacacacacaca	0.010													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	15831783	15831783	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15831783delG								MEIS3P1 (138766 upstream) : ADORA2B (16448 downstream)																							GGCTGAGCATGGGGAGGCTGG	0.453													4	2	---	---	---	---	
TOM1L2	146691	broad.mit.edu	37	17	17765835	17765836	+	Intron	DEL	GT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17765835_17765836delGT	uc002grz.3	-						TOM1L2_uc002gry.3_Intron|TOM1L2_uc010vwy.1_Intron|TOM1L2_uc010cpr.2_Intron|TOM1L2_uc010vwz.1_Intron|TOM1L2_uc010vxa.1_Intron|TOM1L2_uc002grv.3_Intron	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3						intracellular protein transport	intracellular					0	all_neural(463;0.228)					GGGCAGGAGAGTGTGTGTGTGT	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21231493	21231494	+	IGR	INS	-	TCTC	TCTC	rs138596924		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21231493_21231494insTCTC								MAP2K3 (12944 upstream) : KCNJ12 (48205 downstream)																							tccctttcctttcccacagcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21272027	21272027	+	IGR	DEL	A	-	-	rs34412151		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21272027delA								MAP2K3 (53478 upstream) : KCNJ12 (7672 downstream)																							TCCTAGGATTAAAAAAAAGGC	0.517													3	3	---	---	---	---	
C17orf63	55731	broad.mit.edu	37	17	27083466	27083466	+	3'UTR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27083466delA	uc002hct.1	-	3					C17orf63_uc010wax.1_3'UTR|C17orf63_uc010way.1_3'UTR	NM_018182	NP_060652	Q8WU58	CQ063_HUMAN	hypothetical protein LOC55731											ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)			ATTGGGGAGGAAAAAAAAATA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	27704791	27704791	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27704791delT								NUFIP2 (83625 upstream) : TAOK1 (13152 downstream)																							GAACACAGACTTTAGGTCAGG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	32755037	32755040	+	IGR	DEL	CCTC	-	-	rs111859202		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32755037_32755040delCCTC								CCL1 (64785 upstream) : C17orf102 (146102 downstream)																							CTCCAcctctcctccctccctccc	0.466													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	33149027	33149028	+	IGR	DEL	CA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33149027_33149028delCA								TMEM132E (182691 upstream) : CCT6B (105912 downstream)																							TATTCGCAGGCACACACACACT	0.520													4	2	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39898338	39898338	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39898338delC	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GCCCAGCTCTCCCCAAACCCT	0.498													4	2	---	---	---	---	
TUBG1	7283	broad.mit.edu	37	17	40763874	40763874	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40763874delA	uc002ian.2	+							NM_001070	NP_001061	P23258	TBG1_HUMAN	tubulin, gamma 1						G2/M transition of mitotic cell cycle|meiotic spindle organization|protein polymerization	condensed nuclear chromosome|cytosol|gamma-tubulin complex|polar microtubule	GTP binding|GTPase activity|protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)		actccatcgcaaaaaaaaata	0.050													4	2	---	---	---	---	
HDAC5	10014	broad.mit.edu	37	17	42193943	42193943	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42193943delA	uc002ifd.1	-						HDAC5_uc002ife.1_Intron|HDAC5_uc002iff.1_Intron|HDAC5_uc010czp.1_Intron|HDAC5_uc002ifh.2_Intron	NM_005474	NP_005465	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5 isoform 1						B cell differentiation|cellular response to insulin stimulus|chromatin remodeling|chromatin silencing|inflammatory response|negative regulation of cell migration involved in sprouting angiogenesis|negative regulation of myotube differentiation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			ovary(1)	1		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		ACCCCTACATAAAAAAGATGA	0.488													4	2	---	---	---	---	
C17orf53	78995	broad.mit.edu	37	17	42224397	42224398	+	Intron	DEL	GT	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42224397_42224398delGT	uc002ifi.1	+						C17orf53_uc010czq.1_Intron|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_5'Flank	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TCTCtgtgtagtgtgtgtgtgt	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49704724	49704724	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49704724delA								UTP18 (329434 upstream) : CA10 (2951 downstream)																							agtgggatctaaaaatgtgca	0.035													4	2	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	50149507	50149507	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50149507delA	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			GCTCAGATGGAAAAAAAAGTA	0.418													6	3	---	---	---	---	
