Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CA6	765	broad.mit.edu	37	1	9019022	9019022	+	Silent	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9019022T>C	uc001apm.2	+	4	486	c.462T>C	c.(460-462)GAT>GAC	p.D154D	CA6_uc009vmn.2_Silent_p.D94D	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	154					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)		TAGCCCAAGATGCGCCGGATG	0.428													52	157	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11217230	11217230	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11217230C>T	uc001asd.2	-	30	4569	c.4448G>A	c.(4447-4449)TGC>TAC	p.C1483Y		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1483	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GGCCTCGAGGCAGCGCATGCG	0.527													15	63	---	---	---	---	PASS
EIF2C4	192670	broad.mit.edu	37	1	36282525	36282525	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36282525T>C	uc001bzj.1	+	2	252	c.62T>C	c.(61-63)CTT>CCT	p.L21P		NM_017629	NP_060099	Q9HCK5	AGO4_HUMAN	eukaryotic translation initiation factor 2C, 4	21					mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CGTCCTGGCCTTGGAACTGTT	0.373													5	183	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144813815	144813815	+	Silent	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144813815A>G	uc009wig.1	+	10	1138	c.1062A>G	c.(1060-1062)GCA>GCG	p.A354A	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Silent_p.A354A|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Silent_p.A285A|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Silent_p.A285A|NBPF9_uc010oyg.1_Silent_p.A319A|NBPF9_uc009wii.1_Silent_p.A83A|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Silent_p.A14A	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	354	Potential.					cytoplasm					0						AGAAGCTTGCAGAGCAGCTGA	0.532													7	88	---	---	---	---	PASS
FCGR1A	2209	broad.mit.edu	37	1	149763115	149763115	+	3'UTR	SNP	C	T	T	rs147747909	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149763115C>T	uc001esp.3	+	6					HIST2H2BF_uc010pbj.1_Intron|FCGR1A_uc009wlg.2_RNA	NM_000566	NP_000557	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor						interferon-gamma-mediated signaling pathway|phagocytosis, engulfment	integral to membrane|plasma membrane	IgG binding|receptor activity|receptor signaling protein activity			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCGTCCCCTGCCCACTTGCTC	0.532													5	69	---	---	---	---	PASS
SHISA4	149345	broad.mit.edu	37	1	201860697	201860697	+	Splice_Site	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201860697G>T	uc001gxa.2	+	4	638	c.547_splice	c.e4+1	p.A183_splice		NM_198149	NP_937792	Q96DD7	SHSA4_HUMAN	shisa homolog 4 precursor							integral to membrane					0						AACCCTGCAGGTAAGTAAGCA	0.607													18	45	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203668742	203668742	+	Silent	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203668742C>T	uc001gzw.2	+	4	1430	c.546C>T	c.(544-546)TGC>TGT	p.C182C	ATP2B4_uc001gzv.2_Silent_p.C182C|ATP2B4_uc009xaq.2_Silent_p.C182C	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	182	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGCTGCAGTGCCGCATTGAAC	0.498													4	136	---	---	---	---	PASS
ASB3	51130	broad.mit.edu	37	2	53955968	53955968	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53955968A>G	uc002rxg.1	-	5	620	c.485T>C	c.(484-486)ATA>ACA	p.I162T	ASB3_uc002rxh.1_Missense_Mutation_p.I89T|ASB3_uc002rxi.3_Missense_Mutation_p.I200T|ASB3_uc010yoo.1_Intron	NM_016115	NP_057199	Q9Y575	ASB3_HUMAN	ankyrin repeat and SOCS box-containing protein 3	162	ANK 5.				intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AAGCAATTTTATGATCTCAGC	0.333													5	344	---	---	---	---	PASS
EXOC6B	23233	broad.mit.edu	37	2	72960204	72960204	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72960204T>C	uc010fep.2	-	3	461	c.323A>G	c.(322-324)AAG>AGG	p.K108R	EXOC6B_uc002sij.2_Missense_Mutation_p.K108R	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2	108	Potential.				protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						TCTTACTTCCTTTCCCTCATG	0.318													8	674	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73651859	73651859	+	Missense_Mutation	SNP	T	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73651859T>A	uc002sje.1	+	6	1180	c.1069T>A	c.(1069-1071)TGG>AGG	p.W357R	ALMS1_uc002sjf.1_Missense_Mutation_p.W314R	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	356					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AGATACACAGTGGCCTGAAAA	0.343													38	134	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136481790	136481790	+	Silent	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136481790T>C	uc002tuo.2	+	26	3598	c.3228T>C	c.(3226-3228)GTT>GTC	p.V1076V	R3HDM1_uc010fni.2_Silent_p.V1075V|R3HDM1_uc002tup.2_Silent_p.V1021V|R3HDM1_uc010zbh.1_Silent_p.V824V	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1	1076							nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		TTAACTCAGTTAACAAGTTTA	0.448													4	139	---	---	---	---	PASS
FASTKD1	79675	broad.mit.edu	37	2	170411720	170411720	+	Silent	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170411720T>C	uc002uev.3	-	7	1516	c.1128A>G	c.(1126-1128)TTA>TTG	p.L376L	FASTKD1_uc002uew.3_RNA|FASTKD1_uc002uex.3_Silent_p.L362L	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	376					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4						TCAACAACTCTAATGGTTTAT	0.274													103	339	---	---	---	---	PASS
UGT1A5	54579	broad.mit.edu	37	2	234656710	234656710	+	Intron	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234656710G>A	uc002vuw.2	+						UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_RNA	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5						xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		GTGCCAACAGGAAGCCACTAT	0.458													9	35	---	---	---	---	PASS
LOC643387	643387	broad.mit.edu	37	2	239141375	239141375	+	3'UTR	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239141375G>A	uc010znu.1	+	1					LOC151174_uc002vxy.2_5'Flank|LOC151174_uc002vxx.3_5'Flank	NR_026923				Homo sapiens TAR DNA binding protein pseuodgene (LOC643387), non-coding RNA.												0						TGTACGATGGGTGTGTTAGCC	0.542													12	22	---	---	---	---	PASS
ZNF385D	79750	broad.mit.edu	37	3	21706391	21706391	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21706391G>A	uc003cce.2	-	2	560	c.152C>T	c.(151-153)CCC>CTC	p.P51L	ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	51						nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						ATTGAAATTGGGGAAGAGGTT	0.502													4	101	---	---	---	---	PASS
HGD	3081	broad.mit.edu	37	3	120363206	120363206	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120363206A>G	uc003edw.2	-	10	1104	c.734T>C	c.(733-735)GTC>GCC	p.V245A	HGD_uc003edv.2_Missense_Mutation_p.V104A	NM_000187	NP_000178	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	245					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	homogentisate 1,2-dioxygenase activity|metal ion binding				0				GBM - Glioblastoma multiforme(114;0.158)		TTTATTAATGACCGTGTAACC	0.438													5	120	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164737470	164737470	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164737470C>G	uc003fei.2	-	28	3405	c.3343G>C	c.(3343-3345)GGG>CGG	p.G1115R		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1115	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TCCACTTCCCCAAAACCATAT	0.423										HNSCC(35;0.089)			7	262	---	---	---	---	PASS
SPATA5	166378	broad.mit.edu	37	4	123868400	123868400	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123868400G>T	uc003iez.3	+	9	1544	c.1471G>T	c.(1471-1473)GGA>TGA	p.G491*	SPATA5_uc003iey.2_Nonsense_Mutation_p.G490*	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	491					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						AGTAAGTGAAGGACAAGTGTT	0.393													16	53	---	---	---	---	PASS
ELF2	1998	broad.mit.edu	37	4	139994664	139994664	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139994664G>A	uc003ihp.1	-	4	502	c.296C>T	c.(295-297)GCT>GTT	p.A99V	ELF2_uc003ihm.1_Missense_Mutation_p.A39V|ELF2_uc003ihn.1_Missense_Mutation_p.A39V|ELF2_uc003iho.1_Missense_Mutation_p.A39V|ELF2_uc010ioh.2_Missense_Mutation_p.A39V	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription	99					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					CAGGGCTTCAGCAGCTTCAAT	0.383													7	159	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187524569	187524569	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187524569G>A	uc003izf.2	-	19	11299	c.11111C>T	c.(11110-11112)GCT>GTT	p.A3704V		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	3704	Extracellular (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TGAGATCTGAGCACTACCTGG	0.428										HNSCC(5;0.00058)			4	145	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70856036	70856036	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70856036A>C	uc003kbp.1	+	37	7731	c.7468A>C	c.(7468-7470)ACA>CCA	p.T2490P	BDP1_uc003kbq.1_RNA|BDP1_uc003kbr.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	2490					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		GGATAGCAGAACATCGTCTTC	0.373													37	138	---	---	---	---	PASS
MAN2A1	4124	broad.mit.edu	37	5	109110522	109110522	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109110522G>C	uc003kou.1	+	8	2193	c.1230G>C	c.(1228-1230)AAG>AAC	p.K410N		NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	410	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		ACCGAAAGAAGTCAAAGCTTT	0.373													67	237	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127645724	127645724	+	Silent	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127645724G>A	uc003kuu.2	-	40	5590	c.5151C>T	c.(5149-5151)TGC>TGT	p.C1717C		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1717	EGF-like 28; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTGGGCAAATGCAGGTGTAAT	0.453													18	181	---	---	---	---	PASS
ISOC1	51015	broad.mit.edu	37	5	128441025	128441025	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128441025G>C	uc003kva.2	+	3	595	c.577G>C	c.(577-579)GAA>CAA	p.E193Q		NM_016048	NP_057132	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	193						peroxisome	catalytic activity				0		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		ACCAGAAGTAGAAGCGGCATT	0.378													91	580	---	---	---	---	PASS
CAMLG	819	broad.mit.edu	37	5	134086576	134086576	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134086576T>C	uc003kzt.2	+	4	932	c.827T>C	c.(826-828)GTC>GCC	p.V276A	CAMLG_uc003kzu.2_3'UTR	NM_001745	NP_001736	P49069	CAMLG_HUMAN	calcium modulating ligand	276	Cytoplasmic (Potential).				defense response	endoplasmic reticulum|integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Cyclosporine(DB00091)	GATCTCTGTGTCTACTTTTTC	0.403													7	560	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139889648	139889648	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139889648T>G	uc003lfs.1	+	22	4110	c.3986T>G	c.(3985-3987)CTT>CGT	p.L1329R	ANKHD1_uc003lfq.1_Missense_Mutation_p.L1348R|ANKHD1_uc003lfr.2_Missense_Mutation_p.L1329R|ANKHD1_uc003lft.1_Missense_Mutation_p.L540R|ANKHD1_uc003lfu.1_Missense_Mutation_p.L809R|ANKHD1_uc003lfv.1_Missense_Mutation_p.L406R|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.L68R|ANKHD1_uc003lfw.2_5'UTR	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1329						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATACGCCACTTTGGCTGGCA	0.443													44	277	---	---	---	---	PASS
PCDHB1	29930	broad.mit.edu	37	5	140432100	140432100	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140432100G>T	uc003lik.1	+	1	1122	c.1045G>T	c.(1045-1047)GTC>TTC	p.V349F		NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1 precursor	349	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAAGTGATGGTCTCCTCTGT	0.522													5	207	---	---	---	---	PASS
NMUR2	56923	broad.mit.edu	37	5	151784191	151784191	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151784191G>A	uc003luv.2	-	1	650	c.484C>T	c.(484-486)CGG>TGG	p.R162W		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	162	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CTGAGGGCCCGGCGCCGGGTG	0.632													6	67	---	---	---	---	PASS
LOC202181	202181	broad.mit.edu	37	5	177059003	177059003	+	Intron	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177059003G>T	uc011dgc.1	-						LOC202181_uc011dgb.1_RNA	NM_198567	NP_940969			hypothetical protein LOC375484												0						CTTTGAGGCGGGCCTGGCACA	0.542													13	41	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12121951	12121951	+	Silent	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12121951G>A	uc003nac.2	+	4	2102	c.1923G>A	c.(1921-1923)ACG>ACA	p.T641T	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	641					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ACGTAGGAACGGTACACGCCC	0.517													3	51	---	---	---	---	PASS
KIAA0240	23506	broad.mit.edu	37	6	42832809	42832809	+	Silent	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42832809G>A	uc003osn.1	+	13	3016	c.2865G>A	c.(2863-2865)CTG>CTA	p.L955L	KIAA0240_uc011duw.1_Silent_p.L955L|KIAA0240_uc003osp.1_Silent_p.L955L	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506	955										ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			AGAGCAAACTGTCAAGCATCC	0.512													29	65	---	---	---	---	PASS
TMEM151B	441151	broad.mit.edu	37	6	44240820	44240820	+	Silent	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44240820C>T	uc003oxh.2	+	2	153	c.153C>T	c.(151-153)CCC>CCT	p.P51P	SPATS1_uc003oxg.2_RNA|TMEM151B_uc003oxf.2_Silent_p.P51P	NM_001137560	NP_001131032	Q8IW70	T151B_HUMAN	transmembrane protein 151B	51						integral to membrane					0						CCATCCAGCCCTCTTTCACCA	0.632													22	63	---	---	---	---	PASS
KLHL32	114792	broad.mit.edu	37	6	97533101	97533101	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97533101C>T	uc010kcm.1	+	6	983	c.511C>T	c.(511-513)CTC>TTC	p.L171F	KLHL32_uc003poy.2_Missense_Mutation_p.L171F|KLHL32_uc011ead.1_Missense_Mutation_p.L135F|KLHL32_uc003poz.2_Intron|KLHL32_uc011eae.1_Missense_Mutation_p.L102F|KLHL32_uc003ppa.2_RNA	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN	kelch-like 32	171										ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		AGTGAAACATCTCTCTGAACT	0.468													7	254	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102250221	102250221	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102250221C>G	uc003pqp.3	+	8	1360	c.1111C>G	c.(1111-1113)CTC>GTC	p.L371V	GRIK2_uc003pqn.2_Missense_Mutation_p.L371V|GRIK2_uc003pqo.3_Missense_Mutation_p.L371V|GRIK2_uc010kcw.2_Missense_Mutation_p.L371V	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	371	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TTGGGAAGGCCTCACAGGCAG	0.338													18	380	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168349093	168349093	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168349093T>G	uc003qwd.2	+	28	3884	c.3742T>G	c.(3742-3744)TGG>GGG	p.W1248G	MLLT4_uc003qwb.1_Missense_Mutation_p.W1233G|MLLT4_uc003qwc.1_Missense_Mutation_p.W1249G|MLLT4_uc003qwg.1_Missense_Mutation_p.W558G	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1249					adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCAGAACCAGTGGCCAAATTA	0.458			T	MLL	AL								53	154	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94881334	94881334	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94881334A>T	uc003unp.2	+	11	2773	c.2491A>T	c.(2491-2493)AAT>TAT	p.N831Y	PPP1R9A_uc010lfj.2_Missense_Mutation_p.N853Y|PPP1R9A_uc011kif.1_Missense_Mutation_p.N831Y|PPP1R9A_uc003unq.2_Missense_Mutation_p.N831Y|PPP1R9A_uc011kig.1_Missense_Mutation_p.N831Y	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	831	Poly-Asn.|Interacts with TGN38 (By similarity).					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			AGTTAACAATAATAACAACAT	0.383										HNSCC(28;0.073)			71	237	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107849970	107849970	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107849970T>C	uc003vfb.2	-	12	1441	c.970A>G	c.(970-972)ACC>GCC	p.T324A	NRCAM_uc003vfc.2_Missense_Mutation_p.T318A|NRCAM_uc011kmk.1_Missense_Mutation_p.T319A|NRCAM_uc003vfd.2_Missense_Mutation_p.T300A|NRCAM_uc003vfe.2_Missense_Mutation_p.T300A	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	324	Ig-like 3.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						ATCTGCAAGGTTTTCTCAAAG	0.373													7	635	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121651686	121651686	+	Silent	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121651686G>A	uc003vjy.2	+	12	2981	c.2586G>A	c.(2584-2586)GTG>GTA	p.V862V	PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	862	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						CTCTGCCAGTGGCTGGGGGTG	0.478													31	95	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126079080	126079080	+	3'UTR	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126079080C>T	uc003vlr.2	-	10					GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_3'UTR|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TGATTGTAGTCTACGGAGATC	0.378										HNSCC(24;0.065)			97	230	---	---	---	---	PASS
TSGA13	114960	broad.mit.edu	37	7	130368446	130368446	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130368446C>A	uc003vqi.2	-	3	545	c.88G>T	c.(88-90)GTC>TTC	p.V30F	TSGA13_uc003vqj.2_Missense_Mutation_p.V30F	NM_052933	NP_443165	Q96PP4	TSG13_HUMAN	testis specific, 13	30										ovary(2)	2	Melanoma(18;0.0435)					TTGCTATTGACAACCATTCCT	0.378													5	626	---	---	---	---	PASS
DEFA4	1669	broad.mit.edu	37	8	6793661	6793661	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6793661A>G	uc003wqu.1	-	3	226	c.175T>C	c.(175-177)TCA>CCA	p.S59P		NM_001925	NP_001916	P12838	DEF4_HUMAN	defensin, alpha 4 preproprotein	59					defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space				large_intestine(1)	1				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CCCCTTGTTGAGCCTGGGAAC	0.512													4	48	---	---	---	---	PASS
NEFM	4741	broad.mit.edu	37	8	24775663	24775663	+	Silent	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24775663G>A	uc003xed.3	+	3	2328	c.2295G>A	c.(2293-2295)GGG>GGA	p.G765G	NEFM_uc011lac.1_Intron|NEFM_uc010lue.2_Silent_p.G389G	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	765	Tail.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		aagaagaggggaagccactgc	0.189													8	54	---	---	---	---	PASS
EYA1	2138	broad.mit.edu	37	8	72234208	72234208	+	Intron	SNP	A	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72234208A>T	uc003xys.3	-						EYA1_uc003xyr.3_Intron|EYA1_uc003xyt.3_Intron|EYA1_uc010lzf.2_5'UTR|EYA1_uc003xyu.2_Intron|EYA1_uc011lfe.1_Intron|EYA1_uc003xyv.2_Intron	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b						double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			CCAGCTAAATATTGTATCTTA	0.333													7	68	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110491814	110491814	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110491814C>T	uc003yne.2	+	54	9228	c.9124C>T	c.(9124-9126)CGA>TGA	p.R3042*		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	3042	Extracellular (Potential).|G8 2.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GCAATCATCACGAGAAAATAA	0.318										HNSCC(38;0.096)			5	578	---	---	---	---	PASS
KIAA0196	9897	broad.mit.edu	37	8	126093948	126093948	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126093948T>C	uc003yrt.2	-	5	802	c.473A>G	c.(472-474)GAA>GGA	p.E158G	KIAA0196_uc011lir.1_Missense_Mutation_p.E10G	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin	158					cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GACTTCTCCTTCAATCTTTTG	0.423													5	201	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413581	68413581	+	RNA	SNP	G	C	C	rs1809619		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413581G>C	uc004aex.2	+	1		c.136G>C								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		CCGGATCTAGGAAAGGTTGTG	0.602													5	20	---	---	---	---	PASS
HEMGN	55363	broad.mit.edu	37	9	100693032	100693032	+	Silent	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100693032A>G	uc004axy.2	-	3	753	c.645T>C	c.(643-645)CCT>CCC	p.P215P	HEMGN_uc004axz.2_Silent_p.P215P	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	215					cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				ACATTTTGAAAGGATGGTCTT	0.398													6	343	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	116931616	116931616	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116931616C>T	uc011lxl.1	+	3	1781	c.1781C>T	c.(1780-1782)CCG>CTG	p.P594L	COL27A1_uc004bii.2_RNA|COL27A1_uc010mvd.1_Missense_Mutation_p.P444L	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	594	Pro-rich.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						GTATTGGCCCCGGCGCAATTC	0.652													5	16	---	---	---	---	PASS
ABL1	25	broad.mit.edu	37	9	133729596	133729596	+	Missense_Mutation	SNP	T	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133729596T>G	uc004bzw.2	+	2	228	c.225T>G	c.(223-225)AGT>AGG	p.S75R	ABL1_uc004bzv.2_Missense_Mutation_p.S94R	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	75	SH3.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	TTGTGGCCAGTGGAGATAACA	0.478			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								39	70	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12009344	12009344	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12009344A>G	uc001ila.2	-	9	2537	c.2063T>C	c.(2062-2064)TTA>TCA	p.L688S	UPF2_uc001ilb.2_Missense_Mutation_p.L688S|UPF2_uc001ilc.2_Missense_Mutation_p.L688S|UPF2_uc009xiz.1_Missense_Mutation_p.L688S	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	688	MIF4G 2.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				ACTAACCTTTAAACAATGCAG	0.244													95	291	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16957110	16957110	+	Silent	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16957110A>G	uc001ioo.2	-	47	7324	c.7272T>C	c.(7270-7272)AAT>AAC	p.N2424N		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	2424	CUB 17.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCACAGCAGTATTGCTAGAAG	0.413													30	91	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	22023041	22023041	+	Silent	SNP	A	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22023041A>C	uc001iqs.2	+	21	3237	c.2889A>C	c.(2887-2889)CCA>CCC	p.P963P	MLLT10_uc001iqt.2_Silent_p.P947P|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Silent_p.P947P|MLLT10_uc001ira.2_Silent_p.P404P|MLLT10_uc001irb.2_RNA	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	963					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						ATCCAATGCCAGCTACACTGA	0.443			T	MLL|PICALM|CDK6	AL								20	78	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26377180	26377180	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26377180G>T	uc001isn.2	+	15	1768	c.1408G>T	c.(1408-1410)GTA>TTA	p.V470L	MYO3A_uc009xko.1_Missense_Mutation_p.V470L|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Missense_Mutation_p.V470L	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	470	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GAACAATTTGGTAGAAGCCTT	0.299													19	218	---	---	---	---	PASS
DYDC1	143241	broad.mit.edu	37	10	82102061	82102061	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82102061T>C	uc001kbx.2	-	5	471	c.306A>G	c.(304-306)ATA>ATG	p.I102M	DYDC1_uc001kby.1_Missense_Mutation_p.I102M|DYDC1_uc009xsr.1_Missense_Mutation_p.I102M|DYDC2_uc001kbz.1_5'Flank|DYDC2_uc001kca.1_5'Flank	NM_138812	NP_620167	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	102											0			Colorectal(32;0.229)			GTAGTTCTTGTATTCTCTGCC	0.328													6	642	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129906188	129906188	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129906188C>A	uc001lke.2	-	13	4111	c.3916G>T	c.(3916-3918)GAG>TAG	p.E1306*	MKI67_uc001lkf.2_Nonsense_Mutation_p.E946*|MKI67_uc009yav.1_Nonsense_Mutation_p.E881*|MKI67_uc009yaw.1_Nonsense_Mutation_p.E456*	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	1306	16 X 122 AA approximate repeats.|3.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ATGTCTTTCTCTTCACCTACT	0.478													32	277	---	---	---	---	PASS
OR10A5	144124	broad.mit.edu	37	11	6867462	6867462	+	Silent	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6867462G>A	uc001met.1	+	1	549	c.549G>A	c.(547-549)CCG>CCA	p.P183P		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	183	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGACAGCCCGCCTGTGCTGA	0.527													9	175	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26558968	26558968	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26558968T>C	uc001mqt.3	+	10	1137	c.992T>C	c.(991-993)ATA>ACA	p.I331T	ANO3_uc010rdr.1_Missense_Mutation_p.I315T|ANO3_uc010rds.1_Missense_Mutation_p.I170T|ANO3_uc010rdt.1_Missense_Mutation_p.I185T	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	331	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CGTAAACTTATAAACAATGGC	0.373													128	376	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944821	55944821	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944821C>G	uc010rjb.1	+	1	728	c.728C>G	c.(727-729)TCT>TGT	p.S243C		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					ACCTGTGCCTCTCACCTGACT	0.448													29	83	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20801757	20801757	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20801757G>T	uc001reh.1	+	13	2723	c.2701G>T	c.(2701-2703)GTC>TTC	p.V901F		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	901	Catalytic (By similarity).				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	CCGTTTCCTTGTCATTGAAGC	0.393													121	250	---	---	---	---	PASS
C12orf41	54934	broad.mit.edu	37	12	49065653	49065653	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49065653C>A	uc001rrx.2	-	5	713	c.638G>T	c.(637-639)CGA>CTA	p.R213L	C12orf41_uc001rrw.2_Missense_Mutation_p.R18L|C12orf41_uc001rrz.2_Missense_Mutation_p.R396L|C12orf41_uc001rry.2_RNA|C12orf41_uc001rrv.2_5'Flank	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934	213										ovary(2)	2						ATGCTGAAGTCGTTTAAACTG	0.433													10	191	---	---	---	---	PASS
LIMA1	51474	broad.mit.edu	37	12	50571222	50571222	+	Silent	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50571222T>C	uc001rwj.3	-	11	2079	c.1905A>G	c.(1903-1905)CAA>CAG	p.Q635Q	LIMA1_uc001rwg.3_Silent_p.Q333Q|LIMA1_uc001rwh.3_Silent_p.Q474Q|LIMA1_uc001rwi.3_Silent_p.Q476Q|LIMA1_uc001rwk.3_Silent_p.Q636Q|LIMA1_uc010smr.1_RNA|LIMA1_uc010sms.1_RNA	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b	635					actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						CATTTTCCACTTGTTTCCTTT	0.458													74	268	---	---	---	---	PASS
FAM186A	121006	broad.mit.edu	37	12	50748623	50748623	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50748623A>C	uc001rwl.2	-	4	2130	c.1992T>G	c.(1990-1992)AGT>AGG	p.S664R	FAM186A_uc010smt.1_Missense_Mutation_p.S442R	NM_001145475	NP_001138947	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	664											0						TACTCTGTTCACTTTTGCCAT	0.383													20	68	---	---	---	---	PASS
TAOK3	51347	broad.mit.edu	37	12	118639252	118639252	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118639252C>T	uc001twx.2	-	12	1131	c.836G>A	c.(835-837)CGA>CAA	p.R279Q	TAOK3_uc001tww.2_Missense_Mutation_p.R109Q|TAOK3_uc001twy.3_Missense_Mutation_p.R279Q	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	279					MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGCCGGTCTCGTCGAACAAA	0.393													4	261	---	---	---	---	PASS
ZNF268	10795	broad.mit.edu	37	12	133779648	133779648	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133779648T>C	uc010tcf.1	+	6	1706	c.1376T>C	c.(1375-1377)CTC>CCC	p.L459P	ZNF268_uc010tbv.1_Missense_Mutation_p.L298P|ZNF268_uc010tbw.1_Missense_Mutation_p.L298P|ZNF268_uc010tbx.1_Missense_Mutation_p.L319P|ZNF268_uc010tby.1_Missense_Mutation_p.L298P|ZNF268_uc010tbz.1_Missense_Mutation_p.L298P|ZNF268_uc010tca.1_Missense_Mutation_p.L298P|ZNF268_uc010tcb.1_Missense_Mutation_p.L319P|ZNF268_uc010tcc.1_Missense_Mutation_p.L298P|ZNF268_uc010tcd.1_Missense_Mutation_p.L298P|ZNF268_uc010tce.1_Missense_Mutation_p.L298P|ZNF268_uc010tcg.1_Missense_Mutation_p.L298P|ZNF268_uc010tch.1_Missense_Mutation_p.L459P	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a	459	C2H2-type 7.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		AAGTCACAGCTCATTGTACAT	0.403													6	160	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329572	88329572	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329572G>T	uc001vln.2	+	2	2148	c.1929G>T	c.(1927-1929)TTG>TTT	p.L643F	SLITRK5_uc010tic.1_Missense_Mutation_p.L402F	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	643	Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CGGTCCGGTTGAATAGCACCG	0.612													9	52	---	---	---	---	PASS
ABCC4	10257	broad.mit.edu	37	13	95859006	95859006	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95859006G>C	uc001vmd.3	-	8	1060	c.941C>G	c.(940-942)TCC>TGC	p.S314C	ABCC4_uc010afk.2_Missense_Mutation_p.S314C|ABCC4_uc001vme.2_Missense_Mutation_p.S314C|ABCC4_uc010tih.1_Missense_Mutation_p.S239C|ABCC4_uc001vmf.2_Missense_Mutation_p.S271C|ABCC4_uc010afl.1_Missense_Mutation_p.S271C|ABCC4_uc010afm.1_Missense_Mutation_p.S327C	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	314	ABC transmembrane type-1 1.				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	TCTGAGGCAGGAACTTCTCAG	0.383													9	36	---	---	---	---	PASS
FARP1	10160	broad.mit.edu	37	13	99092447	99092447	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99092447A>G	uc001vnj.2	+	23	2923	c.2587A>G	c.(2587-2589)AGC>GGC	p.S863G	FARP1_uc001vnh.2_Missense_Mutation_p.S894G	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	863					regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GAAGAGCAGCAGCCCCGCCCC	0.612													4	39	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103528150	103528150	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103528150A>G	uc001vpw.2	+	15	3901	c.3458A>G	c.(3457-3459)GAC>GGC	p.D1153G		NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	1153					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GATAGTGATGACGATGGAGGG	0.493			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				4	59	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22368718	22368718	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22368718C>T	uc010tzu.1	+	1	143	c.143C>T	c.(142-144)ACC>ATC	p.T48I	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	48	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ATCATTTGCACCATCAGTCTA	0.423													6	823	---	---	---	---	PASS
C15orf29	79768	broad.mit.edu	37	15	34440867	34440867	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34440867T>C	uc001zhp.2	-	5	683	c.523A>G	c.(523-525)AGA>GGA	p.R175G	C15orf29_uc010ubz.1_Missense_Mutation_p.R79G|C15orf29_uc010uca.1_Missense_Mutation_p.R175G	NM_024713	NP_078989	Q9H079	CO029_HUMAN	hypothetical protein LOC79768	175						nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)		CTTATACTTCTCTTTCTCCAG	0.313													6	249	---	---	---	---	PASS
LRRC57	255252	broad.mit.edu	37	15	42837393	42837393	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42837393C>A	uc001zqd.1	-	4	928	c.560G>T	c.(559-561)TGT>TTT	p.C187F	LRRC57_uc001zqc.2_Missense_Mutation_p.C187F	NM_153260	NP_694992	Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	187	LRR 7.										0		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		GAGCTCAAGACAATTCTCTTC	0.408													23	223	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43277102	43277102	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43277102C>T	uc001zqq.2	-	36	4102	c.4036G>A	c.(4036-4038)GCA>ACA	p.A1346T		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1346					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TTTTGAAGTGCTCCAAACAGA	0.308													5	384	---	---	---	---	PASS
PATL2	197135	broad.mit.edu	37	15	44964245	44964245	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44964245C>A	uc010uej.1	-	7	723	c.625G>T	c.(625-627)GCA>TCA	p.A209S	PATL2_uc001zub.3_Missense_Mutation_p.A7S	NM_001145112	NP_001138584	C9JE40	PATL2_HUMAN	protein associated with topoisomerase II homolog	209					negative regulation of translation	cytoplasm|nucleus	protein binding|RNA binding				0						CGGGGTTTTGCACTCTGCAGC	0.567													68	136	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90348359	90348359	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90348359T>C	uc002bop.3	-	4	1139	c.847A>G	c.(847-849)ATT>GTT	p.I283V		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	283	Extracellular.|Interaction with HCoV-229E.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	TCACTGACAATGAAGGCCAGC	0.582													50	147	---	---	---	---	PASS
UNC45A	55898	broad.mit.edu	37	15	91479483	91479483	+	Intron	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91479483T>C	uc002bqg.2	+						UNC45A_uc002bqd.2_Intron|UNC45A_uc010uqo.1_Intron|UNC45A_uc010uqp.1_RNA|UNC45A_uc010uqq.1_Intron	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform						cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			AGTGGCCTCATGGGTGCTGAC	0.587													6	24	---	---	---	---	PASS
IL21R	50615	broad.mit.edu	37	16	27455987	27455987	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27455987A>G	uc002doq.1	+	6	865	c.632A>G	c.(631-633)CAG>CGG	p.Q211R	IL21R_uc002dor.1_Missense_Mutation_p.Q211R|IL21R_uc002dos.1_Missense_Mutation_p.Q211R	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	211	Extracellular (Potential).				natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						TCCTCCTACCAGGGGACCTGG	0.582			T	BCL6	NHL								15	38	---	---	---	---	PASS
CSDAP1	440359	broad.mit.edu	37	16	31579714	31579714	+	3'UTR	SNP	A	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31579714A>T	uc010vfr.1	-	1						NR_027011				SubName: Full=CSDA protein variant; Flags: Fragment;												0						GTTACTCAGCACTGCTCTGCT	0.552													10	88	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47733353	47733353	+	3'UTR	SNP	G	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47733353G>C	uc002eev.3	+	31					PHKB_uc002eeu.3_3'UTR|PHKB_uc002eew.3_3'UTR	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CTTAATCAAGGCAGCCATTAA	0.468													10	81	---	---	---	---	PASS
ZNF469	84627	broad.mit.edu	37	16	88498001	88498001	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88498001C>G	uc002fku.2	+	2	4039	c.4039C>G	c.(4039-4041)CCC>GCC	p.P1347A		NM_001127464	NP_001120936	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1347	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGGGCCTCAGCCCTACAGCAG	0.572													5	35	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89877420	89877420	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89877420C>G	uc002fou.1	-	4	385	c.343G>C	c.(343-345)GGG>CGG	p.G115R	FANCA_uc010vpn.1_Missense_Mutation_p.G115R|FANCA_uc002fov.1_Missense_Mutation_p.G98R|FANCA_uc002fow.1_Missense_Mutation_p.G115R|FANCA_uc002fox.1_Missense_Mutation_p.G115R|FANCA_uc010ciu.1_Missense_Mutation_p.G115R|FANCA_uc002foy.2_Missense_Mutation_p.G115R	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	115					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GCAACCATCCCGGCTGAGAGA	0.537			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	38	---	---	---	---	PASS
POLDIP2	26073	broad.mit.edu	37	17	26680801	26680801	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26680801C>T	uc002haz.2	-	7	490	c.358G>A	c.(358-360)GGC>AGC	p.G120S	POLDIP2_uc010wag.1_RNA	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2	120						mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GAGCCATGGCCAGCAGGGTTC	0.527													4	154	---	---	---	---	PASS
CACNA1G	8913	broad.mit.edu	37	17	48647166	48647166	+	Splice_Site	SNP	T	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48647166T>A	uc002irk.1	+	4	958	c.586_splice	c.e4+2	p.S196_splice	CACNA1G_uc002iri.1_Splice_Site_p.S196_splice|CACNA1G_uc002irj.1_Splice_Site_p.S196_splice|CACNA1G_uc002irl.1_Splice_Site_p.S196_splice|CACNA1G_uc002irm.1_Splice_Site_p.S196_splice|CACNA1G_uc002irn.1_Splice_Site_p.S196_splice|CACNA1G_uc002iro.1_Splice_Site_p.S196_splice|CACNA1G_uc002irp.1_Splice_Site_p.S196_splice|CACNA1G_uc002irq.1_Splice_Site_p.S196_splice|CACNA1G_uc002irr.1_Splice_Site_p.S196_splice|CACNA1G_uc002irs.1_Splice_Site_p.S196_splice|CACNA1G_uc002irt.1_Splice_Site_p.S196_splice|CACNA1G_uc002irv.1_Splice_Site_p.S196_splice|CACNA1G_uc002irw.1_Splice_Site_p.S196_splice|CACNA1G_uc002iru.1_Splice_Site_p.S196_splice|CACNA1G_uc002irx.1_Splice_Site_p.S109_splice|CACNA1G_uc002iry.1_Splice_Site_p.S109_splice|CACNA1G_uc002irz.1_Splice_Site_p.S109_splice|CACNA1G_uc002isa.1_Splice_Site_p.S109_splice|CACNA1G_uc002isb.1_Splice_Site_p.S109_splice|CACNA1G_uc002isc.1_Splice_Site_p.S109_splice|CACNA1G_uc002isd.1_Splice_Site_p.S109_splice|CACNA1G_uc002ise.1_Splice_Site_p.S109_splice|CACNA1G_uc002isf.1_Splice_Site_p.S109_splice|CACNA1G_uc002isg.1_Splice_Site_p.S109_splice|CACNA1G_uc002ish.1_Splice_Site_p.S109_splice|CACNA1G_uc002isi.1_Splice_Site_p.S109_splice	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G						axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GGGTGCCCAGTGAGTGACCCC	0.607													9	22	---	---	---	---	PASS
FAM104A	84923	broad.mit.edu	37	17	71205829	71205829	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71205829C>G	uc002jji.3	-	3	488	c.400G>C	c.(400-402)GAA>CAA	p.E134Q	FAM104A_uc002jjj.3_Missense_Mutation_p.E155Q	NM_032837	NP_116226	Q969W3	F104A_HUMAN	hypothetical protein LOC84923 isoform 2	134	Ser-rich.										0			LUSC - Lung squamous cell carcinoma(166;0.197)			AAGCTGCCTTCCGGCCCGCTG	0.537													7	20	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71415436	71415436	+	Silent	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71415436G>T	uc010dfm.2	-	16	2055	c.2055C>A	c.(2053-2055)CTC>CTA	p.L685L	SDK2_uc010dfn.2_Silent_p.L364L	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	685	Extracellular (Potential).				cell adhesion	integral to membrane				ovary(2)	2						GCTCCTCGGGGAGGGAGACCC	0.592													25	71	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78727975	78727975	+	Missense_Mutation	SNP	G	A	A	rs148973724		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78727975G>A	uc002jyt.1	+	6	1625	c.820G>A	c.(820-822)GCC>ACC	p.A274T	RPTOR_uc002jys.2_Missense_Mutation_p.A274T|RPTOR_uc010wuf.1_Missense_Mutation_p.A89T|RPTOR_uc010wug.1_Missense_Mutation_p.A274T	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	274					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						CATCAAGATCGCCCTGCGCTG	0.677													18	30	---	---	---	---	PASS
STRA13	201254	broad.mit.edu	37	17	79977055	79977055	+	3'UTR	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79977055G>T	uc002kdc.2	-	4					STRA13_uc002kdd.2_RNA	NM_144998	NP_659435	A8MT69	CENPX_HUMAN	stimulated by retinoic acid 13						DNA repair	chromosome, centromeric region|Fanconi anaemia nuclear complex	DNA binding|protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CTCCTCTGGGGGTGGCCTCAG	0.612													8	13	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80041659	80041659	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80041659G>A	uc002kdu.2	-	30	5324	c.5207C>T	c.(5206-5208)ACG>ATG	p.T1736M	FASN_uc002kdv.1_5'Flank	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	1736	Enoyl reductase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	CTTCCCGCCCGTGTGCCACAG	0.682													6	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	109344	109344	+	RNA	SNP	T	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:109344T>A	uc002kke.2	+	1		c.280T>A								Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		aggctttgcctacaggggaca	0.000													3	29	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14542931	14542931	+	Missense_Mutation	SNP	C	T	T	rs45554841	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14542931C>T	uc010dln.2	-	1	669	c.215G>A	c.(214-216)TGC>TAC	p.C72Y	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	72										skin(3)	3						GCTCCCCCTGCAGCAGGGGAA	0.567													9	48	---	---	---	---	PASS
SERPINB12	89777	broad.mit.edu	37	18	61231280	61231280	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61231280T>C	uc010xen.1	+	5	572	c.572T>C	c.(571-573)GTT>GCT	p.V191A	SERPINB12_uc010xeo.1_Missense_Mutation_p.V211A	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	191					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0						GTGAATGCTGTTTACTTCAAG	0.413													6	335	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67742714	67742714	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67742714G>A	uc002lkp.2	-	33	4506	c.4438C>T	c.(4438-4440)CTT>TTT	p.L1480F	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Missense_Mutation_p.L568F	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1480							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TGATATAAAAGAGCCTGAAGG	0.418													36	120	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6714022	6714022	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6714022C>A	uc002mfm.2	-	7	816	c.754G>T	c.(754-756)GAG>TAG	p.E252*		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	252					complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		ATGGTGACCTCCAGGCCCTTC	0.607													8	40	---	---	---	---	PASS
C19orf45	374877	broad.mit.edu	37	19	7573131	7573131	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7573131C>T	uc002mgm.2	+	9	1474	c.1333C>T	c.(1333-1335)CGC>TGC	p.R445C		NM_198534	NP_940936	Q8NA69	CS045_HUMAN	hypothetical protein LOC374877	445											0						GGGTGGACTGCGCTTCTTCTC	0.602													13	29	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31770507	31770507	+	Silent	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31770507G>A	uc002nsy.3	-	2	257	c.192C>T	c.(190-192)GCC>GCT	p.A64A		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	64					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					AAAACTCGGCGGCCGGGGAGT	0.592													19	34	---	---	---	---	PASS
PDCD5	9141	broad.mit.edu	37	19	33077619	33077619	+	Intron	SNP	A	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33077619A>G	uc002ntm.2	+						PDCD5_uc002ntl.2_3'UTR|PDCD5_uc010ede.2_Intron	NM_004708	NP_004699	O14737	PDCD5_HUMAN	programmed cell death 5						apoptosis|induction of apoptosis	cytoplasm|nucleus	DNA binding			ovary(1)|lung(1)	2	Esophageal squamous(110;0.137)					GTTATAACCAATAGTTTCAAC	0.403													6	36	---	---	---	---	PASS
ALKBH6	84964	broad.mit.edu	37	19	36504275	36504275	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36504275G>T	uc002oct.2	-	2	125	c.25C>A	c.(25-27)CCA>ACA	p.P9T	ALKBH6_uc002ocv.1_Missense_Mutation_p.P37T|ALKBH6_uc002ocx.1_5'UTR|ALKBH6_uc002ocw.1_Missense_Mutation_p.P37T|ALKBH6_uc010eeo.1_Missense_Mutation_p.P9T|ALKBH6_uc010eep.1_Missense_Mutation_p.P37T|uc002ocy.2_5'Flank	NM_032878	NP_116267	Q3KRA9	ALKB6_HUMAN	alkB, alkylation repair homolog 6 isoform 2	9						cytoplasm|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCCAGGGCTGGGACTCTGGCG	0.587													25	87	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41601828	41601828	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41601828G>T	uc002opt.2	+	9	1476	c.1467G>T	c.(1465-1467)ATG>ATT	p.M489I		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	489					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	ACTACACCATGAGCTTCCTGC	0.323													8	76	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17449242	17449242	+	Silent	SNP	T	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17449242T>A	uc002zlw.2	-	5	1077	c.969A>T	c.(967-969)GGA>GGT	p.G323G	GAB4_uc010gqs.1_Missense_Mutation_p.R223W	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	323										large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TGGCATTCCCTCCACCATGCT	0.582													27	84	---	---	---	---	PASS
PRPS2	5634	broad.mit.edu	37	X	12817354	12817354	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12817354G>A	uc004cvb.2	+	2	275	c.151G>A	c.(151-153)GAA>AAA	p.E51K	PRPS2_uc004cva.2_Missense_Mutation_p.E51K|PRPS2_uc010nec.2_5'UTR	NM_002765	NP_002756	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	51					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0						CGTGAGAGGGGAAGATGTCTA	0.413													13	131	---	---	---	---	PASS
ALG13	79868	broad.mit.edu	37	X	110925368	110925368	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110925368G>C	uc011msy.1	+	2	124	c.90G>C	c.(88-90)GAG>GAC	p.E30D	ALG13_uc004epi.1_Missense_Mutation_p.E30D|ALG13_uc011msw.1_5'UTR|ALG13_uc011msx.1_Intron|ALG13_uc011msz.1_5'UTR|ALG13_uc011mta.1_Intron|ALG13_uc011mtb.1_5'UTR			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);	30					dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						AGAAAATCGAGAGCCTTGGTT	0.433													5	98	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123838862	123838862	+	Splice_Site	SNP	C	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123838862C>A	uc004euj.2	-	5	1079	c.1015_splice	c.e5+1	p.A339_splice	ODZ1_uc011muj.1_Splice_Site_p.V339_splice|ODZ1_uc010nqy.2_Splice_Site_p.A339_splice	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						AAAGGACTTACCAATCACATA	0.443													26	34	---	---	---	---	PASS
TAZ	6901	broad.mit.edu	37	X	153649048	153649048	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153649048C>G	uc004fkx.2	+	10	1055	c.751C>G	c.(751-753)CGG>GGG	p.R251G	TAZ_uc004fky.2_Missense_Mutation_p.R237G|TAZ_uc004fkz.2_RNA|TAZ_uc004fla.2_Missense_Mutation_p.R221G|TAZ_uc004flb.2_Missense_Mutation_p.R207G|TAZ_uc010nuy.2_Missense_Mutation_p.R255G|TAZ_uc004flc.3_Missense_Mutation_p.R221G	NM_000116	NP_000107	Q16635	TAZ_HUMAN	tafazzin isoform 1	251					cardiac muscle contraction|cardiac muscle tissue development|cardiolipin biosynthetic process|cristae formation|hemopoiesis|mitochondrial ATP synthesis coupled electron transport|mitochondrial respiratory chain complex I assembly|skeletal muscle tissue development	integral to membrane|mitochondrion	1-acylglycerophosphocholine O-acyltransferase activity				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTACTCGAGCGGCTCCGGGC	0.642													15	22	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	4966255	4966255	+	Splice_Site	SNP	G	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:4966255G>T	uc004fqo.2	+	2	1371	c.637_splice	c.e2-1	p.S213_splice	PCDH11Y_uc010nwg.1_Splice_Site_p.S202_splice|PCDH11Y_uc004fql.1_Splice_Site_p.S202_splice|PCDH11Y_uc004fqm.1_Splice_Site_p.S202_splice|PCDH11Y_uc004fqn.1_Splice_Site_p.S213_splice|PCDH11Y_uc004fqp.1_5'Flank	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						ATGTTTTCCAGAGTCAAAACA	0.274													12	65	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7053610	7053610	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7053610delT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		tgaggctctgttattaggcac	0.025													4	2	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8639571	8639571	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8639571delA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		ACATAAAATGAAACAACGCCC	0.348													4	2	---	---	---	---	
PEX14	5195	broad.mit.edu	37	1	10544730	10544731	+	Intron	DEL	GC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10544730_10544731delGC	uc001arn.2	+						PEX14_uc001arm.1_Intron|PEX14_uc009vmu.1_Intron|PEX14_uc009vmv.2_Intron|PEX14_uc010oam.1_Intron|PEX14_uc010oan.1_Intron|PEX14_uc001arl.2_Intron	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14						negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		aaaccactgggctgagtctcac	0.000													4	2	---	---	---	---	
MTHFR	4524	broad.mit.edu	37	1	11852810	11852810	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11852810delT	uc001atc.1	-						MTHFR_uc001atb.1_Intron	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase						blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	TTAAGCTGGGTTTACTCAAAC	0.418													4	2	---	---	---	---	
PRAMEF11	440560	broad.mit.edu	37	1	12891862	12891863	+	5'Flank	INS	-	T	T	rs148863245		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12891862_12891863insT	uc001auk.2	-							NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11												0						aaataaaaaaaTCATTCATTCA	0.198													4	4	---	---	---	---	
HNRNPCL1	343069	broad.mit.edu	37	1	12908384	12908385	+	Intron	INS	-	A	A	rs143606605		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12908384_12908385insA	uc010obf.1	-						LOC649330_uc009vno.2_5'Flank	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like							ribonucleoprotein complex	nucleotide binding				0						ATTGCATTTAGAAAAAAAATCA	0.356													4	4	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16921902	16921903	+	Intron	INS	-	TG	TG	rs145494951	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16921902_16921903insTG	uc009vos.1	-							NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ggggcctggaatgtttgttaac	0.109													4	2	---	---	---	---	
PADI6	353238	broad.mit.edu	37	1	17723476	17723477	+	Intron	INS	-	CA	CA	rs144056968	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17723476_17723477insCA	uc001bak.1	+							NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGGAATGCACCCAGGTGGCTGG	0.629													11	5	---	---	---	---	
ACTL8	81569	broad.mit.edu	37	1	18098429	18098429	+	Intron	DEL	C	-	-	rs74820442		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18098429delC	uc001bat.2	+							NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8							cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		TTGTCCTCTTCCTGCCTTCTC	0.483													3	3	---	---	---	---	
ACTL8	81569	broad.mit.edu	37	1	18108225	18108225	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18108225delG	uc001bat.2	+							NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8							cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		ATTTATGGGTGGGCTTCGGGA	0.299													4	2	---	---	---	---	
TMCO4	255104	broad.mit.edu	37	1	20093604	20093604	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20093604delC	uc001bcn.2	-						TMCO4_uc001bcm.2_Intron|TMCO4_uc001bco.1_Intron|TMCO4_uc001bcp.1_Intron|TMCO4_uc009vpn.1_Intron|TMCO4_uc001bcq.1_Intron	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4							integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		TGCTTCAATTCCCTAATTCCT	0.318													4	2	---	---	---	---	