C17orf67	339210	broad.mit.edu	37	17	54886973	54886974	+	Intron	DEL	CG	-	-	rs146089797	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54886973_54886974delCG	uc010dci.2	-						C17orf67_uc002iuq.2_Intron	NM_001085430	NP_001078899	Q0P5P2	CQ067_HUMAN	hypothetical protein LOC339210 precursor							extracellular region					0	Breast(9;2.49e-06)					acaaccctcacgcgcacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55252886	55252887	+	IGR	DEL	AC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55252886_55252887delAC								AKAP1 (54177 upstream) : MSI2 (80325 downstream)																							AAGAGGCAGTACACACACACAC	0.510													3	4	---	---	---	---	
MRPS23	51649	broad.mit.edu	37	17	55928462	55928462	+	5'Flank	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55928462delA	uc002ivc.2	-							NM_016070	NP_057154	Q9Y3D9	RT23_HUMAN	mitochondrial ribosomal protein S23						translation	intermediate filament cytoskeleton|mitochondrion|nuclear membrane|ribosome	structural constituent of ribosome				0	Breast(9;8.75e-08)					aacgtgttagaaaaaaaaaag	0.000													2	4	---	---	---	---	
CUEDC1	404093	broad.mit.edu	37	17	55977091	55977091	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55977091delT	uc002ivd.1	-						CUEDC1_uc002ive.1_Intron	NM_017949	NP_060419	Q9NWM3	CUED1_HUMAN	CUE domain-containing 1											skin(2)	2						CACTTTAGGATTTTTTTTGAA	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	56038195	56038195	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56038195delT								CUEDC1 (5511 upstream) : VEZF1 (10715 downstream)																							CTGTGAGCCCTTCTTCCCTTG	0.532													4	3	---	---	---	---	
TANC2	26115	broad.mit.edu	37	17	61098815	61098816	+	Intron	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61098815_61098816insC	uc002jal.3	+							NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2						gcctcctttttcccctgtctct	0.000													4	2	---	---	---	---	
KCNH6	81033	broad.mit.edu	37	17	61600906	61600906	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61600906delG	uc002jay.2	+						KCNH6_uc002jax.1_Intron|KCNH6_uc010wpl.1_Intron|KCNH6_uc010wpm.1_Intron|KCNH6_uc002jaz.1_Intron	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	TTCCGTGAAAGGGGGGGCTGG	0.537													19	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70495033	70495033	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70495033delG	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		actacactttgcatggcTGcc	0.129													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	71058148	71058148	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71058148delA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						aaaacaaaacaaaaaaaatcc	0.000													4	2	---	---	---	---	
RHBDF2	79651	broad.mit.edu	37	17	74492840	74492840	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74492840delT	uc002jrq.1	-						RHBDF2_uc002jrp.1_Intron	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1						negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						TCCAGAtctcttttttttttc	0.274													4	2	---	---	---	---	
SEPT9	10801	broad.mit.edu	37	17	75290672	75290672	+	Intron	DEL	T	-	-	rs79827695		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75290672delT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			tgtttttttctttttttttaa	0.000													4	2	---	---	---	---	
TBC1D16	125058	broad.mit.edu	37	17	78006338	78006340	+	Intron	DEL	TTA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78006338_78006340delTTA	uc002jxj.2	-							NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16							intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			AAAAGCAGATTTATTAGAGATGC	0.409													4	2	---	---	---	---	
THOC1	9984	broad.mit.edu	37	18	243002	243002	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:243002delA	uc002kkj.3	-						THOC1_uc002kkk.3_Intron|THOC1_uc002kkl.2_Intron	NM_005131	NP_005122	Q96FV9	THOC1_HUMAN	THO complex 1						apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding			ovary(1)	1		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				AAAATACACCAAAAAATATGA	0.299													4	2	---	---	---	---	
ENOSF1	55556	broad.mit.edu	37	18	688168	688168	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:688168delA	uc002kku.3	-						ENOSF1_uc002kkt.3_Intron|ENOSF1_uc010dke.2_Intron|ENOSF1_uc010dkf.2_Intron|ENOSF1_uc002kkv.3_Intron|ENOSF1_uc002kkw.3_Intron|ENOSF1_uc002kkx.3_Intron	NM_017512	NP_059982	Q7L5Y1	ENOF1_HUMAN	enolase superfamily 1 isoform rTS beta						cellular amino acid catabolic process	mitochondrion	isomerase activity|metal ion binding			ovary(1)	1						acttcatctcaaaaaaaaaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	1800016	1800017	+	IGR	INS	-	TTA	TTA	rs139349484	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1800016_1800017insTTA								C18orf2 (392835 upstream) : METTL4 (737508 downstream)																							GGGTTTTCAAGTTATACTCCGA	0.193													3	3	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3989285	3989286	+	Intron	DEL	GA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3989285_3989286delGA	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				agaaggttctgagggttcctgt	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5782778	5782779	+	Intron	INS	-	G	G	rs145585600	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5782778_5782779insG	uc002kmw.2	+											Homo sapiens chromosome 18 unknown mRNA sequence.																		gtttgtagtttcaccaggtgtt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	9908460	9908460	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9908460delT								TXNDC2 (20083 upstream) : VAPA (5495 downstream)																							tttacaattcttcaaaatcca	0.000													4	2	---	---	---	---	
ROCK1	6093	broad.mit.edu	37	18	18533912	18533913	+	Intron	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18533912_18533913insA	uc002kte.2	-							NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein						actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					AGGCTGAAATTAAAAAAAAAAA	0.208													4	2	---	---	---	---	
LAMA3	3909	broad.mit.edu	37	18	21281036	21281036	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21281036delA	uc002kuq.2	+						LAMA3_uc010dlv.1_Intron|LAMA3_uc002kur.2_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGACACTGATAAAAGGGGTCA	0.294													4	2	---	---	---	---	
SLC39A6	25800	broad.mit.edu	37	18	33690805	33690805	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33690805delA	uc010dmy.2	-							NM_012319	NP_036451	Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter),							integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2						gtgcccagccAAAAAAAAAGA	0.010													6	3	---	---	---	---	
PIAS2	9063	broad.mit.edu	37	18	44398133	44398136	+	Intron	DEL	TTAT	-	-	rs10533549		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44398133_44398136delTTAT	uc002lck.2	-						PIAS2_uc010dnp.2_Intron	NM_004671	NP_004662	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT X isoform						androgen receptor signaling pathway|negative regulation of androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|PML body	androgen receptor binding|DNA binding|protein binding|SUMO ligase activity|transcription coactivator activity|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						CACATTTTCCTTATTTGAGTCATA	0.240													8	12	---	---	---	---	
HDHD2	84064	broad.mit.edu	37	18	44663014	44663014	+	Intron	DEL	T	-	-	rs144963110		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44663014delT	uc002lcs.2	-						HDHD2_uc002lct.2_Intron	NM_032124	NP_115500	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain								hydrolase activity				0						AATACTTAGGtttttttttaa	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45226274	45226274	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45226274delC								IER3IP1 (523529 upstream) : SMAD2 (133193 downstream)																							tcaacagtctcccggaggaga	0.000													4	2	---	---	---	---	
MAPK4	5596	broad.mit.edu	37	18	48106550	48106552	+	Intron	DEL	GGA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48106550_48106552delGGA	uc002lev.2	+						MAPK4_uc010xdm.1_Intron|MAPK4_uc010doz.2_Intron	NM_002747	NP_002738	P31152	MK04_HUMAN	mitogen-activated protein kinase 4						cell cycle		ATP binding|MAP kinase activity			lung(4)|skin(2)	6		Colorectal(6;0.0297)		Colorectal(21;0.156)		TGAGTAGGCTGGAGGAGGAGGAG	0.562													4	2	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	56053269	56053272	+	Intron	DEL	TTGA	-	-	rs74183251		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56053269_56053272delTTGA	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron|NEDD4L_uc002lhg.2_Intron|NEDD4L_uc002lhh.2_Intron|NEDD4L_uc010dpn.2_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						CTGCCTGGGCttgattgattgatt	0.309													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	56457683	56457684	+	IGR	DEL	GG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56457683_56457684delGG								MALT1 (40313 upstream) : ZNF532 (72377 downstream)																							TCAGGACTCTGGGATTCAGAAA	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57851459	57851460	+	IGR	INS	-	CCTCCCCCTCACCAAACTTAA	CCTCCCCCTCACCAAACTTAA			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57851459_57851460insCCTCCCCCTCACCAAACTTAA								PMAIP1 (279921 upstream) : MC4R (187104 downstream)																							AAGGTCATTTGCCCGCTCTTTC	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60292232	60292232	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60292232delG								ZCCHC2 (38270 upstream) : PHLPP1 (90502 downstream)																							ggggatgggagggggctattt	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75377342	75377343	+	IGR	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75377342_75377343insA								GALR1 (395248 upstream) : None (None downstream)																							GTTAGCACTTGAAAAAAAACAT	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76385448	76385448	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76385448delA								None (None upstream) : SALL3 (354827 downstream)																							TTTTATTACCAAAAAAGGGAG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	2712984	2712984	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2712984delG								GNG7 (10238 upstream) : DIRAS1 (1581 downstream)																							TGCCTCCCCTGCTGCATGTCC	0.289													4	2	---	---	---	---	