ECE1	1889	broad.mit.edu	37	1	21609269	21609269	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21609269delG	uc001bek.2	-						ECE1_uc001bem.2_Intron|ECE1_uc001bei.2_Intron|ECE1_uc010odl.1_Intron|ECE1_uc009vqa.1_Intron	NM_001397	NP_001388	P42892	ECE1_HUMAN	endothelin converting enzyme 1 isoform 1						bradykinin catabolic process|calcitonin catabolic process|ear development|embryonic digit morphogenesis|endothelin maturation|heart development|positive regulation of receptor recycling|substance P catabolic process	early endosome|external side of plasma membrane|integral to membrane|intrinsic to endosome membrane|membrane fraction|perinuclear region of cytoplasm|plasma membrane|Weibel-Palade body	metal ion binding|metalloendopeptidase activity|protein homodimerization activity			ovary(2)|skin(1)	3		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		AGCCATCTGCggagagaaggg	0.303													4	2	---	---	---	---	
EPHB2	2048	broad.mit.edu	37	1	23115247	23115247	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23115247delT	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		tttgtttttgttttttttttt	0.015									Hereditary_Prostate_Cancer				3	3	---	---	---	---	
FUCA1	2517	broad.mit.edu	37	1	24175455	24175456	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24175455_24175456insT	uc001bie.2	-							NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor						fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		TGCTGTTTTAAttttttttttt	0.183													4	2	---	---	---	---	
TMEM50A	23585	broad.mit.edu	37	1	25688537	25688538	+	3'UTR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25688537_25688538insC	uc001bke.2	+	7					TMEM50A_uc010oeq.1_3'UTR|TMEM50A_uc009vrr.2_RNA|TMEM50A_uc009vrs.2_RNA	NM_014313	NP_055128	O95807	TM50A_HUMAN	small membrane protein 1							endoplasmic reticulum|integral to membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)		ACAACCTCTTTCCCCACAGTGC	0.361													4	2	---	---	---	---	
TMEM57	55219	broad.mit.edu	37	1	25775682	25775682	+	Intron	DEL	A	-	-	rs12027110	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25775682delA	uc001bkk.2	+						TMEM57_uc009vru.2_Intron|TMEM57_uc009vrv.2_Intron|TMEM57_uc009vrt.2_Intron	NM_018202	NP_060672	Q8N5G2	MACOI_HUMAN	transmembrane protein 57							axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		ATATCTTTTTAAAAAAAAAAT	0.254													6	3	---	---	---	---	
ARID1A	8289	broad.mit.edu	37	1	27033094	27033094	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27033094delA	uc001bmv.1	+						ARID1A_uc001bmt.1_Intron|ARID1A_uc001bmu.1_Intron	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a						androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TAGAGGGATTAAAGGCCACAT	0.468			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								4	2	---	---	---	---	
GPN2	54707	broad.mit.edu	37	1	27215784	27215784	+	Intron	DEL	C	-	-	rs910048	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27215784delC	uc001bnd.1	-							NM_018066	NP_060536	Q9H9Y4	GPN2_HUMAN	ATP binding domain 1 family, member B								GTP binding				0						TAGGAGTCATCTTTTTTTTCT	0.443													6	3	---	---	---	---	
PHACTR4	65979	broad.mit.edu	37	1	28740232	28740232	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28740232delT	uc001bpw.2	+						PHACTR4_uc001bpu.2_Intron|PHACTR4_uc001bpv.1_Intron|PHACTR4_uc001bpx.2_Intron	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1								actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		gcatagtctctttttttccta	0.000													4	2	---	---	---	---	
GMEB1	10691	broad.mit.edu	37	1	29037337	29037337	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29037337delA	uc001bra.2	+						GMEB1_uc001bqz.2_Intron|GMEB1_uc001brb.2_Intron	NM_006582	NP_006573	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|metal ion binding|transcription coactivator activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GGCACAAAGGAAAAAAAAAGG	0.338													6	5	---	---	---	---	
OPRD1	4985	broad.mit.edu	37	1	29155728	29155728	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29155728delC	uc001brf.1	+							NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1						immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)	tctacagtttcctcacctctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	29814085	29814086	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29814085_29814086delCA								PTPRU (160770 upstream) : None (None downstream)																							cagatgcctgcacacacacaca	0.287													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30500619	30500619	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30500619delC	uc001bry.3	-											Homo sapiens cDNA clone IMAGE:4830073.																		gagagtggagcccccatgata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30896831	30896831	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30896831delA								None (None upstream) : MATN1 (287295 downstream)																							AGGTTATTGTAAGCACAGTTG	0.388													4	2	---	---	---	---	
PUM1	9698	broad.mit.edu	37	1	31468481	31468481	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31468481delA	uc001bsi.1	-						PUM1_uc001bsf.1_5'Flank|PUM1_uc001bsg.1_Intron|PUM1_uc001bsh.1_Intron|PUM1_uc001bsj.1_Intron|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Intron|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2						cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AATAGCATAGAAAAAAAAAAT	0.353													5	3	---	---	---	---	
LCK	3932	broad.mit.edu	37	1	32745970	32745970	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32745970delC	uc001bux.2	+						LCK_uc001buy.2_Intron|LCK_uc001buz.2_Intron|LCK_uc001bva.2_Intron	NM_005356	NP_005347	P06239	LCK_HUMAN	lymphocyte-specific protein tyrosine kinase						activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)	TGCCACATCTCCCAGGGCTGG	0.373			T	TRB@	T-ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33935124	33935124	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33935124delA								PHC2 (38509 upstream) : ZSCAN20 (3108 downstream)																							GCTAAGGATCAAAAAGCTGGG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35288595	35288596	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35288595_35288596insT								GJA4 (27249 upstream) : C1orf212 (30528 downstream)																							tgaggtcagaattttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	40197531	40197532	+	IGR	INS	-	TCAG	TCAG	rs10646429		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40197531_40197532insTCAG								HPCAL4 (40442 upstream) : PPIE (6998 downstream)																							gcatatgtagctcaaagtgtct	0.000													1	5	---	---	---	---	
PPIE	10450	broad.mit.edu	37	1	40206039	40206040	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40206039_40206040insT	uc001cds.1	+						PPIE_uc001cdt.1_Intron|PPIE_uc010oiy.1_Intron|PPIE_uc001cdu.1_Intron|PPIE_uc001cdv.2_Intron|PPIE_uc001cdw.2_Intron|PPIE_uc001cdx.1_5'Flank	NM_006112	NP_006103	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E isoform 1						protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding				0	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TATGGTTAGTATACACTACAGG	0.376													28	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	40442755	40442755	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40442755delA								MFSD2A (7128 upstream) : CAP1 (63500 downstream)																							agaaaggaagaaaaaaaaaga	0.000													4	2	---	---	---	---	
DEM1	64789	broad.mit.edu	37	1	40973256	40973256	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40973256delT	uc001cfp.2	+						DEM1_uc001cfq.2_5'Flank|DEM1_uc001cfr.2_5'Flank|DEM1_uc001cfs.2_5'Flank	NM_022774	NP_073611	Q9H790	EXO5_HUMAN	defects in morphology 1 homolog								DNA binding|exonuclease activity				0						ggatttcacatttaggtctta	0.000													4	2	---	---	---	---	
SCMH1	22955	broad.mit.edu	37	1	41694422	41694422	+	Intron	DEL	A	-	-	rs113412121		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41694422delA	uc001cgs.2	-						SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron	NM_012236	NP_036368	Q96GD3	SCMH1_HUMAN	sex comb on midleg 1 isoform 2						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				tgacttggggaaaaaaaaaaa	0.015													2	5	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43014782	43014782	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43014782delG	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						attctgcagaggggcctcaga	0.000													4	2	---	---	---	---	
ST3GAL3	6487	broad.mit.edu	37	1	44260113	44260114	+	Intron	DEL	CT	-	-	rs147940293		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44260113_44260114delCT	uc001ckc.2	+						ST3GAL3_uc009vwu.1_Intron|ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270	Q11203	SIAT6_HUMAN	sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				gcagtggaaactctgattttct	0.000													2	4	---	---	---	---	
TESK2	10420	broad.mit.edu	37	1	45897094	45897094	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45897094delA	uc001cns.1	-						TESK2_uc009vxr.1_Intron|TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_Intron|TESK2_uc010olp.1_Intron	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2						actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					tatctaaaagaaaaaaaaaaa	0.174													3	3	---	---	---	---	
MKNK1	8569	broad.mit.edu	37	1	47056095	47056096	+	Intron	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47056095_47056096delTT	uc001cqb.2	-						MKNK1_uc010omd.1_Intron|MKNK1_uc001cqc.2_Intron|MKNK1_uc009vyi.2_Intron|MKNK1_uc010ome.1_Intron|MKNK1_uc009vyj.2_Intron|MKNK1_uc001cqd.2_Intron|MKNK1_uc010omf.1_Intron	NM_003684	NP_003675	Q9BUB5	MKNK1_HUMAN	MAP kinase-interacting serine/threonine kinase 1						intracellular protein kinase cascade|peptidyl-serine phosphorylation|regulation of translation	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2	Acute lymphoblastic leukemia(166;0.155)					ttctaagcactttaccaacgct	0.153													4	2	---	---	---	---	
FAF1	11124	broad.mit.edu	37	1	51062787	51062788	+	Intron	INS	-	AAAG	AAAG	rs72395262		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51062787_51062788insAAAG	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron|FAF1_uc010onc.1_Intron	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		agtttatgggtaaagcaatgag	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	52379843	52379844	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52379843_52379844delTC								NRD1 (35234 upstream) : RAB3B (4993 downstream)																							AGCCAGGCAGTCTAACAATGTT	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56944332	56944332	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56944332delT								None (None upstream) : PPAP2B (16101 downstream)																							caataaattcttgacactaac	0.000													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57811145	57811145	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57811145delG	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						AGAACCAACAGGGGTGACTGA	0.393													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58095791	58095791	+	Intron	DEL	A	-	-	rs10889059	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58095791delA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						CATGAGACTCAAAAATAAGAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61357984	61357984	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61357984delT								C1orf87 (818558 upstream) : NFIA (184962 downstream)																							TATATGACAATTTAAAAAAAA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62079630	62079630	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62079630delA								NFIA (151171 upstream) : TM2D1 (67089 downstream)																							gtctcaaaagaaaaaaaaaaa	0.149													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62094604	62094605	+	IGR	INS	-	T	T	rs11424869		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62094604_62094605insT								NFIA (166145 upstream) : TM2D1 (52114 downstream)																							cgcccggctagttttttgtatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	63489661	63489661	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63489661delT								ATG4C (159612 upstream) : FOXD3 (299069 downstream)																							CCAGTGCCACTTTACAAATAC	0.279													4	2	---	---	---	---	
IL23R	149233	broad.mit.edu	37	1	67688204	67688204	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67688204delT	uc001ddo.2	+						IL23R_uc009waz.2_Intron|IL23R_uc001ddp.2_Intron|IL23R_uc010opi.1_Intron|IL23R_uc010opj.1_Intron|IL23R_uc010opk.1_Intron|IL23R_uc010opl.1_Intron|IL23R_uc010opm.1_Intron|IL23R_uc001ddq.2_Intron|IL23R_uc010opn.1_Intron|IL23R_uc001ddr.2_Intron|IL23R_uc010opo.1_Intron|IL23R_uc010opp.1_Intron|IL23R_uc010opq.1_Intron|IL23R_uc010opr.1_Intron|IL23R_uc010ops.1_Intron|IL23R_uc010opt.1_Intron|IL23R_uc010opu.1_Intron|IL23R_uc010opv.1_Intron|IL23R_uc010opw.1_Intron|IL23R_uc010opx.1_Intron|IL23R_uc010opy.1_Intron|IL23R_uc010opz.1_Intron|IL23R_uc010oqa.1_Intron|IL23R_uc010oqb.1_Intron|IL23R_uc010oqc.1_Intron|IL23R_uc010oqd.1_Intron|IL23R_uc010oqe.1_Intron|IL23R_uc010oqf.1_Intron|IL23R_uc010oqg.1_Intron|IL23R_uc010oqh.1_Intron|IL23R_uc001dds.2_Intron|IL23R_uc001ddt.2_Intron	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor precursor						inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						TTAGATGCCATTTTATAATAG	0.259													4	2	---	---	---	---	
WLS	79971	broad.mit.edu	37	1	68606864	68606864	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68606864delT	uc001def.1	-						uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Intron|WLS_uc001deg.1_Intron|WLS_uc009wbf.1_Intron	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 1						multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						AACAACAAGATTTCCAAATCC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68847974	68847974	+	IGR	DEL	G	-	-	rs72672567	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68847974delG								WLS (149721 upstream) : RPE65 (46533 downstream)																							ctggcttactggggaagcaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	69967495	69967495	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69967495delA								None (None upstream) : LRRC7 (65373 downstream)																							CAATAAATagaaaaaaattct	0.154													4	2	---	---	---	---	
LRRC7	57554	broad.mit.edu	37	1	70487565	70487565	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70487565delT	uc001dep.2	+						LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TCTCATTTACTTTTTATAACA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	71559724	71559724	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71559724delA	uc001dfu.1	+											Homo sapiens cDNA clone IMAGE:6592429, partial cds.																		AATGGCTGGGAAAAAAAGTCA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	73186083	73186083	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73186083delT								NEGR1 (437678 upstream) : None (None downstream)																							tgagtgaatattttttttatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	73495693	73495694	+	IGR	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73495693_73495694delCT								NEGR1 (747288 upstream) : LRRIQ3 (996010 downstream)																							CTTTAGGAGACTACAGAAACAG	0.193													4	2	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	76137736	76137736	+	Intron	DEL	A	-	-	rs113458277		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76137736delA	uc010oqz.1	-						SLC44A5_uc010orb.1_Intron|uc001dgv.2_Intron	NM_001130058	NP_001123530	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						ccaactatccacccaaaaaag	0.040													4	4	---	---	---	---	
AK5	26289	broad.mit.edu	37	1	77880787	77880787	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77880787delA	uc001dhn.2	+						AK5_uc001dho.2_Intron	NM_174858	NP_777283	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1						AGACTCTGTCAAAAAAAAACA	0.323													4	2	---	---	---	---	
NEXN	91624	broad.mit.edu	37	1	78393288	78393291	+	Intron	DEL	TGTG	-	-	rs61778872	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78393288_78393291delTGTG	uc001dic.3	+						NEXN_uc001dia.3_Intron|NEXN_uc009wcb.1_Intron|NEXN_uc001dib.3_Intron|NEXN_uc001did.1_Intron|NEXN_uc001dif.1_Intron	NM_144573	NP_653174	Q0ZGT2	NEXN_HUMAN	nexilin (F actin binding protein)						regulation of cell migration|regulation of cytoskeleton organization	cytoskeleton|Z disc	actin filament binding|structural constituent of muscle			ovary(2)	2				Colorectal(170;0.114)		tgtgtgtgtctgtgtgtgtgtgtg	0.078													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	78909170	78909171	+	IGR	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78909170_78909171delGT								MGC27382 (74025 upstream) : PTGFR (47557 downstream)																							AGAGACCTGAGTGTGTGTGTAT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	79035501	79035501	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79035501delT								PTGFR (29116 upstream) : IFI44L (50587 downstream)																							tgtagcgtacttactacatag	0.114													4	2	---	---	---	---	
IFI44L	10964	broad.mit.edu	37	1	79101997	79101997	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79101997delA	uc010oro.1	+						IFI44L_uc010orp.1_Intron|IFI44L_uc010orq.1_Intron	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like							cytoplasm					0						ccagtcagggaaaaggagaca	0.000													4	2	---	---	---	---	
ELTD1	64123	broad.mit.edu	37	1	79404219	79404220	+	Intron	INS	-	A	A	rs149043950	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79404219_79404220insA	uc001diq.3	-							NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain						neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		ATAATTTTTTTAAATGAGCTTT	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80719812	80719812	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80719812delC								None (None upstream) : None (None downstream)																							aagtcaaactccccattgaga	0.060													4	2	---	---	---	---	
LPHN2	23266	broad.mit.edu	37	1	82119008	82119009	+	Intron	INS	-	G	G	rs71868393		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82119008_82119009insG	uc001dis.2	+									O95490	LPHN2_HUMAN	SubName: Full=cDNA FLJ41428 fis, clone BRHIP2005236, highly similar to Latrophilin-2;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		ctttagggtttttttttttttc	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	82740916	82740916	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82740916delA								LPHN2 (282810 upstream) : None (None downstream)																							GCTCAAATGGAAGTCTAGAAA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	83133056	83133056	+	IGR	DEL	A	-	-	rs72319200		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83133056delA								LPHN2 (674950 upstream) : None (None downstream)																							ccatgtactgaaaaaggatgt	0.000													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	84760387	84760387	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84760387delT								PRKACB (56208 upstream) : SAMD13 (3662 downstream)																							catataaatgtttacactata	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	86789368	86789368	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86789368delT								COL24A1 (166922 upstream) : ODF2L (25044 downstream)																							agctgggatattttctgACTC	0.134													4	2	---	---	---	---	
GBP6	163351	broad.mit.edu	37	1	89826655	89826656	+	5'Flank	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89826655_89826656delAC	uc001dnf.2	+						GBP6_uc010ost.1_5'Flank	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6								GTP binding|GTPase activity			ovary(2)	2		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		tctctcacagacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90530924	90530925	+	IGR	INS	-	AAG	AAG	rs143657087	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90530924_90530925insAAG								ZNF326 (36830 upstream) : BARHL2 (646655 downstream)																							GATGCtaaagaaagaccaattt	0.173													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	91323656	91323656	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91323656delA								BARHL2 (140862 upstream) : ZNF644 (57204 downstream)																							TAGGCTAGGCAAAAAAAATTG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	93752542	93752542	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93752542delA	uc001dps.2	-											Homo sapiens cDNA FLJ42965 fis, clone BRSTN2014751.																		gactgtctacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	98622242	98622242	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98622242delT								MIR137 (110515 upstream) : SNX7 (504994 downstream)																							TTTTCTTGTCTTAGTTCTCAG	0.259													4	2	---	---	---	---	
SLC35A3	23443	broad.mit.edu	37	1	100460661	100460664	+	Intron	DEL	TTTC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100460661_100460664delTTTC	uc001dsp.1	+						SLC35A3_uc001dsq.1_Intron|SLC35A3_uc009wdy.1_Intron|SLC35A3_uc001dsr.1_Intron|SLC35A3_uc001dss.1_Intron	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A						UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		ttttgtgtattttctttctttctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	102801181	102801182	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102801181_102801182insT								OLFM3 (338391 upstream) : COL11A1 (540842 downstream)																							CTCTGACAGAATTTTTTTTTTT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	102846394	102846394	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102846394delT								OLFM3 (383604 upstream) : COL11A1 (495630 downstream)																							TCACATATTCTTTTAACTAAT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	106472858	106472858	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106472858delC								None (None upstream) : None (None downstream)																							ttgtaatttaccctttatcac	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	106479142	106479142	+	IGR	DEL	T	-	-	rs71815353		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106479142delT								None (None upstream) : None (None downstream)																							tatatcacgatttttttttaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	107301175	107301176	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107301175_107301176insC								None (None upstream) : PRMT6 (298091 downstream)																							ACCCCTTCCTGCCCAGCCAATC	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	107315085	107315085	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107315085delA								None (None upstream) : PRMT6 (284182 downstream)																							CCATCCTAACAAAAAAAAAGC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110275277	110275278	+	IGR	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110275277_110275278delCT								GSTM5 (14389 upstream) : GSTM3 (1276 downstream)																							ATCCCTGTCCCTCTCTCCTTTC	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	110523934	110523934	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110523934delC								CSF1 (51580 upstream) : AHCYL1 (3374 downstream)																							CTGCACCCCACCCCCATCACC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	112561986	112561986	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112561986delT								KCND3 (30209 upstream) : CTTNBP2NL (376814 downstream)																							ctgctctatattttttttcca	0.000													4	2	---	---	---	---	
ST7L	54879	broad.mit.edu	37	1	113119845	113119845	+	Intron	DEL	A	-	-	rs71775909		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113119845delA	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron|ST7L_uc010owi.1_Intron|ST7L_uc001ech.2_Intron|ST7L_uc001eci.2_Intron|ST7L_uc009wgi.1_Intron|ST7L_uc010owj.1_Intron	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGGACTAACaaaaaaaaaaa	0.174													8	5	---	---	---	---	
ST7L	54879	broad.mit.edu	37	1	113127117	113127117	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113127117delT	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron|ST7L_uc010owi.1_Intron|ST7L_uc001ech.2_Intron|ST7L_uc001eci.2_Intron|ST7L_uc009wgi.1_Intron|ST7L_uc010owj.1_Intron	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCATACCTGCttttttttttg	0.189													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	115698993	115698993	+	IGR	DEL	A	-	-	rs59265352		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115698993delA								TSPAN2 (66878 upstream) : NGF (129544 downstream)																							TAAGGGGAACAGAAACAGATC	0.299													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	115821044	115821044	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115821044delG								TSPAN2 (188929 upstream) : NGF (7493 downstream)																							CTCCTGACATGGTTTGACTAC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118866684	118866684	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118866684delT								SPAG17 (138836 upstream) : TBX15 (558982 downstream)																							ATTAATTCTCTTACATTCTAC	0.209													4	2	---	---	---	---	
WARS2	10352	broad.mit.edu	37	1	119665656	119665657	+	Intron	DEL	AT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119665656_119665657delAT	uc001ehn.2	-						WARS2_uc010oxf.1_Intron|WARS2_uc001ehm.2_Intron|WARS2_uc010oxg.1_Intron|WARS2_uc010oxh.1_Intron|WARS2_uc010oxi.1_Intron	NM_015836	NP_056651	Q9UGM6	SYWM_HUMAN	mitochondrial tryptophanyl tRNA synthetase 2						tryptophanyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|tryptophan-tRNA ligase activity				0	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	ttgagaatgcatatacgcattt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121315294	121315294	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121315294delT								LOC647121 (1608 upstream) : None (None downstream)																							TCTTTCTTTCTTTTTTTTTTT	0.229													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142559133	142559133	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142559133delG								None (None upstream) : None (None downstream)																							GGATTATAAAGATGATTCCAT	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142602781	142602781	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142602781delT								None (None upstream) : None (None downstream)																							ttaggttttatcaaggtaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142686987	142686989	+	Intron	DEL	CTT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142686987_142686989delCTT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		atctcatgtccttctcacattgc	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142729354	142729354	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142729354delA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		CTCAGGTCTTAAGAGTATGTT	0.393													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142901691	142901692	+	Intron	INS	-	T	T	rs148238158	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142901691_142901692insT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		ctaaaatttcctttttttgttg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	144013173	144013173	+	Intron	DEL	T	-	-	rs5780318		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144013173delT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		GTGAAAAAAATCTCTTTCCAA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	144071773	144071773	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144071773delA	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		AATCCTACACAAAAatttgac	0.184													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144530876	144530877	+	Intron	INS	-	CC	CC	rs72257362		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144530876_144530877insCC	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						cttaactgaggcctctctctct	0.000													7	4	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144533512	144533514	+	Intron	DEL	AAG	-	-	rs66523280		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144533512_144533514delAAG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						cgtatgtgaaaagaaccgttttt	0.172													3	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145014535	145014536	+	Intron	DEL	CT	-	-	rs143267591		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145014535_145014536delCT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TAGAATTTTACTTTTTTTTTTT	0.327			T	PDGFRB	MPD								4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145054505	145054505	+	Intron	DEL	G	-	-	rs11296748		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145054505delG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						actgaagtatgCTAGCAATAT	0.174													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148849428	148849430	+	IGR	DEL	TCG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148849428_148849430delTCG								NBPF16 (91117 upstream) : LOC645166 (78856 downstream)																							tcttttcatctcgtcatttcatt	0.000													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148849748	148849752	+	IGR	DEL	TCATT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148849748_148849752delTCATT								NBPF16 (91437 upstream) : LOC645166 (78534 downstream)																							tttcatctcgtcatttcatttcatc	0.000													4	3	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151200077	151200077	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151200077delT	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTAAATGAGATTTTTTTTggc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152021846	152021847	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152021846_152021847delTG								S100A11 (12335 upstream) : TCHHL1 (34773 downstream)																							ttgcttattttgtgtgtgtgtg	0.000													5	3	---	---	---	---	
ADAR	103	broad.mit.edu	37	1	154559439	154559439	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154559439delA	uc001ffh.2	-						ADAR_uc001ffj.2_Intron|ADAR_uc001ffi.2_Intron|ADAR_uc001ffk.2_Intron	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a						adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		AAAAAAAAACAaaaaaaaatg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	156476191	156476191	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156476191delT								MEF2D (5662 upstream) : IQGAP3 (19007 downstream)																							tcagatgcaattttttttctg	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157215661	157215662	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157215661_157215662delTC								ETV3 (107278 upstream) : FCRL5 (267506 downstream)																							tctctctctttctctctctctc	0.406													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157587658	157587658	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157587658delG								FCRL4 (19788 upstream) : FCRL3 (58620 downstream)																							ccatcacactgggctttagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159069287	159069287	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159069287delT								AIM2 (22640 upstream) : CADM3 (72090 downstream)																							ACCTACTTTGTTTTTTTTCCC	0.348													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159480230	159480230	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159480230delG								OR10J1 (69720 upstream) : OR10J5 (24640 downstream)																							AGTATCCTCTGGAAAAAAAAG	0.438													4	2	---	---	---	---	
NHLH1	4807	broad.mit.edu	37	1	160341681	160341681	+	3'UTR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160341681delA	uc001fwa.2	+	2						NM_005598	NP_005589	Q02575	HEN1_HUMAN	nescient helix loop helix 1						cell differentiation|central nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	all_cancers(52;7.11e-19)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GTCACTAGAGAAAAAAAAAAA	0.488													3	3	---	---	---	---	
SDHC	6391	broad.mit.edu	37	1	161310139	161310140	+	Intron	INS	-	TTTGC	TTTGC	rs140670104	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161310139_161310140insTTTGC	uc001gag.2	+						SDHC_uc001gai.2_Intron|SDHC_uc001gaj.2_Intron|SDHC_uc001gak.2_Intron|SDHC_uc001gah.2_Intron	NM_003001	NP_002992	Q99643	C560_HUMAN	succinate dehydrogenase complex, subunit C						respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II|plasma membrane succinate dehydrogenase complex	electron carrier activity|heme binding|succinate dehydrogenase activity				0	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Succinic acid(DB00139)	ttttgttttgttttgttttgtt	0.124			Mis|N|F			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome				12	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	164904672	164904672	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164904672delA								PBX1 (50372 upstream) : LMX1A (266433 downstream)																							CCCTGCAGAGAAAAAAAATCA	0.343													4	2	---	---	---	---	
RXRG	6258	broad.mit.edu	37	1	165402157	165402157	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165402157delC	uc001gda.2	-							NM_006917	NP_008848	P48443	RXRG_HUMAN	retinoid X receptor, gamma isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tretinoin(DB00755)	gtgtgtccctccaaaatttgt	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	170754321	170754321	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170754321delA								PRRX1 (45781 upstream) : C1orf129 (150291 downstream)																							tattaaaaagaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	172731337	172731337	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172731337delT								FASLG (95327 upstream) : TNFSF18 (279023 downstream)																							CCTTCTTGCATTTTTTTTTCC	0.373													4	2	---	---	---	---	
TNFSF4	7292	broad.mit.edu	37	1	173156194	173156194	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173156194delA	uc001giw.2	-						TNFSF4_uc001giv.2_Intron	NM_003326	NP_003317	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily,						acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1						tgtctcaaacaaaaaaaaaaa	0.244													6	6	---	---	---	---	
RABGAP1L	9910	broad.mit.edu	37	1	174856750	174856750	+	Intron	DEL	G	-	-	rs36031364		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174856750delG	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron|RABGAP1L_uc001gke.3_Intron|RABGAP1L_uc001gkf.2_Intron|RABGAP1L_uc001gkg.2_Intron|RABGAP1L_uc001gkh.3_Intron	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						GCAAAAACTTGGGGGGGGGgt	0.219													3	3	---	---	---	---	
RABGAP1L	9910	broad.mit.edu	37	1	174859211	174859211	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174859211delA	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron|RABGAP1L_uc001gke.3_Intron|RABGAP1L_uc001gkf.2_Intron|RABGAP1L_uc001gkg.2_Intron|RABGAP1L_uc001gkh.3_Intron	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						ACAAACGAACAAAAAAATGCA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	175257917	175257918	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175257917_175257918insA								KIAA0040 (95688 upstream) : TNR (34017 downstream)																							ttgcttgtgttaaaaaaaaaat	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	175876823	175876824	+	IGR	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175876823_175876824delAA								TNR (164071 upstream) : RFWD2 (37143 downstream)																							cttcatctcgaaaaaaaaaaag	0.000													4	2	---	---	---	---	
TOR3A	64222	broad.mit.edu	37	1	179064540	179064540	+	3'UTR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179064540delT	uc001gmd.2	+	6					TOR3A_uc010pnd.1_3'UTR	NM_022371	NP_071766	Q9H497	TOR3A_HUMAN	torsin family 3, member A precursor						chaperone mediated protein folding requiring cofactor	endoplasmic reticulum	ATP binding			pancreas(1)	1						ATCCTTTTTCTTTTTTTtgga	0.338													4	2	---	---	---	---	
TDRD5	163589	broad.mit.edu	37	1	179607363	179607363	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179607363delT	uc001gnf.1	+						TDRD5_uc010pnp.1_Intron|TDRD5_uc001gnh.1_Intron	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5						DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						TGAAGATCTATTAGTGGACTA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181819687	181819687	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181819687delA								CACNA1E (48974 upstream) : ZNF648 (204020 downstream)																							aagaatagggaaaaaaaagaa	0.000													4	2	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183155716	183155716	+	Intron	DEL	T	-	-	rs79122995		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183155716delT	uc001gqa.2	+						LAMC2_uc001gpz.3_Intron|LAMC2_uc010poa.1_Intron	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						CTGGGGCTCCTCCAGAGACGG	0.433													0	7	---	---	---	---	
RGL1	23179	broad.mit.edu	37	1	183806350	183806350	+	Intron	DEL	T	-	-	rs34416951		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183806350delT	uc001gqo.2	+						RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron|RGL1_uc010poi.1_Intron	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						TATGGCATGCTGGGAAAGCTT	0.512													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	188219129	188219129	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188219129delT								None (None upstream) : None (None downstream)																							CATCTTTTTGTTTTTTTTTCC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	188705182	188705182	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188705182delA								None (None upstream) : None (None downstream)																							tactaTCTTCAAAAAAAATTA	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	190706114	190706115	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190706114_190706115insT								FAM5C (259355 upstream) : None (None downstream)																							AAATTTTCAGATTTTTTTTCTC	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	192730170	192730170	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192730170delA								RGS13 (100783 upstream) : RGS2 (47999 downstream)																							tctttctagtaggatcaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	193426752	193426752	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193426752delT								CDC73 (202812 upstream) : None (None downstream)																							ATCACTTTTGTTTTTTTTTCC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	194574803	194574803	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194574803delT								None (None upstream) : None (None downstream)																							ttcccaatcattttttttctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	194836085	194836086	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194836085_194836086insT								None (None upstream) : None (None downstream)																							ACTCACTTGAGTTTTTTTTTTG	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	195654363	195654364	+	IGR	INS	-	GC	GC	rs71778715		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195654363_195654364insGC								None (None upstream) : KCNT2 (540549 downstream)																							TTtgtgtgtgtgtgtgtgtgtg	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	196116661	196116662	+	IGR	INS	-	AC	AC			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196116661_196116662insAC								None (None upstream) : KCNT2 (78251 downstream)																							CAACAACAACAAAAAAAACAGA	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205413628	205413629	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205413628_205413629delTC								LEMD1 (22447 upstream) : MIR135B (3801 downstream)																							GACCCCCACATCTCTCTGTGCC	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207046529	207046529	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207046529delC								IL20 (3962 upstream) : IL24 (24260 downstream)																							TCCCTCATTTCCACCATGGCT	0.264													4	2	---	---	---	---	
PLXNA2	5362	broad.mit.edu	37	1	208388880	208388891	+	Intron	DEL	GAAGGGATGGAG	-	-	rs113737048		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208388880_208388891delGAAGGGATGGAG	uc001hgz.2	-						PLXNA2_uc001hha.3_Intron	NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		agagatggatgaagggatggaggaagggatgg	0.047													4	2	---	---	---	---	
TMEM206	55248	broad.mit.edu	37	1	212573961	212573962	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212573961_212573962insA	uc001hjc.3	-						TMEM206_uc010pte.1_Intron	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206							integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TACTTTATCATAAAAAAAAAAC	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214433492	214433492	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214433492delG								PROX1 (223732 upstream) : SMYD2 (21073 downstream)																							cagagatcttggtttgctcac	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214521013	214521013	+	IGR	DEL	T	-	-	rs34432406		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214521013delT								SMYD2 (10536 upstream) : PTPN14 (9998 downstream)																							TTTAGTTTTGTGGGGAATTAT	0.333													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215164459	215164459	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215164459delT								CENPF (326547 upstream) : KCNK2 (14426 downstream)																							aaattctcccttttttttgtg	0.000													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	216249865	216249865	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216249865delT	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTTGTTTTTATTTTTTTTTTC	0.373										HNSCC(13;0.011)			3	3	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	216443859	216443859	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216443859delT	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CATTGTTCTATACATCCACAA	0.358										HNSCC(13;0.011)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	217392343	217392344	+	IGR	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217392343_217392344delTT								ESRRG (81246 upstream) : GPATCH2 (211490 downstream)																							TACAGAGTTCTTTTTAAAATCA	0.366													4	2	---	---	---	---	
GPATCH2	55105	broad.mit.edu	37	1	217736194	217736194	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217736194delA	uc001hlf.1	-							NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN	G patch domain containing 2							intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		CTTGGCACCCAAAAAAACAGT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	220574656	220574657	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220574656_220574657insT								RAB3GAP2 (128813 upstream) : MARK1 (126911 downstream)																							gtttatcaatcttttttttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221494740	221494740	+	IGR	DEL	T	-	-	rs76278745		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221494740delT								HLX (436342 upstream) : LOC400804 (8530 downstream)																							AATGTTTCTATTTTTTTTTCC	0.313													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223334022	223334022	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223334022delT								TLR5 (17398 upstream) : SUSD4 (60141 downstream)																							TTTCTTCCTCTTTTTTTTTTG	0.229													2	6	---	---	---	---	
DNAH14	127602	broad.mit.edu	37	1	225188168	225188168	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225188168delT	uc001how.2	+						DNAH14_uc001hou.3_Intron|DNAH14_uc001hot.3_Intron	NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						tcttcaagtattttttttttt	0.000													4	3	---	---	---	---	
DNAH14	127602	broad.mit.edu	37	1	225370499	225370499	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225370499delG	uc001how.2	+							NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						gactcactgtggaccagaaag	0.000													4	2	---	---	---	---	
ITPKB	3707	broad.mit.edu	37	1	226828945	226828945	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226828945delA	uc010pvo.1	-							NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B								ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				CATGTATAGGAAGCTTCTGTG	0.428													4	2	---	---	---	---	
PSEN2	5664	broad.mit.edu	37	1	227057269	227057269	+	5'Flank	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227057269delG	uc009xeo.1	+						PSEN2_uc009xep.1_5'Flank	NM_000447	NP_000438	P49810	PSN2_HUMAN	presenilin 2 isoform 1						amyloid precursor protein catabolic process|anti-apoptosis|apoptosis|beta-amyloid metabolic process|calcium ion transport|induction of apoptosis by extracellular signals|intracellular signal transduction|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear inner membrane|perinuclear region of cytoplasm|Z disc	aspartic-type endopeptidase activity|protein binding			lung(2)	2		Prostate(94;0.0771)				acatgtacatgcatgttcatg	0.000													4	2	---	---	---	---	
TSNAX-DISC1	100303453	broad.mit.edu	37	1	231735585	231735586	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231735585_231735586insA	uc010pwg.1	+						TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron	NM_001012959	NP_001012977			disrupted in schizophrenia 1 isoform S												0						AACCAAAAAGTAAAAAAAACTC	0.361													4	2	---	---	---	---	
SLC35F3	148641	broad.mit.edu	37	1	234098609	234098609	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234098609delT	uc001hvy.1	+							NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			GAATATTGCATTTTTTGGCAT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	235046128	235046128	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235046128delT								IRF2BP2 (300857 upstream) : TOMM20 (226532 downstream)																							attctagctatttttttaatg	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240083445	240083445	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240083445delA								CHRM3 (10730 upstream) : FMN2 (171740 downstream)																							tcctacatgcaaaaaaaatct	0.000													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241413767	241413767	+	Intron	DEL	T	-	-	rs112899877		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241413767delT	uc001hyv.2	-						RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TATTGTGGGATTTTTTTTTTT	0.333													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	244288918	244288918	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244288918delT								ZNF238 (68142 upstream) : C1orf100 (227019 downstream)																							ctgagacctgttttaggtcct	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	245904034	245904035	+	IGR	INS	-	A	A	rs143886741	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245904034_245904035insA								KIF26B (37606 upstream) : SMYD3 (8610 downstream)																							tgggaggagggagaggaacagg	0.000													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2465172	2465173	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2465172_2465173insC								MYT1L (130127 upstream) : TSSC1 (727568 downstream)																							TCATCATGTCGCCCCCAAGCAC	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7663241	7663241	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7663241delC								RNF144A (478934 upstream) : LOC339788 (399317 downstream)																							CTTCCTTTCTCCAGTTCATCT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7805078	7805080	+	IGR	DEL	ATC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7805078_7805080delATC								RNF144A (620771 upstream) : LOC339788 (257478 downstream)																							TTctgactatatcattagggcta	0.236													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	9290493	9290493	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9290493delT								MBOAT2 (146617 upstream) : ASAP2 (56401 downstream)																							ttgataaagatttttttttta	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	14018597	14018598	+	IGR	DEL	CT	-	-	rs72536429		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14018597_14018598delCT								None (None upstream) : FAM84A (754258 downstream)																							CAATTCCCCCCTGTCTTTGAGC	0.411													3	7	---	---	---	---	
NBAS	51594	broad.mit.edu	37	2	15331567	15331567	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15331567delC	uc002rcc.1	-						NBAS_uc002rcb.1_Intron|NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4						CACACAGTGACCCACCAGATC	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17136481	17136481	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17136481delA								FAM49A (289385 upstream) : RAD51AP2 (555505 downstream)																							GTGCCTACTCAAAAAAAATAT	0.194													4	2	---	---	---	---	
SMC6	79677	broad.mit.edu	37	2	17872224	17872225	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17872224_17872225insA	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					tttatactactaaaaaaaaaac	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19723989	19723989	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19723989delT								OSR1 (165617 upstream) : TTC32 (372529 downstream)																							accttacctcttactctaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22484540	22484541	+	IGR	DEL	AT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22484540_22484541delAT								None (None upstream) : None (None downstream)																							atgttgtggaatagtgtcaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22521625	22521625	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22521625delA								None (None upstream) : None (None downstream)																							ACTAGTAAAGAAAAAAAAAAA	0.308													4	3	---	---	---	---	
CENPO	79172	broad.mit.edu	37	2	25035267	25035267	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25035267delT	uc002rfo.1	+						CENPO_uc002rfn.2_Intron|CENPO_uc002rfp.1_Intron|CENPO_uc002rfq.1_Intron	NM_024322	NP_077298	Q9BU64	CENPO_HUMAN	centromere protein O						cell division|CenH3-containing nucleosome assembly at centromere|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					ctaagcatgattttttttttt	0.000													4	4	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28509231	28509231	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28509231delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					TGGTGTGAGCTTTTTTCCCTA	0.423													4	2	---	---	---	---	
BRE	9577	broad.mit.edu	37	2	28521683	28521683	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28521683delA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|BRE_uc002rlx.2_Intron	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GTTGGTCTCTAAAATTAGCCA	0.269													4	2	---	---	---	---	
CLIP4	79745	broad.mit.edu	37	2	29364616	29364617	+	Intron	INS	-	T	T	rs3100223	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29364616_29364617insT	uc002rmv.2	+						CLIP4_uc002rmu.2_Intron|CLIP4_uc010ezm.1_Intron|CLIP4_uc002rmw.2_Intron|CLIP4_uc010ymn.1_Intron	NM_024692	NP_078968	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family,											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					gacaagtcttctttttttttaa	0.000													4	2	---	---	---	---	
ALK	238	broad.mit.edu	37	2	29674335	29674336	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29674335_29674336delAC	uc002rmy.2	-							NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	ACATTCTCCTACACACACACAA	0.455			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30903551	30903551	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30903551delC								LCLAT1 (36461 upstream) : CAPN13 (42089 downstream)																							gacagaagagcaggtcagagg	0.000													4	2	---	---	---	---	
BIRC6	57448	broad.mit.edu	37	2	32648014	32648015	+	Intron	INS	-	TTA	TTA			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32648014_32648015insTTA	uc010ezu.2	+							NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					tctctatttttttatttttgag	0.000													4	2	---	---	---	---	
RASGRP3	25780	broad.mit.edu	37	2	33659278	33659278	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33659278delT	uc002rox.2	+						RASGRP3_uc002row.1_5'Flank	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and						MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					tctctttttctttttttctct	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34868445	34868446	+	IGR	INS	-	AAAAG	AAAAG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34868445_34868446insAAAAG								MYADML (915161 upstream) : None (None downstream)																							TGTAGCCATAAAAAAGAAAAGA	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	35250360	35250361	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35250360_35250361delCA								None (None upstream) : None (None downstream)																							TTTACACTTGCACACACACACA	0.213													4	3	---	---	---	---	
SULT6B1	391365	broad.mit.edu	37	2	37421321	37421322	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37421321_37421322insT	uc002rpv.2	-						SULT6B1_uc010fae.1_Intron|SULT6B1_uc010faf.1_Intron|SULT6B1_uc002rpw.2_Intron|SULT6B1_uc010fag.1_Intron|uc002rpx.1_5'Flank			Q6IMI4	ST6B1_HUMAN	Homo sapiens sulfotransferase SULT6B1 (SULT6B1) mRNA, partial 5'UTR; alternate transcript.							cytoplasm	sulfotransferase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(82;0.248)				CTGTCTGTAGAttttttttttt	0.149													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38701185	38701185	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38701185delA								ATL2 (96753 upstream) : HNRPLL (89143 downstream)																							TTAATTCTTCAAAAAAAAAAA	0.343													4	2	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39082580	39082591	+	Intron	DEL	CAATCAAAAGGA	-	-	rs72020623		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39082580_39082591delCAATCAAAAGGA	uc002rrf.2	-						DHX57_uc002rrd.3_5'Flank|DHX57_uc002rre.2_Intron|DHX57_uc002rrg.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				ATTTGCACTCCAATCAAAAGGACAATCAAATA	0.311													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	40316610	40316610	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40316610delA	uc002rrw.2	+											Homo sapiens cDNA clone IMAGE:5223469, partial cds.																		gggacatactaaaaaatttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41636714	41636714	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41636714delA								SLC8A1 (897139 upstream) : PKDCC (638447 downstream)																							attttccttgaaaaaactgaA	0.015													4	2	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42794138	42794138	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42794138delG	uc002rso.1	+						MTA3_uc002rsp.1_5'Flank|MTA3_uc002rsq.2_5'Flank|MTA3_uc002rsr.2_5'Flank	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TGTTTTTGGTGGGATCTCTGG	0.279													4	2	---	---	---	---	
C2orf34	79823	broad.mit.edu	37	2	44734674	44734674	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44734674delT	uc002rum.2	+							NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				TTTCATCTCATTTTTTTCTTG	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	47027118	47027118	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47027118delT								SOCS5 (37192 upstream) : LOC100134259 (27885 downstream)																							TATAGTGTAGTTTTTTTTTTA	0.294													4	2	---	---	---	---	
MSH2	4436	broad.mit.edu	37	2	47736172	47736172	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47736172delT	uc002rvz.2	+							NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding			large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			cttctgctggttttttttgct	0.144			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	48175809	48175810	+	IGR	INS	-	AATC	AATC	rs77142003		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48175809_48175810insAATC								FBXO11 (42995 upstream) : FOXN2 (365985 downstream)																							TAAACGTGCTTAATTAATCTCA	0.391													3	6	---	---	---	---	
FSHR	2492	broad.mit.edu	37	2	49343222	49343223	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49343222_49343223insT	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	agatcttggcattttttttagt	0.000									Gonadal_Dysgenesis_46_XX				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	50001621	50001621	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50001621delA								FSHR (619991 upstream) : NRXN1 (144023 downstream)																							CCAGAAAAAGAAAAAAAAGCA	0.358													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50655051	50655051	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50655051delA	uc010fbq.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTTGAAACTTAAAAGATCAAG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	51555266	51555267	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51555266_51555267insT								NRXN1 (295592 upstream) : None (None downstream)																							ACTTTCCACCATTTTTTTTTCA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52961768	52961768	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52961768delA								None (None upstream) : ASB3 (935350 downstream)																							AGTGAAAAACAAAAAAAAGTG	0.423													4	2	---	---	---	---	
ASB3	51130	broad.mit.edu	37	2	53985148	53985149	+	Intron	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53985148_53985149delAG	uc002rxg.1	-						ASB3_uc002rxh.1_Intron|ASB3_uc002rxi.3_Intron|ASB3_uc010yoo.1_Intron	NM_016115	NP_057199	Q9Y575	ASB3_HUMAN	ankyrin repeat and SOCS box-containing protein 3						intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			gagaagagacagagagagagag	0.163													4	2	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54712334	54712334	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54712334delG	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			tctccctctcggtctccctct	0.070													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60057355	60057355	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60057355delA								None (None upstream) : BCL11A (620948 downstream)																							CCGTTGGGAGAAAAAAAAAAT	0.428													9	4	---	---	---	---	
COMMD1	150684	broad.mit.edu	37	2	62260336	62260336	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62260336delT	uc002sbp.2	+							NM_152516	NP_689729	Q8N668	COMD1_HUMAN	MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			AAGAAATTAATTTTACCAGAC	0.284													4	2	---	---	---	---	
B3GNT2	10678	broad.mit.edu	37	2	62427419	62427419	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62427419delT	uc002sbs.2	+							NM_006577	NP_006568	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal							Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)	1	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			CATCTATAACTTAAAAAAAAC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	62707834	62707834	+	IGR	DEL	A	-	-	rs79920740		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62707834delA								B3GNT2 (255970 upstream) : TMEM17 (19522 downstream)																							gccccttcgtaaaaaaaaatc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65198474	65198474	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65198474delA								SERTAD2 (317428 upstream) : SLC1A4 (17105 downstream)																							actttctcttaaaaaaaaaTA	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66354287	66354288	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66354287_66354288insC								SPRED2 (694631 upstream) : MEIS1 (308244 downstream)																							GGACCTTTTGGCCCCCAGTTTC	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66556894	66556895	+	IGR	INS	-	A	A	rs150147317	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66556894_66556895insA								SPRED2 (897238 upstream) : MEIS1 (105637 downstream)																							TATACAATGGGAAAAAAAAATC	0.371													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67152746	67152746	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67152746delA								MEIS1 (352856 upstream) : ETAA1 (471696 downstream)																							GCCATGCAGGAAAAAAAGGAC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67299231	67299231	+	IGR	DEL	T	-	-	rs75036858		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67299231delT								MEIS1 (499341 upstream) : ETAA1 (325211 downstream)																							TCTTTCATTGTTCTGTCTCTT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67436155	67436155	+	Intron	DEL	T	-	-	rs11312221		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67436155delT	uc002sdx.2	+						uc002sdy.1_Intron					Homo sapiens, clone IMAGE:5541055, mRNA.																		GAAGGATCTATTTTTTTTCAT	0.313													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	68098353	68098353	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68098353delA								ETAA1 (460820 upstream) : C1D (170980 downstream)																							aataaactgtatccattCCCA	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	68404210	68404212	+	IGR	DEL	AGT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68404210_68404212delAGT								PNO1 (1121 upstream) : PPP3R1 (1777 downstream)																							CCTGTTCCCCAGTAGTAGTAGTA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	72018551	72018552	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72018551_72018552insA								DYSF (104659 upstream) : CYP26B1 (337815 downstream)																							GGGCCCCCTTTGGGGAACTAGC	0.579													4	2	---	---	---	---	
EXOC6B	23233	broad.mit.edu	37	2	72803475	72803475	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72803475delA	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						CCTTCAGCTTAAAAAAAAATA	0.343													4	2	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	76994821	76994822	+	Intron	DEL	TC	-	-	rs66805256		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76994821_76994822delTC	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		attttctctttcttttacttct	0.243													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78523001	78523002	+	IGR	INS	-	T	T	rs141877786	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78523001_78523002insT								SNAR-H (340849 upstream) : REG3G (729824 downstream)																							TTCATGGTGTATTTTTTTTTTC	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	79265503	79265504	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79265503_79265504insA								REG3G (9873 upstream) : REG1B (46645 downstream)																							CTCATTGATACAAAATGGCCAC	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	83064293	83064294	+	IGR	INS	-	T	T	rs142217417	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83064293_83064294insT								None (None upstream) : None (None downstream)																							tgtttttatacgctatcatact	0.144													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	83860512	83860512	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83860512delA								None (None upstream) : FUNDC2P2 (657294 downstream)																							gtcaacaagcaaaaaaaaaca	0.000													6	4	---	---	---	---	
REEP1	65055	broad.mit.edu	37	2	86459280	86459281	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86459280_86459281insT	uc002srh.3	-						REEP1_uc010ytg.1_Intron|REEP1_uc010yth.1_Intron|REEP1_uc010yti.1_Intron	NM_022912	NP_075063	Q9H902	REEP1_HUMAN	receptor accessory protein 1 isoform 2						cell death|protein insertion into membrane	integral to membrane|mitochondrial membrane	olfactory receptor binding				0						AGACAGCAGAGTGAGAGAGAGG	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90475303	90475303	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90475303delC								None (None upstream) : None (None downstream)																							ctctctcactctctctctctc	0.015													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90479146	90479147	+	IGR	DEL	TT	-	-	rs71276607		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90479146_90479147delTT								None (None upstream) : None (None downstream)																							caggctggtctttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91625671	91625672	+	IGR	DEL	AT	-	-	rs4005753		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91625671_91625672delAT								None (None upstream) : LOC654342 (179520 downstream)																							tatattaaacatagaattgtca	0.040													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91872179	91872181	+	IGR	DEL	TTT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91872179_91872181delTTT								LOC654342 (24204 upstream) : GGT8P (91187 downstream)																							CCAAGTATCAttttttttttttt	0.355													3	3	---	---	---	---	
PROM2	150696	broad.mit.edu	37	2	95938082	95938082	+	5'Flank	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95938082delA	uc002suh.1	+						PROM2_uc002sui.2_5'Flank|PROM2_uc002suj.2_5'Flank|PROM2_uc002suk.2_5'Flank|PROM2_uc002sul.2_5'Flank	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor							apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						CCAAGTCTCCAAGGGCTTTTA	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	101847205	101847205	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101847205delT								TBC1D8 (79359 upstream) : C2orf29 (22140 downstream)																							GGTGTTATTCTTCTTAGCCCC	0.448													4	2	---	---	---	---	
IL1R1	3554	broad.mit.edu	37	2	102691963	102691964	+	Intron	INS	-	AA	AA			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102691963_102691964insAA	uc010fix.2	+							NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor						innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	CCAGTTATTTGAAAAAAAAATT	0.307													4	2	---	---	---	---	
IL18R1	8809	broad.mit.edu	37	2	102997129	102997130	+	Intron	INS	-	ACTG	ACTG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102997129_102997130insACTG	uc002tbw.3	+						IL18R1_uc010ywc.1_Intron|IL18R1_uc010ywd.1_Intron|IL18R1_uc010fiy.2_Intron	NM_003855	NP_003846	Q13478	IL18R_HUMAN	interleukin 18 receptor 1 precursor						innate immune response	integral to membrane|plasma membrane	interleukin-1 receptor activity			ovary(2)|pancreas(1)	3						CTCACTCTGGCACTGCACTTTC	0.550													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	104543609	104543610	+	IGR	DEL	TG	-	-	rs150848102		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104543609_104543610delTG								None (None upstream) : LOC150568 (507195 downstream)																							TAAAAAAAATtgtgtgtgtgtg	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106082273	106082273	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106082273delA								FHL2 (27043 upstream) : NCK2 (279081 downstream)																							actccatctcaaaaaaaaaaa	0.050													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	107540421	107540421	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107540421delT								ST6GAL2 (36858 upstream) : LOC729121 (899099 downstream)																							ttgattttactttttttttat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108149350	108149351	+	IGR	INS	-	G	G	rs72530070		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108149350_108149351insG								ST6GAL2 (645787 upstream) : LOC729121 (290169 downstream)																							AAAACAAAAAAAACCTGATCTG	0.302													4	2	---	---	---	---	
ZC3H8	84524	broad.mit.edu	37	2	112996386	112996386	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112996386delT	uc002thp.2	-							NM_032494	NP_115883	Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8						apoptosis|negative regulation of T cell differentiation in thymus|negative regulation of transcription, DNA-dependent|positive regulation of thymocyte apoptosis|response to antibiotic|T cell homeostasis	nucleus	RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ATTGTGTGCCTTTGACTGAAT	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114077487	114077487	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114077487delA								PAX8 (40989 upstream) : CBWD2 (117781 downstream)																							TTTTTCTAGGAAAAAAAAAAA	0.358													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114116486	114116486	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114116486delT								PAX8 (79988 upstream) : CBWD2 (78782 downstream)																							AGATAACTTGTTTTTTTTCTG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114891911	114891911	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114891911delT								ACTR3 (175744 upstream) : DPP10 (307988 downstream)																							ATGAAAGTTGTTTTTTTTGTG	0.274													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	116620024	116620024	+	IGR	DEL	T	-	-	rs74997426		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116620024delT								DPP10 (18088 upstream) : None (None downstream)																							tgaatgcgtattttttttcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	118372193	118372194	+	IGR	DEL	AC	-	-	rs10198944	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118372193_118372194delAC								None (None upstream) : DDX18 (200061 downstream)																							tcatacccatacacacacacac	0.069													4	2	---	---	---	---	
CCDC93	54520	broad.mit.edu	37	2	118748397	118748397	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118748397delT	uc002tlj.2	-						CCDC93_uc010fld.1_Intron	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93											large_intestine(1)|ovary(1)	2						tacaatgccattttttttttg	0.000													5	3	---	---	---	---	
EPB41L5	57669	broad.mit.edu	37	2	120853798	120853798	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120853798delT	uc002tmg.2	+						EPB41L5_uc010flk.2_Intron|EPB41L5_uc010fll.2_Intron|EPB41L5_uc002tmh.3_Intron|EPB41L5_uc010flm.2_Intron	NM_020909	NP_065960	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1						GAAATGTCCATTTTTTTTTCA	0.368													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121484091	121484092	+	IGR	DEL	AA	-	-	rs10174148		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121484091_121484092delAA								LOC84931 (260166 upstream) : GLI2 (9107 downstream)																							acataattttaaaaaaagataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122067511	122067512	+	IGR	INS	-	A	A	rs151293370	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122067511_122067512insA								TFCP2L1 (24733 upstream) : CLASP1 (27842 downstream)																							GTTGCTACCATAAAAAAAAACA	0.441													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122907509	122907509	+	IGR	DEL	T	-	-	rs35281418		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122907509delT								TSN (382083 upstream) : None (None downstream)																							tttttcactgttttttttttt	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	123233747	123233747	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123233747delA								TSN (708321 upstream) : None (None downstream)																							ggcaagttccaaaaaagaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	124161032	124161032	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124161032delT								None (None upstream) : CNTNAP5 (621832 downstream)																							TAGTACTACCTTTATTTATTC	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	124322723	124322724	+	IGR	INS	-	AA	AA	rs140010263	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124322723_124322724insAA								None (None upstream) : CNTNAP5 (460140 downstream)																							tttaataaaacagtttcaagac	0.109													2	5	---	---	---	---	
WDR33	55339	broad.mit.edu	37	2	128478163	128478163	+	Intron	DEL	T	-	-	rs72166193		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128478163delT	uc002tpg.1	-							NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN	WD repeat domain 33 isoform 1						postreplication repair|spermatogenesis	collagen|nucleus	protein binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		tttttccttattttttttttc	0.169													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131236257	131236257	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131236257delG								PTPN18 (103276 upstream) : CFC1B (42579 downstream)																							TTTCTTTTCTGGCAGCTGTGA	0.428													4	3	---	---	---	---	
PLEKHB2	55041	broad.mit.edu	37	2	131968642	131968644	+	Intron	DEL	GGA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131968642_131968644delGGA	uc002tsh.2	+									Q96CS7	PKHB2_HUMAN	SubName: Full=Putative uncharacterized protein PLEKHB2;							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)		aagccaggctggaggaggaggag	0.138													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133111638	133111639	+	IGR	INS	-	TGT	TGT	rs148412024	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133111638_133111639insTGT								NCRNA00164 (96096 upstream) : GPR39 (62508 downstream)																							cttagaaattctgttgagttgt	0.000													5	3	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133444435	133444436	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133444435_133444436insA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						CTTTGTTCTTCAAAAAAAATTT	0.307													4	2	---	---	---	---	
NXPH2	11249	broad.mit.edu	37	2	139477701	139477701	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139477701delA	uc002tvi.2	-							NM_007226	NP_009157	O95156	NXPH2_HUMAN	neurexophilin 2 precursor						neuropeptide signaling pathway	extracellular region				ovary(3)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(221;0.101)		ttttaaggttaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	140513490	140513490	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140513490delT								NXPH2 (975679 upstream) : LRP1B (475506 downstream)																							attcctcttgtttttgactgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	140705775	140705778	+	IGR	DEL	AGAA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140705775_140705778delAGAA								None (None upstream) : LRP1B (283218 downstream)																							agagaaagggagaaagaaagaaag	0.113													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	146417177	146417177	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146417177delA								None (None upstream) : PABPC1P2 (927448 downstream)																							CCTAAATCCGAAAGAGAAGGG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	146906804	146906805	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146906804_146906805insT								None (None upstream) : PABPC1P2 (437820 downstream)																							TTGTAGCCACCTTTTTTTCTTT	0.366													4	2	---	---	---	---	
MBD5	55777	broad.mit.edu	37	2	148932179	148932180	+	Intron	INS	-	A	A	rs79597844	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148932179_148932180insA	uc002twm.3	+							NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		caagaaaattttaaaaaaaaac	0.000													4	2	---	---	---	---	
KIF5C	3800	broad.mit.edu	37	2	149658238	149658239	+	Intron	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149658238_149658239delAA	uc010zbu.1	+							NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		TTTACTCTCTAATTACAAACTG	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	151118199	151118199	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151118199delA								MMADHC (673869 upstream) : RND3 (206513 downstream)																							TAAGAaaaagaaaaaaaacgt	0.035													4	2	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153213253	153213254	+	Intron	INS	-	T	T	rs139979639		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153213253_153213254insT	uc002tye.2	+							NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						cacttttgtgcttttttttttt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156257736	156257736	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156257736delG								KCNJ3 (544722 upstream) : NR4A2 (923210 downstream)																							ATCTGCGTGTGGGCTGCAACA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156883865	156883866	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156883865_156883866insT	uc002tyw.2	-											Homo sapiens cDNA clone IMAGE:5209417.																		gtataataaACTTTTTTAAAAA	0.134													4	2	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161337139	161337139	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161337139delC	uc002ubo.2	-						RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron|RBMS1_uc010fox.2_Intron	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						tatcaattctcccccaattga	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	162103271	162103271	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162103271delT	uc002ubt.1	+											Homo sapiens cDNA FLJ14635 fis, clone NT2RP2001196.																		GTTTAATACCTTCTCTTACAG	0.368													4	2	---	---	---	---	
SLC4A10	57282	broad.mit.edu	37	2	162707340	162707340	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162707340delT	uc002ubx.3	+						SLC4A10_uc010fpa.1_Intron|SLC4A10_uc010zcr.1_Intron|SLC4A10_uc002uby.3_Intron|SLC4A10_uc010zcs.1_Intron	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						taagtttttcttttttatgtc	0.000													4	2	---	---	---	---	
DPP4	1803	broad.mit.edu	37	2	162866024	162866025	+	Intron	DEL	TG	-	-	rs72484587		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162866024_162866025delTG	uc002ubz.2	-						DPP4_uc010fpb.2_Intron	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	TCATAAAAATtgtgtgtgtgtg	0.248													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164939850	164939850	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164939850delT								FIGN (347337 upstream) : GRB14 (409483 downstream)																							agtgggactgttcccctgtgc	0.000													4	2	---	---	---	---	
SCN7A	6332	broad.mit.edu	37	2	167313314	167313315	+	Intron	DEL	AT	-	-	rs146217556		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167313314_167313315delAT	uc002udu.1	-						SCN7A_uc010fpm.1_Intron	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						caagactaaAatatatatatat	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	168633472	168633472	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168633472delT								XIRP2 (517213 upstream) : B3GALT1 (41710 downstream)																							CAGGCTAAGGTTTTTTTTGTT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	173063561	173063561	+	IGR	DEL	A	-	-	rs72263835		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173063561delA								DLX2 (96083 upstream) : ITGA6 (228521 downstream)																							caaaattggtaaaaaaaaaat	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174435388	174435389	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174435388_174435389delTG								CDCA7 (201670 upstream) : SP3 (337870 downstream)																							GTACAGGATTTGTGTGTGTGTG	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174514531	174514531	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174514531delT								CDCA7 (280813 upstream) : SP3 (258728 downstream)																							GCTTTGGCAGTTCTTTTTATT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174529583	174529583	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174529583delC								CDCA7 (295865 upstream) : SP3 (243676 downstream)																							ATATACCCCACCCCCAAACCA	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174765988	174765990	+	IGR	DEL	TTC	-	-	rs34729691		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174765988_174765990delTTC								CDCA7 (532270 upstream) : SP3 (7269 downstream)																							ggtaaagaatttcttaagacaca	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	182093051	182093051	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182093051delT	uc002uns.1	+											Homo sapiens cDNA FLJ43011 fis, clone BRTHA2015853.																		gtcttatttattttttccatc	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	184614568	184614568	+	IGR	DEL	A	-	-	rs74980398		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184614568delA								NUP35 (588161 upstream) : ZNF804A (848525 downstream)																							TAAGTGGAAGAAAAAAAAAAG	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186720838	186720839	+	IGR	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186720838_186720839delAG								ZNF804A (916626 upstream) : ZC3H15 (630046 downstream)																							agcaggagcaagagagagagag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	188579524	188579524	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188579524delA								TFPI (160305 upstream) : GULP1 (577080 downstream)																							aatctgaactaaaaaaaaaaa	0.000													4	3	---	---	---	---	
MFSD6	54842	broad.mit.edu	37	2	191320490	191320490	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191320490delT	uc002urz.2	+							NM_017694	NP_060164	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				ovary(2)	2						ATGCCCTTCCTTTTTTTTTTG	0.363													3	3	---	---	---	---	
OBFC2A	64859	broad.mit.edu	37	2	192541617	192541620	+	5'Flank	DEL	AGTT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192541617_192541620delAGTT	uc002usx.2	+						OBFC2A_uc002usw.2_5'Flank|OBFC2A_uc002usy.2_5'Flank|OBFC2A_uc002usz.2_5'Flank|OBFC2A_uc002uta.2_5'Flank	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold						double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			CACCACTGGAAGTTAAGTCTAAAC	0.216													4	2	---	---	---	---	
TMEFF2	23671	broad.mit.edu	37	2	192852370	192852370	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192852370delA	uc002utc.2	-							NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two							extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TTCAAatgttactgatgagaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196059590	196059591	+	IGR	INS	-	AAGC	AAGC			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196059590_196059591insAAGC								None (None upstream) : SLC39A10 (461941 downstream)																							aggaaggaaggaaggaagaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196061990	196061990	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196061990delT								None (None upstream) : SLC39A10 (459542 downstream)																							ATCTATCCCCTTTTCTCTTGA	0.398													4	2	---	---	---	---	
SATB2	23314	broad.mit.edu	37	2	200171825	200171825	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200171825delA	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						tcaaaatgagaaaaaaaaaag	0.025													4	2	---	---	---	---	
ABI2	10152	broad.mit.edu	37	2	204194287	204194287	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204194287delT	uc002vaa.2	+						ABI2_uc010zig.1_Intron|ABI2_uc002uzz.2_Intron|ABI2_uc010zih.1_Intron|ABI2_uc010zii.1_Intron|ABI2_uc010zij.1_Intron	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2						actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0						AATCTTTTGCTTTTTTTTTTA	0.294													4	2	---	---	---	---	
RAPH1	65059	broad.mit.edu	37	2	204375993	204375993	+	Intron	DEL	A	-	-	rs2469956	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204375993delA	uc002vad.2	-						RAPH1_uc002vae.2_Intron|RAPH1_uc002vaf.2_Intron	NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains						cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						ACATTTCTTTAAAAAAAAAAA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204411856	204411856	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204411856delA								RAPH1 (11798 upstream) : CD28 (159342 downstream)																							TTCAATCTGTAAAAAAAATGA	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204944545	204944546	+	IGR	INS	-	GAAT	GAAT	rs147851316	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204944545_204944546insGAAT								ICOS (118249 upstream) : PARD3B (465970 downstream)																							atatgtttatggaatgaatgaa	0.168													2	6	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	205486015	205486016	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205486015_205486016insT	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GTGGATGTGTATTCTTTTTTTC	0.386													3	3	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	206203463	206203464	+	Intron	DEL	AT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206203463_206203464delAT	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		TCAAGTGGGAATATAATTCTAT	0.317													4	2	---	---	---	---	
PLEKHM3	389072	broad.mit.edu	37	2	208817887	208817888	+	Intron	INS	-	T	T	rs140276944	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208817887_208817888insT	uc002vcl.2	-						PLEKHM3_uc002vcm.2_Intron	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,						intracellular signal transduction		metal ion binding			ovary(1)	1						GCTAATGCGGATAGTATGGCAT	0.386													4	2	---	---	---	---	
PTH2R	5746	broad.mit.edu	37	2	209572064	209572065	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209572064_209572065insT	uc010fuo.1	+									P49190	PTH2R_HUMAN	Homo sapiens cDNA FLJ60238 complete cds, highly similar to Parathyroid hormone receptor precursor.							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		tactaattagattttttttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	212040192	212040194	+	IGR	DEL	AAG	-	-	rs67183703		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212040192_212040194delAAG								CPS1 (496363 upstream) : ERBB4 (200248 downstream)																							aaaagaaaaaaagaactttgctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216735359	216735359	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216735359delA								FN1 (434568 upstream) : MREG (71956 downstream)																							TCTTTGGGAGAAAAAAAAAAC	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	217464756	217464756	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217464756delA								RPL37A (98570 upstream) : IGFBP2 (33371 downstream)																							catcaaacctaaacataaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	217757979	217757979	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217757979delA								TNP1 (33197 upstream) : DIRC3 (390769 downstream)																							tcagaatgctaatccaatcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221978475	221978475	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221978475delG								None (None upstream) : EPHA4 (304274 downstream)																							ATCACAATTAGGATTAATTGG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227313006	227313006	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227313006delT								KIAA1486 (717535 upstream) : IRS1 (283028 downstream)																							TTACAATAACTTTTTTCACTT	0.239													4	2	---	---	---	---	
SP100	6672	broad.mit.edu	37	2	231325732	231325733	+	Intron	INS	-	T	T	rs146997369	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231325732_231325733insT	uc002vqt.2	+						SP100_uc002vqs.2_Intron|SP100_uc002vqu.1_Intron|SP100_uc010zmb.1_Intron|SP100_uc002vqq.1_Intron|SP100_uc002vqr.1_Intron|SP100_uc010zmc.1_Intron|SP100_uc002vqv.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		tataatttttattttttttaaa	0.312													3	3	---	---	---	---	
CAB39	51719	broad.mit.edu	37	2	231625776	231625776	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231625776delT	uc002vqx.2	+						CAB39_uc010fxr.2_Intron|CAB39_uc010fxq.2_Intron	NM_016289	NP_057373	Q9Y376	CAB39_HUMAN	calcium binding protein 39						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		agagtttggattttttttttt	0.070													3	4	---	---	---	---	
GIGYF2	26058	broad.mit.edu	37	2	233637707	233637707	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233637707delT	uc002vti.3	+						GIGYF2_uc010zmj.1_Intron|GIGYF2_uc002vtg.2_Intron|GIGYF2_uc002vtj.3_Intron|GIGYF2_uc002vtk.3_Intron|GIGYF2_uc002vth.3_Intron|GIGYF2_uc010zmk.1_Intron|GIGYF2_uc010zml.1_Intron|KCNJ13_uc002vtn.2_5'Flank|KCNJ13_uc002vto.2_5'Flank|KCNJ13_uc002vtp.2_Intron	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b						cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GATTAGAGACTTTTTTTTGTA	0.348													4	2	---	---	---	---	
NGEF	25791	broad.mit.edu	37	2	233764661	233764662	+	Intron	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233764661_233764662delTG	uc002vts.2	-						NGEF_uc010zmm.1_Intron|NGEF_uc010fyg.1_Intron|NGEF_uc002vtt.2_Intron	NM_019850	NP_062824	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		cttacacacatgctctcacagt	0.158													4	2	---	---	---	---	
COPS8	10920	broad.mit.edu	37	2	238001191	238001191	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238001191delA	uc002vwh.2	+						COPS8_uc010fys.1_Intron|COPS8_uc002vwg.2_Intron|COPS8_uc002vwi.2_Intron	NM_006710	NP_006701	Q99627	CSN8_HUMAN	COP9 signalosome subunit 8 isoform 1						cullin deneddylation	cytoplasm|signalosome				ovary(1)	1		Breast(86;0.000162)|Renal(207;0.00339)|all_hematologic(139;0.0123)|Ovarian(221;0.0694)|Acute lymphoblastic leukemia(138;0.0775)|all_lung(227;0.169)|all_neural(83;0.211)		Epithelial(121;7.41e-23)|OV - Ovarian serous cystadenocarcinoma(60;5.42e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000175)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0258)		TTACTTCTCTAAAAAAAAAAA	0.299													4	2	---	---	---	---	
TRAF3IP1	26146	broad.mit.edu	37	2	239236197	239236197	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239236197delT	uc002vye.2	+						TRAF3IP1_uc002vyf.2_Intron	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting							cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		agatCAGTGGTTTTTTACCCA	0.035													4	2	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	239976721	239976721	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239976721delT	uc002vyk.3	-						HDAC4_uc010fyy.2_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TAAAAGTGGATTTTTTTTTAG	0.413													4	2	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240283744	240283744	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240283744delT	uc002vyk.3	-						HDAC4_uc010fza.2_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TGTGGACATATTACAACTTTC	0.353													4	2	---	---	---	---	
PPP1R7	5510	broad.mit.edu	37	2	242095383	242095383	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242095383delT	uc002wat.1	+						PPP1R7_uc010fzm.1_Intron|PPP1R7_uc002war.2_Intron|PPP1R7_uc002was.2_Intron|PPP1R7_uc002wau.1_Intron|PPP1R7_uc002wav.1_Intron	NM_002712	NP_002703	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7							cytoplasm|nucleus	protein binding|protein phosphatase type 1 regulator activity			ovary(3)	3		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		TATAGTAAACTTTTTTTTTTA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	243002359	243002359	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:243002359delT								C2orf85 (186877 upstream) : LOC728323 (28485 downstream)																							tctcagtaggttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	6869901	6869901	+	IGR	DEL	A	-	-	rs145598802		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6869901delA								None (None upstream) : GRM7 (32901 downstream)																							ATTTTTGGGGAAAAAAAACAC	0.333													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10191479	10191480	+	Frame_Shift_Ins	INS	-	T	T	rs121913346		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191479_10191480insT	uc003bvc.2	+	3	685_686	c.472_473insT	c.(472-474)CTGfs	p.L158fs	VHL_uc003bvd.2_Frame_Shift_Ins_p.L117fs	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	158	Interaction with Elongin BC complex.		L -> V (in VHLD; type I).|L -> P (in VHLD; type I-II; abolishes release from chaperonin complex and the interaction with Elongin BC complex).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L158V(8)|p.L158Q(6)|p.L158P(3)|p.L158fs*16(3)|p.V155fs*15(2)|p.L158R(1)|p.L158_K159del(1)|p.L158fs*15(1)|p.T157_K159del(1)|p.Y156*(1)|p.L158fs*6(1)|p.L158fs*1(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGTGTATACTCTGAAAGAGCGA	0.500		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				83	42	---	---	---	---	
SYN2	6854	broad.mit.edu	37	3	12105505	12105505	+	Intron	DEL	G	-	-	rs141647347	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12105505delG	uc003bwm.2	+						SYN2_uc003bwl.1_Intron	NM_133625	NP_598328	Q92777	SYN2_HUMAN	synapsin II isoform IIa						neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2						ttacattggagaaacctgaca	0.000													4	2	---	---	---	---	
KAT2B	8850	broad.mit.edu	37	3	20188281	20188281	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20188281delA	uc003cbq.2	+							NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						atttactgttaaagggcacat	0.080													4	2	---	---	---	---	
ZNF385D	79750	broad.mit.edu	37	3	21501671	21501671	+	Intron	DEL	T	-	-	rs35583200		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21501671delT	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						TAACACCATCTTTTTTTTCTT	0.363													3	3	---	---	---	---	
ZNF385D	79750	broad.mit.edu	37	3	21564313	21564313	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21564313delT	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						AGAAAAAAAATTTTTTGTTTT	0.358													4	2	---	---	---	---	
THRB	7068	broad.mit.edu	37	3	24175186	24175187	+	Intron	INS	-	AG	AG	rs149709348	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24175186_24175187insAG	uc003ccx.3	-						THRB_uc010hfe.2_Intron|THRB_uc003ccy.3_Intron|THRB_uc003ccz.3_Intron	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)	TTGCTGCagaaagagagagaga	0.337													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	24941159	24941159	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24941159delA								THRB (404706 upstream) : RARB (274664 downstream)																							TTTTGAGGAGAAAAAAAAAAT	0.403													5	4	---	---	---	---	
TOP2B	7155	broad.mit.edu	37	3	25665606	25665611	+	Intron	DEL	ATTCAT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25665606_25665611delATTCAT	uc011awn.1	-						TOP2B_uc003cdj.2_Intron	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme						DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						TTCACCAACAATTCATAAAAATTAAG	0.330													9	5	---	---	---	---	
ZCWPW2	152098	broad.mit.edu	37	3	28476277	28476277	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28476277delT	uc003ceh.2	+						ZCWPW2_uc003cei.2_Intron|ZCWPW2_uc010hfo.2_5'Flank	NM_001040432	NP_001035522	Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2						TTGAGGAATCTTTTTTTTTCT	0.333													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	30164123	30164123	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30164123delC								RBMS3 (117504 upstream) : TGFBR2 (483871 downstream)																							CTCCCCCTCTCCTCCCGTGAA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	34171766	34171766	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34171766delA								PDCD6IP (260572 upstream) : None (None downstream)																							ATTCATGCTGAAAAAAAAAAC	0.219													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	34626963	34626963	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34626963delT								PDCD6IP (715769 upstream) : None (None downstream)																							ggaattgtgatttttttttct	0.000													6	4	---	---	---	---	
SCN5A	6331	broad.mit.edu	37	3	38608161	38608162	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38608161_38608162insT	uc003cio.2	-						SCN5A_uc003cin.2_Intron|SCN5A_uc003cil.3_Intron|SCN5A_uc010hhi.2_Intron|SCN5A_uc010hhk.2_Intron|SCN5A_uc011ayr.1_Intron|SCN5A_uc010hhj.1_Intron	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha						blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	tccattttttctttttttttct	0.257													8	4	---	---	---	---	
ULK4	54986	broad.mit.edu	37	3	41769230	41769231	+	Intron	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41769230_41769231delAA	uc003ckv.3	-							NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		acatgtggttaaaaaaaaacag	0.000													4	2	---	---	---	---	
CCBP2	1238	broad.mit.edu	37	3	42930023	42930024	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42930023_42930024insA	uc003cmg.2	+									O00590	CCBP2_HUMAN	Homo sapiens cDNA, FLJ94124, highly similar to Homo sapiens chemokine binding protein 2 (CCBP2), mRNA.						chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)		ccagtttctacaaaaaaaatca	0.000													4	2	---	---	---	---	
C3orf77	375337	broad.mit.edu	37	3	44311062	44311062	+	Intron	DEL	A	-	-	rs35035443		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44311062delA	uc003cna.3	+							NM_001145030	NP_001138502	Q8N9V7	CC077_HUMAN	hypothetical protein LOC375337											pancreas(1)	1						actgcCCCTTAAAAAAAAAAA	0.100													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	47210647	47210647	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47210647delT	uc003cqw.1	+											Homo sapiens cDNA FLJ39534 fis, clone PUAEN2005247.																		TTCCTTTTTCTTTTTTTTTCA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	49921745	49921745	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49921745delG								CAMKV (14376 upstream) : MST1R (2693 downstream)																							GGAGGGAGATGGGACAGAGAG	0.577													4	2	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	50719753	50719753	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50719753delG	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AACTAGTGCCGCCATGTCCCA	0.403													4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52643401	52643401	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643401delT	uc003des.2	-	16	2507	c.2495delA	c.(2494-2496)AATfs	p.N832fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.N832fs|PBRM1_uc003der.2_Frame_Shift_Del_p.N800fs|PBRM1_uc003det.2_Frame_Shift_Del_p.N847fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.N847fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.N832fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.N832fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.N832fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.N832fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.N745fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.N178fs|PBRM1_uc003dfc.2_Frame_Shift_Del_p.N199fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	832	Bromo 6.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACGGTAGCGATTATTTTCAAC	0.373			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								191	99	---	---	---	---	
ERC2	26059	broad.mit.edu	37	3	55813670	55813670	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55813670delA	uc003dhr.1	-						ERC2_uc003dhq.1_Intron|ERC2_uc003dht.1_Intron	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		caacacttgcaaaaaaaaccc	0.045													3	4	---	---	---	---	
ERC2	26059	broad.mit.edu	37	3	56055805	56055805	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56055805delA	uc003dhr.1	-						ERC2_uc003dht.1_Intron	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		ttgtgttcataagttcttatc	0.000													4	2	---	---	---	---	
C3orf67	200844	broad.mit.edu	37	3	58765710	58765710	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58765710delA	uc003dkt.1	-						C3orf67_uc003dkr.1_Intron|C3orf67_uc003dks.1_Intron	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844												0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		agtcatttataagggaacccc	0.000													4	2	---	---	---	---	
LOC285401	285401	broad.mit.edu	37	3	62990999	62990999	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62990999delC	uc003dlo.2	+						LOC285401_uc010hnr.1_Intron					Homo sapiens, clone IMAGE:5557531, mRNA.												0						TCTCTTCTCTCCCCAATGAGG	0.388													4	2	---	---	---	---	
C3orf49	132200	broad.mit.edu	37	3	63804796	63804796	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63804796delT	uc003dls.3	+							NR_026866				RecName: Full=Putative uncharacterized protein C3orf49;												0						tgttgttTGATTTTTTTTTTC	0.358													4	2	---	---	---	---	
FAM19A4	151647	broad.mit.edu	37	3	68923935	68923936	+	Intron	DEL	AC	-	-	rs10574878		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68923935_68923936delAC	uc003dnh.1	-						FAM19A4_uc003dni.1_Intron	NM_182522	NP_872328	Q96LR4	F19A4_HUMAN	family with sequence similarity 19 (chemokine							extracellular region				skin(2)	2		Lung NSC(201;0.0198)		BRCA - Breast invasive adenocarcinoma(55;1.38e-05)|Epithelial(33;0.000124)|LUSC - Lung squamous cell carcinoma(21;0.0248)|KIRC - Kidney renal clear cell carcinoma(39;0.0729)|Kidney(39;0.0904)		CCCTTTCTTTacacacacacac	0.386													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	69066347	69066348	+	IGR	DEL	TT	-	-	rs147553786		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69066347_69066348delTT								C3orf64 (3573 upstream) : TMF1 (2632 downstream)																							ctgcaacatcttacatcaggaa	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70887370	70887370	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70887370delA								MITF (869884 upstream) : FOXP1 (117367 downstream)																							tgtattttttaaattaaaatc	0.000													4	2	---	---	---	---	