SLC25A41	284427	broad.mit.edu	37	19	6430376	6430376	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6430376delT	uc010dus.2	-						SLC25A41_uc010dut.2_Intron	NM_173637	NP_775908	Q8N5S1	S2541_HUMAN	solute carrier family 25, member 41						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						TCAACCTACATTCCCACCTCA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9556893	9556893	+	IGR	DEL	T	-	-	rs34964364		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9556893delT								ZNF266 (10659 upstream) : ZNF560 (20138 downstream)																							tgaacgctgatttttttttcc	0.000													4	2	---	---	---	---	
ZNF833	401898	broad.mit.edu	37	19	11763709	11763709	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11763709delA	uc002msl.3	+											Homo sapiens cDNA FLJ44800 fis, clone BRACE3041162, moderately similar to Homo sapiens zinc finger protein 14 (KOX 6) (ZNF14).												0						GTGTGGATATAAAAAATGTAA	0.224													4	2	---	---	---	---	
TPM4	7171	broad.mit.edu	37	19	16200479	16200479	+	Intron	DEL	T	-	-	rs35056151		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16200479delT	uc002ndj.2	+						TPM4_uc002ndi.2_Intron|TPM4_uc002ndk.1_Intron	NM_003290	NP_003281	P67936	TPM4_HUMAN	tropomyosin 4 isoform 2						cellular component movement|muscle filament sliding|response to oxidative stress	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding|calcium ion binding|structural constituent of muscle		TPM4/ALK(12)	soft_tissue(10)|haematopoietic_and_lymphoid_tissue(2)|breast(1)	13						caccccccacttttttttttt	0.000			T	ALK	ALCL								3	3	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17729974	17729974	+	Intron	DEL	C	-	-	rs3214455		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17729974delC	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TGAGGATAGTCCCCCACCCTC	0.572													3	3	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17777719	17777727	+	Intron	DEL	GAAAGACAG	-	-	rs61595485		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17777719_17777727delGAAAGACAG	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						gagagagagagaaagacagagacagagac	0.167													4	2	---	---	---	---	
IL12RB1	3594	broad.mit.edu	37	19	18188174	18188174	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18188174delA	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron|IL12RB1_uc002nhy.2_Intron	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						tccgtctcagaaaaaaaaaaa	0.234													6	3	---	---	---	---	
ZNF253	56242	broad.mit.edu	37	19	19989125	19989125	+	Intron	DEL	G	-	-	rs3841054		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19989125delG	uc002noj.2	+						ZNF253_uc002nok.2_Intron|ZNF253_uc002nol.2_Intron	NM_021047	NP_066385	O75346	ZN253_HUMAN	zinc finger protein 253						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGAGTTAGAGGATACATTAG	0.308													4	4	---	---	---	---	
ZNF708	7562	broad.mit.edu	37	19	21477893	21477893	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21477893delA	uc002npq.1	-						ZNF708_uc002npr.1_Intron|ZNF708_uc010ecs.1_Intron	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6						TTAAAAGACTAAAAAAAATAG	0.383													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22299087	22299087	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22299087delT								ZNF257 (25186 upstream) : ZNF676 (62816 downstream)																							AGCTTACCACTTTAGGGGCCT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22885286	22885286	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22885286delC								ZNF492 (34814 upstream) : ZNF99 (53723 downstream)																							GCTTTTCTGTCCTTTGTGGCC	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30082872	30082872	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30082872delG								VSTM2B (27646 upstream) : POP4 (14298 downstream)																							AGGGTGTGCAGGGAGTGGCTG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31182327	31182328	+	IGR	INS	-	AAC	AAC	rs78202814		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31182327_31182328insAAC								ZNF536 (133362 upstream) : DKFZp566F0947 (458455 downstream)																							CCTCAACTGTTAATCAAATTGG	0.540													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36074583	36074583	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36074583delT								ATP4A (20023 upstream) : HAUS5 (29063 downstream)																							ataggcaaacttttttttttt	0.025													6	3	---	---	---	---	