FOXP1	27086	broad.mit.edu	37	3	71034840	71034840	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71034840delT	uc003dol.2	-						FOXP1_uc003dom.2_Intron|FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003dop.2_Intron|FOXP1_uc003doq.1_Intron|FOXP1_uc003doi.2_Intron|FOXP1_uc003doj.2_Intron|FOXP1_uc003dok.2_Intron|FOXP1_uc003dor.1_Intron	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		AAATGTGATCTTTTTTTTTTT	0.333			T	PAX5	ALL								3	3	---	---	---	---	
FOXP1	27086	broad.mit.edu	37	3	71594173	71594173	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71594173delA	uc003dop.2	-						FOXP1_uc003doo.2_Intron|FOXP1_uc003dos.2_Intron|MIR1284_hsa-mir-1284|MI0006431_5'Flank	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		TGATATTTCCAAGTCACCACG	0.313			T	PAX5	ALL								4	2	---	---	---	---	
PDZRN3	23024	broad.mit.edu	37	3	73499790	73499790	+	Intron	DEL	A	-	-	rs35948653		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73499790delA	uc003dpl.1	-						PDZRN3_uc011bgh.1_Intron|PDZRN3_uc010hoe.1_Intron|PDZRN3_uc011bgg.1_Intron	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3								ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CAAATTGAGCAAAAAATGTGG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	73876070	73876073	+	IGR	DEL	TATT	-	-	rs75842641		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73876070_73876073delTATT								PDZRN3 (201998 upstream) : CNTN3 (435649 downstream)																							AAGAGTTGACTATTTATGATGATG	0.324													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	74176111	74176111	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74176111delA								PDZRN3 (502039 upstream) : CNTN3 (135611 downstream)																							TATCCGGTTCAAAAAAAAAAA	0.303													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	80913011	80913011	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80913011delA								None (None upstream) : GBE1 (625839 downstream)																							gaggatatagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83443555	83443555	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83443555delA								None (None upstream) : None (None downstream)																							gtgaaaaaagaaaaaaaagtg	0.000													6	4	---	---	---	---	
CADM2	253559	broad.mit.edu	37	3	86018112	86018112	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86018112delT	uc003dqj.2	+						CADM2_uc003dqk.2_Intron|CADM2_uc003dql.2_Intron	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		GATTCTAAAATTTTTCCTTGA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	87055963	87055963	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87055963delT								VGLL3 (15706 upstream) : CHMP2B (220450 downstream)																							TTTAATTGTATTTTTCCTTTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	87725897	87725897	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87725897delC								POU1F1 (400160 upstream) : HTR1F (305829 downstream)																							TGTCACAGAACCCAGCAACAT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	95068974	95068974	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95068974delA								LOC255025 (173895 upstream) : None (None downstream)																							ctgtagatagaaaaaaaaaac	0.000													5	5	---	---	---	---	
CLDND1	56650	broad.mit.edu	37	3	98239732	98239732	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98239732delA	uc003dsp.2	-						CLDND1_uc003dso.2_Intron|CLDND1_uc003dsq.2_Intron|CLDND1_uc003dss.2_Intron|CLDND1_uc003dsr.2_Intron|CLDND1_uc003dst.2_Intron|CLDND1_uc003dsu.2_Intron|CLDND1_uc003dsv.2_Intron	NM_019895	NP_063948	Q9NY35	CLDN1_HUMAN	claudin domain containing 1 protein isoform a							integral to membrane				ovary(1)	1						AGTAAATAAGAAAAAAAAAAG	0.308													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99075443	99075443	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99075443delC								DCBLD2 (454910 upstream) : COL8A1 (282011 downstream)																							GGATAGTTGGCCAGGCCAGAC	0.418													4	2	---	---	---	---	
ZPLD1	131368	broad.mit.edu	37	3	102122087	102122087	+	Intron	DEL	A	-	-	rs77996811		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102122087delA	uc003dvs.1	+							NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1							integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						AGAGAGAGAGAAAAAAAAATT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	103304493	103304494	+	IGR	INS	-	A	A	rs146450503	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103304493_103304494insA								None (None upstream) : None (None downstream)																							TTCAATTTCAGAAAAACAAATT	0.312													3	6	---	---	---	---	
ALCAM	214	broad.mit.edu	37	3	105118109	105118109	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105118109delT	uc003dvx.2	+						ALCAM_uc003dvv.2_Intron|ALCAM_uc003dvw.1_Intron|ALCAM_uc003dvy.2_Intron	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						TGCTGACCTATTTTTTTTCTT	0.318													4	2	---	---	---	---	
ALCAM	214	broad.mit.edu	37	3	105282958	105282958	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105282958delA	uc003dvx.2	+						ALCAM_uc003dvy.2_Intron|ALCAM_uc010hpp.2_Intron|ALCAM_uc003dvz.2_Intron	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						cggacatttgaaaaaaaaaaa	0.000													6	3	---	---	---	---	
LOC100302640	100302640	broad.mit.edu	37	3	106782221	106782221	+	Intron	DEL	A	-	-	rs112513802		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106782221delA	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0						aggggaggggaaaaagtgtga	0.194													3	5	---	---	---	---	
C3orf52	79669	broad.mit.edu	37	3	111805438	111805439	+	Intron	INS	-	T	T	rs143187697	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111805438_111805439insT	uc003dyq.3	+						C3orf52_uc011bhs.1_Intron|C3orf52_uc011bht.1_Intron	NM_024616	NP_078892	Q5BVD1	TTMP_HUMAN	TPA-induced transmembrane protein							endoplasmic reticulum membrane|integral to membrane					0						CGGCGGGACAGTAGTAGGACCC	0.683													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	116193931	116193932	+	IGR	DEL	GA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116193931_116193932delGA								LSAMP (669913 upstream) : LOC285194 (234703 downstream)																							GTGTGTGTGTgagagagagaga	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117264111	117264111	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117264111delA								LOC285194 (828226 upstream) : None (None downstream)																							GTTTATGGGGAAAAAAAAAAA	0.254													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117363293	117363293	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117363293delA								LOC285194 (927408 upstream) : None (None downstream)																							aatggtttttaaaaaattatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	118388466	118388466	+	Intron	DEL	A	-	-	rs77807173		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118388466delA	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																		ctACCTTCAGAAAAAAAAAGA	0.164													4	2	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119037774	119037774	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119037774delT	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						AACCTGCCCATTTTTTTTTAC	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	119841733	119841734	+	Intron	INS	-	T	T	rs150512775	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119841733_119841734insT	uc003edp.2	+											Homo sapiens cDNA clone IMAGE:4827879.																		TATCATATCAATTTTTTTCCCT	0.104													4	2	---	---	---	---	
STXBP5L	9515	broad.mit.edu	37	3	121126995	121126995	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121126995delC	uc003eec.3	+						STXBP5L_uc011bji.1_Intron	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		aaaagtgaggccagTCTGATA	0.114													4	2	---	---	---	---	
ROPN1	54763	broad.mit.edu	37	3	123709305	123709305	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123709305delC	uc003eha.2	-						ROPN1_uc003ehb.1_Intron|ROPN1_uc003ehc.1_Intron	NM_017578	NP_060048	Q9HAT0	ROP1A_HUMAN	ropporin						signal transduction		cAMP-dependent protein kinase regulator activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.148)		GTCAAATTATCCCCCCATGTT	0.438													4	2	---	---	---	---	
ITGB5	3693	broad.mit.edu	37	3	124491533	124491535	+	Intron	DEL	CTC	-	-	rs3841932		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124491533_124491535delCTC	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		CTCATTTGCACTCTGGTGGAGCA	0.557													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128256841	128256841	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128256841delT								LOC90246 (27414 upstream) : C3orf27 (34003 downstream)																							tcttGACTCCTTTTTTTTTTT	0.249													6	5	---	---	---	---	
IFT122	55764	broad.mit.edu	37	3	129195788	129195788	+	Intron	DEL	C	-	-	rs73204212	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129195788delC	uc003emm.2	+						IFT122_uc003eml.2_Intron|IFT122_uc003emn.2_Intron|IFT122_uc003emo.2_Intron|IFT122_uc003emp.2_Intron|IFT122_uc010htc.2_Intron|IFT122_uc011bky.1_Intron|IFT122_uc003emq.2_Intron|IFT122_uc003emr.2_Intron|IFT122_uc011bla.1_Intron|IFT122_uc011bkx.1_Intron|IFT122_uc011bkz.1_Intron	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2						camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						GTCTTGTTTTCTTTTTTTTTT	0.318													6	4	---	---	---	---	
COL6A6	131873	broad.mit.edu	37	3	130360236	130360236	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130360236delA	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						aatgagttttaaaaaggaata	0.000													4	2	---	---	---	---	
ATP2C1	27032	broad.mit.edu	37	3	130572491	130572491	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130572491delC	uc011bli.1	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron	NM_001001487	NP_001001487	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1b						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	AAAGCTTTCTCCAGTGCTGCT	0.239									Hailey-Hailey_disease				4	2	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	130864662	130864662	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130864662delA	uc003eny.2	+						NEK11_uc003enx.2_Intron|NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron|NEK11_uc011blm.1_Intron|NEK11_uc010hto.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						ttctcatctgaaaaatgggaa	0.000													4	2	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131459620	131459620	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131459620delT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						caactccccatttcactcaaa	0.000													4	2	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131722379	131722380	+	Intron	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131722379_131722380delTC	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TGAGGGCCCTTCTCTCTCTACT	0.500													4	2	---	---	---	---	
NCRNA00119	348808	broad.mit.edu	37	3	132531129	132531129	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132531129delG	uc003epg.1	+							NR_002811				Homo sapiens cDNA clone IMAGE:4826885.												0						gattttatcagggggaaaagc	0.000													4	2	---	---	---	---	
CEP70	80321	broad.mit.edu	37	3	138221382	138221383	+	Intron	DEL	AA	-	-	rs35132741		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138221382_138221383delAA	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron	NM_024491	NP_077817	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1						CTAGAATTTGAAAAAAAAAAAA	0.302													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140074893	140074893	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140074893delG	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						ccttcatgctggggtagggag	0.030										HNSCC(16;0.037)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	141176346	141176346	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141176346delA								ZBTB38 (7721 upstream) : RASA2 (29580 downstream)																							CACACTCTTCAAAAAAAAAAA	0.284													3	4	---	---	---	---	
RASA2	5922	broad.mit.edu	37	3	141323084	141323084	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141323084delT	uc003etz.1	+						RASA2_uc010huq.1_Intron|RASA2_uc003eua.1_Intron	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2						intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6						ttgttttgtgttttctattta	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	143767483	143767483	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143767483delA								C3orf58 (56274 upstream) : None (None downstream)																							GGCTGCTTAGAAAAAAATTAT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	144925708	144925708	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144925708delG								None (None upstream) : PLOD2 (861520 downstream)																							TGGGGTGTCTGGGTTGAATTC	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147358265	147358265	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147358265delA								ZIC1 (223761 upstream) : None (None downstream)																							TTCATGAGAGAAAAAAAAATT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148322103	148322103	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148322103delA								None (None upstream) : AGTR1 (93555 downstream)																							CATTATCATTAAAAAAAAAAA	0.299													4	2	---	---	---	---	
AADAC	13	broad.mit.edu	37	3	151536308	151536308	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151536308delA	uc003eze.2	+							NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase						positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity			skin(2)	2		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			gaagagttataggtagaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152519592	152519592	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152519592delT								MBNL1 (336024 upstream) : P2RY1 (33144 downstream)																							tttctgagcatttttttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152652987	152652987	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152652987delA								P2RY1 (97146 upstream) : RAP2B (227042 downstream)																							ACGTCTTGATAAAAGTGGGAC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154426387	154426387	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154426387delA								GPR149 (278883 upstream) : MME (315526 downstream)																							ttcataatctaaacatgcaac	0.154													4	2	---	---	---	---	
KCNAB1	7881	broad.mit.edu	37	3	156195943	156195944	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156195943_156195944insT	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron|KCNAB1_uc003fat.2_Intron|KCNAB1_uc010hvt.1_Intron|KCNAB1_uc011boo.1_Intron	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GTTGTCCAACCTTTTTTTTTCG	0.307													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	158703081	158703081	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158703081delA								MFSD1 (155577 upstream) : SCHIP1 (84036 downstream)																							gtatacttgtaaaaaaaaaag	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161136880	161136880	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161136880delT								C3orf57 (47009 upstream) : OTOL1 (77716 downstream)																							TGCTCTCCAATTTTTTTGTAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161542775	161542776	+	IGR	INS	-	T	T	rs147854688	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161542775_161542776insT								OTOL1 (321047 upstream) : None (None downstream)																							AAACATGGGTCTTTTTTTAACT	0.307													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163049597	163049597	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163049597delA								None (None upstream) : MIR1263 (839662 downstream)																							CTCAGTGAGGAAAATGCAAAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163587418	163587418	+	IGR	DEL	C	-	-	rs71156811		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163587418delC								None (None upstream) : MIR1263 (301841 downstream)																							ACAACAACAACAAAAGCAACT	0.408													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163587422	163587423	+	IGR	DEL	AG	-	-	rs13074334	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163587422_163587423delAG								None (None upstream) : MIR1263 (301836 downstream)																							CAACAACAAAAGCAACTACAAC	0.401													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	164921582	164921583	+	IGR	INS	-	T	T	rs142738948	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164921582_164921583insT								SLITRK3 (7113 upstream) : BCHE (569111 downstream)																							AGTCTCCACCATTTTTTTTCCT	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	165414028	165414028	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165414028delT								SLITRK3 (499559 upstream) : BCHE (76666 downstream)																							gggtattcactttttttttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	165989520	165989524	+	IGR	DEL	TGTAT	-	-	rs112110203		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165989520_165989524delTGTAT								BCHE (434267 upstream) : ZBBX (968557 downstream)																							ACTGAAAAAATGTATTGTATATGAT	0.171													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166291140	166291141	+	IGR	INS	-	T	T	rs141486306	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166291140_166291141insT								BCHE (735887 upstream) : ZBBX (666940 downstream)																							TCAAAAGGATCTTTTAGGATAT	0.267													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166922693	166922693	+	IGR	DEL	A	-	-	rs75000635		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166922693delA								None (None upstream) : ZBBX (35388 downstream)																							aactcagaccaaaaaaaaaaa	0.144													2	4	---	---	---	---	
PDCD10	11235	broad.mit.edu	37	3	167422345	167422345	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167422345delA	uc003fex.2	-						PDCD10_uc003fez.2_Intron|PDCD10_uc003fey.2_Intron	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10						angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2						CAAATAATAGAAAAAAAAAAA	0.179									Familial_Cerebral_Cavernous_Angioma				3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167626858	167626861	+	Intron	DEL	GTAA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167626858_167626861delGTAA	uc003ffc.2	+						uc003ffd.2_Intron					Homo sapiens cDNA FLJ36036 fis, clone TESTI2017125.																		CCAATCTCTTGTAAGTGACTAGTC	0.426													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	169410562	169410563	+	IGR	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169410562_169410563delTT								MECOM (28999 upstream) : TERC (71835 downstream)																							TTTAGTGATGTTTAGAAGGTGT	0.307													4	2	---	---	---	---	
PRKCI	5584	broad.mit.edu	37	3	169964747	169964747	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169964747delT	uc003fgs.2	+							NM_002740	NP_002731	P41743	KPCI_HUMAN	protein kinase C, iota						anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			gaagtttttgtttttttttct	0.015													4	2	---	---	---	---	
CLDN11	5010	broad.mit.edu	37	3	170358988	170358988	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170358988delG	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			CAGGCTCCTTGCTTAGACATG	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	171280027	171280027	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171280027delG								TNIK (101830 upstream) : PLD1 (38593 downstream)																							GAACAAGGAAGGGAATTGTTA	0.378													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174087226	174087226	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174087226delT								NLGN1 (86110 upstream) : NAALADL2 (489885 downstream)																							taacttgttattttttttgta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	176540653	176540654	+	IGR	INS	-	T	T	rs140375012		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176540653_176540654insT								None (None upstream) : TBL1XR1 (197889 downstream)																							taaacactgggttttttttttt	0.000													6	3	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176823580	176823581	+	Intron	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176823580_176823581delGT	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron|TBL1XR1_uc003fiy.2_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CAgtgtgtgggtgtgtgtgtgc	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	178027040	178027040	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178027040delC								None (None upstream) : KCNMB2 (227184 downstream)																							ggagtctagtcccacctactg	0.119													4	2	---	---	---	---	
KCNMB2	10242	broad.mit.edu	37	3	178429059	178429059	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178429059delT	uc003fjd.2	+						uc003fjb.1_Intron|uc003fjc.1_Intron|KCNMB2_uc003fje.2_Intron|KCNMB2_uc003fjf.2_Intron	NM_181361	NP_852006	Q9Y691	KCMB2_HUMAN	calcium-activated potassium channel beta 2						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of vasoconstriction	voltage-gated potassium channel complex	calcium-activated potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(1)	1	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)			TTTGCAAATATTTTAgttata	0.100													4	2	---	---	---	---	
PEX5L	51555	broad.mit.edu	37	3	179733886	179733887	+	Intron	INS	-	CAC	CAC	rs141177096	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179733886_179733887insCAC	uc003fki.1	-						PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			AAGTGCTGTAAcaccaccacca	0.262													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182083203	182083203	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182083203delA								SOX2OT (624200 upstream) : ATP11B (428088 downstream)																							CAAACAGTTTAAATGGGATTC	0.358													4	2	---	---	---	---	
ATP11B	23200	broad.mit.edu	37	3	182553489	182553489	+	Intron	DEL	A	-	-	rs10708300		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182553489delA	uc003flb.2	+						ATP11B_uc003fla.2_Intron	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			tatttatactatttgaagaca	0.000													4	3	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184569254	184569255	+	Intron	DEL	TG	-	-	rs72444885		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184569254_184569255delTG	uc003fpb.1	+						VPS8_uc010hyd.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TGGATATTTATGTGTGTGTGTG	0.213													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185995414	185995414	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185995414delT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CTCATCCCCCTTTCTCAGCTA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187025272	187025273	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187025272_187025273delTG								MASP1 (15520 upstream) : RTP4 (60895 downstream)																							atattccatttgtgtgtgtgtg	0.000													5	3	---	---	---	---	
TP63	8626	broad.mit.edu	37	3	189408676	189408676	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189408676delT	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CTGAAGATGCTTTTTTGACTG	0.403									Hay-Wells_syndrome	HNSCC(45;0.13)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189673486	189673486	+	IGR	DEL	G	-	-	rs63195561		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189673486delG								TP63 (58418 upstream) : LEPREL1 (1033 downstream)																							ACCCATTCACggccgggcaca	0.164													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191216817	191216817	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191216817delT								PYDC2 (37574 upstream) : FGF12 (642867 downstream)																							TAAGTAAttatttgacaaact	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	192918798	192918798	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192918798delT								C3orf59 (282848 upstream) : HRASLS (40120 downstream)																							ccacccccactttttttttgc	0.000													0	6	---	---	---	---	
OPA1	4976	broad.mit.edu	37	3	193394027	193394028	+	Intron	INS	-	T	T	rs146299663	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193394027_193394028insT	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AGAAAAATTGATTTTTTTTTCC	0.267													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195416183	195416186	+	IGR	DEL	ATAT	-	-	rs113364013		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195416183_195416186delATAT								SDHAP2 (450 upstream) : MIR570 (10086 downstream)																							TATAATGCAAATATATATTTGCTT	0.265													2	4	---	---	---	---	
MUC20	200958	broad.mit.edu	37	3	195458847	195458871	+	Intron	DEL	TTTTGTTTTGTTTTGTTTTGTTTTG	-	-	rs34253275		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195458847_195458871delTTTTGTTTTGTTTTGTTTTGTTTTG	uc010hzo.2	+						MUC20_uc010hzp.2_Intron	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		AGCCAATTGCttttgttttgttttgttttgttttgttttgttttg	0.133													4	2	---	---	---	---	
SENP5	205564	broad.mit.edu	37	3	196610566	196610566	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196610566delT	uc003fwz.3	+						SENP5_uc011bty.1_Intron	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5						cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		TAGCTGCTGCttttttttttg	0.075													3	3	---	---	---	---	
DLG1	1739	broad.mit.edu	37	3	196922107	196922107	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196922107delA	uc003fxo.3	-						DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		AAGGCACAATAAAAAAAGAAT	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3585125	3585127	+	Intron	DEL	CTC	-	-	rs144308608		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3585125_3585127delCTC	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		cagacatcttctcccagtgtgtc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4607765	4607766	+	Intron	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4607765_4607766delGT	uc003gid.2	+											Homo sapiens, clone IMAGE:5204729, mRNA.																		CTCAAGTGGGGTGTGTGTGTGT	0.426													4	2	---	---	---	---	
RAB28	9364	broad.mit.edu	37	4	13433396	13433396	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13433396delA	uc003gmu.2	-						RAB28_uc003gmt.2_Intron|RAB28_uc011bwz.1_Intron|RAB28_uc003gmv.2_Intron	NM_001017979	NP_001017979	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family isoform 1						small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity			ovary(1)|skin(1)	2						accctcaaggaaaaaaagaat	0.000													4	2	---	---	---	---	
RAB28	9364	broad.mit.edu	37	4	13443969	13443969	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13443969delT	uc003gmu.2	-						RAB28_uc003gmt.2_Intron|RAB28_uc011bwz.1_Intron|RAB28_uc003gmv.2_Intron	NM_001017979	NP_001017979	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family isoform 1						small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity			ovary(1)|skin(1)	2						ATGCAGCATCTTTTTTTTTTA	0.333													4	2	---	---	---	---	
LDB2	9079	broad.mit.edu	37	4	16544348	16544349	+	Intron	INS	-	T	T	rs140614064	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16544348_16544349insT	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron|LDB2_uc003goy.2_Intron|LDB2_uc011bxi.1_Intron	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0						ATGCTCAATAATTTTTTTTTAA	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18453757	18453757	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18453757delA								LCORL (430372 upstream) : None (None downstream)																							GCAGCTCCAGAGGGATGTAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	19625495	19625495	+	IGR	DEL	T	-	-	rs33968955		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19625495delT								None (None upstream) : SLIT2 (629740 downstream)																							CATATTTTCATTTTTTTTTTT	0.363													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	22078449	22078449	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22078449delT								KCNIP4 (128075 upstream) : GPR125 (310550 downstream)																							TCAAGGTGGCTTTTTTCCCAT	0.358													4	2	---	---	---	---	
GPR125	166647	broad.mit.edu	37	4	22492089	22492090	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22492089_22492090insT	uc003gqm.1	-						GPR125_uc003gqo.2_Intron	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				TGAGTCTCTGATTTTTTTTCAG	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	23548053	23548053	+	IGR	DEL	T	-	-	rs66666345		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23548053delT								GBA3 (726862 upstream) : PPARGC1A (245592 downstream)																							aatggactggttttttttttg	0.159													4	2	---	---	---	---	
PPARGC1A	10891	broad.mit.edu	37	4	23884810	23884810	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23884810delA	uc003gqs.2	-						PPARGC1A_uc003gqt.2_Intron|PPARGC1A_uc011bxp.1_5'Flank|PPARGC1A_uc010ier.1_Intron|PPARGC1A_uc003gqu.3_3'UTR	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor						androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				AAGTAGAACTAACCACAACCT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	24025044	24025044	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24025044delA								PPARGC1A (133344 upstream) : MIR573 (496771 downstream)																							GATCCTCCCCAAAAAGTAGAG	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	24233826	24233826	+	IGR	DEL	A	-	-	rs111530085		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24233826delA								PPARGC1A (342126 upstream) : MIR573 (287989 downstream)																							GGAAGGATTGAAAAAAAAAAA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	24999505	24999506	+	IGR	INS	-	T	T	rs149801134	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24999505_24999506insT								CCDC149 (17735 upstream) : LGI2 (965 downstream)																							GATGCAGAACAtttttttttaa	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26046616	26046616	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26046616delT								C4orf52 (115116 upstream) : RBPJ (274716 downstream)																							CTCTTTCCCATTTTCTTGGCT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	27790058	27790059	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27790058_27790059insT								STIM2 (764250 upstream) : None (None downstream)																							CCACTGATGTATTTTTTTTCCC	0.416													4	2	---	---	---	---	
PCDH7	5099	broad.mit.edu	37	4	30839178	30839178	+	Intron	DEL	A	-	-	rs75084222		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30839178delA	uc011bxx.1	+						PCDH7_uc011bxw.1_Intron	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						GAAAATAGAGAAAAAAAAACG	0.318													6	3	---	---	---	---	
PCDH7	5099	broad.mit.edu	37	4	30845322	30845322	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30845322delT	uc011bxx.1	+						PCDH7_uc011bxw.1_Intron	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						ACTACCTAGATTTTTTTTTGT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31166080	31166080	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31166080delT								PCDH7 (17659 upstream) : None (None downstream)																							ATGATGACAATTTTTTTTCTT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31575519	31575519	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31575519delA								PCDH7 (427098 upstream) : None (None downstream)																							ACTTGTAATGAAAAAAAAAAA	0.274													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31974086	31974086	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31974086delG								PCDH7 (825665 upstream) : None (None downstream)																							ATCTTCTGATGGTAGATTGGT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	32311512	32311512	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32311512delC								None (None upstream) : None (None downstream)																							gaacattatgccccatctgta	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	34491245	34491245	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34491245delT								None (None upstream) : None (None downstream)																							TGTattcatcttttttaacag	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	35440124	35440124	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35440124delT								None (None upstream) : ARAP2 (509720 downstream)																							TTAATTGGAATTTTTTTTACT	0.244													4	2	---	---	---	---	
C4orf19	55286	broad.mit.edu	37	4	37566577	37566578	+	Intron	INS	-	ACACACACACACGTAC	ACACACACACACGTAC	rs35446364		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37566577_37566578insACACACACACACGTAC	uc003gsw.3	+							NM_001104629	NP_001098099	Q8IY42	CD019_HUMAN	hypothetical protein LOC55286												0						TTCCACCCCGTacacacacaca	0.396													4	2	---	---	---	---	
TBC1D1	23216	broad.mit.edu	37	4	37936573	37936574	+	Intron	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37936573_37936574delCT	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1						actgagtggactctctctctct	0.000													4	2	---	---	---	---	
TBC1D1	23216	broad.mit.edu	37	4	37989810	37989810	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37989810delT	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1						TTCCAATACATTTTTtgacct	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38309377	38309377	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38309377delA								TBC1D1 (168584 upstream) : FLJ13197 (304945 downstream)																							gtttgcagtgaaaaaaatatg	0.070													4	2	---	---	---	---	
RFC1	5981	broad.mit.edu	37	4	39314154	39314155	+	Intron	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39314154_39314155delAA	uc003gty.1	-						RFC1_uc003gtx.1_Intron	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit						DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						TAAATACACTAAAAAAAAGTCA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	44046155	44046155	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44046155delA								None (None upstream) : KCTD8 (129767 downstream)																							ttagtagaagaaaaaaaatac	0.000													4	2	---	---	---	---	
GABRA2	2555	broad.mit.edu	37	4	46267801	46267801	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46267801delT	uc003gxc.3	-						GABRA2_uc010igc.2_Intron|GABRA2_uc011bzc.1_Intron|GABRA2_uc003gxe.2_Intron	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2						gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	gatttgagaattttttttctc	0.000													4	2	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48669453	48669453	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48669453delT	uc003gyh.1	-						FRYL_uc003gyk.2_Intron|FRYL_uc003gym.1_Intron|FRYL_uc003gyn.3_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						ACCCCCTCGCTTTTTTTTTTT	0.234													4	2	---	---	---	---	
CWH43	80157	broad.mit.edu	37	4	48990903	48990904	+	Intron	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48990903_48990904delAA	uc003gyv.2	+						CWH43_uc011bzl.1_Intron	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog						GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						AGAAAGACCTAAAAATCACTGC	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49292354	49292354	+	IGR	DEL	G	-	-	rs111574778		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49292354delG								CWH43 (228261 upstream) : None (None downstream)																							aaggaaggaaggaaggaaaga	0.239													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49638909	49638909	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49638909delG								CWH43 (574816 upstream) : None (None downstream)																							gaattgaattgaatggaatgg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49657131	49657135	+	IGR	DEL	AATGG	-	-	rs148758805		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49657131_49657135delAATGG								CWH43 (593038 upstream) : None (None downstream)																							attaaaaactaatggaatggaatgg	0.000													5	5	---	---	---	---	
USP46	64854	broad.mit.edu	37	4	53517448	53517448	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53517448delC	uc003gzn.2	-						USP46_uc003gzm.3_Intron|USP46_uc011bzr.1_Intron|USP46_uc011bzs.1_Intron	NM_022832	NP_073743	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46 isoform 1						behavior|protein deubiquitination|regulation of synaptic transmission, GABAergic|ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(32;0.0295)			CCTCAGCTCACCTATAACAGA	0.274													4	2	---	---	---	---	
SCFD2	152579	broad.mit.edu	37	4	53823332	53823332	+	Intron	DEL	A	-	-	rs76776944		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53823332delA	uc003gzu.2	-						SCFD2_uc010igm.2_Intron|uc003gzw.1_3'UTR	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TAAGGGTTGGAAAAAAAAAAG	0.498													4	4	---	---	---	---	
CLOCK	9575	broad.mit.edu	37	4	56312647	56312647	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56312647delC	uc003haz.1	-						CLOCK_uc003hba.1_Intron|CLOCK_uc010igu.1_Intron	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			AGTAGAATTACCCAAAGTTGC	0.343													4	2	---	---	---	---	
LOC644145	644145	broad.mit.edu	37	4	56684721	56684721	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56684721delT	uc010igy.1	+							NR_003935				Homo sapiens cDNA clone IMAGE:9054530.												0						gtccaaaggcttagctggtat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56707189	56707189	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56707189delA								LOC644145 (3759 upstream) : EXOC1 (12627 downstream)																							cctgaagcagaaaaaaaaaat	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	58242901	58242902	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58242901_58242902insA								IGFBP7 (266362 upstream) : None (None downstream)																							TTACACACCTTAAAAAAATGTC	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	60343888	60343888	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60343888delG								None (None upstream) : None (None downstream)																							cctgtatgatgggtaagcttg	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61261899	61261899	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61261899delA								None (None upstream) : LPHN3 (805075 downstream)																							CCGAATATTTAAAAAAAAAAG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61581206	61581207	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61581206_61581207insC								None (None upstream) : LPHN3 (485767 downstream)																							gatatggtgtgcccctccctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	61999303	61999303	+	IGR	DEL	G	-	-	rs56412901		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61999303delG								None (None upstream) : LPHN3 (67671 downstream)																							TTAGTTAAGTGTTTCTTGATC	0.284													3	5	---	---	---	---	
LPHN3	23284	broad.mit.edu	37	4	62708343	62708343	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62708343delT	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc003hcs.1_Intron	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						GTGTTTTTCCTTAAAAAAAAT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	65428062	65428062	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65428062delA								TECRL (152884 upstream) : EPHA5 (757220 downstream)																							AAAATTTCCTAAATAAGTGAG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	65785274	65785274	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65785274delA								TECRL (510096 upstream) : EPHA5 (400008 downstream)																							ggaatcaaccaaaaatattta	0.000													4	2	---	---	---	---	
STAP1	26228	broad.mit.edu	37	4	68432970	68432970	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68432970delT	uc003hde.3	+						STAP1_uc003hdf.2_Intron	NM_012108	NP_036240	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1						cellular membrane fusion|intracellular protein transport	cytoplasm					0						TTGAGGACCATTTATTGGCTG	0.373													4	2	---	---	---	---	
TMPRSS11F	389208	broad.mit.edu	37	4	68995887	68995888	+	5'Flank	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68995887_68995888insG	uc003hdt.1	-							NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F						proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						TTTCCAAAAAAAAAAAAAAACC	0.391													4	2	---	---	---	---	
UGT2B4	7363	broad.mit.edu	37	4	70361792	70361792	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70361792delT	uc003hek.3	-						UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_5'Flank	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor						estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						TCTTTTTGGATTTTTTTTTTT	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	72856606	72856606	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72856606delA								GC (186848 upstream) : NPFFR2 (40915 downstream)																							atgccaatgcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
BTC	685	broad.mit.edu	37	4	75700472	75700472	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75700472delA	uc003hig.2	-							NM_001729	NP_001720	P35070	BTC_HUMAN	betacellulin precursor						positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity			central_nervous_system(1)|skin(1)	2			Lung(101;0.219)			tagacttctcaaaaaaggaaa	0.060													4	2	---	---	---	---	
RCHY1	25898	broad.mit.edu	37	4	76419633	76419634	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76419633_76419634delAC	uc003hik.2	-						RCHY1_uc010iio.2_5'UTR|RCHY1_uc003hij.2_Intron|RCHY1_uc003hil.2_Intron|RCHY1_uc010iip.2_Intron|RCHY1_uc010iiq.2_Intron|RCHY1_uc010iir.2_Intron	NM_015436	NP_056251	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein autoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nuclear speck|ubiquitin ligase complex	electron carrier activity|p53 binding|protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AGAAACACAGACACACACACAC	0.233													4	2	---	---	---	---	
SEPT11	55752	broad.mit.edu	37	4	77942823	77942823	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77942823delA	uc003hkj.2	+						SEPT11_uc010ijh.1_Intron|SEPT11_uc011cca.1_Intron	NM_018243	NP_060713	Q9NVA2	SEP11_HUMAN	septin 11						cell cycle|cell division|protein heterooligomerization	axon|cell junction|dendritic spine|septin complex|stress fiber|synapse	GTP binding|protein binding				0						TTCCTTGGGGAAAAAAAACCT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	78107209	78107209	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78107209delT								CCNG2 (15999 upstream) : CXCL13 (325698 downstream)																							ATATTATCACTTTTTTTTTCA	0.353													4	2	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79129681	79129681	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79129681delA	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ttaaggaaataaaaaaatgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	80064503	80064503	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80064503delG	uc003hlr.1	+											Homo sapiens full length insert cDNA clone YY75G10.																		ctgaagttgtgaacccctcaa	0.000													4	2	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83785932	83785932	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83785932delT	uc003hnf.2	-						SEC31A_uc003hne.2_Intron|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				ggttttttggttttttttttt	0.159													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	85157531	85157531	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85157531delT	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																		AGCATTTGAATTTAGGATTGT	0.338													4	2	---	---	---	---	
SLC10A6	345274	broad.mit.edu	37	4	87745311	87745312	+	Intron	INS	-	ATTC	ATTC	rs144636304	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87745311_87745312insATTC	uc003hqd.2	-							NM_197965	NP_932069	Q3KNW5	SOAT_HUMAN	sodium-dependent organic anion transporter							integral to membrane|plasma membrane	bile acid:sodium symporter activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		CAcactcatatattcattcatt	0.361													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	88622341	88622341	+	IGR	DEL	T	-	-	rs77691509		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88622341delT								DMP1 (36831 upstream) : IBSP (98361 downstream)																							atggtacatcttttttttttt	0.000													4	3	---	---	---	---	
ABCG2	9429	broad.mit.edu	37	4	89054064	89054064	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89054064delA	uc003hrg.2	-						ABCG2_uc003hrh.2_Intron|ABCG2_uc003hrf.2_5'Flank|ABCG2_uc003hri.1_Intron|ABCG2_uc003hrj.1_Intron|ABCG2_uc003hrk.1_Intron	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2						cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)	ctacttaaagaaaaaaaaaaa	0.139													4	2	---	---	---	---	
HERC3	8916	broad.mit.edu	37	4	89583088	89583088	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89583088delG	uc003hrw.1	+						HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TCAAAGCAAAGGGGAAAGAAG	0.244													4	2	---	---	---	---	
GPRIN3	285513	broad.mit.edu	37	4	90227821	90227821	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90227821delC	uc003hsm.1	-							NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth											ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TTTCTCCCCTCCCCCTCCAAG	0.522													4	2	---	---	---	---	
FAM190A	401145	broad.mit.edu	37	4	91858654	91858655	+	Intron	INS	-	C	C	rs148319170	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91858654_91858655insC	uc003hsv.3	+						FAM190A_uc003hsx.2_Intron	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2						acacacacacaaacacacacac	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	92597268	92597268	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92597268delT								FAM190A (73899 upstream) : GRID2 (628282 downstream)																							AATTAATTCCTTTTTTATTTG	0.234													5	3	---	---	---	---	
BMPR1B	658	broad.mit.edu	37	4	95815589	95815590	+	Intron	INS	-	AG	AG	rs138153336	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95815589_95815590insAG	uc003htm.3	+							NM_001203	NP_001194	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		tggccTTTAAAagagagagaga	0.129													2	4	---	---	---	---	
TSPAN5	10098	broad.mit.edu	37	4	99460722	99460722	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99460722delT	uc003hub.2	-						TSPAN5_uc011cdz.1_Intron	NM_005723	NP_005714	P62079	TSN5_HUMAN	transmembrane 4 superfamily member 9							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		TCCCTTTAGATTTTTTTTTTC	0.358													2	4	---	---	---	---	
ADH1A	124	broad.mit.edu	37	4	100231634	100231634	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100231634delT	uc011ceg.1	-						ADH1B_uc003hus.3_Intron|ADH1B_uc003hut.3_Intron|ADH1B_uc011ceh.1_Intron	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit						ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)	TTTTGTGGGGTTTTTTTTGGG	0.373													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	101714493	101714493	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101714493delT								EMCN (275243 upstream) : PPP3CA (230094 downstream)																							aagagattaatttttatgttc	0.095													4	2	---	---	---	---	
PPA2	27068	broad.mit.edu	37	4	106375458	106375459	+	Intron	DEL	GC	-	-	rs147385358	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106375458_106375459delGC	uc003hxl.2	-						PPA2_uc003hxm.2_Intron|PPA2_uc003hxn.2_Intron|PPA2_uc003hxo.2_Intron|PPA2_uc003hxp.2_Intron|PPA2_uc003hxq.2_Intron|PPA2_uc003hxr.2_Intron|PPA2_uc011cfa.1_Intron	NM_176869	NP_789845	Q9H2U2	IPYR2_HUMAN	inorganic pyrophosphatase 2 isoform 1 precursor						diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		ttttgctgctgctgttgttgtt	0.114													4	2	---	---	---	---	
GSTCD	79807	broad.mit.edu	37	4	106730912	106730913	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106730912_106730913insT	uc003hxz.3	+						GSTCD_uc003hxx.2_Intron|GSTCD_uc003hxy.3_Intron|GSTCD_uc011cfb.1_Intron	NM_001031720	NP_001026890	Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain							cytoplasm	rRNA methyltransferase activity			breast(1)|central_nervous_system(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		AGACAGGTTGGTTTTTTTTTTT	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	107576451	107576451	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107576451delT								AIMP1 (306072 upstream) : DKK2 (266509 downstream)																							TAAGATAAACTTTTTTTTTGC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	109334461	109334461	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109334461delA								LEF1 (244883 upstream) : LOC285456 (124885 downstream)																							aattgagactaaaaaaatgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111151244	111151244	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111151244delG								ELOVL6 (31424 upstream) : ENPEP (245985 downstream)																							CTTGCAACGTGGCAGAATGAA	0.353													4	2	---	---	---	---	
ENPEP	2028	broad.mit.edu	37	4	111409055	111409055	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111409055delA	uc003iab.3	+							NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase						cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	TTAGAGCCATAAAAAAAAATG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112430057	112430057	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112430057delT								MIR297 (648254 upstream) : C4orf32 (636496 downstream)																							atcttctgtgttttttttatc	0.080													4	2	---	---	---	---	
NDST4	64579	broad.mit.edu	37	4	115952457	115952457	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115952457delC	uc003ibu.2	-						NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TTCCATTGTTCAGAGGATAGA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117558616	117558616	+	IGR	DEL	A	-	-	rs72212709		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117558616delA								MIR1973 (337692 upstream) : TRAM1L1 (446100 downstream)																							GCTTCAGAAGAAAAAAAAAAC	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117657748	117657748	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117657748delT								MIR1973 (436824 upstream) : TRAM1L1 (346968 downstream)																							TATTTCTGGATTGCTTTCATG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	118918453	118918454	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118918453_118918454insG								TRAM1L1 (911717 upstream) : NDST3 (36319 downstream)																							ccccaaaaaaagaaatctccag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	120027994	120027994	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120027994delC								SYNPO2 (45601 upstream) : MYOZ2 (28945 downstream)																							GTCAGTGTAGCCCAGGAGATT	0.463													4	2	---	---	---	---	
MYOZ2	51778	broad.mit.edu	37	4	120097385	120097385	+	Intron	DEL	T	-	-	rs34481750		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120097385delT	uc003icp.3	+							NM_016599	NP_057683	Q9NPC6	MYOZ2_HUMAN	myozenin 2								protein phosphatase 2B binding				0						TTGAACAAACtttttttttta	0.050													2	4	---	---	---	---	
FGF2	2247	broad.mit.edu	37	4	123796510	123796510	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123796510delA	uc003iev.1	+							NM_002006	NP_001997	P09038	FGF2_HUMAN	fibroblast growth factor 2						activation of MAPK activity|branching involved in ureteric bud morphogenesis|cell migration involved in sprouting angiogenesis|chemotaxis|chondroblast differentiation|embryonic morphogenesis|fibroblast growth factor receptor signaling pathway|inositol phosphate biosynthetic process|insulin receptor signaling pathway|negative regulation of blood vessel endothelial cell migration|negative regulation of cell death|organ morphogenesis|phosphatidylinositol biosynthetic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cardiac muscle cell proliferation|positive regulation of cell division|positive regulation of cell fate specification|positive regulation of ERK1 and ERK2 cascade|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of phospholipase C activity|Ras protein signal transduction|release of sequestered calcium ion into cytosol|wound healing	extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|lung(1)|central_nervous_system(1)	3					Pentosan Polysulfate(DB00686)	CACTTATTTTATGAAAATCAT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	130087112	130087112	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130087112delA								C4orf33 (53270 upstream) : None (None downstream)																							ACAAAAGAAGAAAAAAAAAAT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	131215568	131215568	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131215568delT								None (None upstream) : None (None downstream)																							ttcgtttttgtttttttttcg	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	133672155	133672156	+	IGR	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133672155_133672156delTT								None (None upstream) : PCDH10 (398314 downstream)																							TAAGTGCTCCTTACATGCCAGT	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	133762308	133762309	+	IGR	INS	-	T	T	rs7673085		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133762308_133762309insT								None (None upstream) : PCDH10 (308161 downstream)																							taaaagctgagtttttttttgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	133935480	133935480	+	IGR	DEL	A	-	-	rs80124563		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133935480delA								None (None upstream) : PCDH10 (134990 downstream)																							AAACATTTGCAAAAAAAAACT	0.194													4	2	---	---	---	---	
PCDH10	57575	broad.mit.edu	37	4	134070665	134070665	+	5'UTR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134070665delA	uc003iha.2	+	1					uc003igy.2_5'Flank|PCDH10_uc003igz.2_5'UTR	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		GCGAAAGAGGAAAAAAATGTC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	137476769	137476769	+	IGR	DEL	C	-	-	rs7674477	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137476769delC								None (None upstream) : PCDH18 (963307 downstream)																							TTTTATTTTTCTTGCCTATCC	0.353													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138035910	138035910	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138035910delT								None (None upstream) : PCDH18 (404166 downstream)																							ctatttctgcttttttttttc	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138512799	138512800	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138512799_138512800insA								PCDH18 (59151 upstream) : SLC7A11 (572448 downstream)																							TGCAAGGAGGGAGGACATCACA	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138750567	138750567	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138750567delT								PCDH18 (296919 upstream) : SLC7A11 (334681 downstream)																							TAAAAATTACTTTTTTTTTAC	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	139630150	139630150	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139630150delC								SLC7A11 (466647 upstream) : CCRN4L (306793 downstream)																							tgcttgagctcccctagttct	0.139													4	2	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140924351	140924351	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140924351delC	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					TCACCTCCTGCCCCCAGGCCA	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	146257381	146257381	+	IGR	DEL	T	-	-	rs113335939		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146257381delT								OTUD4 (156549 upstream) : SMAD1 (145570 downstream)																							CTTCTTTTTCTTTTTTTTTTT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	147044056	147044056	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147044056delT	uc003iko.1	-						uc010ioy.1_5'Flank					Homo sapiens cDNA FLJ32671 fis, clone TESTI1000128.																		TTTCCTGGTCTTTTTTTTTTT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	149995879	149995879	+	IGR	DEL	A	-	-	rs4554049	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149995879delA								NR3C2 (632236 upstream) : None (None downstream)																							atttttttttaaaatttctca	0.000													4	2	---	---	---	---	
ARFIP1	27236	broad.mit.edu	37	4	153763980	153763980	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153763980delT	uc003imz.2	+						ARFIP1_uc003inb.2_Intron|ARFIP1_uc003ina.2_Intron|ARFIP1_uc003inc.2_Intron|ARFIP1_uc011cij.1_Intron	NM_001025595	NP_001020766	P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1						intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane				ovary(1)	1	all_hematologic(180;0.093)					ttcttatgtctttttttttgg	0.000													4	2	---	---	---	---	
KIAA0922	23240	broad.mit.edu	37	4	154453599	154453599	+	Intron	DEL	A	-	-	rs13126509		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154453599delA	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				Ctttttttttaaaaaaaaaaa	0.199													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	155006313	155006313	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155006313delT								SFRP2 (296085 upstream) : DCHS2 (149214 downstream)																							aatttggaaattttttgCTGA	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	155771147	155771148	+	IGR	INS	-	AA	AA	rs143916778	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155771147_155771148insAA								RBM46 (21183 upstream) : NPY2R (358633 downstream)																							aatcaatatataagtccccttg	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	156569989	156569990	+	IGR	INS	-	T	T	rs112984199		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156569989_156569990insT								MAP9 (271867 upstream) : GUCY1A3 (17872 downstream)																							gttgataaagcttttttttttt	0.000													4	4	---	---	---	---	
TDO2	6999	broad.mit.edu	37	4	156826769	156826770	+	Intron	INS	-	T	T	rs71602203		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156826769_156826770insT	uc003ipf.1	+							NM_005651	NP_005642	P48775	T23O_HUMAN	tryptophan 2,3-dioxygenase						tryptophan catabolic process to kynurenine	cytosol	tryptophan 2,3-dioxygenase activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)	L-Tryptophan(DB00150)	TGGGCAGTGGGTTTTTTTTTAG	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	156937108	156937108	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156937108delC								CTSO (62060 upstream) : PDGFC (745656 downstream)																							AATATTGGGTCCCCACGATAT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	157092959	157092959	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157092959delA								CTSO (217911 upstream) : PDGFC (589805 downstream)																							ttacaataagaaaaaaaaaAT	0.164													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	159272692	159272692	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159272692delA								TMEM144 (96254 upstream) : RXFP1 (170355 downstream)																							gccagaatatagggggaatgt	0.000													4	2	---	---	---	---	
FSTL5	56884	broad.mit.edu	37	4	162712558	162712559	+	Intron	DEL	AA	-	-	rs5863485		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162712558_162712559delAA	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AGATTGAAACAAAATTAATCTA	0.149													2	4	---	---	---	---	
FSTL5	56884	broad.mit.edu	37	4	162884319	162884319	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162884319delT	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CAGTTACTGCTTTTTTTTCAC	0.269													4	2	---	---	---	---	
KLHL2	11275	broad.mit.edu	37	4	166232339	166232339	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166232339delT	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		TTATCAAGAATTTCCTTAAAT	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	166679172	166679172	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166679172delA								CPE (259691 upstream) : TLL1 (115238 downstream)																							GCAGGGTTGTAAAAAAAAATA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	168711591	168711591	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168711591delT								SPOCK3 (555850 upstream) : ANXA10 (302116 downstream)																							GAAATGAGCATTTTTTAAATC	0.234													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173421781	173421781	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173421781delA	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						aatgttcaggaaaaaaaaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	176162628	176162628	+	IGR	DEL	T	-	-	rs11418294		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176162628delT								ADAM29 (263298 upstream) : GPM6A (391461 downstream)																							ATGCTATAAGTTTTTTTTTTC	0.274													3	4	---	---	---	---	
LOC285501	285501	broad.mit.edu	37	4	178812671	178812671	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178812671delT	uc010iru.2	+							NR_028342				Homo sapiens cDNA clone IMAGE:4828874.												0		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)		all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)		aaagacagaatttttttttcg	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	178969670	178969672	+	IGR	DEL	CTT	-	-	rs141923163		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178969670_178969672delCTT								LOC285501 (57767 upstream) : None (None downstream)																							AGTTGTCCTCCTTAATTCCCCTC	0.291													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179015598	179015598	+	IGR	DEL	A	-	-	rs634706	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179015598delA								LOC285501 (103695 upstream) : None (None downstream)																							tatctgagatattttaaaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179240286	179240286	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179240286delT								LOC285501 (328383 upstream) : None (None downstream)																							TAAAAATACATTTTTTTTtca	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179461718	179461720	+	IGR	DEL	GAG	-	-	rs147888469		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179461718_179461720delGAG								LOC285501 (549815 upstream) : None (None downstream)																							TGAGTGAAAAGAGGAGAAGGCGG	0.429													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	180831249	180831249	+	IGR	DEL	A	-	-	rs11300229		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180831249delA								None (None upstream) : None (None downstream)																							ctgtaaaaggaaaaaaaaaaa	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181273693	181273693	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181273693delC								None (None upstream) : None (None downstream)																							cagtcaccttctaccacgccc	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181527607	181527607	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181527607delA								None (None upstream) : None (None downstream)																							AACTTGAAGGAAAAAAAAATA	0.313													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	182076290	182076291	+	Intron	INS	-	TCTATCTATCTA	TCTATCTATCTA	rs141158606	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182076290_182076291insTCTATCTATCTA	uc003iuz.2	-											Homo sapiens full length insert cDNA clone YY72H05.																		tgatctgtctgtctatctatct	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184781242	184781242	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184781242delT								C4orf41 (146498 upstream) : STOX2 (45267 downstream)																							AATCATATTCTTTTTTTTTTA	0.269													4	3	---	---	---	---	
IRF2	3660	broad.mit.edu	37	4	185352751	185352752	+	Intron	INS	-	GCG	GCG	rs146168193	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185352751_185352752insGCG	uc003iwf.3	-							NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2						blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		CTAAATCCAGAGCGGTCAAGAA	0.535													2	4	---	---	---	---	
CCDC111	201973	broad.mit.edu	37	4	185606962	185606962	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185606962delT	uc003iwk.2	+						CCDC111_uc003iwj.2_Intron|CCDC111_uc003iwl.2_Intron|CCDC111_uc003iwm.2_Intron|CCDC111_uc003iwn.2_Intron	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111						DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		ATTAAAtttcttttttttttc	0.060													9	6	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186172974	186172974	+	Intron	DEL	A	-	-	rs76052830		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186172974delA	uc003ixh.2	+							NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		ACTTGTGGGGAAAAAAAAAAG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	188235354	188235355	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188235354_188235355insT								FAT1 (587504 upstream) : ZFP42 (681570 downstream)																							tcatttgtctatttttttttat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	188403723	188403723	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188403723delA								FAT1 (755873 upstream) : ZFP42 (513202 downstream)																							GTAAGTACTCAAAAAAATAAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190545398	190545399	+	IGR	INS	-	ATT	ATT	rs35790619		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190545398_190545399insATT								None (None upstream) : FRG1 (316575 downstream)																							ttgtggaagacgttgtgatcac	0.119													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190629253	190629254	+	IGR	DEL	CC	-	-	rs57704975		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190629253_190629254delCC								None (None upstream) : FRG1 (232720 downstream)																							CACACAAATACCTAAAAGTAAC	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190629256	190629264	+	IGR	DEL	AAAAGTAAC	-	-	rs61610645		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190629256_190629264delAAAAGTAAC								None (None upstream) : FRG1 (232710 downstream)																							ACAAATACCTAAAAGTAACCTAAAAgtct	0.215													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190746924	190746925	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190746924_190746925insT								None (None upstream) : FRG1 (115049 downstream)																							CTCAGGCTTGGTTTTTTTTCTG	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190823302	190823302	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190823302delG	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		ATGGACAGAAGCTGTGAGCTT	0.473													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	191037516	191037517	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:191037516_191037517insT								LOC653545 (27340 upstream) : None (None downstream)																							aggtaaacagattttttttatg	0.124													12	6	---	---	---	---	
CLPTM1L	81037	broad.mit.edu	37	5	1342124	1342125	+	Intron	INS	-	GT	GT	rs71598674		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1342124_1342125insGT	uc003jch.2	-						CLPTM1L_uc003jcg.2_5'Flank	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CTTTACGAGTCgtgtgtgtgtg	0.416													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2146620	2146621	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2146620_2146621insC								IRX4 (263740 upstream) : IRX2 (599660 downstream)																							CCTAATCACTTCCAGATCCTCC	0.406													5	3	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5279037	5279038	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5279037_5279038insA	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						ACCAAACAAACAAAAAAAACAA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6021293	6021293	+	IGR	DEL	A	-	-	rs11325887		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6021293delA								KIAA0947 (530956 upstream) : FLJ33360 (289261 downstream)																							ACACATCCACAACTATGGGTA	0.189													4	2	---	---	---	---	
UBE2QL1	134111	broad.mit.edu	37	5	6474211	6474211	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6474211delA	uc003jdp.3	+							NM_001145161	NP_001138633	A1L167	U2QL1_HUMAN	ubiquitin-conjugating enzyme E2Q family-like 1								ATP binding|ubiquitin-protein ligase activity				0						TTTACCTTCTAAAAGATACTT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6944006	6944012	+	IGR	DEL	TACACGA	-	-	rs11279914		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6944006_6944012delTACACGA								PAPD7 (186845 upstream) : ADCY2 (452331 downstream)																							GGAATGCGTCTACACGATATTGTTTCA	0.498													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8821563	8821563	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8821563delT								MTRR (920330 upstream) : SEMA5A (213575 downstream)																							tatttgcagattttttttagt	0.000													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11592728	11592728	+	Intron	DEL	A	-	-	rs141627260		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11592728delA	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						attcttaagtaaaaaaaaaaa	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12104055	12104055	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12104055delG								CTNND2 (199945 upstream) : None (None downstream)																							ggtcattcttggcccttctgt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13588389	13588389	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13588389delT								None (None upstream) : DNAH5 (102048 downstream)																							AACTTCCAAATTTTTTGGCTA	0.229													3	3	---	---	---	---	
FBXL7	23194	broad.mit.edu	37	5	15760933	15760933	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15760933delT	uc003jfn.1	+							NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						AAGTCATTGATTATTTGGATC	0.333													4	2	---	---	---	---	
FBXL7	23194	broad.mit.edu	37	5	15851341	15851341	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15851341delT	uc003jfn.1	+							NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						GTTCAGAGAATTTTTTTTTCT	0.398													4	2	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16766554	16766554	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16766554delT	uc003jft.3	-						MYO10_uc010itx.2_5'Flank	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						ttgcaactccttttttttgag	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17877799	17877800	+	Intron	INS	-	T	T	rs139017660	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17877799_17877800insT	uc003jgb.2	+											Homo sapiens cDNA clone IMAGE:5201079.																		TTTAAAGTGTGTTTTTTTTTTC	0.317													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17990811	17990812	+	IGR	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17990811_17990812delGT								BASP1 (713876 upstream) : None (None downstream)																							gtgtgcgtgggtgtgtgtgtgc	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20307738	20307738	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20307738delA								CDH18 (319431 upstream) : None (None downstream)																							TCTGGAGGGTAAAAATTACTT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20371334	20371334	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20371334delT								CDH18 (383027 upstream) : GUSBP1 (970608 downstream)																							gaataattactaggatcttcc	0.134													4	2	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21453247	21453248	+	Intron	INS	-	AA	AA	rs140503211	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21453247_21453248insAA	uc011cnn.1	+											Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						GGCATGGATATAACTCTTTTGG	0.347													5	5	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21564551	21564554	+	Intron	DEL	AAAA	-	-	rs71706943		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21564551_21564554delAAAA	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						tttcacacttaaaaaaaaatctgt	0.078													3	5	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21570911	21570911	+	Intron	DEL	T	-	-	rs66508635		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21570911delT	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						actttgcagatttttttttct	0.075													6	3	---	---	---	---	
CDH12	1010	broad.mit.edu	37	5	22720168	22720169	+	Intron	INS	-	AG	AG	rs76973032		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22720168_22720169insAG	uc003jgk.2	-							NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						cacacacacacaGAAGAAAACA	0.208										HNSCC(59;0.17)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23025700	23025700	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23025700delA								CDH12 (171969 upstream) : PRDM9 (482024 downstream)																							gtgatccttgaaaaaaaatgt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	25754174	25754175	+	IGR	INS	-	T	T	rs139339860	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25754174_25754175insT								None (None upstream) : None (None downstream)																							AATGAATCTTATTTTTTtttta	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	27792606	27792607	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27792606_27792607insC								CDH9 (753917 upstream) : None (None downstream)																							CTATGATATTTCCCCCTTGACC	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	29425727	29425728	+	IGR	INS	-	A	A	rs139149003	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29425727_29425728insA								None (None upstream) : None (None downstream)																							ACAACATTGAGAAAAAATTGTc	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30373820	30373820	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30373820delT								None (None upstream) : CDH6 (819976 downstream)																							AAAAAAGCCCTTTTTTTAAAG	0.239													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30933404	30933404	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30933404delA								None (None upstream) : CDH6 (260392 downstream)																							GGGGGGGAGGAAAAAAAAACA	0.264													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	32917066	32917066	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32917066delT								C5orf23 (125247 upstream) : TARS (523736 downstream)																							CTTATCGTAATTTTTTTTGTC	0.353											OREG0016551	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
ADAMTS12	81792	broad.mit.edu	37	5	33529498	33529498	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33529498delT	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TTCAATTAGATTTTTTTTTTT	0.413										HNSCC(64;0.19)			2	4	---	---	---	---	
ADAMTS12	81792	broad.mit.edu	37	5	33659216	33659216	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33659216delA	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						ACCAGCAGCTAACGGGGTTTG	0.438										HNSCC(64;0.19)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34109932	34109934	+	IGR	DEL	TGT	-	-	rs78871010		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34109932_34109934delTGT								C1QTNF3 (66615 upstream) : RAI14 (546499 downstream)																							tgatacagactgttttctgagaa	0.128													6	4	---	---	---	---	
RAI14	26064	broad.mit.edu	37	5	34719960	34719960	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34719960delT	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_Intron|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_Intron	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					TTCAAAGATATTTTTTGTGGT	0.393													4	2	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35119489	35119490	+	Intron	DEL	CA	-	-	rs112932819		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35119489_35119490delCA	uc003jjm.2	-							NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CTCTCTCTCTcacacacacaca	0.431													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35321142	35321143	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35321142_35321143insT								PRLR (90348 upstream) : SPEF2 (296846 downstream)																							GCTTATGTGTATTTTTTTTTTA	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35489917	35489918	+	IGR	DEL	AT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35489917_35489918delAT								PRLR (259123 upstream) : SPEF2 (128071 downstream)																							cagtcctctcatattaggtttg	0.000													4	2	---	---	---	---	
C5orf33	133686	broad.mit.edu	37	5	36196077	36196079	+	Intron	DEL	TAG	-	-	rs71979892		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36196077_36196079delTAG	uc003jkf.3	-						C5orf33_uc003jke.3_Intron|C5orf33_uc010iux.2_Intron|C5orf33_uc003jkg.3_Intron|C5orf33_uc011cov.1_Intron	NM_001085411	NP_001078880	Q4G0N4	NAKD1_HUMAN	hypothetical protein LOC133686 isoform 1								NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			gtaatagtaatagtagtgtgttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	36452432	36452432	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36452432delA								RANBP3L (150421 upstream) : SLC1A3 (154025 downstream)																							GACAGGAATGAAAAAAAAAAC	0.363													4	2	---	---	---	---	
SLC1A3	6507	broad.mit.edu	37	5	36667677	36667677	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36667677delG	uc003jkj.3	+						SLC1A3_uc011cox.1_Intron|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity						D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)	taacttctctggtctcttgtt	0.055													4	2	---	---	---	---	
NIPBL	25836	broad.mit.edu	37	5	36905248	36905248	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36905248delA	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TAAATTGGCCAAAAAAAATTA	0.259													2	4	---	---	---	---	
EGFLAM	133584	broad.mit.edu	37	5	38401416	38401416	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38401416delT	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron|EGFLAM_uc003jle.1_5'Flank|EGFLAM_uc003jlf.1_5'Flank|uc003jld.1_RNA	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					CTGAACTATCTTTAGATACTT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38796441	38796441	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38796441delA	uc003jlk.1	-											full-length cDNA clone CS0DI053YO12 of Placenta Cot 25-normalized of Homo sapiens (human).																		GAGAGAGATTAAAAAAAAACT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39531125	39531125	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39531125delA								DAB2 (105790 upstream) : None (None downstream)																							ATGAGATTACAAAAAAAAAAA	0.269													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40064109	40064109	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40064109delT								DAB2 (638774 upstream) : PTGER4 (615923 downstream)																							agtgcaggtatttttttggta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	40989879	40989879	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40989879delT								C7 (6840 upstream) : HEATR7B2 (8244 downstream)																							ttctttttccttttttttttt	0.124													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44892527	44892527	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44892527delT								MRPS30 (76913 upstream) : HCN1 (366826 downstream)																							ctatacacagttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	49434945	49434945	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49434945delC								None (None upstream) : EMB (257088 downstream)																							actgctctatccaaaaaaagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	50463752	50463752	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50463752delA								PARP8 (325583 upstream) : ISL1 (215206 downstream)																							TAATTCCAGGAAAAAAAGGAG	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	50792411	50792411	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50792411delA								ISL1 (101854 upstream) : None (None downstream)																							tatcaaaactaagacattatc	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51255070	51255071	+	IGR	INS	-	TGTG	TGTG	rs141381786	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51255070_51255071insTGTG								ISL1 (564513 upstream) : ITGA1 (828703 downstream)																							AGGCAtgtgtttgtgtgtgtgt	0.297													4	4	---	---	---	---	
ITGA1	3672	broad.mit.edu	37	5	52104513	52104514	+	Intron	INS	-	C	C	rs60113844		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52104513_52104514insC	uc003jou.2	+						ITGA1_uc003jov.2_Intron|PELO_uc003jot.1_Intron	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor						axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				tttctttctttttttttttttt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	54490196	54490197	+	IGR	INS	-	T	T	rs142262925	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54490196_54490197insT								CDC20B (21193 upstream) : CCNO (36786 downstream)																							TTTACAATGAAtttttttttct	0.153													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56942580	56942580	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56942580delT								ACTBL2 (163944 upstream) : PLK2 (807232 downstream)																							cattgtatagtttttttttgg	0.000													3	3	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58966440	58966440	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58966440delA	uc003jsa.2	-						PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	tccaaaatccaaaaaaaaaat	0.020													3	3	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	59325571	59325571	+	Intron	DEL	T	-	-	rs34134759		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59325571delT	uc003jsb.2	-						PDE4D_uc010iwj.1_Intron|PDE4D_uc003jse.1_Intron	NM_006203	NP_006194	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 2						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	tgagtctctgtttgttcttcc	0.204													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	61435504	61435504	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61435504delA								FLJ37543 (433142 upstream) : KIF2A (166485 downstream)																							GATGACTGACAAAAATTTTAC	0.249													4	2	---	---	---	---	
IPO11	51194	broad.mit.edu	37	5	61749360	61749360	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61749360delT	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtb.1_Intron	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		ATTGGCCAACTTTTTGTTCTG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	62220715	62220716	+	IGR	DEL	TT	-	-	rs111450647		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62220715_62220716delTT								ISCA1P1 (147545 upstream) : None (None downstream)																							gcttaaaccattttttttttgg	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	63221894	63221894	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63221894delT								None (None upstream) : HTR1A (34385 downstream)																							CTTTTCTTAATTTTTTTTTTA	0.323													2	4	---	---	---	---	
CWC27	10283	broad.mit.edu	37	5	64256039	64256039	+	Intron	DEL	T	-	-	rs35137019		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64256039delT	uc003jtn.1	+						CWC27_uc010iwt.1_Intron	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0						TTCCTAGGGATTTTTTTTTTT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	64371221	64371222	+	IGR	DEL	CA	-	-	rs34122514		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64371221_64371222delCA								CWC27 (56631 upstream) : ADAMTS6 (73342 downstream)																							ctctctctGTcacacacacaca	0.188													3	3	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64673991	64673991	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64673991delG	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		catatcttttggggggataca	0.114													4	2	---	---	---	---	
ADAMTS6	11174	broad.mit.edu	37	5	64718779	64718780	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64718779_64718780delAC	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron|ADAMTS6_uc003jtr.1_Intron	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		atatacacatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	65544811	65544811	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65544811delA								SFRS12 (68099 upstream) : MAST4 (347365 downstream)																							TTATTGCCAGAAAAAAAGAAG	0.254													4	2	---	---	---	---	
PIK3R1	5295	broad.mit.edu	37	5	67513831	67513831	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67513831delA	uc003jva.2	+							NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding			endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TCTGCTTTTTAAAAATAATGA	0.328			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			4	2	---	---	---	---	
PIK3R1	5295	broad.mit.edu	37	5	67595055	67595055	+	3'UTR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67595055delA	uc003jva.2	+	16					PIK3R1_uc003jvb.2_3'UTR|PIK3R1_uc003jvc.2_3'UTR|PIK3R1_uc003jvd.2_3'UTR|PIK3R1_uc003jve.2_3'UTR	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TCATTTTAGGAAAAAAAAAAG	0.363			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	70664485	70664486	+	Intron	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70664485_70664486insC	uc010iyu.1	-						uc003kbl.1_Intron					Homo sapiens cDNA FLJ41874 fis, clone OCBBF2019327.																		GAACACATAAGGAAAAAAAAAA	0.337													4	2	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70807821	70807821	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70807821delT	uc003kbp.1	+						BDP1_uc003kbo.2_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TTTCAAGGACTTTTTTTTTTT	0.289													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	73465641	73465642	+	IGR	INS	-	T	T	rs142281852	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73465641_73465642insT								RGNEF (228228 upstream) : ENC1 (457593 downstream)																							AAATGTCAGCATTTTCACCTCT	0.381													8	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	75063873	75063873	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75063873delA								POC5 (50560 upstream) : SV2C (315432 downstream)																							tgttcagttcaaaaaaatttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	75106122	75106122	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75106122delT								POC5 (92809 upstream) : SV2C (273183 downstream)																							ttgcttagtcttgctttggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	79699765	79699765	+	IGR	DEL	A	-	-	rs35409865		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79699765delA								LOC441089 (51980 upstream) : ZFYVE16 (4073 downstream)																							TGGTCATCAGAAAAAAAAAAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	81213693	81213693	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81213693delT								SSBP2 (166621 upstream) : ATG10 (54151 downstream)																							GCTCTGTCAATTTCCCCCAGT	0.438													4	2	---	---	---	---	
XRCC4	7518	broad.mit.edu	37	5	82527866	82527866	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82527866delT	uc003kib.2	+						XRCC4_uc003kia.1_Intron|XRCC4_uc003kid.2_Intron|XRCC4_uc003kic.2_Intron|XRCC4_uc003kie.2_Intron|XRCC4_uc003kif.1_Intron|XRCC4_uc003kig.2_Intron	NM_022406	NP_071801	Q13426	XRCC4_HUMAN	X-ray repair cross complementing protein 4						DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		TTGTTGGACATTACCCCCAAG	0.373								NHEJ					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	84091225	84091225	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84091225delA								EDIL3 (410614 upstream) : None (None downstream)																							CTCTACTGACAAAGATCCTTC	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	85883970	85883971	+	IGR	DEL	TA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85883970_85883971delTA								NBPF22P (290608 upstream) : COX7C (29813 downstream)																							TATAAATAACTATAGCTTGATC	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	86199507	86199507	+	IGR	DEL	C	-	-	rs10942477	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86199507delC								COX7C (282926 upstream) : RASA1 (364644 downstream)																							CTCATCTATTCTTTTTCTTTA	0.338													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	87700986	87700986	+	Intron	DEL	A	-	-	rs35360954		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87700986delA	uc003kjd.2	+						uc003kje.2_Intron					Homo sapiens cDNA clone IMAGE:4814828.																		TGCTATTATGAAAAAAAAAAA	0.338													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	89137245	89137245	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89137245delT								MEF2C (937376 upstream) : CETN3 (552286 downstream)																							AGAGTCCTGATTTTTTTTCCC	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92402160	92402160	+	IGR	DEL	T	-	-	rs58624706		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92402160delT								None (None upstream) : FLJ42709 (342905 downstream)																							accactgCTGTAGGGCACTCA	0.164													3	6	---	---	---	---	
C5orf36	285600	broad.mit.edu	37	5	93871490	93871493	+	Intron	DEL	TTTC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93871490_93871493delTTTC	uc011cuk.1	-						C5orf36_uc003kkp.2_Intron	NM_001145678	NP_001139150	Q8IV33	K0825_HUMAN	hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)		tacaaaaaagtttctttctcctca	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	94626344	94626345	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94626344_94626345insA								MCTP1 (6065 upstream) : FAM81B (100703 downstream)																							catgtggccagaaggagagagg	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95563708	95563709	+	IGR	DEL	TG	-	-	rs143739141		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95563708_95563709delTG								MIR583 (148792 upstream) : PCSK1 (162410 downstream)																							tttctctctctgtgtgtgtgtg	0.163													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	96947657	96947657	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96947657delC								RIOK2 (428652 upstream) : None (None downstream)																							TTTAAAAAATCCCAGTCATTT	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97313282	97313282	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97313282delT								RIOK2 (794277 upstream) : RGMB (791717 downstream)																							ACTTACTTACTTTTTTTTTCT	0.179													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97630233	97630233	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97630233delA								None (None upstream) : RGMB (474766 downstream)																							aagaatatacaaaaaaaaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	98721161	98721161	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98721161delG								CHD1 (458923 upstream) : LOC100133050 (994048 downstream)																							AAAGGAATACGGATATTTGTG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99020043	99020043	+	IGR	DEL	T	-	-	rs76849212	byFrequency	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99020043delT								CHD1 (757805 upstream) : LOC100133050 (695166 downstream)																							taaaaaaaaattaaatgtttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99145816	99145817	+	IGR	INS	-	C	C	rs143506247	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99145816_99145817insC								CHD1 (883578 upstream) : LOC100133050 (569392 downstream)																							AAACAAATGTTCCCTTGCCTTT	0.396													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99188562	99188563	+	IGR	INS	-	T	T	rs80297860		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99188562_99188563insT								CHD1 (926324 upstream) : LOC100133050 (526646 downstream)																							GAACAAAAAAAATGACCAGAAG	0.188													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99456430	99456430	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99456430delT								None (None upstream) : LOC100133050 (258779 downstream)																							CTCAATTCAATTTTTTTTTGT	0.294													4	2	---	---	---	---	
SLCO6A1	133482	broad.mit.edu	37	5	101725331	101725332	+	Intron	INS	-	C	C	rs148053853	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101725331_101725332insC	uc003knn.2	-						SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Intron|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		gtgatagtactatttttaatta	0.054													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102743418	102743418	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102743418delA								C5orf30 (129057 upstream) : NUDT12 (141139 downstream)																							TGTACAAAGCAAAACCTGGCC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102767761	102767762	+	IGR	INS	-	AGAC	AGAC	rs139474952	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102767761_102767762insAGAC								C5orf30 (153400 upstream) : NUDT12 (116795 downstream)																							TATCATGAATTAGACAGGTAAG	0.342													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	102979518	102979518	+	IGR	DEL	T	-	-	rs78608037		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102979518delT								NUDT12 (81028 upstream) : None (None downstream)																							TCTTTTTCAATTTTTTTTTTG	0.269													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103059469	103059470	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103059469_103059470insC								NUDT12 (160979 upstream) : None (None downstream)																							TGGCTTCTTTACCCCCCTACCT	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103663695	103663695	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103663695delT								NUDT12 (765205 upstream) : RAB9BP1 (771480 downstream)																							AATGAATGGCTTTTTTCCTGG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105062817	105062818	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105062817_105062818insA								RAB9BP1 (627019 upstream) : None (None downstream)																							gggccacagccccaaatattta	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105225229	105225229	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105225229delA								RAB9BP1 (789431 upstream) : None (None downstream)																							aatcagcaccaaaaaaatcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	107770516	107770516	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107770516delT								FBXL17 (52717 upstream) : FER (313007 downstream)																							gttttatgcattttttttttc	0.000													4	2	---	---	---	---	
FER	2241	broad.mit.edu	37	5	108385270	108385270	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108385270delT	uc003kop.1	+						FER_uc011cvg.1_Intron	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		tactctctacttttTTTTTTA	0.154													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	108655628	108655629	+	IGR	INS	-	G	G	rs139445770	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108655628_108655629insG								FER (132255 upstream) : PJA2 (14782 downstream)																							cgggtgggggtgggggggtggc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	109217019	109217020	+	IGR	INS	-	T	T	rs141370159	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109217019_109217020insT								MAN2A1 (13590 upstream) : TMEM232 (407914 downstream)																							ATATGATCCACTTTTTTTTTTG	0.337													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	110402320	110402321	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110402320_110402321insT								SLC25A46 (303838 upstream) : TSLP (3457 downstream)																							AACTGTGCCACTTTTTTTTTCA	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	111973367	111973367	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111973367delA								FLJ11235 (216694 upstream) : APC (69851 downstream)																							TTTGACCTTCAAAAATATCAG	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	112005704	112005704	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112005704delA								FLJ11235 (249031 upstream) : APC (37514 downstream)																							TATTACTGAGAAAAAAAAGAT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113228032	113228032	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113228032delA								YTHDC2 (297053 upstream) : KCNN2 (469984 downstream)																							AATTGGCCCCAAGCAATTTAG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113429928	113429929	+	IGR	INS	-	A	A	rs144886944	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113429928_113429929insA								YTHDC2 (498949 upstream) : KCNN2 (268087 downstream)																							TGACACTCTTTACCTGCCCTGC	0.446													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113637275	113637275	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113637275delT								YTHDC2 (706296 upstream) : KCNN2 (60741 downstream)																							GTGGGAACTGTTTCCAGCTAC	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	114775383	114775383	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114775383delT								CCDC112 (142925 upstream) : FEM1C (81225 downstream)																							attcccttggtttttgtttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	114785366	114785366	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114785366delT								CCDC112 (152908 upstream) : FEM1C (71242 downstream)																							TCTTGGATGCTTCCAATCACA	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115690882	115690882	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115690882delA								COMMD10 (61904 upstream) : SEMA6A (88370 downstream)																							atgaagctacaaaaaaaaaat	0.000													4	2	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115857948	115857949	+	Intron	INS	-	TTC	TTC	rs146026949	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115857948_115857949insTTC	uc010jck.2	-						SEMA6A_uc003krx.3_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TGTGCATGTGTTTTTTTAGAAC	0.342													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116067703	116067704	+	IGR	DEL	CA	-	-	rs76112432		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116067703_116067704delCA								SEMA6A (157152 upstream) : None (None downstream)																							TTCCCAGACTCACAGAATTAGA	0.347													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116588733	116588734	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116588733_116588734insG								SEMA6A (678182 upstream) : None (None downstream)																							tttactacgtaggggggcagct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116654851	116654851	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116654851delA								SEMA6A (744300 upstream) : None (None downstream)																							TAAAAATGATAAGGTTGTATA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	117684122	117684123	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117684122_117684123insA								None (None upstream) : DTWD2 (488448 downstream)																							tcattactgctaaaaaaaaaaa	0.000													4	3	---	---	---	---	
DTWD2	285605	broad.mit.edu	37	5	118193868	118193868	+	Intron	DEL	A	-	-	rs35031977		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118193868delA	uc003ksa.2	-							NM_173666	NP_775937	Q8NBA8	DTWD2_HUMAN	DTW domain containing 2												0		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)		TTCACATGGCAAAAAAAAAAA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	121453169	121453169	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121453169delA								LOX (39114 upstream) : ZNF474 (12046 downstream)																							AGAAACTCATAAAAAAACTGC	0.373													4	2	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121672212	121672213	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121672212_121672213insA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc010jct.2_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|SNCAIP_uc011cwm.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TCCCAGACCTCAGAAATTTGTC	0.292													4	2	---	---	---	---	