AXL	558	broad.mit.edu	37	19	41750170	41750171	+	Intron	DEL	TA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41750170_41750171delTA	uc010ehj.2	+						CYP2F1_uc010xvw.1_Intron|AXL_uc010ehk.2_Intron	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1							integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						CATTGGATCTTAGAAgatgtaa	0.079													4	2	---	---	---	---	
ERCC1	2067	broad.mit.edu	37	19	45980833	45980833	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45980833delG	uc002pbu.1	-									P07992	ERCC1_HUMAN	SubName: Full=cDNA FLJ34720 fis, clone MESAN2005724, highly similar to DNA EXCISION REPAIR PROTEIN ERCC-1;						mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding			ovary(2)	2		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		aggattgcttgagcctggaag	0.085								NER					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	46583274	46583275	+	5'Flank	INS	-	G	G	rs140889370	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46583274_46583275insG	uc002pdz.1	-											Homo sapiens cDNA FLJ25073 fis, clone CBL05774.																		cgtgcgtcagagggccacatcc	0.000													4	2	---	---	---	---	
IGFL2	147920	broad.mit.edu	37	19	46652434	46652437	+	Intron	DEL	TCTC	-	-	rs143439832	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46652434_46652437delTCTC	uc010xxv.1	+						IGFL2_uc002peb.2_Intron	NM_001135113	NP_001128585	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2 isoform b							extracellular region	protein binding				0		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		ctctctctcttctctctctctttc	0.132													18	9	---	---	---	---	
ZC3H4	23211	broad.mit.edu	37	19	47592962	47592963	+	Intron	INS	-	C	C	rs145573806	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47592962_47592963insC	uc002pga.3	-						ZC3H4_uc002pgb.1_Intron	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4								nucleic acid binding|zinc ion binding			skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TGTTCCCTTCTCCCCCCACAGC	0.629													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57002693	57002694	+	Intron	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57002693_57002694insA	uc002qnf.2	+						uc002qng.2_Intron					Homo sapiens cDNA clone IMAGE:5753168.																		TGCAAGTGGATAAAAAAATTTA	0.248													4	2	---	---	---	---	
RPS5	6193	broad.mit.edu	37	19	58905673	58905674	+	Intron	DEL	TG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58905673_58905674delTG	uc002qsn.2	+						RPS5_uc002qso.2_Intron	NM_001009	NP_001000	P46782	RS5_HUMAN	ribosomal protein S5						endocrine pancreas development|regulation of translational fidelity|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|structural constituent of ribosome				0		all_cancers(17;1.71e-22)|all_epithelial(17;1.69e-16)|Lung NSC(17;2.25e-06)|all_lung(17;9.97e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Breast(46;0.0194)|Ovarian(87;0.0443)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.171)|GBM - Glioblastoma multiforme(193;0.0323)|Lung(386;0.0543)|LUSC - Lung squamous cell carcinoma(496;0.176)		AACTTCAGCCTGTGTGTGTGTG	0.426													4	2	---	---	---	---	
RSPO4	343637	broad.mit.edu	37	20	981996	981996	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:981996delT	uc002wej.2	-						RSPO4_uc002wek.2_Intron	NM_001029871	NP_001025042	Q2I0M5	RSPO4_HUMAN	R-spondin family, member 4 isoform 1 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding				0						CCAACCCACCTTCTGAGGATG	0.567													4	2	---	---	---	---	
ATRN	8455	broad.mit.edu	37	20	3520383	3520383	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3520383delT	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						CTTAGTTTTGTTTTTTTTTTC	0.448													3	3	---	---	---	---	
CDC25B	994	broad.mit.edu	37	20	3785945	3785946	+	3'UTR	DEL	TG	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3785945_3785946delTG	uc002wjn.2	+	16					CDC25B_uc010zqk.1_3'UTR|CDC25B_uc010zql.1_3'UTR|CDC25B_uc010zqm.1_3'UTR|CDC25B_uc002wjl.2_3'UTR|CDC25B_uc002wjm.2_3'UTR|CDC25B_uc002wjo.2_3'UTR|CDC25B_uc002wjp.2_3'UTR|CDC25B_uc002wjq.2_3'UTR|CDC25B_uc010gbc.2_3'UTR	NM_021873	NP_068659	P30305	MPIP2_HUMAN	cell division cycle 25B isoform 1						cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of cell proliferation	cytosol|microtubule organizing center|nucleoplasm	protein binding|protein tyrosine phosphatase activity			lung(3)|ovary(2)	5						AACGCTCCTTTGTGTGTGTGTC	0.520													4	2	---	---	---	---	
SEL1L2	80343	broad.mit.edu	37	20	13904919	13904919	+	Intron	DEL	T	-	-	rs76451954		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13904919delT	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2						TTCAACTTGGTTTTTTTTTGT	0.050													4	2	---	---	---	---	
PCSK2	5126	broad.mit.edu	37	20	17355086	17355086	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17355086delG	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GGAGGTGGGTGGGGTAGAACG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	18084155	18084155	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18084155delG								OVOL2 (45634 upstream) : CSRP2BP (34372 downstream)																							AAAAAAAAAAGATTTGTACTT	0.154													4	2	---	---	---	---	