CSNK1G3	1456	broad.mit.edu	37	5	122913413	122913413	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122913413delT	uc003ktm.2	+						CSNK1G3_uc003ktl.2_Intron|CSNK1G3_uc003ktn.2_Intron|CSNK1G3_uc003kto.2_Intron|CSNK1G3_uc011cwr.1_Intron|CSNK1G3_uc011cws.1_Intron|CSNK1G3_uc010jda.2_Intron	NM_004384	NP_004375	Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3 isoform 1						Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		tattgaagagtttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123380996	123380996	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123380996delT								CSNK1G3 (428534 upstream) : ZNF608 (591614 downstream)																							CTTATGAAGATTTTTTTTTTG	0.323													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123716313	123716313	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123716313delT								CSNK1G3 (763851 upstream) : ZNF608 (256297 downstream)																							agttatctgataaatgagcag	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124976863	124976863	+	IGR	DEL	A	-	-	rs148591953		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124976863delA								ZNF608 (892363 upstream) : GRAMD3 (718925 downstream)																							accgcatcttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	125315387	125315387	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125315387delA								None (None upstream) : GRAMD3 (380401 downstream)																							GTGTTTAAAGAAAAAAAAATA	0.259													3	4	---	---	---	---	
GRAMD3	65983	broad.mit.edu	37	5	125718603	125718603	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125718603delC	uc011cwt.1	+						GRAMD3_uc011cwu.1_Intron	NM_001146319	NP_001139791	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3 isoform 1											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		tctcccccttcccctagggat	0.000													4	2	---	---	---	---	
MEGF10	84466	broad.mit.edu	37	5	126747243	126747246	+	Intron	DEL	TGTG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126747243_126747246delTGTG	uc003kuh.3	+						MEGF10_uc010jdc.1_Intron|MEGF10_uc010jdd.1_Intron|MEGF10_uc003kui.3_Intron	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GTTTGCACTCtgtgtgtgtgtgtg	0.265													4	2	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127737841	127737841	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127737841delA	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCACTGTATTAAAAAATGTAT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	129570093	129570093	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129570093delT								CHSY3 (47767 upstream) : HINT1 (924782 downstream)																							AAGATAGAAGTTTTTTTGGTC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	129829359	129829360	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129829359_129829360delCA								CHSY3 (307033 upstream) : HINT1 (665515 downstream)																							ctaaagcctccacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	130035854	130035855	+	IGR	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130035854_130035855delAA								CHSY3 (513528 upstream) : HINT1 (459020 downstream)																							agtgcgaaagaaaaaaaaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	130569746	130569746	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130569746delA								LYRM7 (28627 upstream) : CDC42SE2 (29956 downstream)																							tatgtgcaagaaaaaaaaatt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	130581147	130581147	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130581147delA								LYRM7 (40028 upstream) : CDC42SE2 (18555 downstream)																							CAAGAAGAAGAAAAAAAAATA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133015228	133015228	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133015228delC								FSTL4 (67005 upstream) : C5orf15 (275971 downstream)																							AGAAGGTGTGCCCATCACTTC	0.532													4	2	---	---	---	---	
CDKL3	51265	broad.mit.edu	37	5	133544237	133544239	+	Intron	DEL	CTC	-	-	rs149581546		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133544237_133544239delCTC	uc011cxm.1	-						CDKL3_uc011cxn.1_Intron|PPP2CA_uc003kze.2_Intron	NM_001113575	NP_001107047	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3 isoform 1							cytoplasm	ATP binding|cyclin-dependent protein kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGTAcagatgctcctcaatttgt	0.177													3	3	---	---	---	---	
TRPC7	57113	broad.mit.edu	37	5	135654533	135654533	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135654533delT	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ttcactgttgtttttttttta	0.000													5	3	---	---	---	---	
PCDHA1	56147	broad.mit.edu	37	5	140299567	140299568	+	Intron	INS	-	A	A	rs72541245	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140299567_140299568insA	uc003lhb.2	+						PCDHA1_uc003lha.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor						homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			gatagaagatggaaaacagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141923529	141923531	+	IGR	DEL	TCC	-	-	rs67212546		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141923529_141923531delTCC								SPRY4 (218909 upstream) : FGF1 (48213 downstream)																							GACAAAAATTTCCTCCTCCTCTT	0.217													5	5	---	---	---	---	
KCTD16	57528	broad.mit.edu	37	5	143832337	143832337	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143832337delA	uc003lnm.1	+						KCTD16_uc003lnn.1_Intron	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain							cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AAGCAAGAATAAAAAAAAAAA	0.403													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	144217052	144217052	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144217052delA								KCTD16 (360108 upstream) : PRELID2 (921530 downstream)																							gtttgctgagaaagaagatgg	0.129													4	2	---	---	---	---	
RBM27	54439	broad.mit.edu	37	5	145668696	145668696	+	3'UTR	DEL	A	-	-	rs78748150		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145668696delA	uc003lnz.3	+	21						NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27						mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCACAATTGGAAAAAAAAAAG	0.244													5	4	---	---	---	---	
FBXO38	81545	broad.mit.edu	37	5	147786778	147786778	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147786778delG	uc003lpf.1	+						FBXO38_uc003lpg.1_Intron|FBXO38_uc003lph.2_Intron	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b							cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTGATTGATGGCGATAGTTA	0.363													4	2	---	---	---	---	
NDST1	3340	broad.mit.edu	37	5	149926865	149926865	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149926865delG	uc003lsk.3	+						NDST1_uc011dcj.1_Intron	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan						heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGGAAGGGTGGGGGCCTGTC	0.592													4	2	---	---	---	---	
FAT2	2196	broad.mit.edu	37	5	150915783	150915783	+	Intron	DEL	A	-	-	rs11307084		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150915783delA	uc003lue.3	-						GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor						epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ccatattcagaaaaaaaaaCG	0.214													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152640269	152640270	+	IGR	INS	-	CG	CG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152640269_152640270insCG								NMUR2 (855429 upstream) : GRIA1 (228905 downstream)																							TGTAacacacacacacacacac	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153206460	153206460	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153206460delC								GRIA1 (13032 upstream) : FAM114A2 (164811 downstream)																							CAGCTCTTCTCCAGGGCCATT	0.502													4	2	---	---	---	---	
LARP1	23367	broad.mit.edu	37	5	154149793	154149793	+	Intron	DEL	T	-	-	rs113245853		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154149793delT	uc003lvp.2	+						LARP1_uc003lvo.2_Intron|LARP1_uc010jie.1_Intron	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2								protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTGGGCCTGATTTTTTTTTTT	0.219													4	4	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154275235	154275239	+	Intron	DEL	ATTAC	-	-	rs147830817		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154275235_154275239delATTAC	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTGATGGGTTATTACATTATTCTGC	0.200													5	3	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155193803	155193803	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155193803delC	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			caaattaaaaccaagggagtc	0.005													8	6	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155242891	155242891	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155242891delA	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGCTGGAAAGAAAAAAAAAGT	0.179													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155277185	155277185	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155277185delT	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTTTATTTGCTTTTTTCTGTA	0.353													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155295067	155295067	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155295067delT	uc003lwa.1	+							NM_172244	NP_758447	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAAGATGATCttttttttttt	0.194													4	2	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155886047	155886047	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155886047delC	uc003lwd.3	+						SGCD_uc003lwa.1_Intron|SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCAACAGAAACCATCTAAGAG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	156204745	156204745	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156204745delA								SGCD (9949 upstream) : PPP1R2P3 (72804 downstream)																							gaagcaaaataaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	156543406	156543406	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156543406delA								HAVCR2 (7268 upstream) : MED7 (22047 downstream)																							CGAGTAGAGGAAATGGAGAGG	0.338													4	2	---	---	---	---	
EBF1	1879	broad.mit.edu	37	5	158180128	158180128	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158180128delT	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGAAAGTAATTTTTTTTTAT	0.333			T	HMGA2	lipoma								4	2	---	---	---	---	
EBF1	1879	broad.mit.edu	37	5	158294658	158294659	+	Intron	INS	-	CTC	CTC	rs138975881	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158294658_158294659insCTC	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCAGACAATTCTCACCTGCCT	0.421			T	HMGA2	lipoma								4	2	---	---	---	---	
EBF1	1879	broad.mit.edu	37	5	158448297	158448297	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158448297delA	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCTCCCGCCAAAAAAAAGGG	0.388			T	HMGA2	lipoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	158830757	158830757	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158830757delA								IL12B (73276 upstream) : LOC285627 (44807 downstream)																							caaaataattaaacctctctc	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159185926	159185926	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159185926delA								LOC285627 (292642 upstream) : ADRA1B (157814 downstream)																							cccttagtacaaaaaaaaata	0.000													4	2	---	---	---	---	
ATP10B	23120	broad.mit.edu	37	5	160063990	160063991	+	Intron	INS	-	CCAC	CCAC	rs149045770		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160063990_160063991insCCAC	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron|ATP10B_uc003lyn.2_5'Flank|ATP10B_uc003lyo.2_Intron	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			aatccctccatccacccaccca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	160505474	160505474	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160505474delA								LOC285629 (139841 upstream) : GABRB2 (209962 downstream)																							TCTCATTTGGAAAAGGATATA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	160701223	160701224	+	IGR	INS	-	C	C	rs150779931	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160701223_160701224insC								LOC285629 (335590 upstream) : GABRB2 (14212 downstream)																							TTTGATGTGGTCTCATGACTAA	0.356													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161848585	161848586	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161848585_161848586delTG								GABRG2 (266041 upstream) : None (None downstream)																							CTtgtgtgtatgtgtgtgtgtg	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163573080	163573080	+	IGR	DEL	T	-	-	rs112397364		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163573080delT								MAT2B (626747 upstream) : None (None downstream)																							CGCTATCCTATTTTTTTTTTA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163634667	163634668	+	IGR	INS	-	CAT	CAT	rs151038869	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163634667_163634668insCAT								MAT2B (688334 upstream) : None (None downstream)																							TAATGTAGAGACATTAGGTTCA	0.208													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163680575	163680576	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163680575_163680576insT								MAT2B (734242 upstream) : None (None downstream)																							TAGAAAAAACGTTTCCAGACCT	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	164904599	164904599	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164904599delT								None (None upstream) : None (None downstream)																							GCCTTAAACATTTTTTTTCCC	0.313													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165445357	165445358	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165445357_165445358delTG								None (None upstream) : None (None downstream)																							GAATCATGTATGTGTGTGTGTG	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165514840	165514840	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165514840delA								None (None upstream) : None (None downstream)																							AGAGTAGACCAAGTCAGTCGT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165850735	165850735	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165850735delA								None (None upstream) : ODZ2 (861108 downstream)																							aaaaaaaaacaaaaaaaaaat	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166123882	166123882	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166123882delA								None (None upstream) : ODZ2 (587961 downstream)																							ACTTAAAGTTAAAATAAGAGT	0.333													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166858035	166858035	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166858035delT	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		ATCTTCTCTCTTATTTGGGGA	0.323													4	2	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169442575	169442575	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169442575delG	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTtttttttgtttgtttgtt	0.418													4	3	---	---	---	---	
C5orf58	133874	broad.mit.edu	37	5	169666403	169666403	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169666403delA	uc010jjn.2	+						C5orf58_uc003mal.2_Intron	NM_001102609	NP_001096079	C9J3I9	CE058_HUMAN	hypothetical protein LOC133874												0						ctgaaaattgaaaaaaaaaaa	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172736105	172736105	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172736105delC								NKX2-5 (73843 upstream) : STC2 (5621 downstream)																							ACCATTTTGTCCCCCCCCAAC	0.299													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173311027	173311028	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173311027_173311028insA								BOD1 (267361 upstream) : CPEB4 (4303 downstream)																							CAGCATTAGTTAAAAAAAAAAA	0.361													4	2	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177807394	177807395	+	Intron	INS	-	TG	TG	rs142357430	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177807394_177807395insTG	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GAGCATGCATTtgtgtgtgtgt	0.396													4	5	---	---	---	---	
TBC1D9B	23061	broad.mit.edu	37	5	179295046	179295046	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179295046delT	uc003mlh.2	-						TBC1D9B_uc003mli.2_Intron|TBC1D9B_uc003mlj.2_Intron|TBC1D9B_uc003mlf.2_5'Flank|TBC1D9B_uc003mlg.2_Intron|TBC1D9B_uc011dgv.1_Intron|TBC1D9B_uc011dgw.1_Intron	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)							integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTTCCTCAGCttttttttttt	0.259													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180122585	180122588	+	IGR	DEL	CAAA	-	-	rs140448796		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180122585_180122588delCAAA								FLT4 (45961 upstream) : OR2Y1 (43535 downstream)																							atagagtgtgcaaacacacagtta	0.000													4	3	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	488586	488586	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:488586delA	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CTCAAAAATTAAAAAAAAAAT	0.254													3	3	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	560150	560150	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:560150delA	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TTTAACAaataaaaatccttt	0.154													4	2	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5615767	5615767	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5615767delT	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	cttcactacattttaaaaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	5788533	5788533	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5788533delT								FARS2 (16717 upstream) : NRN1 (209702 downstream)																							tgctcctttctttTTTTTAAG	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7721818	7721818	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7721818delA								SNRNP48 (109619 upstream) : BMP6 (5193 downstream)																							TTTTGCTCAGAAAAAAAATTG	0.323													4	2	---	---	---	---	
BMP6	654	broad.mit.edu	37	6	7755903	7755903	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7755903delA	uc003mxu.3	+							NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein						BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					atttttttttaatctagaatc	0.000													4	2	---	---	---	---	
TXNDC5	81567	broad.mit.edu	37	6	8005800	8005803	+	Intron	DEL	ACTG	-	-	rs72392084		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8005800_8005803delACTG	uc003mxw.2	-							NM_001145549	NP_001139021	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)					GGAAAAAAATACTGACAACTAGCT	0.324													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9581607	9581607	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9581607delT								HULC (927530 upstream) : TFAP2A (815310 downstream)																							GTTTTTACCATCCTGTGGAAC	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11981092	11981093	+	IGR	INS	-	A	A	rs72544735	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11981092_11981093insA								C6orf105 (201812 upstream) : HIVEP1 (31631 downstream)																							CACAAAATAGTGTAACTGTTTA	0.297													4	5	---	---	---	---	
RNF182	221687	broad.mit.edu	37	6	13975465	13975465	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13975465delA	uc003nbe.2	+						RNF182_uc003nbf.2_Intron|RNF182_uc003nbg.2_Intron	NM_152737	NP_689950	Q8N6D2	RN182_HUMAN	ring finger protein 182							cytoplasm|integral to membrane|intracellular membrane-bounded organelle	protein binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			CCACAGGAGGAAAAAAAATGC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14701961	14701961	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14701961delC								CD83 (564815 upstream) : JARID2 (543773 downstream)																							GAAGTTCCCGCCCCCAGCTGT	0.358													4	2	---	---	---	---	
KIF13A	63971	broad.mit.edu	37	6	17826830	17826831	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17826830_17826831delAC	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron|KIF13A_uc003ncj.2_Intron	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GGATAAACAGACACACACACAC	0.079													2	4	---	---	---	---	
DEK	7913	broad.mit.edu	37	6	18257956	18257956	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18257956delA	uc003ncr.1	-						DEK_uc011djf.1_Intron|DEK_uc011djg.1_Intron	NM_003472	NP_003463	P35659	DEK_HUMAN	DEK oncogene isoform 1						chromatin modification|regulation of transcription from RNA polymerase II promoter|signal transduction|transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|histone binding			kidney(1)	1	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			taaaagaaagaaaaaaaaaag	0.000			T	NUP214	AML								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20014421	20014421	+	IGR	DEL	T	-	-	rs67065332		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20014421delT								ID4 (173507 upstream) : MBOAT1 (86514 downstream)																							CTACTCGCTATTTTTTTTTTT	0.388													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20231056	20231056	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20231056delA								MBOAT1 (18386 upstream) : E2F3 (171081 downstream)																							agataggaggaaaaaaaaaag	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20289990	20289990	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20289990delA								MBOAT1 (77320 upstream) : E2F3 (112147 downstream)																							aacttgggggaaaaaaagctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	23230125	23230125	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23230125delA								HDGFL1 (659376 upstream) : NRSN1 (896289 downstream)																							ATACAGTCACAAAAAAAAGGG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25191725	25191725	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25191725delA								CMAH (24932 upstream) : LRRC16A (87923 downstream)																							gcgaagtggtaagtaggaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25882043	25882044	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25882043_25882044insG								SLC17A3 (7572 upstream) : SLC17A2 (30947 downstream)																							CTCAGCTTTCAGGAAACCAATG	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32448569	32448570	+	IGR	INS	-	A	A	rs67983085		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32448569_32448570insA								HLA-DRA (35748 upstream) : HLA-DRB1 (36593 downstream)																							AGACAGTTTGCAAAAATGAGCA	0.411													4	2	---	---	---	---	
BTBD9	114781	broad.mit.edu	37	6	38523638	38523639	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38523638_38523639insA	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a						cell adhesion						0						TGTATTTTTGCAAAATCTGCCA	0.356													4	2	---	---	---	---	
BTBD9	114781	broad.mit.edu	37	6	38549232	38549232	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38549232delG	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9 isoform a						cell adhesion						0						TTGATAGTCTGTCATCAAAAT	0.313													4	2	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38829340	38829340	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38829340delT	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						acctggtttctttttttgttt	0.060													4	2	---	---	---	---	
LOC221442	221442	broad.mit.edu	37	6	41095525	41095525	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41095525delT	uc003ops.2	+						LOC221442_uc003opt.2_Intron|LOC221442_uc003opu.2_Intron	NR_026938				Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 1709050.												0						AAATTATTTCTTtttttttct	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	41734038	41734041	+	IGR	DEL	GAAA	-	-	rs111511560		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41734038_41734041delGAAA								PGC (18917 upstream) : FRS3 (3873 downstream)																							aagaaagaaggaaagaaagaaaga	0.039													1	5	---	---	---	---	
ZNF318	24149	broad.mit.edu	37	6	43326770	43326770	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43326770delA	uc003oux.2	-						ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			ttcaattgggaaaaaaaagtA	0.129													4	2	---	---	---	---	
LOC100132354	100132354	broad.mit.edu	37	6	43887857	43887857	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43887857delA	uc011dvm.1	+							NR_024478				Homo sapiens cDNA FLJ38229 fis, clone FCBBF2004256.												0						GACTGATTTTAAAAGTGCTTG	0.343													4	2	---	---	---	---	
MEP1A	4224	broad.mit.edu	37	6	46793414	46793415	+	Intron	INS	-	T	T	rs144936463	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46793414_46793415insT	uc010jzh.1	+						MEP1A_uc011dwg.1_Intron|MEP1A_uc011dwh.1_Intron|MEP1A_uc011dwi.1_Intron	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor						digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			gtctatggctgtttttgcgctt	0.158													5	9	---	---	---	---	
TNFRSF21	27242	broad.mit.edu	37	6	47259161	47259161	+	Intron	DEL	A	-	-	rs71778442		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47259161delA	uc003oyv.2	-							NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,						cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)			TTAGAGGGTGAAAAACCAACA	0.498													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	47812631	47812631	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47812631delT								OPN5 (18517 upstream) : C6orf138 (33409 downstream)																							ctttttcttatttttttattg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	48316338	48316338	+	IGR	DEL	A	-	-	rs5876056		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48316338delA								C6orf138 (237395 upstream) : None (None downstream)																							TACACTAAGCAAAAAATTCTT	0.154													4	2	---	---	---	---	
LOC730101	730101	broad.mit.edu	37	6	52530655	52530655	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52530655delG	uc003pav.2	+						LOC730101_uc003paw.3_Intron	NR_024405				Homo sapiens cDNA FLJ33798 fis, clone CTONG2000063.												0						GTCTTAGACTGGGACTGTCAG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	53047573	53047573	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53047573delT								GCM1 (33949 upstream) : ELOVL5 (84623 downstream)																							cctcaggtgatccatctgcct	0.065													4	2	---	---	---	---	
LRRC1	55227	broad.mit.edu	37	6	53787794	53787794	+	3'UTR	DEL	T	-	-	rs67155925		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53787794delT	uc003pcd.1	+	14						NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CCCGGTGTGATTTTTTTTTTT	0.458													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	54547963	54547963	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54547963delT								TINAG (293013 upstream) : FAM83B (163606 downstream)																							TTCCTGTGAGTTTTAATGGGT	0.398													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57254950	57254951	+	Intron	INS	-	T	T	rs145182844	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57254950_57254951insT	uc003pdx.2	+						hsa-mir-548u|MI0014168_RNA	NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgcaaaagtaatgtggtttttt	0.252													4	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57257973	57257974	+	Intron	INS	-	GTG	GTG	rs140385725	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57257973_57257974insGTG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gatacccagtagtgttgctgga	0.000													6	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57276405	57276405	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57276405delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aatattgtttaaattttttaa	0.010													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57334901	57334902	+	Intron	INS	-	TAGAT	TAGAT			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57334901_57334902insTAGAT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AATAATGTAAGTAGTATTTGAG	0.292													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57359669	57359670	+	Intron	INS	-	AATATTA	AATATTA	rs142753141	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57359669_57359670insAATATTA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ACATCCTCAATAATGAGTTTTG	0.312													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57390882	57390885	+	Intron	DEL	TTTG	-	-	rs71787468		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57390882_57390885delTTTG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TGTTTTTTTATTTGTTTGTTTGTT	0.377													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57404370	57404371	+	Intron	INS	-	A	A	rs139203387		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57404370_57404371insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		aaagaaacacgaaaagcagctc	0.104													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57432144	57432145	+	Intron	INS	-	T	T	rs11435895		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57432144_57432145insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gtatgcacctctaaaaaaaata	0.030													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57446941	57446941	+	Intron	DEL	A	-	-	rs66606417		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57446941delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ACTATGAAAGAAAAAAAAAAG	0.254													2	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57454042	57454042	+	Intron	DEL	G	-	-	rs67619850		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57454042delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ataaaagacaggatagtgtta	0.000													6	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57489752	57489755	+	Intron	DEL	TCTT	-	-	rs139252788		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57489752_57489755delTCTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TAAAAGTAACTCTTTGTCAAGAAG	0.270													5	5	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57501872	57501872	+	Intron	DEL	A	-	-	rs11344307		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57501872delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCCCCCAAATAAAATCCTATG	0.303													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57515066	57515070	+	IGR	DEL	TGTCA	-	-	rs138941800		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57515066_57515070delTGTCA								PRIM2 (1691 upstream) : GUSBL2 (731089 downstream)																							TTTGATCTCCTGTCATGTATTATAC	0.268													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57524791	57524793	+	IGR	DEL	TTT	-	-	rs35354100		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57524791_57524793delTTT								PRIM2 (11416 upstream) : GUSBL2 (721366 downstream)																							gtaatacatcttttgtttcacac	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57553564	57553564	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57553564delA								PRIM2 (40189 upstream) : GUSBL2 (692595 downstream)																							tttctatcacaattccaataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57561998	57561998	+	IGR	DEL	A	-	-	rs111734895		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57561998delA								PRIM2 (48623 upstream) : GUSBL2 (684161 downstream)																							gactgaggagacttttcacct	0.000													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57562855	57562855	+	IGR	DEL	A	-	-	rs68009168		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57562855delA								PRIM2 (49480 upstream) : GUSBL2 (683304 downstream)																							aagctgtcacaaaaggagatg	0.025													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58146994	58146995	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58146994_58146995insT								PRIM2 (633619 upstream) : GUSBL2 (99164 downstream)																							TAGAACACTTGTTTTttttcca	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	68073505	68073505	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68073505delA								None (None upstream) : None (None downstream)																							ACACCTACTCAAAAACACGCA	0.363													3	3	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	69665690	69665690	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69665690delA	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				tctccaaatgaaaaaaaaaaa	0.129													5	3	---	---	---	---	
KCNQ5	56479	broad.mit.edu	37	6	73799966	73799966	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73799966delT	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		cttagcccactttttgatggg	0.000													4	2	---	---	---	---	
IMPG1	3617	broad.mit.edu	37	6	76735217	76735217	+	Intron	DEL	T	-	-	rs146322420		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76735217delT	uc003pik.1	-							NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1						visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GTAAGCATCCTTTTTTTTGTG	0.378													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	78644383	78644383	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78644383delT								HTR1B (471263 upstream) : IRAK1BP1 (932806 downstream)																							ATGAAGCATATTTTGCAATGG	0.368													4	2	---	---	---	---	
LCA5	167691	broad.mit.edu	37	6	80203711	80203711	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80203711delG	uc003pix.2	-						LCA5_uc003piy.2_Intron|LCA5_uc011dyq.1_Intron	NM_001122769	NP_001116241	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5						protein transport	cilium axoneme|microtubule basal body	protein binding				0		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		Aggctgggatggtggctcatg	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	80788519	80788520	+	IGR	DEL	AC	-	-	rs71742212		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80788519_80788520delAC								TTK (36282 upstream) : BCKDHB (27824 downstream)																							GCATATGTATacacacacacac	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	81216515	81216515	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81216515delT								BCKDHB (160528 upstream) : None (None downstream)																							ATGAAATAGCTTTTTTTTGGT	0.274													4	2	---	---	---	---	
MRAP2	112609	broad.mit.edu	37	6	84785202	84785202	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84785202delT	uc003pkg.3	+						MRAP2_uc010kbo.2_Intron	NM_138409	NP_612418	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2						positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding			skin(2)	2						CTTTTCTGGATTTTTTAAGGA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	86512266	86512266	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86512266delA								SNHG5 (123815 upstream) : None (None downstream)																							gcatgagtgtaaaatgatcct	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88899835	88899835	+	IGR	DEL	T	-	-	rs34774114		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88899835delT								CNR1 (24068 upstream) : RNGTT (420154 downstream)																							tcttttgcaatttttttttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	89020023	89020023	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89020023delA								CNR1 (144256 upstream) : RNGTT (299966 downstream)																							CTCTTCTACTAAGGGCAGTTA	0.259													4	2	---	---	---	---	
MAP3K7	6885	broad.mit.edu	37	6	91248772	91248772	+	Intron	DEL	A	-	-	rs3799911	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91248772delA	uc003pnz.1	-						MAP3K7_uc003pny.1_5'Flank|MAP3K7_uc003poa.1_Intron|MAP3K7_uc003pob.1_Intron|MAP3K7_uc003poc.1_Intron	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		CCCAAGATTTAAAAAAATGCA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92069224	92069224	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92069224delT								MAP3K7 (772317 upstream) : None (None downstream)																							GGTGACTGTATTTTTTGATGT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	96392977	96392977	+	IGR	DEL	T	-	-	rs72246815		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96392977delT								MANEA (335651 upstream) : FUT9 (70868 downstream)																							CTTCCCTTTCTTTTTTCACTT	0.343													3	3	---	---	---	---	
FHL5	9457	broad.mit.edu	37	6	97024807	97024808	+	Intron	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97024807_97024808insC	uc003pos.1	+						FHL5_uc003pot.1_Intron	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator							nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		TAACAGATTTTCCCCATTTCCT	0.337													4	2	---	---	---	---	
GPR63	81491	broad.mit.edu	37	6	97262705	97262705	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97262705delA	uc010kcl.2	-						GPR63_uc003pou.2_Intron	NM_001143957	NP_001137429	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63							integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		CAAAATGACCAAAAAAAAATG	0.383													4	2	---	---	---	---	
FBXL4	26235	broad.mit.edu	37	6	99340968	99340968	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99340968delT	uc003ppf.1	-						FBXL4_uc003ppg.1_Intron|FBXL4_uc003pph.1_Intron|FBXL4_uc010kcp.2_Intron	NM_012160	NP_036292	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4						ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex				skin(2)	2		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TGACTCCAGATTTTTTTTTTC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	104541934	104541934	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104541934delT								None (None upstream) : HACE1 (634034 downstream)																							CGCACTGAGATTTTTTTGAAA	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	105073447	105073447	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105073447delT								None (None upstream) : HACE1 (102521 downstream)																							TGAATCTCAGTTTGGGTCTGT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107451151	107451152	+	IGR	INS	-	C	C	rs144680291	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107451151_107451152insC								BEND3 (15515 upstream) : PDSS2 (22609 downstream)																							ACAGTCTTATACCCCCACATGG	0.450													2	4	---	---	---	---	
LACE1	246269	broad.mit.edu	37	6	108704979	108704979	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108704979delT	uc003psj.2	+							NM_145315	NP_660358	Q8WV93	LACE1_HUMAN	lactation elevated 1								ATP binding			central_nervous_system(1)	1		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)		TGCCTTCTGCTTTTCAAATTA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	109556216	109556217	+	5'Flank	INS	-	GA	GA	rs144538326	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109556216_109556217insGA	uc003pta.1	+											RecName: Full=Transmembrane protein FLJ37396;																		gagagagagaggagagagagag	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	109630510	109630510	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109630510delT								C6orf182 (145397 upstream) : CD164 (57208 downstream)																							AAACTTGGCATTTTCATACAG	0.259													4	2	---	---	---	---	
ZBTB24	9841	broad.mit.edu	37	6	109800037	109800037	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109800037delA	uc003ptl.1	-						ZBTB24_uc011ear.1_Intron|ZBTB24_uc010kds.1_Intron|ZBTB24_uc010kdt.1_Intron	NM_014797	NP_055612	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		aagcaagaagaaaaaaaaaag	0.000													3	3	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112475741	112475741	+	Intron	DEL	T	-	-	rs66713115		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112475741delT	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		ttttaggacatttttccccta	0.060													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116406880	116406880	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116406880delT								FRK (24959 upstream) : NT5DC1 (15119 downstream)																							tgtgtgggtgtgtgtgtgtgt	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116406882	116406882	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116406882delT								FRK (24961 upstream) : NT5DC1 (15117 downstream)																							tgtgggtgtgtgtgtgtgtgt	0.343													4	2	---	---	---	---	
C6orf204	387119	broad.mit.edu	37	6	118916182	118916182	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118916182delT	uc003pxz.1	-						C6orf204_uc003pya.1_Intron|C6orf204_uc003pyb.2_Intron|C6orf204_uc011ebj.1_Intron|C6orf204_uc003pyc.2_Intron|C6orf204_uc011ebl.1_Intron	NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		AGTAAGTTTCTTTTTTTTGCC	0.458													5	3	---	---	---	---	
NKAIN2	154215	broad.mit.edu	37	6	124170105	124170105	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124170105delA	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		GCTAAACTTTAAAAATCATAT	0.323													4	2	---	---	---	---	
PTPRK	5796	broad.mit.edu	37	6	128718505	128718505	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128718505delT	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Intron|PTPRK_uc003qbm.3_Intron	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AATACTTATCTTTTTTTTTTC	0.229													5	3	---	---	---	---	
EPB41L2	2037	broad.mit.edu	37	6	131220932	131220933	+	Intron	INS	-	TACC	TACC	rs146154470	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131220932_131220933insTACC	uc003qch.2	-						EPB41L2_uc003qcg.1_Intron|EPB41L2_uc011eby.1_Intron|EPB41L2_uc003qci.2_Intron|EPB41L2_uc010kfk.2_Intron|EPB41L2_uc010kfl.1_Intron	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2						cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		GCATGGAGGTATACCTCCACTC	0.351													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134177431	134177432	+	Intron	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134177431_134177432delTG	uc003qeg.1	-											Homo sapiens cDNA FLJ36194 fis, clone TESTI2027615.																		TAATTGACAATGTAACACCGAG	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	135593706	135593706	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135593706delT								MIR548A2 (33312 upstream) : AHI1 (11406 downstream)																							tctttctttcttttttttttt	0.109													4	3	---	---	---	---	
C6orf217	100131814	broad.mit.edu	37	6	135853724	135853725	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135853724_135853725insA	uc003qgn.2	+						C6orf217_uc003qgo.2_Intron|C6orf217_uc010kgo.2_Intron|C6orf217_uc003qgm.2_Intron					Homo sapiens cDNA clone IMAGE:4795512.												0						AGAGGGATGACAaaaaaaaagg	0.252													5	3	---	---	---	---	
PEX7	5191	broad.mit.edu	37	6	137219074	137219074	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137219074delT	uc003qhd.2	+						PEX7_uc010kgx.2_Intron	NM_000288	NP_000279	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7						ether lipid biosynthetic process|protein import into peroxisome matrix	peroxisome	peroxisome matrix targeting signal-2 binding				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		TGATGTAGGGtttttttttta	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	137417398	137417399	+	IGR	INS	-	T	T	rs142471376	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137417398_137417399insT								IL20RA (51100 upstream) : IL22RA2 (47559 downstream)																							TCACCAGGAAATTTTCTTGGTG	0.460													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138059127	138059127	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138059127delA								OLIG3 (243596 upstream) : TNFAIP3 (129454 downstream)																							CACTCATCTTAAAAAAAAATC	0.338													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138332845	138332846	+	IGR	INS	-	C	C	rs142413695	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138332845_138332846insC								TNFAIP3 (128400 upstream) : PERP (76796 downstream)																							AACAGAGCAGACCCCCCCCAGA	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142803464	142803465	+	IGR	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142803464_142803465delAG								GPR126 (36063 upstream) : LOC153910 (44127 downstream)																							gggaaaaagaagagagagagag	0.257													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	144672919	144672919	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144672919delA	uc003qkt.2	+						UTRN_uc010khq.1_Intron	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CCGCTGATCCAAATACTCTGA	0.433													4	2	---	---	---	---	
GRM1	2911	broad.mit.edu	37	6	146747328	146747329	+	Intron	INS	-	AAG	AAG	rs145800679	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146747328_146747329insAAG	uc010khw.1	+						GRM1_uc010khv.1_Intron|GRM1_uc003qll.2_Intron|GRM1_uc011edz.1_Intron|GRM1_uc011eea.1_Intron	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	GCACTTCCTTTAGGAGTAGAGG	0.411													3	3	---	---	---	---	
C6orf103	79747	broad.mit.edu	37	6	147102609	147102609	+	Intron	DEL	A	-	-	rs138158213		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147102609delA	uc010khx.2	+						C6orf103_uc003qlp.2_Intron|C6orf103_uc003qlq.2_Intron|C6orf103_uc003qlr.2_Intron	NM_024694	NP_078970	Q8N7X0	CAN7L_HUMAN	hypothetical protein LOC79747						oxygen transport|proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|heme binding|oxygen binding			central_nervous_system(2)|lung(1)	3		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.04e-08)|GBM - Glioblastoma multiforme(68;0.0113)		gaaatgaattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152578100	152578100	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152578100delT	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATGGATGGATTTTTTTTTTT	0.234										HNSCC(10;0.0054)			3	3	---	---	---	---	
RGS17	26575	broad.mit.edu	37	6	153440028	153440029	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153440028_153440029insA	uc003qpm.2	-							NM_012419	NP_036551	Q9UGC6	RGS17_HUMAN	regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		ATAAAACTGGTAAAAAAAATCT	0.173									Lung_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155204315	155204315	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155204315delC	uc003qqb.2	+						uc003qqc.1_Intron	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TCTGTAATTACCACTCTTTAT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	155694030	155694030	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155694030delA								TFB1M (58404 upstream) : NOX3 (22473 downstream)																							ATGCTCAAACAAAAAAATGAG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159964328	159964329	+	IGR	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159964328_159964329delCT								FNDC1 (271189 upstream) : SOD2 (135822 downstream)																							catctccccactctctctctct	0.000													4	2	---	---	---	---	
PLG	5340	broad.mit.edu	37	6	161130003	161130003	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161130003delA	uc003qtm.3	+							NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen						extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ACCAGATTTTAAAAAAAAAAA	0.313													4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162932475	162932475	+	Intron	DEL	A	-	-	rs67616745		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162932475delA	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		TACAGAATACAAAAAAAAATG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164017840	164017840	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164017840delA								QKI (22948 upstream) : None (None downstream)																							AATTTTGGGTAAAAAAAATCC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	165364807	165364808	+	IGR	DEL	TC	-	-	rs150461387		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165364807_165364808delTC								None (None upstream) : C6orf118 (328347 downstream)																							TTGTGCAGAATCTCTTAGACTT	0.371													1	5	---	---	---	---	
MLLT4	4301	broad.mit.edu	37	6	168278753	168278753	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168278753delT	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwf.2_5'Flank	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		ATTGTTATGGTTTTTTTTTTT	0.348			T	MLL	AL								3	4	---	---	---	---	
WDR27	253769	broad.mit.edu	37	6	170072740	170072741	+	Intron	INS	-	TTTC	TTTC	rs143416653	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170072740_170072741insTTTC	uc003qwx.2	-						WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron|WDR27_uc011egw.1_Intron|WDR27_uc010kkx.2_Intron			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		TCGTTCTTCCATTTATCACTTA	0.376													3	4	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	946218	946218	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:946218delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aagggaaaggagaaaggagaa	0.085													4	2	---	---	---	---	
GNA12	2768	broad.mit.edu	37	7	2877475	2877475	+	Intron	DEL	A	-	-	rs34262163		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2877475delA	uc003smu.2	-						GNA12_uc011jwb.1_Intron	NM_007353	NP_031379	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein)						G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		aataggtaataaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4379558	4379559	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4379558_4379559insT								SDK1 (70929 upstream) : FOXK1 (303829 downstream)																							catcttccccatttttttttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	6985368	6985370	+	IGR	DEL	TGA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6985368_6985370delTGA								C7orf28B (119507 upstream) : C1GALT1 (236876 downstream)																							CTTTTGTTTTtgatgatgatgat	0.330													4	2	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7459631	7459634	+	Intron	DEL	TATG	-	-	rs56023768		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7459631_7459634delTATG	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_Intron	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TTAAAGACTTTATGTTTTTTTCAA	0.373													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	9739554	9739554	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9739554delT								PER4 (64107 upstream) : None (None downstream)																							TTCTTCTATCTTTTTTTTGGT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	10333665	10333665	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10333665delA								PER4 (658218 upstream) : NDUFA4 (639150 downstream)																							aTATGCCTTCAAAAAAGGGGT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	10399474	10399474	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10399474delG								PER4 (724027 upstream) : NDUFA4 (573341 downstream)																							ctggagggctggtatcaggcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15606055	15606055	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15606055delT								TMEM195 (4415 upstream) : MEOX2 (44784 downstream)																							TCTTCCATTCTTTTTTTTTTC	0.274													4	2	---	---	---	---	