GZF1	64412	broad.mit.edu	37	20	23346738	23346738	+	Intron	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23346738delC	uc010gdb.2	+						GZF1_uc002wsy.2_Intron|GZF1_uc010zsq.1_Intron|GZF1_uc010zsr.1_Intron|GZF1_uc002wsz.2_Intron	NM_022482	NP_071927	Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1						transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding			kidney(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CCATCCGGGTCCCACAGTCTC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23763993	23763994	+	IGR	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23763993_23763994insA								CST1 (32419 upstream) : CST2 (40410 downstream)																							atcaatatcaccataatcttca	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25737830	25737831	+	IGR	INS	-	G	G	rs149587535	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25737830_25737831insG								ZNF337 (60361 upstream) : FAM182B (6271 downstream)																							ccctgtggccaggggcacagct	0.015													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29634402	29634402	+	Intron	DEL	T	-	-	rs67656346		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29634402delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GAACTAGGGGTCTGGGCAGAG	0.443													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31274059	31274059	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31274059delT								C20orf203 (12316 upstream) : COMMD7 (16435 downstream)																							TAAGAGttccttttttttggt	0.234													4	2	---	---	---	---	
C20orf185	359710	broad.mit.edu	37	20	31641855	31641855	+	5'Flank	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31641855delG	uc002wym.1	+							NM_182658	NP_872599	P59826	LPLC3_HUMAN	antimicrobial peptide RYA3 precursor						innate immune response	cytoplasm|extracellular region	lipid binding|protein binding			ovary(4)	4						TATGAATGATGGGCACGGAAA	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32778903	32778903	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32778903delA								EIF2S2 (78818 upstream) : ASIP (69268 downstream)																							CAGGAAACCTAAAAGACTTTA	0.378											OREG0025876	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36519767	36519767	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36519767delA								CTNNBL1 (19248 upstream) : VSTM2L (11732 downstream)																							agagatggagaagcagccgca	0.119													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41363085	41363086	+	Intron	INS	-	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41363085_41363086insT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGCTGTTCTTCAAGGCCCACTG	0.490													4	2	---	---	---	---	
SERINC3	10955	broad.mit.edu	37	20	43132818	43132818	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43132818delA	uc002xme.2	-						SERINC3_uc002xmf.1_Intron|SERINC3_uc010ggs.1_Intron|SERINC3_uc010zwp.1_Intron	NM_198941	NP_945179	Q13530	SERC3_HUMAN	tumor differentially expressed protein 1							integral to membrane|plasma membrane	protein binding			skin(3)	3		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			CAGAATTAGGAAAAAAAAAGA	0.284													4	2	---	---	---	---	
PPP4R1L	55370	broad.mit.edu	37	20	56883712	56883713	+	Intron	INS	-	A	A			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56883712_56883713insA	uc002xyy.1	-						RAB22A_uc002xyz.2_5'Flank|PPP4R1L_uc010gjn.1_Intron					SubName: Full=cDNA FLJ50842, moderately similar to Serine/threonine-protein phosphatase 4regulatory subunit 1;												0						AACATGATTCCAAAAAAGAGGG	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60512850	60512853	+	5'Flank	DEL	GAGT	-	-	rs139990170		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60512850_60512853delGAGT	uc002ybr.1	+											Homo sapiens cDNA: FLJ22202 fis, clone HRC01333.																		TGGTCCAGAAGAGTGAGTTGTCCA	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9828810	9828810	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9828810delG								None (None upstream) : None (None downstream)																							AGGGTTGAAAGGATGCTGCCG	0.264													5	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11074125	11074126	+	Intron	INS	-	AAA	AAA	rs56402007		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11074125_11074126insAAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tggacaataagatctgaaaaac	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11079770	11079771	+	Intron	DEL	TG	-	-	rs148543332		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11079770_11079771delTG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCCAAAACACTGTGCAGATGTA	0.168													11	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11093095	11093095	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11093095delA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTACCATGCAAAAAAATATA	0.328													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11184776	