MEOX2	4223	broad.mit.edu	37	7	15677158	15677159	+	Intron	DEL	CA	-	-	rs140574657	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15677158_15677159delCA	uc003stc.2	-						MEOX2_uc011jxw.1_Intron	NM_005924	NP_005915	P50222	MEOX2_HUMAN	mesenchyme homeobox 2						blood circulation|multicellular organismal development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		cacacacacgcacacacacacg	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15739949	15739950	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15739949_15739950delTC								MEOX2 (13641 upstream) : ISPD (387202 downstream)																							acttacctcttctctctctctc	0.188													4	2	---	---	---	---	
ISPD	729920	broad.mit.edu	37	7	16234473	16234474	+	Intron	INS	-	T	T	rs11416860		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16234473_16234474insT	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896	A4D126	ISPD_HUMAN	notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1						TGGTCTTTTGGTTTTTTTTTTT	0.366										Multiple Myeloma(15;0.18)			3	3	---	---	---	---	
ANKMY2	57037	broad.mit.edu	37	7	16674788	16674788	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16674788delA	uc003sti.2	-						ANKMY2_uc010ktz.2_Intron	NM_020319	NP_064715	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2							cilium	zinc ion binding			central_nervous_system(1)	1	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		cacatacaacaaaaaaaacta	0.000													4	2	---	---	---	---	
TWIST1	7291	broad.mit.edu	37	7	19158638	19158639	+	5'Flank	INS	-	T	T	rs141235282	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19158638_19158639insT	uc003sum.2	-							NM_000474	NP_000465	Q15672	TWST1_HUMAN	twist						aortic valve morphogenesis|cellular response to hypoxia|embryonic camera-type eye formation|embryonic cranial skeleton morphogenesis|eyelid development in camera-type eye|muscle organ development|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of histone phosphorylation|negative regulation of osteoblast differentiation|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of cell motility|positive regulation of epithelial to mesenchymal transition|positive regulation of fatty acid beta-oxidation|positive regulation of monocyte chemotactic protein-1 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of tumor necrosis factor production|regulation of bone mineralization	nucleus	bHLH transcription factor binding|E-box binding|sequence-specific DNA binding RNA polymerase II transcription factor activity				0						TGGGGGCAGCGTTTGGGGGCGA	0.510									Saethre-Chotzen_syndrome				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	19969224	19969225	+	IGR	INS	-	A	A	rs147776706	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19969224_19969225insA								TMEM196 (156008 upstream) : MACC1 (205063 downstream)																							GAGAGGAAAAGAAAAAAAAAGG	0.243													4	2	---	---	---	---	
RAPGEF5	9771	broad.mit.edu	37	7	22251360	22251363	+	Intron	DEL	TTCC	-	-	rs10541996		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22251360_22251363delTTCC	uc003svg.2	-							NM_012294	NP_036426	Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5						nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1						ctaatcatttttccttccttcttg	0.069													1	5	---	---	---	---	
KLHL7	55975	broad.mit.edu	37	7	23142476	23142477	+	5'Flank	DEL	AA	-	-	rs35152293		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23142476_23142477delAA	uc003svs.3	+						KLHL7_uc003svr.3_5'Flank|KLHL7_uc011jys.1_5'Flank|KLHL7_uc011jyt.1_5'Flank|uc003svo.1_RNA|KLHL7_uc003svp.2_5'Flank|KLHL7_uc003svq.2_5'Flank	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1							Golgi apparatus|nucleolus|plasma membrane					0						agaaatttggaagttgattcca	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	23604013	23604013	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23604013delT								TRA2A (32357 upstream) : CLK2P (20322 downstream)																							CCAAAATGGCttttttttttt	0.254													5	3	---	---	---	---	
STK31	56164	broad.mit.edu	37	7	23791130	23791130	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23791130delT	uc003sws.3	+						STK31_uc003swt.3_Intron|STK31_uc011jze.1_Intron|STK31_uc010kuq.2_Intron	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						gtttcatgcatttttaaaagt	0.000													4	2	---	---	---	---	
HOXA3	3200	broad.mit.edu	37	7	27162524	27162525	+	Intron	INS	-	T	T	rs150266705	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27162524_27162525insT	uc003syk.2	-						uc003syl.2_Intron	NM_153631	NP_705895	O43365	HXA3_HUMAN	homeobox A3 isoform a						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						CTTTTTCTTTCTTTTTTTTGGC	0.436													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27457936	27457936	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27457936delT								EVX1 (171744 upstream) : HIBADH (107127 downstream)																							gcccaatccctgctttcaagg	0.199													4	2	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28808036	28808036	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28808036delA	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron|CREB5_uc003szs.2_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						accatgtcacaaaaaaaagga	0.164													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	29774324	29774324	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29774324delA	uc003tai.2	+											Homo sapiens DPY-19-like 2 pseudogene 3 (DPY19L2P3) pseudogene mRNA, complete sequence.																		agatgtaatgaaaaaaagaac	0.000													4	2	---	---	---	---	
INMT	11185	broad.mit.edu	37	7	30743380	30743380	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30743380delT	uc010kwc.1	+									O95050	INMT_HUMAN	Homo sapiens indolethylamine N-methyltransferase (INMT) mRNA, INMT-1 allele, complete cds.							cytoplasm	amine N-methyltransferase activity				0						acaaggaggctttttagatat	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	32379960	32379960	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32379960delG								PDE1C (41019 upstream) : LSM5 (144985 downstream)																							AGAATAGGGAGTGAATGTGGA	0.458													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	32394340	32394341	+	IGR	DEL	AT	-	-	rs3079628		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32394340_32394341delAT								PDE1C (55399 upstream) : LSM5 (130604 downstream)																							ATTGCCACTCATGTGTAATTTG	0.332													0	6	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36685391	36685391	+	Intron	DEL	A	-	-	rs35848406		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36685391delA	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						TCCAGGGATGAAAAAAAAAAG	0.323													4	2	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40354712	40354712	+	Intron	DEL	A	-	-	rs80190491		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40354712delA	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						ctgcttttttaaaaaaaattt	0.050													5	3	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43496232	43496236	+	Intron	DEL	AAGTT	-	-	rs3214630		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43496232_43496236delAAGTT	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GGCGAGAGACAAGTTAAGCTTGAGT	0.390													7	5	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44299886	44299887	+	Intron	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44299886_44299887insG	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						TGGTTCTCCCAGGGGCCCAGCC	0.624													4	2	---	---	---	---	
MYO1G	64005	broad.mit.edu	37	7	45016807	45016808	+	Intron	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45016807_45016808insG	uc003tmh.2	-						MYO1G_uc003tmg.2_5'Flank|MYO1G_uc010kym.2_Intron|MYO1G_uc003tmi.1_5'Flank|MYO1G_uc003tmj.2_Intron	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG							myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						AGAAGGAAGAAGGGGGCAGGTG	0.619													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	46999113	46999114	+	IGR	INS	-	T	T	rs140729796	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46999113_46999114insT								None (None upstream) : TNS3 (315639 downstream)																							AGTTAGAAGAgttttttttgtt	0.208													2	4	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48420087	48420087	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48420087delT	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc003tos.1_Intron|ABCA13_uc010kyt.1_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ttctgaaaaatttagtgtata	0.134													4	2	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48536565	48536565	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48536565delT	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc010kyt.1_Intron|ABCA13_uc010kyu.1_Intron	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						aggtttatggtttttttttgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	48983385	48983390	+	IGR	DEL	TCTCTC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48983385_48983390delTCTCTC								CDC14C (16336 upstream) : VWC2 (829867 downstream)																							tttcttcctttctctctctctcactt	0.044													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	50297226	50297226	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50297226delG								C7orf72 (97868 upstream) : IKZF1 (47152 downstream)																							ttcgatttcagggcactttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	51503132	51503133	+	IGR	INS	-	TC	TC			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51503132_51503133insTC								COBL (118617 upstream) : None (None downstream)																							TTAATTACAGAtctctctctct	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	51985312	51985312	+	IGR	DEL	T	-	-	rs141453256		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51985312delT								COBL (600797 upstream) : None (None downstream)																							TATCCATTACTTTTCGTGGCA	0.214													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55076740	55076740	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55076740delT								SEC61G (249801 upstream) : EGFR (9985 downstream)																							TGCAGTCATGTTTTTTTATTG	0.209													4	2	---	---	---	---	
EGFR	1956	broad.mit.edu	37	7	55250956	55250956	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55250956delA	uc003tqk.2	+						EGFR_uc010kzg.1_Intron|EGFR_uc011kco.1_Intron|uc003tqo.2_Intron	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	ttcttagcacaaaaaaaaatg	0.010		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			4	2	---	---	---	---	
PSPH	5723	broad.mit.edu	37	7	56085251	56085251	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56085251delT	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			tttctttttcttttttttttg	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57698975	57698976	+	IGR	INS	-	AGTG	AGTG	rs145904451	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57698975_57698976insAGTG								ZNF716 (165710 upstream) : None (None downstream)																							AAAAAATGTACAGTGAGGGAAT	0.277													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57870965	57870968	+	IGR	DEL	ATTG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57870965_57870968delATTG								ZNF716 (337700 upstream) : None (None downstream)																							tctttgttatattgattgattttt	0.113													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57936923	57936923	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57936923delT								ZNF716 (403658 upstream) : None (None downstream)																							ATAGTTAATATTTTTTCTCTC	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61077032	61077032	+	IGR	DEL	A	-	-	rs74858662		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61077032delA								None (None upstream) : None (None downstream)																							tctctcttttaaaaaagctag	0.015													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61756340	61756342	+	IGR	DEL	ATC	-	-	rs147086130		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61756340_61756342delATC								None (None upstream) : LOC643955 (995330 downstream)																							gaatggaataatcatcaaatgta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61848534	61848534	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61848534delA								None (None upstream) : LOC643955 (903138 downstream)																							cacagaATGTAAAAAAAaaac	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61862268	61862269	+	IGR	DEL	CA	-	-	rs56823074		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61862268_61862269delCA								None (None upstream) : LOC643955 (889403 downstream)																							agttatttatcagatagtttcc	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63317424	63317424	+	IGR	DEL	A	-	-	rs35870556		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63317424delA								LOC100287704 (505273 upstream) : ZNF727 (188397 downstream)																							actctgcctcaaaaaaaaaaa	0.194													5	4	---	---	---	---	
ZNF680	340252	broad.mit.edu	37	7	63983013	63983013	+	Intron	DEL	A	-	-	rs34852861		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63983013delA	uc003tta.2	-						ZNF680_uc010kzr.2_Intron	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)				cctaaaagttaaaaaaaaaaa	0.080													4	2	---	---	---	---	
VKORC1L1	154807	broad.mit.edu	37	7	65411848	65411848	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65411848delT	uc003tul.2	+						VKORC1L1_uc011kds.1_Intron	NM_173517	NP_775788	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit							integral to membrane					0		Lung NSC(55;0.197)			Menadione(DB00170)|Warfarin(DB00682)	GAAggctgggtgtcatagctc	0.045													4	2	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69847406	69847407	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69847406_69847407delAC	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		TTTTTCCCAAACACACACACAC	0.406													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70912487	70912487	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70912487delA	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				atctaaaatcaaaaaaaaaat	0.075													4	2	---	---	---	---	
TYW1B	441250	broad.mit.edu	37	7	72240741	72240741	+	Intron	DEL	A	-	-	rs113111246		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72240741delA	uc011kej.1	-						TYW1B_uc011keh.1_Intron|TYW1B_uc011kek.1_Intron	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B isoform						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0						tttaaattagaaaaaaaaaaa	0.000													9	4	---	---	---	---	
EIF4H	7458	broad.mit.edu	37	7	73601779	73601779	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73601779delT	uc003uad.1	+						RFC2_uc011kfa.1_Intron|EIF4H_uc011kfg.1_Intron|EIF4H_uc010lbm.2_Intron|EIF4H_uc003uae.1_Intron|EIF4H_uc003uaf.1_Intron	NM_022170	NP_071496	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H						interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0						TTTCTTTTCCTTTTTTTTTGT	0.289													4	3	---	---	---	---	
HIP1	3092	broad.mit.edu	37	7	75309339	75309339	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75309339delC	uc003uds.1	-							NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						cctcaaaatgccagcttttat	0.000			T	PDGFRB	CMML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75498337	75498337	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75498337delT								CCL24 (55304 upstream) : RHBDD2 (9980 downstream)																							taaagttaccttttttttttt	0.055													3	3	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	77810067	77810068	+	Intron	INS	-	T	T	rs140607072	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77810067_77810068insT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TCATGAGCAGGAAACAGAGGCA	0.431													2	7	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	78065642	78065643	+	Intron	INS	-	T	T	rs147795560	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78065642_78065643insT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron|MAGI2_uc010ldy.1_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GTGAAAGCCACTTGGATCATTC	0.431													3	3	---	---	---	---	
MAGI2	9863	broad.mit.edu	37	7	78492373	78492373	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78492373delG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GTCTTTATGTGGATCCAAATA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79312091	79312094	+	IGR	DEL	TGTG	-	-	rs67368758		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79312091_79312094delTGTG								MAGI2 (229201 upstream) : GNAI1 (452046 downstream)																							tgtgtgtgcttgtgtgtgtgtgtg	0.000													3	4	---	---	---	---	
SEMA3E	9723	broad.mit.edu	37	7	83025625	83025625	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83025625delT	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TGAAAATGTATTTTTTTTTGT	0.244													4	2	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83789031	83789031	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83789031delA	uc003uhz.2	-							NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						AATAAACCATAAAAAAAAATA	0.333													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	84841712	84841712	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84841712delA								SEMA3D (25541 upstream) : None (None downstream)																							ccatcaATGGAAAACCCTTCA	0.189													4	2	---	---	---	---	
KIAA1324L	222223	broad.mit.edu	37	7	86530637	86530637	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86530637delT	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					CACATTAACCTTTTTTAGGAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	87950066	87950069	+	IGR	DEL	AAAT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87950066_87950069delAAAT								STEAP4 (13857 upstream) : ZNF804B (438684 downstream)																							ACTCAGTACCAAATAAATAAATAA	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	89339196	89339197	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89339196_89339197insC								ZNF804B (372852 upstream) : DPY19L2P4 (409517 downstream)																							TTTGCATATTTCCCCAAGGAGA	0.381													4	2	---	---	---	---	
PEX1	5189	broad.mit.edu	37	7	92131773	92131773	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92131773delT	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Intron	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CCTTTAAGAATTTTTTTTTGG	0.194													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93031802	93031803	+	IGR	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93031802_93031803delGT								CCDC132 (43465 upstream) : CALCR (21996 downstream)																							gtgtgtgtgagtgtgtgtgtgt	0.302													4	2	---	---	---	---	
GNGT1	2792	broad.mit.edu	37	7	93479870	93479870	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93479870delA	uc003umx.1	+									P63211	GBG1_HUMAN	Homo sapiens guanine nucleotide binding protein gamma 1 (GNG1) mRNA, complete cds.						G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			ttgttgtgccaaaaaaaaccc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	94360907	94360907	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94360907delT								PEG10 (61903 upstream) : PPP1R9A (176042 downstream)																							ATATTTTGTCTTTTTTTTTTT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96377983	96377984	+	IGR	INS	-	TCAT	TCAT	rs145355854	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96377983_96377984insTCAT								SHFM1 (38780 upstream) : DLX6AS (219844 downstream)																							TATGAACCAACtcattcattca	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96396807	96396808	+	IGR	INS	-	A	A	rs151118399	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96396807_96396808insA								SHFM1 (57604 upstream) : DLX6AS (201020 downstream)																							CTAGATAATGCATTCTGAGACT	0.376													2	6	---	---	---	---	
NPTX2	4885	broad.mit.edu	37	7	98258104	98258105	+	3'UTR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98258104_98258105insT	uc003upl.2	+	5						NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor						synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CTGTCACTGGCTTGTTTGTTCC	0.550													4	2	---	---	---	---	
TRRAP	8295	broad.mit.edu	37	7	98565648	98565648	+	Intron	DEL	T	-	-	rs35931783		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98565648delT	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CCCAttgttcttttttttttt	0.159													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100718098	100718098	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100718098delG								MUC17 (15958 upstream) : TRIM56 (10688 downstream)																							tgttggaggtggggcctaatg	0.000													4	2	---	---	---	---	
FBXL13	222235	broad.mit.edu	37	7	102608857	102608857	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102608857delT	uc003vaq.2	-						FBXL13_uc010liq.1_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron|FBXL13_uc003vav.2_Intron	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform												0						ATTTGCTTTATTTTTTGAATG	0.318													4	2	---	---	---	---	
DPY19L2P2	349152	broad.mit.edu	37	7	102846844	102846844	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102846844delA	uc003vbh.3	-						DPY19L2P2_uc003vbg.3_Intron|DPY19L2P2_uc010lit.2_Intron	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						agatgaaaagaaaaaaaaaaa	0.070													4	2	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103389634	103389634	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103389634delA	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGCAAAACTGAAAAAAAAAAT	0.313													8	4	---	---	---	---	
SRPK2	6733	broad.mit.edu	37	7	104965520	104965521	+	Intron	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104965520_104965521insC	uc003vcv.2	-						SRPK2_uc003vcw.1_Intron	NM_182692	NP_872634	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						AACTGTATTCTCCCCCAGAAAG	0.262													4	2	---	---	---	---	
ZNF277	11179	broad.mit.edu	37	7	111947473	111947473	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111947473delT	uc003vge.2	+						ZNF277_uc003vgd.2_Intron|ZNF277_uc003vgf.2_Intron|ZNF277_uc003vgg.2_Intron	NM_021994	NP_068834	Q9NRM2	ZN277_HUMAN	zinc finger protein (C2H2 type) 277							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4						aatttatttcttttttttgtt	0.000													4	2	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	114291856	114291856	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114291856delA	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc010ljz.1_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						AATACATCATAGAAACAACAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	118199351	118199351	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118199351delA								ANKRD7 (316569 upstream) : None (None downstream)																							gtccaaatttaaacatattat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	119279324	119279324	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119279324delG								None (None upstream) : KCND2 (634398 downstream)																							cacaaggtcaggagatcaaga	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	119871674	119871675	+	IGR	INS	-	AG	AG	rs137975539	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119871674_119871675insAG								None (None upstream) : KCND2 (42047 downstream)																							aaactgggggaagagagagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	122563570	122563570	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122563570delC								CADPS2 (37016 upstream) : TAS2R16 (71189 downstream)																							ATTGATAACACCATCTCCTAG	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	122726188	122726189	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122726188_122726189delTC								TAS2R16 (90434 upstream) : SLC13A1 (27400 downstream)																							aggccctgcttcacagttgcca	0.000													4	2	---	---	---	---	
SLC13A1	6561	broad.mit.edu	37	7	122807975	122807976	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122807975_122807976insA	uc003vkm.2	-						SLC13A1_uc010lks.2_Intron	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate							integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	Agagaaggatgaaaaaaaccta	0.173													4	2	---	---	---	---	
POT1	25913	broad.mit.edu	37	7	124535399	124535399	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124535399delT	uc003vlm.2	-						POT1_uc011koe.1_Intron|POT1_uc003vlk.2_Intron|POT1_uc003vll.2_Intron|POT1_uc003vlo.2_Intron|POT1_uc003vln.2_Intron	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1						DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						ACATGAACAATTTTTTTTTTT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	124599654	124599655	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124599654_124599655insT	uc010lkx.1	+						uc003vlp.2_Intron|uc003vlq.1_Intron					Homo sapiens cDNA FLJ33356 fis, clone BRACE2005160.																		cttttagcttattttttttttc	0.000													4	2	---	---	---	---	
CHCHD3	54927	broad.mit.edu	37	7	132643173	132643173	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132643173delA	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron	NM_017812	NP_060282	Q9NX63	CHCH3_HUMAN	coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0						CTGTGATAATAAAAAAAATAG	0.274													4	2	---	---	---	---	
JHDM1D	80853	broad.mit.edu	37	7	139842223	139842223	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139842223delA	uc003vvm.2	-							NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					aaatcaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	140675970	140675970	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140675970delG								BRAF (51406 upstream) : MRPS33 (29992 downstream)																							agaggccaaagggcatgtttg	0.144													4	2	---	---	---	---	
LOC100124692	100124692	broad.mit.edu	37	7	141875228	141875230	+	Intron	DEL	AGA	-	-	rs148294868		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141875228_141875230delAGA	uc003vxa.2	+							NR_003717				Homo sapiens cDNA FLJ16351 fis, clone TESTI2039060, moderately similar to Maltase-glucoamylase, intestinal.												0						TTGGGGAAACAGAAGGAGAAGGA	0.419													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142771245	142771245	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142771245delA								OR6W1P (10363 upstream) : PIP (57929 downstream)																							aggtactagtaaaaaaaaata	0.055													4	2	---	---	---	---	
ARHGEF35	445328	broad.mit.edu	37	7	143895188	143895189	+	5'Flank	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143895188_143895189delCT	uc003wdz.1	-							NM_001003702	NP_001003702	A5YM69	ARG35_HUMAN	Rho guanine nucleotide exchange factor (GEF)												0						GATTACAGTGctctctctctct	0.436													5	3	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144212984	144212984	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144212984delA	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	ATGTAGAAAGAAAAAAAAGGA	0.299													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148751396	148751396	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148751396delA								PDIA4 (25614 upstream) : ZNF786 (15337 downstream)																							AACTCATGGGAAAAAAaaaat	0.269													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	153148880	153148880	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153148880delA								ACTR3B (596417 upstream) : DPP6 (435539 downstream)																							attatgatggaaaaaaagatg	0.000													4	2	---	---	---	---	
PAXIP1	22976	broad.mit.edu	37	7	154755906	154755906	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154755906delG	uc003wlp.2	-						PAXIP1_uc003wlq.1_Intron|PAXIP1_uc011kvs.1_Intron	NM_007349	NP_031375	Q6ZW49	PAXI1_HUMAN	PAX interacting protein 1						DNA damage response, signal transduction by p53 class mediator|DNA recombination|DNA repair|histone H3-K4 methylation|positive regulation of histone acetylation|positive regulation of histone H3-K36 methylation|positive regulation of histone H3-K4 methylation|positive regulation of isotype switching|positive regulation of protein ubiquitination|positive regulation of transcription initiation from RNA polymerase II promoter|response to ionizing radiation|transcription, DNA-dependent	histone methyltransferase complex|nuclear matrix				lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		ggtctatggtgggcagatcca	0.139													4	2	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155513126	155513126	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155513126delG	uc010lqk.1	+						RBM33_uc011kvv.1_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CAGTCTTGTTGGGAAGGAAAA	0.308													4	2	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155571021	155571021	+	3'UTR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155571021delT	uc010lqk.1	+	18					RBM33_uc003wmg.2_3'UTR	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CCCAGGGGTCTTTTTTTCAAA	0.453													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157629303	157629304	+	Intron	INS	-	ACAC	ACAC	rs139103264	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157629303_157629304insACAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GCAAAATAAAGacacacacaca	0.233													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1244943	1244943	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1244943delT								ERICH1 (563717 upstream) : DLGAP2 (204626 downstream)																							AACACAGCCCTTTCCTCCCCA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2712779	2712779	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2712779delC								MYOM2 (619400 upstream) : CSMD1 (80097 downstream)																							gtgcctgcttcccctttgact	0.144													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4058392	4058394	+	Intron	DEL	ATA	-	-	rs6990955	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4058392_4058394delATA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		aaTAATGATGATAATAATAATAA	0.143													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4425320	4425320	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4425320delA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACCAGAAAGGAAAAAAAAAGT	0.299													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9181955	9181955	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9181955delT	uc003wsq.1	+											Homo sapiens cDNA FLJ31301 fis, clone LIVER1000073.																		GTTAGCATCGTTCCATCAGTG	0.428													4	2	---	---	---	---	
EFHA2	286097	broad.mit.edu	37	8	16950892	16950892	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16950892delT	uc003wxd.2	+							NM_181723	NP_859074	Q86XE3	EFHA2_HUMAN	EF-hand domain family, member A2							integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)		atattgagacttttttatgga	0.035													4	2	---	---	---	---	
PSD3	23362	broad.mit.edu	37	8	18820013	18820013	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18820013delA	uc003wza.2	-							NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		AATATTTTGGAAAAAAAATGG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	19101853	19101854	+	IGR	INS	-	T	T	rs147351504	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19101853_19101854insT								PSD3 (230657 upstream) : SH2D4A (69353 downstream)																							GCTTTCTTTTGTTTTTTTTTAT	0.356													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	21516411	21516411	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21516411delT								None (None upstream) : GFRA2 (33119 downstream)																							gccatatcggtgcttttaaaa	0.000													4	2	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25252070	25252070	+	Intron	DEL	T	-	-	rs77506537		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25252070delT	uc003xeg.2	+						PPP2R2A_uc003xek.2_Intron|DOCK5_uc003xei.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CACTTACCTCTTTTCATGGAG	0.393													2	5	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	26212348	26212348	+	Intron	DEL	T	-	-	rs142557137	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26212348delT	uc003xeu.2	+						PPP2R2A_uc003xek.2_Intron|PPP2R2A_uc011laf.1_Intron	NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		CAATTTTTTGTTTACTACACC	0.174													4	2	---	---	---	---	
FUT10	84750	broad.mit.edu	37	8	33265679	33265679	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33265679delA	uc003xje.2	-						FUT10_uc003xjc.2_Intron|FUT10_uc003xjd.2_Intron|FUT10_uc011lbi.1_Intron|FUT10_uc003xjf.2_Intron|FUT10_uc003xjg.2_Intron|FUT10_uc003xjh.2_Intron	NM_032664	NP_116053	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10						embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		ctatctctacaaaaaaaatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	34039934	34039934	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34039934delT								DUSP26 (582495 upstream) : None (None downstream)																							AGAGATATCATTTTTTTTTTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	34643714	34643714	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34643714delG								None (None upstream) : UNC5D (449261 downstream)																							ATGATAAGCTGGTTATTTGAT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37786609	37786609	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37786609delG								RAB11FIP1 (29606 upstream) : GOT1L1 (5191 downstream)																							aaaagatggagggggaaagta	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40328628	40328629	+	IGR	INS	-	GA	GA	rs141775574	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40328628_40328629insGA								C8orf4 (315807 upstream) : ZMAT4 (59487 downstream)																							tgtgaaagtgtgaggatcactg	0.178													3	3	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40578397	40578400	+	Intron	DEL	GGGA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40578397_40578400delGGGA	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			TGAGTAAGGTGGGAGGGAGGGAAG	0.275													4	2	---	---	---	---	
ANK1	286	broad.mit.edu	37	8	41622743	41622744	+	Intron	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41622743_41622744delTC	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			tctttctttttctctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49653537	49653537	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49653537delT								EFCAB1 (5667 upstream) : SNAI2 (176702 downstream)																							AAAGGGGAAATTTTTTTTTTT	0.308													4	2	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	50980200	50980200	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50980200delT	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TCATGTATTATTTTTGTTAGG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52092715	52092716	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52092715_52092716delCA								SNTG1 (387288 upstream) : PXDNL (139428 downstream)																							gaactaaatgcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	54317150	54317150	+	IGR	DEL	A	-	-	rs75628260		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54317150delA								OPRK1 (152956 upstream) : ATP6V1H (310966 downstream)																							gacattaagcaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57317103	57317103	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57317103delA								SDR16C5 (83862 upstream) : PENK (36410 downstream)																							gaaattagacaaaaggtcatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58275258	58275258	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58275258delC	uc003xth.2	+											Homo sapiens cDNA clone IMAGE:5267652.																		agacaaaaatccctaacctgg	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	59317222	59317222	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59317222delA								FAM110B (254945 upstream) : UBXN2B (6601 downstream)																							AAACACAAACAAAAAaaaaaa	0.100													4	2	---	---	---	---	
TOX	9760	broad.mit.edu	37	8	59873210	59873210	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59873210delA	uc003xtw.1	-							NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TTTATGTATTAAAAATGCATA	0.313													4	2	---	---	---	---	
CA8	767	broad.mit.edu	37	8	61141215	61141215	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61141215delA	uc003xtz.1	-						CA8_uc003xua.1_Intron	NM_004056	NP_004047	P35219	CAH8_HUMAN	carbonic anhydrase VIII						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)				tggagaggataaaaatgatag	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	75039558	75039558	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75039558delA								LY96 (98253 upstream) : JPH1 (107383 downstream)																							GGAGAGGAACAAAGGGTTCAA	0.502													4	2	---	---	---	---	
ZFHX4	79776	broad.mit.edu	37	8	77688132	77688132	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77688132delT	uc003yav.2	+						ZFHX4_uc003yau.1_Intron|ZFHX4_uc003yaw.1_Intron	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTAAGTTTTCTTTTTTTTTTT	0.428										HNSCC(33;0.089)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	78306382	78306382	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78306382delA								PEX2 (393858 upstream) : None (None downstream)																							CATTTTAACCAAAAACAGTTC	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	88617628	88617628	+	IGR	DEL	C	-	-	rs35698263		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88617628delC								CNBD1 (222673 upstream) : DCAF4L2 (265345 downstream)																							GCCTAGAGTTCAGCAGTGATT	0.348													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	90643642	90643642	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90643642delG								None (None upstream) : RIPK2 (126333 downstream)																							GTCCACTTGTGGAAATCACTC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	94895597	94895597	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94895597delT								TMEM67 (65251 upstream) : PDP1 (33486 downstream)																							TCAAACTAGCTTTTTTTTTCA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97498932	97498932	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97498932delC								PTDSS1 (152158 upstream) : SDC2 (6950 downstream)																							TATAGCAACTCCAATATTCCA	0.224													4	2	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101011908	101011908	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101011908delT	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AGAAGTGGGATTTTTATCctg	0.179													4	2	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101058872	101058872	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101058872delA	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc011lgz.1_Intron|RGS22_uc010mbo.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			aaaaacttacaaaaataaatc	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103826147	103826147	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103826147delA								KLF10 (158164 upstream) : AZIN1 (12390 downstream)																							ccccattgctaaaaaaaacta	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	106855161	106855162	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106855161_106855162insT								ZFPM2 (38396 upstream) : OXR1 (427311 downstream)																							tattgtgctgcttttttttgtt	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	108134483	108134484	+	IGR	INS	-	T	T	rs10955436	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108134483_108134484insT								ABRA (352011 upstream) : ANGPT1 (127227 downstream)																							atggctgtggcaagtttctcaa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	108847835	108847835	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108847835delA								ANGPT1 (337581 upstream) : RSPO2 (63710 downstream)																							GGGTCGTAGTAAAGGAATCTG	0.448													4	2	---	---	---	---	
RSPO2	340419	broad.mit.edu	37	8	108967866	108967867	+	Intron	INS	-	A	A	rs138872806	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108967866_108967867insA	uc003yms.2	-						RSPO2_uc003ymq.2_Intron|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CACTGTTTTTTAAAAAAAACTC	0.248													4	2	---	---	---	---	
RSPO2	340419	broad.mit.edu	37	8	108986271	108986271	+	Intron	DEL	A	-	-	rs35833691		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108986271delA	uc003yms.2	-						RSPO2_uc003ymq.2_Intron|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			ATCCtcaaacaaacatgcatt	0.119													3	4	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113494237	113494237	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113494237delA	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTTTAATACTAAAAAAAAAAA	0.249										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	115299982	115299982	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115299982delA								CSMD3 (850740 upstream) : None (None downstream)																							TAAGAAAAACAAAAAAATGTA	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	116070296	116070296	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116070296delA								None (None upstream) : TRPS1 (350429 downstream)																							GAATATCAACAAAAAAAACCA	0.313													4	2	---	---	---	---	
TRPS1	7227	broad.mit.edu	37	8	116617475	116617475	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116617475delA	uc003ynz.2	-						TRPS1_uc011lhy.1_Intron|TRPS1_uc003yny.2_Intron|TRPS1_uc010mcy.2_Intron	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1						negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GGTAAGTAATAAATGCACTAT	0.308									Langer-Giedion_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117188207	117188208	+	IGR	INS	-	GAAG	GAAG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117188207_117188208insGAAG								TRPS1 (506979 upstream) : EIF3H (468848 downstream)																							aaagaaagaaaaaggaaggaag	0.000													4	2	---	---	---	---	
SLC30A8	169026	broad.mit.edu	37	8	118093375	118093375	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118093375delA	uc010mcz.2	+						SLC30A8_uc011lia.1_Intron|SLC30A8_uc003yog.2_Intron	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8						insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			AACTGTACTCAGGCAGGTAAT	0.363													4	2	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121575530	121575531	+	Intron	INS	-	T	T	rs11453370		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121575530_121575531insT	uc010mdg.2	-							NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			GTGAGCATACCTTTTTTTTTTT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	124648661	124648662	+	IGR	DEL	TC	-	-	rs10552933		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124648661_124648662delTC								FBXO32 (95215 upstream) : KLHL38 (9253 downstream)																							tgatctcggttccCTCAACCCC	0.183													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129547111	129547112	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129547111_129547112insA								MIR1208 (384677 upstream) : None (None downstream)																							TAAGAATGACCAAAAAAAAAAA	0.287													3	3	---	---	---	---	
ADCY8	114	broad.mit.edu	37	8	131903664	131903664	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131903664delT	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TTTTGTGTTCtttttttgaca	0.199										HNSCC(32;0.087)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	132289921	132289923	+	IGR	DEL	TGA	-	-	rs5895083		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132289921_132289923delTGA								ADCY8 (237086 upstream) : EFR3A (626436 downstream)																							CTCAATATCCtgatgatgatgat	0.241													3	3	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133482177	133482178	+	Intron	DEL	CA	-	-	rs10217015	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133482177_133482178delCA	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			ACCTTCGTCTCATCCCTGGCTG	0.426													4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	133998135	133998135	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133998135delT	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ttccttgttcttttttttgtt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134349816	134349816	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134349816delT								NDRG1 (40269 upstream) : ST3GAL1 (117275 downstream)																							CCAATGTTAGTTTTTTTTTCT	0.338													4	2	---	---	---	---	
ST3GAL1	6482	broad.mit.edu	37	8	134567965	134567965	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134567965delG	uc003yuk.2	-						ST3GAL1_uc003yum.2_Intron	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			AGGAGTCGGCGGGTGCCTGGC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135031635	135031635	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135031635delT								ST3GAL1 (447452 upstream) : ZFAT (458398 downstream)																							tcaatcaatgttttttgaaag	0.095													0	7	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135577862	135577862	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135577862delC	uc003yup.2	-						ZFAT_uc011ljj.1_Frame_Shift_Del_p.G16fs|ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GAGAGGCACTCCCCAGGGAGG	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	137489520	137489520	+	IGR	DEL	A	-	-	rs77737636		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137489520delA								KHDRBS3 (829674 upstream) : None (None downstream)																							gtcaggaatcaaaaaaaatgg	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140497153	140497153	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140497153delC								COL22A1 (570917 upstream) : KCNK9 (115929 downstream)																							GAATCTTAAACCCCCAGAAAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	3701520	3701520	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3701520delT								RFX3 (175537 upstream) : GLIS3 (122608 downstream)																							AAGAGTCTAATTTTTTTGTGT	0.423													4	2	---	---	---	---	
C9orf68	55064	broad.mit.edu	37	9	4665999	4665999	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4665999delA	uc011llz.1	-						C9orf68_uc003zik.2_Intron|C9orf68_uc003zil.2_Intron|C9orf68_uc010mhj.2_Intron|C9orf68_uc011lly.1_Intron|C9orf68_uc003zim.2_Intron	NM_001039395	NP_001034484	B4DIY4	B4DIY4_HUMAN	hypothetical protein LOC55064												0		Breast(48;0.0456)		GBM - Glioblastoma multiforme(50;0.0222)		TTTAGAACAGAAAAAAAAAAA	0.343													3	3	---	---	---	---	
C9orf46	55848	broad.mit.edu	37	9	5600478	5600478	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5600478delA	uc003zjd.2	-							NM_018465	NP_060935	Q9HBL7	CI046_HUMAN	hypothetical protein LOC55848							integral to membrane				ovary(1)	1	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.00106)|Lung(218;0.125)		taaactccggaaaaaaaaaaa	0.050													4	3	---	---	---	---	
KIAA2026	158358	broad.mit.edu	37	9	5988755	5988755	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5988755delA	uc003zjq.3	-							NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358											ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCCCTGCATTAAAAAAAAAAA	0.299													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	7582922	7582922	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7582922delT								KDM4C (407275 upstream) : C9orf123 (213571 downstream)																							CCTGTATTACTTTTTTTTGGG	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	7732280	7732281	+	IGR	INS	-	T	T	rs145533797	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7732280_7732281insT								KDM4C (556633 upstream) : C9orf123 (64212 downstream)																							TTTTACAACtgttttttttgtc	0.188													2	6	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	10239704	10239705	+	Intron	INS	-	A	A	rs144131758	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:10239704_10239705insA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ACTGAATCCAGAAAAAAATGAC	0.243										TSP Lung(15;0.13)			0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	14390996	14390997	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14390996_14390997insG								NFIB (77051 upstream) : ZDHHC21 (164484 downstream)																							tataaagaaatggggggtggaa	0.000													4	2	---	---	---	---	
PSIP1	11168	broad.mit.edu	37	9	15482287	15482287	+	Intron	DEL	A	-	-	rs111702299		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15482287delA	uc003zlv.3	-						PSIP1_uc003zlw.3_Intron|PSIP1_uc003zlz.3_Intron|PSIP1_uc003zma.3_Intron|PSIP1_uc003zly.2_Intron	NM_033222	NP_150091	O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1 isoform 2						initiation of viral infection|interspecies interaction between organisms|nuclear mRNA 5'-splice site recognition|provirus integration|regulation of transcription, DNA-dependent|response to heat|response to oxidative stress|transcription, DNA-dependent	cytosol|nuclear heterochromatin|nuclear periphery|nucleoplasm|nucleoplasm|transcriptionally active chromatin	activating transcription factor binding|chromatin binding|DNA secondary structure binding|RNA polymerase II transcription coactivator activity			breast(1)	1				GBM - Glioblastoma multiforme(50;2.38e-06)		GCCTGCTGGGAAAAAAAAAAT	0.413													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	16384864	16384864	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16384864delG								C9orf93 (412969 upstream) : BNC2 (24638 downstream)																							ttggctatttggggtcttgtg	0.000													4	2	---	---	---	---	
BNC2	54796	broad.mit.edu	37	9	16527918	16527918	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16527918delA	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc011lmv.1_Intron|BNC2_uc003zmo.1_Intron	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		TAAGAGGTGGAAAAAGGATGA	0.423													4	2	---	---	---	---	