11184779	+	IGR	DEL	AAAC	-	-	rs11184115		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11184776_11184779delAAAC								BAGE (85839 upstream) : None (None downstream)																							aaaaacaaaaaaacaaaaaactgg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14353185	14353185	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14353185delA								None (None upstream) : C21orf99 (57302 downstream)																							gcttctgtgtagtttttatgt	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	17431288	17431288	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17431288delA								USP25 (178911 upstream) : C21orf34 (11554 downstream)																							ATCAACCCATAAAAAGACAAG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18668527	18668528	+	IGR	INS	-	C	C	rs138647886	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18668527_18668528insC								C21orf34 (686433 upstream) : CXADR (216802 downstream)																							CCAGCTCCCAGCCCCCACACCA	0.629													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	46159730	46159730	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46159730delT								C21orf29 (28235 upstream) : UBE2G2 (29226 downstream)																							gtgaggaagctttcttaaaag	0.000													4	2	---	---	---	---	
PPIL2	23759	broad.mit.edu	37	22	22039702	22039702	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22039702delG	uc010gtj.1	+						PPIL2_uc002zvh.3_Intron|PPIL2_uc002zvi.3_Intron|PPIL2_uc002zvg.3_Intron|PPIL2_uc011aij.1_Intron|PPIL2_uc002zvk.3_5'Flank	NM_148175	NP_680480	Q13356	PPIL2_HUMAN	peptidylprolyl isomerase-like 2 isoform a						blood coagulation|leukocyte migration|protein folding|protein polyubiquitination	Golgi lumen|nucleus|ubiquitin ligase complex	peptidyl-prolyl cis-trans isomerase activity|ubiquitin-ubiquitin ligase activity			ovary(2)	2	Colorectal(54;0.105)					CCACCTGTCTGGGGCTGTCGT	0.612													4	2	---	---	---	---	
TOP3B	8940	broad.mit.edu	37	22	22325664	22325665	+	Intron	INS	-	GG	GG	rs144820768	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22325664_22325665insGG	uc002zvs.2	-						TOP3B_uc002zvr.2_5'Flank|TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GGCGACCCATAGAACAACAGTC	0.629													1	5	---	---	---	---	
C22orf13	83606	broad.mit.edu	37	22	24943495	24943495	+	Intron	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24943495delA	uc003aah.2	-						C22orf13_uc003aal.2_Intron|C22orf13_uc003aai.3_Intron|C22orf13_uc003aaj.3_Intron|C22orf13_uc003aak.3_Intron	NM_031444	NP_113632	Q96NT3	CV013_HUMAN	chromosome 22 open reading frame 13												0						TCTCCTGGTGAAAAGTAAAAA	0.408													4	2	---	---	---	---	
ADRBK2	157	broad.mit.edu	37	22	26101820	26101821	+	Intron	INS	-	C	C			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26101820_26101821insC	uc003abx.3	+						ADRBK2_uc010gux.2_Intron|ADRBK2_uc003abw.2_Intron|ADRBK2_uc003aby.3_Intron	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2								ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)	gtaataattttcccccagagct	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	28138222	28138222	+	IGR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28138222delC								None (None upstream) : MN1 (6044 downstream)																							GTCACTGGGGCCTTGGGCCAC	0.403													4	2	---	---	---	---	
YWHAH	7533	broad.mit.edu	37	22	32349824	32349825	+	Intron	INS	-	AA	AA	rs144759317		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32349824_32349825insAA	uc003alz.2	+						YWHAH_uc010gwl.2_Intron|YWHAH_uc003ama.2_Intron|YWHAH_uc010gwm.2_Intron	NM_003405	NP_003396	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan						glucocorticoid catabolic process|glucocorticoid receptor signaling pathway|intracellular protein transport|negative regulation of dendrite morphogenesis|positive regulation of transcription, DNA-dependent|regulation of synaptic plasticity	cytoplasm	enzyme binding|glucocorticoid receptor binding|insulin-like growth factor receptor binding|protein domain specific binding			central_nervous_system(1)	1						AGGAGAGACTTTGCCTGTGTTA	0.500													4	3	---	---	---	---	
YWHAH	7533	broad.mit.edu	37	22	32349826	32349826	+	Intron	DEL	G	-	-	rs67276346		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32349826delG	uc003alz.2	+						YWHAH_uc010gwl.2_Intron|YWHAH_uc003ama.2_Intron|YWHAH_uc010gwm.2_Intron	NM_003405	NP_003396	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan						glucocorticoid catabolic process|glucocorticoid receptor signaling pathway|intracellular protein transport|negative regulation of dendrite morphogenesis|positive regulation of transcription, DNA-dependent|regulation of synaptic plasticity	cytoplasm	enzyme binding|glucocorticoid receptor binding|insulin-like growth factor receptor binding|protein domain specific binding			central_nervous_system(1)	1						GAGAGACTTTGCCTGTGTTAA	0.498													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32676613	32676613	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32676613delG								SLC5A4 (25295 upstream) : RFPL3 (74259 downstream)																							actgagggcagggactctgaa	0.229													4	2	---	---	---	---	
NPTXR	23467	broad.mit.edu	37	22	39214543	39214544	+	3'UTR	DEL	AC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39214543_39214544delAC	uc003awk.2	-	5						NM_014293	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor							integral to membrane	metal ion binding			central_nervous_system(2)|skin(1)	3	Melanoma(58;0.04)					acacacacatacacacacacac	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39662662	39662662	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39662662delG								PDGFB (21705 upstream) : RPL3 (46226 downstream)																							ACATCTTTCCGGGTGTCTGAA	0.468													4	2	---	---	---	---	
SMCR7L	54471	broad.mit.edu	37	22	39910639	39910639	+	3'UTR	DEL	C	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39910639delC	uc003axx.2	+	6					SMCR7L_uc003axw.2_Intron|SMCR7L_uc003axy.2_3'UTR	NM_019008	NP_061881	Q9NQG6	SMC7L_HUMAN	hypothetical protein LOC54471							integral to membrane|mitochondrion				central_nervous_system(1)	1	Melanoma(58;0.04)					TGCGTTTTGGCCCATGTTTGC	0.502											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PACSIN2	11252	broad.mit.edu	37	22	43308276	43308277	+	Intron	DEL	TC	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43308276_43308277delTC	uc010gzg.2	-						PACSIN2_uc003bdg.3_Intron|PACSIN2_uc003bde.3_Intron|PACSIN2_uc003bdf.3_Intron	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				TACAGGGCGGTCTATAATATTT	0.421													4	2	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49009604	49009605	+	Intron	INS	-	CT	CT			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49009604_49009605insCT	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GCCCTTCGTGACTCTGTCGCCA	0.629													4	2	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49093271	49093272	+	Intron	INS	-	TGA	TGA	rs141636076	by1000genomes	TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49093271_49093272insTGA	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		gatggtggtggtatttatgatg	0.015													2	4	---	---	---	---	
CSF2RA	1438	broad.mit.edu	37	X	1408445	1408445	+	Intron	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1408445delT	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	tgtttttgtgtttttttggtt	0.000													4	4	---	---	---	---	
PPEF1	5475	broad.mit.edu	37	X	18714792	18714792	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18714792delG	uc004cyq.2	+						PPEF1_uc004cyp.2_Intron|PPEF1_uc004cyr.2_Intron	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding						detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					catgtgctgtggggaagctac	0.199													4	2	---	---	---	---	
GPR64	10149	broad.mit.edu	37	X	19080613	19080613	+	Intron	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19080613delG	uc004cyx.2	-						GPR64_uc004cyy.2_Intron|GPR64_uc004cyz.2_Intron|GPR64_uc004czb.2_Intron|GPR64_uc004czc.2_Intron|GPR64_uc004czd.2_Intron|GPR64_uc004cze.2_Intron|GPR64_uc004czf.2_Intron|GPR64_uc004cza.2_Intron|GPR64_uc004cyw.2_Intron|GPR64_uc010nfj.2_Intron	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1						neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					AGGGGTCAGTGGGGGTTGTGA	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	94163593	94163597	+	IGR	DEL	CAGCA	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:94163593_94163597delCAGCA								None (None upstream) : MIR548M (154543 downstream)																							cacgaatctccagcacagcacagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128903616	128903616	+	IGR	DEL	G	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128903616delG								XPNPEP2 (91 upstream) : SASH3 (10276 downstream)																							AGGTGGGGGTGGGGACATGAG	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	135188904	135188904	+	IGR	DEL	T	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135188904delT								SLC9A6 (59478 upstream) : FHL1 (39957 downstream)																							AGCACACACATTTTTTGGCTC	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	144066753	144066753	+	IGR	DEL	A	-	-			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144066753delA								None (None upstream) : SPANXN1 (262354 downstream)																							GAGTCAGAGTAAAATATGGTC	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28817114	28817115	+	IGR	INS	-	T	T			TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28817114_28817115insT								None (None upstream) : None (None downstream)																							gtggaatggagggaatgtatta	0.163													25	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59022489	59022490	+	IGR	INS	-	A	A	rs28547130		TCGA-B0-5399-01A-01D-1501-10	TCGA-B0-5399-10A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59022489_59022490insA								None (None upstream) : None (None downstream)																							aaaagaaaaagaaaaaaCTCca	0.010													5	3	---	---	---	---	