SLC24A2	25769	broad.mit.edu	37	9	19555016	19555016	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19555016delG	uc003zoa.1	-						SLC24A2_uc003zob.1_Intron	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24						visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		ATGCAGGTCAGGGGGCCACAT	0.433													4	2	---	---	---	---	
MLLT3	4300	broad.mit.edu	37	9	20407762	20407764	+	Intron	DEL	AAT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20407762_20407764delAAT	uc003zoe.2	-						MLLT3_uc011lne.1_Intron|MLLT3_uc011lnf.1_Intron|MLLT3_uc003zof.2_Intron	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		ataaaatggcaataataataata	0.015			T	MLL	ALL								4	2	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20995359	20995360	+	Intron	INS	-	AA	AA			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20995359_20995360insAA	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		CAGGGTAACTTAAAAAAAAAAA	0.238													4	2	---	---	---	---	
IFT74	80173	broad.mit.edu	37	9	26948940	26948940	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26948940delT	uc010mja.2	+						IFT74_uc010mjb.2_Intron|PLAA_uc003zqd.2_5'Flank|PLAA_uc003zqe.2_5'Flank	NM_001099223	NP_001092693	Q96LB3	IFT74_HUMAN	coiled-coil domain containing 2 isoform a							cytoplasmic membrane-bounded vesicle|intraflagellar transport particle B|microtubule-based flagellum				skin(1)	1		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		TGTACATGCATTTTTTTTTTA	0.363													4	2	---	---	---	---	
CHMP5	51510	broad.mit.edu	37	9	33274016	33274017	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33274016_33274017insA	uc003zsl.3	+						SUGT1P1_uc010mjq.1_Intron|CHMP5_uc003zsm.3_Intron|CHMP5_uc011lnv.1_Intron	NM_016410	NP_057494	Q9NZZ3	CHMP5_HUMAN	chromatin modifying protein 5						cellular membrane organization|protein transport	cytosol|endosome membrane	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			AATCAAAGTTTAAAAAAAAAAT	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33522637	33522637	+	IGR	DEL	T	-	-	rs80312677		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33522637delT								SUGT1P1 (11590 upstream) : ANXA2P2 (101586 downstream)																							ggatttagtctttttttgttt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44984841	44984841	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44984841delG								None (None upstream) : FAM27C (5395 downstream)																							tgattaaattggcccccccca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66464673	66464674	+	Intron	DEL	TG	-	-	rs113415960		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66464673_66464674delTG	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																		GTCAAAACACTGTACTGATTCC	0.356													8	5	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66502885	66502885	+	RNA	DEL	A	-	-	rs147375690	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66502885delA	uc004aed.1	+	3		c.2978delA								Homo sapiens similar to prostaglandin E receptor 4, subtype EP4; PGE receptor, EP4 subtype; prostaglandin E2 receptor, mRNA (cDNA clone IMAGE:5288780).												0						AGTGGCAAATATTTTTTTTTT	0.308													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68385894	68385894	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68385894delC								FAM27B (591705 upstream) : MIR1299 (616345 downstream)																							caggagcaaacaaattcaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68404156	68404158	+	IGR	DEL	TCT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68404156_68404158delTCT								FAM27B (609967 upstream) : MIR1299 (598081 downstream)																							TCTAAATAGATCTTCATTAATGT	0.335													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68416594	68416595	+	IGR	INS	-	A	A	rs76457516		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68416594_68416595insA								FAM27B (622405 upstream) : MIR1299 (585644 downstream)																							GTTCTTAAAACAAAACggccag	0.040													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68454761	68454761	+	IGR	DEL	T	-	-	rs149527199		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68454761delT								FAM27B (660572 upstream) : MIR1299 (547478 downstream)																							TAGAAAAAAATTAATCAATAA	0.229													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68491574	68491575	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68491574_68491575insC								FAM27B (697385 upstream) : MIR1299 (510664 downstream)																							ctttctttctttctttctttct	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68688109	68688109	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68688109delG								FAM27B (893920 upstream) : MIR1299 (314130 downstream)																							AACAAAAAAAGAAAACTGAAC	0.254													19	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69053724	69053724	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69053724delT								MIR1299 (51403 upstream) : PGM5P2 (26521 downstream)																							atatcacttgtttttttgacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70182345	70182346	+	RNA	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70182345_70182346delTG	uc004afw.2	-	3		c.1766_1767delCA								Homo sapiens COBW domain containing 5, mRNA (cDNA clone IMAGE:5287337), complete cds.																		TTCTGTGTATTGTTTTTTTTTT	0.238													12	9	---	---	---	---	
PGM5	5239	broad.mit.edu	37	9	71115875	71115875	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71115875delT	uc004agr.2	+							NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5						cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						AAAGCAGTGCTTTTTTTTTTT	0.448													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	71221171	71221172	+	IGR	INS	-	T	T	rs148045687	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71221171_71221172insT								C9orf71 (65388 upstream) : PIP5K1B (99444 downstream)																							TCACATTACTCCtttttttttt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	71283100	71283100	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71283100delA								C9orf71 (127317 upstream) : PIP5K1B (37516 downstream)																							agccaaaaccaaaaaaaaggg	0.174													4	2	---	---	---	---	
PIP5K1B	8395	broad.mit.edu	37	9	71549097	71549097	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71549097delC	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		GACGTGTCCTCCATGAAGTCC	0.423													4	2	---	---	---	---	
KLF9	687	broad.mit.edu	37	9	73001090	73001090	+	3'UTR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73001090delA	uc004aht.2	-	2						NM_001206	NP_001197	Q13886	KLF9_HUMAN	Kruppel-like factor 9						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACTTCTGAAGAAAAAAAAAAT	0.378													9	4	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	74007425	74007426	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74007425_74007426insT	uc004aii.2	-							NM_206948	NP_996831	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						CTGGGTATTGGTTTTTTTCAGA	0.381													4	2	---	---	---	---	
TMEM2	23670	broad.mit.edu	37	9	74324530	74324530	+	Intron	DEL	T	-	-	rs3837279		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74324530delT	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AGTTGTCAGCTATGGCACTCA	0.438													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	75738362	75738362	+	IGR	DEL	T	-	-	rs35113118		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75738362delT								ALDH1A1 (43004 upstream) : ANXA1 (28419 downstream)																							TAATGGCCTCTTTGGCAACAT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	79177839	79177839	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79177839delT								GCNT1 (55509 upstream) : PRUNE2 (48454 downstream)																							GCATGACACATTTTTTTGAAC	0.343													4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79814426	79814426	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79814426delT	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						tctcattttctttttttattg	0.015													4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79895392	79895392	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79895392delT	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						TGGAGTTTGATTTTTTTTTTC	0.289													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	80715234	80715239	+	IGR	DEL	GGTGCA	-	-	rs35985384		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80715234_80715239delGGTGCA								GNAQ (69042 upstream) : CEP78 (135752 downstream)																							TGCAAGTTATGGTGCAGGAGTTGGCG	0.296													2	4	---	---	---	---	
RASEF	158158	broad.mit.edu	37	9	85635026	85635027	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85635026_85635027insA	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						ctgttacagttaaaaaaaAATA	0.203													4	2	---	---	---	---	
AGTPBP1	23287	broad.mit.edu	37	9	88226279	88226280	+	Intron	INS	-	A	A	rs111888615		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88226279_88226280insA	uc011ltd.1	-						AGTPBP1_uc004aod.3_Intron|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Intron|AGTPBP1_uc011lte.1_Intron	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1						C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						TCTTATTTATGAAAAAAAAAGC	0.064													3	4	---	---	---	---	
GOLM1	51280	broad.mit.edu	37	9	88672560	88672560	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88672560delC	uc004aol.2	-						GOLM1_uc010mqd.1_Intron|GOLM1_uc004aom.2_Intron	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1							Golgi apparatus|integral to plasma membrane					0						GGTCTGCACACCCGTGTTCAG	0.667													2	5	---	---	---	---	
C9orf153	389766	broad.mit.edu	37	9	88835709	88835710	+	3'UTR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88835709_88835710insT	uc004aon.2	-	5					GOLM1_uc010mqd.1_Intron	NM_001010907	NP_001010907	Q5TBE3	CI153_HUMAN	hypothetical protein LOC389766												0						ccattctcctattttttttctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89945832	89945832	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89945832delA								C9orf170 (171191 upstream) : DAPK1 (166826 downstream)																							gagatgaaccaaaaaaaagga	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92949809	92949809	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92949809delC								LOC100129066 (615135 upstream) : DIRAS2 (422305 downstream)																							cctacttgtgccacctgtttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93039552	93039552	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93039552delA								LOC100129066 (704878 upstream) : DIRAS2 (332562 downstream)																							taggcatactaaaaaaacaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93045415	93045415	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93045415delC								LOC100129066 (710741 upstream) : DIRAS2 (326699 downstream)																							atgcatgattccacttatatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93819610	93819611	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93819610_93819611insT								SYK (158777 upstream) : AUH (156488 downstream)																							attcaggttagtttttttttta	0.000													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94471451	94471453	+	Intron	DEL	TTG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94471451_94471453delTTG	uc004ari.1	-							NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						ttgttgttgtttgttgttgttgt	0.212													4	2	---	---	---	---	
CDC14B	8555	broad.mit.edu	37	9	99302434	99302434	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99302434delA	uc004awj.2	-						CDC14B_uc004awk.2_Intron|CDC14B_uc004awl.2_Intron|CDC14B_uc004awi.2_Intron	NM_033331	NP_201588	O60729	CC14B_HUMAN	CDC14 homolog B isoform 2						activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				ATGAAACAATAAAAAAAAGTA	0.284													4	2	---	---	---	---	
GABBR2	9568	broad.mit.edu	37	9	101406164	101406164	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101406164delC	uc004ays.2	-							NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	gagaacagagccaacacccag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	101650451	101650451	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101650451delA								GALNT12 (38093 upstream) : COL15A1 (55687 downstream)																							gcgtcattccaaaaaaacccc	0.055													4	2	---	---	---	---	
TGFBR1	7046	broad.mit.edu	37	9	101909247	101909247	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101909247delT	uc004azc.2	+						TGFBR1_uc004azd.2_Intron|TGFBR1_uc011lvc.1_Intron	NM_004612	NP_004603	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor I						activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding			lung(2)|ovary(1)	3		Acute lymphoblastic leukemia(62;0.0559)				ATTTTTTTTCTTTGAGATTGT	0.333													4	2	---	---	---	---	
ERP44	23071	broad.mit.edu	37	9	102774415	102774415	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102774415delA	uc004bam.2	-						ERP44_uc010msy.2_Intron|ERP44_uc010msz.2_Intron	NM_015051	NP_055866	Q9BS26	ERP44_HUMAN	thioredoxin domain containing 4 (endoplasmic						cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0						TCTTCAAACCAAAAAAAAGAG	0.299													4	2	---	---	---	---	
TMEFF1	8577	broad.mit.edu	37	9	103278314	103278314	+	Intron	DEL	A	-	-	rs1931141	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103278314delA	uc004baz.1	+						TMEFF1_uc004bay.1_Intron	NM_003692	NP_003683	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two						multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)				TAGTGTTTTTATTTTTTTCTT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	105160293	105160294	+	IGR	INS	-	A	A	rs1346038	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105160293_105160294insA								GRIN3A (659431 upstream) : CYLC2 (597299 downstream)																							tttttttttttaaaaAAACAGG	0.262													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	105640020	105640020	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105640020delA								None (None upstream) : CYLC2 (117573 downstream)																							TAGAGGAAGGAAAAAAAAAGG	0.333													4	2	---	---	---	---	
ZNF462	58499	broad.mit.edu	37	9	109676309	109676310	+	Intron	INS	-	T	T	rs34309250		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109676309_109676310insT	uc004bcz.2	+							NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TTCGCCTAGGATTTTTTTTTTT	0.376													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	109939095	109939096	+	IGR	DEL	GC	-	-	rs12340562	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109939095_109939096delGC								ZNF462 (165306 upstream) : RAD23B (106448 downstream)																							ACTGGGATGTGCGTGTGTTGGG	0.520													4	2	---	---	---	---	
EPB41L4B	54566	broad.mit.edu	37	9	111967930	111967930	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111967930delA	uc004bdz.1	-							NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						TACTACTGTTATCTGTAAGCA	0.353													4	2	---	---	---	---	
MUSK	4593	broad.mit.edu	37	9	113505831	113505831	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113505831delA	uc004bey.2	+						MUSK_uc004bex.2_Intron	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6						TGCTTTGTCCAATAAATATAA	0.254													4	2	---	---	---	---	
LPAR1	1902	broad.mit.edu	37	9	113689666	113689666	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113689666delA	uc004bfa.2	-						LPAR1_uc011lwm.1_Intron|LPAR1_uc004bfb.2_Intron|LPAR1_uc004bfc.2_Intron|LPAR1_uc011lwn.1_Intron|LPAR1_uc011lwo.1_Intron|LPAR1_uc010mub.2_Intron	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						tatttggcagatgaaggggct	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	114606794	114606794	+	IGR	DEL	G	-	-	rs145021171	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114606794delG								C9orf84 (49571 upstream) : UGCG (52412 downstream)																							TTGGGATAATGGGGGAAAGGA	0.328													4	2	---	---	---	---	
COL27A1	85301	broad.mit.edu	37	9	116978541	116978541	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116978541delC	uc011lxl.1	+						COL27A1_uc004bii.2_Intron|COL27A1_uc010mvd.1_Intron	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor						cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						GTGGCTGGGGCCCTGGCAGGG	0.617													4	2	---	---	---	---	
DFNB31	25861	broad.mit.edu	37	9	117216452	117216453	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117216452_117216453insA	uc004biz.3	-						DFNB31_uc004biy.3_Intron|DFNB31_uc004bja.3_Intron	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1						inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						acttcatggtgaaaaattaatg	0.000													4	2	---	---	---	---	
TNC	3371	broad.mit.edu	37	9	117841941	117841941	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117841941delC	uc004bjj.3	-						TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor						cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						cttatgacgaccccacaagga	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120557841	120557842	+	IGR	DEL	AA	-	-	rs146947073		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120557841_120557842delAA								TLR4 (78077 upstream) : None (None downstream)																							TTTGTCAGGCAAAAAAAAAATT	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120574300	120574300	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120574300delA								TLR4 (94536 upstream) : None (None downstream)																							TTTTATCTTCAAGTTAAAGTG	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120911627	120911627	+	IGR	DEL	A	-	-	rs75343770		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120911627delA								TLR4 (431863 upstream) : None (None downstream)																							aaagacagggaaaaaaaaaaa	0.030													1	6	---	---	---	---	
DBC1	1620	broad.mit.edu	37	9	122093981	122093981	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122093981delT	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GACCTCCAGCTTTACTAACGT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	124283371	124283371	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124283371delT								GGTA1 (21065 upstream) : DAB2IP (46028 downstream)																							tacccatttcttttttttttc	0.000													4	2	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126602975	126602975	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126602975delT	uc004bnz.1	-						DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						ATATGCTGTATTTTTTTTCCT	0.423													4	2	---	---	---	---	
NR5A1	2516	broad.mit.edu	37	9	127250421	127250422	+	Intron	INS	-	T	T	rs142530240	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127250421_127250422insT	uc004boo.1	-							NM_004959	NP_004950	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1						cell-cell signaling|male gonad development|positive regulation of transcription from RNA polymerase II promoter|primary sex determination|regulation of steroid biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|phospholipid binding|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0						agtgctgcttgtttttttttca	0.000													2	5	---	---	---	---	
FAM125B	89853	broad.mit.edu	37	9	129131924	129131924	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129131924delT	uc004bqh.1	+						FAM125B_uc004bqg.1_Intron|FAM125B_uc011lzy.1_Intron	NM_033446	NP_258257	Q9H7P6	F125B_HUMAN	hypothetical protein LOC89853 isoform 1						protein transport	late endosome membrane					0						ttcacgtgggtttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132150642	132150642	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132150642delT								C9orf106 (65760 upstream) : C9orf50 (223864 downstream)																							tcaaccagtattttttttagc	0.000													4	2	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140576036	140576036	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140576036delC	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CCCTGCTTGTCCAGGTGACAT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	5399183	5399184	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5399183_5399184delCA								AKR1C4 (138273 upstream) : UCN3 (7792 downstream)																							agagtcagctcacacacacaca	0.094													6	3	---	---	---	---	
SFMBT2	57713	broad.mit.edu	37	10	7348702	7348703	+	Intron	INS	-	A	A	rs147621305	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7348702_7348703insA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						agaaaaggggggaaaaaaaaga	0.163													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	7570995	7570995	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7570995delT								SFMBT2 (117545 upstream) : ITIH5 (30641 downstream)																							TCTGGTTAGATTTTTATCACT	0.353													4	2	---	---	---	---	
TAF3	83860	broad.mit.edu	37	10	7987342	7987342	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7987342delA	uc010qbd.1	+							NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140						maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						TTAGTGGATTAAAAAAACTGT	0.328													4	2	---	---	---	---	
CAMK1D	57118	broad.mit.edu	37	10	12708215	12708215	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12708215delT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		GTCAGGTTGGTTTTTTTTTTC	0.468													4	3	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	14220781	14220781	+	Intron	DEL	A	-	-	rs145886392		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14220781delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imv.2_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						CCAAACTTAGAAAAAAAAAAG	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	16451548	16451549	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16451548_16451549delCA								FAM188A (549029 upstream) : PTER (27418 downstream)																							cacgcgcacgcacacacacaca	0.277													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	17618730	17618731	+	IGR	INS	-	GT	GT	rs147709196	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17618730_17618731insGT								ST8SIA6 (122476 upstream) : PTPLA (13229 downstream)																							TATCCCTCTGCGTGTGTGTGTG	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19189442	19189442	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19189442delT								ARL5B (222502 upstream) : PLXDC2 (915930 downstream)																							ctgggctggGTTTTTTTTTCT	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19417975	19417975	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19417975delT								ARL5B (451035 upstream) : PLXDC2 (687397 downstream)																							cagatgcatgttttttttcca	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	20771447	20771447	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20771447delT								PLXDC2 (202332 upstream) : NEBL (297458 downstream)																							TTAATTTACCTTTTTTTTTTA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	20936553	20936553	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20936553delA								PLXDC2 (367438 upstream) : NEBL (132352 downstream)																							GATAAACCTTAATGAACTAAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	23690734	23690734	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23690734delC								C10orf67 (56962 upstream) : OTUD1 (37464 downstream)																							catcctcctgcctcagccccc	0.045													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24556834	24556834	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24556834delT	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						GTGGGTTAAATTTTCATAAAT	0.378													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24616819	24616820	+	Intron	INS	-	TT	TT	rs149966490	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24616819_24616820insTT	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						tctagagagcattatcattaac	0.223													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	31335020	31335021	+	IGR	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31335020_31335021delTT								ZNF438 (14154 upstream) : LOC220930 (270437 downstream)																							gtacaaaagctttttagtttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33871868	33871868	+	IGR	DEL	T	-	-	rs145607514		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33871868delT								NRP1 (247862 upstream) : PARD3 (528230 downstream)																							cctcttcttgttttttttttt	0.000													4	4	---	---	---	---	
CREM	1390	broad.mit.edu	37	10	35420276	35420276	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35420276delT	uc001iyb.2	+						CREM_uc001ixx.2_Intron|CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Intron|CREM_uc001iyc.2_Intron	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a						cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TTTTTGTGTGTTTTTTTAAAC	0.269													4	2	---	---	---	---	
CCNY	219771	broad.mit.edu	37	10	35759903	35759904	+	Intron	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35759903_35759904delTT	uc001iyw.3	+						CCNY_uc001iyu.3_Intron|CCNY_uc001iyv.3_Intron|CCNY_uc001iyx.3_Intron|CCNY_uc009xmb.2_Intron|CCNY_uc010qet.1_Intron	NM_145012	NP_659449	Q8ND76	CCNY_HUMAN	cyclin Y isoform 1						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0						GGGTTTGAGATTTTAACCATAT	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36744609	36744609	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36744609delA								FZD8 (814247 upstream) : ANKRD30A (670176 downstream)																							TGTTTGAAGGAAAAAAAAAAT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36923340	36923340	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36923340delC								FZD8 (992978 upstream) : ANKRD30A (491445 downstream)																							ataagtttttcccagagaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	37557111	37557112	+	IGR	INS	-	T	T	rs145744934	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37557111_37557112insT								ANKRD30A (35616 upstream) : ZNF248 (533335 downstream)																							ATGTGATAATGTTTTTTCTGTA	0.361													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38671757	38671757	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38671757delT								HSD17B7P2 (4325 upstream) : SEPT7L (243 downstream)																							cttatctacctttttttttcc	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38993396	38993397	+	IGR	INS	-	A	A	rs12184374		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38993396_38993397insA								LOC399744 (252316 upstream) : None (None downstream)																							gcctgtaaaattaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	44919501	44919504	+	IGR	DEL	TCAT	-	-	rs66773740		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44919501_44919504delTCAT								CXCL12 (38959 upstream) : TMEM72 (487260 downstream)																							TGCTCCTTCCtcattcattcattc	0.500													4	2	---	---	---	---	
FRMPD2	143162	broad.mit.edu	37	10	49415184	49415185	+	Intron	DEL	TT	-	-	rs149943097		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49415184_49415185delTT	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		AGAATTTTCCTTTTTTTTTTTT	0.282													4	2	---	---	---	---	
C10orf72	196740	broad.mit.edu	37	10	50240899	50240900	+	Intron	INS	-	AG	AG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50240899_50240900insAG	uc001jhf.2	-							NM_001031746	NP_001026916	Q8IW00	CJ072_HUMAN	hypothetical protein LOC196740 isoform 1							integral to membrane|plasma membrane					0						GATAGATCAATagagagagaga	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52444482	52444483	+	IGR	INS	-	TTTA	TTTA	rs147667479		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52444482_52444483insTTTA								SGMS1 (59559 upstream) : ASAH2B (55213 downstream)																							TAAAGCCCAGCTGCCTCAGGCT	0.639													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55666018	55666018	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55666018delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CTAGTCTTCCTTTTTTTTTGC	0.279										HNSCC(58;0.16)			4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55707315	55707315	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55707315delA	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AGGGAAGAATAAAAAAAAAAC	0.274										HNSCC(58;0.16)			1	5	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55857951	55857952	+	Intron	DEL	TG	-	-	rs142604688		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55857951_55857952delTG	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AAAATAAAGTtgtgtgtgtgtg	0.257										HNSCC(58;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	58324032	58324032	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58324032delT								ZWINT (202998 upstream) : None (None downstream)																							ctgtgtgccctgattcttctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	60746453	60746453	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60746453delA								BICC1 (157608 upstream) : PHYHIPL (189895 downstream)																							gattaacaacaaaaaaaatgc	0.000													2	4	---	---	---	---	
CCDC6	8030	broad.mit.edu	37	10	61552409	61552409	+	3'UTR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61552409delC	uc001jks.3	-	9						NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		ATACCAAATACCAAACAGCGA	0.408													4	2	---	---	---	---	
CCDC6	8030	broad.mit.edu	37	10	61654314	61654317	+	Intron	DEL	CAGA	-	-	rs149494623		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61654314_61654317delCAGA	uc001jks.3	-							NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		tggcatacagcagacactcatgtt	0.328													2	4	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	62345807	62345808	+	Intron	INS	-	A	A	rs151102707	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62345807_62345808insA	uc001jkz.3	-							NM_001149	NP_001140	Q12955	ANK3_HUMAN	ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						aacaaacaaacaaaaAaaagac	0.000													2	5	---	---	---	---	
RHOBTB1	9886	broad.mit.edu	37	10	62750260	62750264	+	Intron	DEL	TTTAT	-	-	rs72321013		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62750260_62750264delTTTAT	uc001jlj.2	-						RHOBTB1_uc001jlk.2_Intron|RHOBTB1_uc001jlm.2_Intron	NM_014836	NP_055651	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			upper_aerodigestive_tract(1)	1	Prostate(12;0.0112)					GCAATTTCTCTTTATTTTAATTCAA	0.322													2	4	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	68386689	68386691	+	Intron	DEL	ACA	-	-	rs34123425		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68386689_68386691delACA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						ATACACACACacaacaacaacaa	0.222													5	3	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	68472367	68472368	+	Intron	DEL	CA	-	-	rs72045061		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68472367_68472368delCA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						ctctctctctcACACACACAGC	0.262													4	2	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	68538140	68538140	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68538140delG	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						CAATGAGCTCGGACTAAAGGT	0.403													4	2	---	---	---	---	
CCAR1	55749	broad.mit.edu	37	10	70523685	70523685	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70523685delC	uc001joo.2	+						CCAR1_uc001jol.1_Intron|CCAR1_uc001jom.1_Intron|CCAR1_uc009xpx.1_Intron|CCAR1_uc001jon.1_Intron|CCAR1_uc010qiz.1_Intron|CCAR1_uc010qja.1_Intron|CCAR1_uc010qjb.1_Intron	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						tcagtcatttccccaggaagc	0.000													4	2	---	---	---	---	
DDX21	9188	broad.mit.edu	37	10	70727306	70727306	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70727306delA	uc001jov.1	+						DDX21_uc001jow.1_Intron	NM_004728	NP_004719	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21							nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)	3						AACTTGGATTAAAAAAAAAAA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71376950	71376950	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71376950delT								NEUROG3 (43828 upstream) : C10orf35 (13053 downstream)																							TCTTCAAACATTTTTTTTTGT	0.378													4	2	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75803109	75803110	+	Intron	INS	-	T	T	rs145684984		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75803109_75803110insT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					TGACATAATAAttttttttttt	0.099													4	4	---	---	---	---	
ADK	132	broad.mit.edu	37	10	76409383	76409383	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76409383delA	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron|ADK_uc001jwl.2_Intron	NM_006721	NP_006712	P55263	ADK_HUMAN	adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)	actctatatcaaaaaaaaaaa	0.139													3	3	---	---	---	---	
SAMD8	142891	broad.mit.edu	37	10	76914661	76914661	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76914661delT	uc001jwx.1	+						SAMD8_uc001jwy.1_Intron	NM_144660	NP_653261	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8						sphingomyelin biosynthetic process	integral to membrane					0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					ttgttttttgttttttttgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	77203643	77203643	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77203643delT								C10orf41 (34904 upstream) : MIR606 (108573 downstream)																							cttgggtgaatttttttatgT	0.174													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78969437	78969439	+	Intron	DEL	AAG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78969437_78969439delAAG	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	ttaacaaaaaaagaagattcaaa	0.020													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	79819555	79819556	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79819555_79819556delCA								RPS24 (2985 upstream) : LOC283050 (883528 downstream)																							ACCTGCTATGCACACACACACA	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82090453	82090454	+	IGR	INS	-	AAAAC	AAAAC	rs111560983		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82090453_82090454insAAAAC								MAT1A (41019 upstream) : DYDC1 (5410 downstream)																							TTTTCAGGCAAaaaacaaaaca	0.337													3	4	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	83862255	83862255	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83862255delG	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ttttttattagttagattttt	0.000													4	2	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	84586675	84586675	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84586675delA	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron|NRG3_uc001kcr.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ataaatgttgaaaaaaaaaGC	0.144													5	3	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	84588419	84588419	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84588419delA	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron|NRG3_uc001kcr.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CACATTTTTTAAATCACAGAT	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	85793575	85793575	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85793575delA								None (None upstream) : GHITM (105610 downstream)																							cctagtgattaaaaaaaactt	0.000													4	2	---	---	---	---	
GHITM	27069	broad.mit.edu	37	10	85911797	85911797	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85911797delT	uc001kcs.1	+						GHITM_uc010qma.1_Intron|GHITM_uc010qmb.1_Intron	NM_014394	NP_055209	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein						apoptosis	integral to membrane|mitochondrial inner membrane					0						AAAATAATGATTTTTTTAAAC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	87013675	87013676	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87013675_87013676insC								FAM190B (735399 upstream) : GRID1 (345636 downstream)																							ccacagtatgtgcacttacaca	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	92622539	92622539	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92622539delT								HTR7 (4868 upstream) : RPP30 (8935 downstream)																							tcaataaacattagtcagttg	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94966512	94966512	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94966512delA								CYP26A1 (128871 upstream) : MYOF (99675 downstream)																							TCAAAAACTTAAAGTCCTTCC	0.493													4	2	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95177051	95177058	+	Intron	DEL	ATTTGGAA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95177051_95177058delATTTGGAA	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc001kip.3_Intron|MYOF_uc009xuf.2_Intron	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						TTCCGCTAACATTTGGAAATGGTTCTCC	0.433													4	2	---	---	---	---	
HELLS	3070	broad.mit.edu	37	10	96352598	96352599	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96352598_96352599insA	uc001kjt.2	+						HELLS_uc001kjs.2_Intron|HELLS_uc009xul.2_Intron|HELLS_uc009xum.2_Intron|HELLS_uc009xun.2_Intron|HELLS_uc009xuo.2_Intron|HELLS_uc001kju.2_Intron|HELLS_uc009xup.2_Intron|HELLS_uc009xuq.2_Intron|HELLS_uc009xur.2_Intron	NM_018063	NP_060533	Q9NRZ9	HELLS_HUMAN	helicase, lymphoid-specific						cell division|centromeric heterochromatin formation|lymphocyte proliferation|maintenance of DNA methylation|methylation-dependent chromatin silencing|mitosis|transcription, DNA-dependent	centromeric heterochromatin|nucleus	ATP binding|DNA binding|helicase activity			ovary(1)|kidney(1)	2		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		tggcaaagttgaaaaaaaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	97794600	97794600	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97794600delG	uc001klg.1	-						uc001klj.1_Intron|uc009xvb.1_Intron					Homo sapiens cDNA FLJ34077 fis, clone FCBBF3003481, weakly similar to ZINC FINGER PROTEIN 195.																		ttgaggtagagggaactgcaa	0.000													3	7	---	---	---	---	
C10orf12	26148	broad.mit.edu	37	10	98721042	98721042	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98721042delT	uc009xvg.1	+							NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148											skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TTCCAGTTCATTTAGAGCTGT	0.284													4	2	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100931575	100931576	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100931575_100931576insA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ATTCTGTGACTAAAAAAAAAAA	0.337													3	3	---	---	---	---	
SLC25A28	81894	broad.mit.edu	37	10	101371955	101371955	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101371955delA	uc001kpx.2	-						SLC25A28_uc001kpy.2_Intron	NM_031212	NP_112489	Q96A46	MFRN2_HUMAN	solute carrier family 25, member 28						ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		CATAAGGGGGAAAAAAAAAGT	0.363											OREG0020433	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
C10orf76	79591	broad.mit.edu	37	10	103611109	103611109	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103611109delG	uc009xwy.1	-						C10orf76_uc009xwx.1_Intron	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TAGGAAGAAAGGGGAGACCAA	0.483													4	2	---	---	---	---	
C10orf76	79591	broad.mit.edu	37	10	103771297	103771297	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103771297delA	uc009xwy.1	-							NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		GTGGGGATTCAAAAAAAAAAG	0.388													5	3	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105501404	105501404	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105501404delC	uc001kxj.1	-							NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GCCCAGAGAGCCCAGGCTGTC	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	109239052	109239055	+	IGR	DEL	CTTC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109239052_109239055delCTTC								SORCS1 (314760 upstream) : None (None downstream)																							AATTTTTTTTCTTCCTTCAGATTT	0.319													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	109624670	109624670	+	IGR	DEL	C	-	-	rs112305029		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109624670delC								SORCS1 (700378 upstream) : None (None downstream)																							cttccacacaccctcccatct	0.000													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113586669	113586669	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113586669delG								ADRA2A (746009 upstream) : GPAM (322953 downstream)																							CAAGTAAGTAGGGGGAAAAAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113855185	113855186	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113855185_113855186delTC								None (None upstream) : GPAM (54436 downstream)																							tctctctctttctctctctctc	0.312													4	2	---	---	---	---	
VTI1A	143187	broad.mit.edu	37	10	114261954	114261954	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114261954delT	uc001kzy.2	+						VTI1A_uc001kzz.2_Intron	NM_145206	NP_660207	Q96AJ9	VTI1A_HUMAN	SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		acccagctaatttttttttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	117746845	117746846	+	IGR	INS	-	GA	GA	rs141505482	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117746845_117746846insGA								ATRNL1 (38351 upstream) : GFRA1 (69598 downstream)																							tggcagcaggtgagagagagag	0.000													5	3	---	---	---	---	
KIAA1598	57698	broad.mit.edu	37	10	118675696	118675696	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118675696delA	uc009xyw.2	-						KIAA1598_uc001lcz.3_Intron|KIAA1598_uc010qso.1_Intron|KIAA1598_uc010qsp.1_Intron|KIAA1598_uc010qsq.1_Intron|KIAA1598_uc001lcy.3_Intron	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a						axon guidance	axon					0				all cancers(201;0.00494)		ATTTTGCTGCaaaaaaaataa	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119396965	119396965	+	IGR	DEL	G	-	-	rs66499053		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119396965delG								EMX2 (87909 upstream) : RAB11FIP2 (367464 downstream)																							TTAAGCTTTTGGGGGGGAATA	0.144													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	120347518	120347518	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120347518delA								C10orf84 (245679 upstream) : PRLHR (5398 downstream)																							TTTTGTAATTAAAAAAAAAAT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	121464634	121464634	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121464634delT								BAG3 (27307 upstream) : INPP5F (20975 downstream)																							ACCTTCTTAAtttttttttgt	0.179													4	2	---	---	---	---	
INPP5F	22876	broad.mit.edu	37	10	121497411	121497411	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121497411delT	uc001leo.2	+						INPP5F_uc001len.3_Intron	NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F								phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		CTCTGATACCTTTTTTTTTTC	0.383													4	2	---	---	---	---	
CPXM2	119587	broad.mit.edu	37	10	125696906	125696907	+	Intron	INS	-	G	G	rs140648447	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125696906_125696907insG	uc001lhj.2	-									Q8N436	CPXM2_HUMAN	Homo sapiens cDNA FLJ56000 complete cds, highly similar to Carboxypeptidase-like protein X2 precursor.						cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		TCTGCAACCTCAGGACCCCCCA	0.460													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125940056	125940057	+	IGR	INS	-	CT	CT	rs146229058	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125940056_125940057insCT								CHST15 (86850 upstream) : OAT (145815 downstream)																							ctccaaggtccctccaaggcca	0.163													2	5	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127582669	127582670	+	Intron	DEL	AT	-	-	rs141033053		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127582669_127582670delAT	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ACTTAAAAAAATATATATAGAA	0.297													4	2	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127583479	127583480	+	Intron	INS	-	AG	AG	rs146232148		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127583479_127583480insAG	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGCTGATCTTTATACTTTCTGT	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130029835	130029835	+	Intron	DEL	G	-	-	rs151281177		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130029835delG	uc001lkg.1	+											Homo sapiens cDNA FLJ42232 fis, clone THYMU3000224.																		TGCTTTGTTTGTGTCTTGTTT	0.473													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132789220	132789220	+	IGR	DEL	C	-	-	rs6482832	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132789220delC								GLRX3 (806436 upstream) : TCERG1L (101436 downstream)																							GAAAAAAAAACATCCCAGTAT	0.423													4	2	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	132944473	132944473	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132944473delG	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		ATAAAATGCTGGGTAACAGTG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133291395	133291395	+	IGR	DEL	A	-	-	rs11336554		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133291395delA								TCERG1L (181411 upstream) : PPP2R2D (456565 downstream)																							AGGCAACAGGAAAAAAAAATA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134668423	134668423	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134668423delT	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		tcttttaaaattattgagact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134668426	134668427	+	Intron	DEL	TT	-	-	rs60827647		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134668426_134668427delTT	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		tttaaaattattgagacttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135501166	135501166	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135501166delC								LOC653544 (5973 upstream) : None (None downstream)																							agacaagagtcccatcacctg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1636371	1636372	+	IGR	INS	-	A	A	rs149213747	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1636371_1636372insA								KRTAP5-3 (6678 upstream) : KRTAP5-4 (5816 downstream)																							aggacgtacagtggcaaataag	0.000													2	5	---	---	---	---	
STIM1	6786	broad.mit.edu	37	11	4092073	4092076	+	Intron	DEL	GTCA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4092073_4092076delGTCA	uc001lyv.2	+						STIM1_uc009yef.2_Intron|STIM1_uc009yeg.2_Intron	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		GAGAGTGCCCGTCAGTCAGTCAGT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4224313	4224313	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4224313delA								RRM1 (554 upstream) : OR52B4 (164270 downstream)																							AACAGCCCACAAAAAATCCTG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4231311	4231312	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4231311_4231312insA								RRM1 (7552 upstream) : OR52B4 (157271 downstream)																							ATCTTCAATAGAAAAAAAAAGG	0.312													6	3	---	---	---	---	
OR51B5	282763	broad.mit.edu	37	11	5511057	5511057	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5511057delG	uc001maq.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTATCACACTGAACATACTAT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	6317743	6317743	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6317743delC								CCKBR (24388 upstream) : PRKCDBP (22433 downstream)																							CCTCTTACCTCCCTACCCCAC	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	7232272	7232273	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7232272_7232273delCA								RBMXL2 (119893 upstream) : MIR302E (23724 downstream)																							cacacacactcacacacacaca	0.307													4	2	---	---	---	---	
GALNTL4	374378	broad.mit.edu	37	11	11391358	11391358	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11391358delA	uc001mjo.2	-							NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		tacaaatcagaaaaaaaaaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	12686501	12686502	+	IGR	INS	-	A	A	rs146986036	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12686501_12686502insA								PARVA (135091 upstream) : TEAD1 (9467 downstream)																							ccagtctctataaaaaaatata	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13155037	13155037	+	IGR	DEL	T	-	-	rs66903413		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13155037delT								RASSF10 (122390 upstream) : ARNTL (144288 downstream)																							TTCAATTGCCTTTCAAAATCA	0.368													4	2	---	---	---	---	
FAR1	84188	broad.mit.edu	37	11	13700269	13700270	+	Intron	INS	-	T	T	rs140822650	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13700269_13700270insT	uc001mld.2	+						FAR1_uc009ygp.2_Intron	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1						ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2						AATTTAGTGGGTCTTTTTTTTG	0.356													4	3	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14879027	14879027	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14879027delG	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TGAGTCTACTGGGGATCAGCA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15619065	15619065	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15619065delA								INSC (350313 upstream) : SOX6 (368931 downstream)																							ctgggtacacaaaatacctgg	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15897544	15897544	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15897544delT								INSC (628792 upstream) : SOX6 (90452 downstream)																							TTGTCTTTACTTTTTTTTTCT	0.398													4	2	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	15994037	15994037	+	3'UTR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15994037delA	uc001mme.2	-	16					SOX6_uc001mmd.2_3'UTR|SOX6_uc001mmf.2_3'UTR|SOX6_uc001mmg.2_3'UTR	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						CATCCAAAAGAAAAAAAAAGT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	17608480	17608480	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17608480delA	uc001mnh.1	+											SubName: Full=Putative uncharacterized protein OTOG;																		ggatgtatataAAAAGGCAGG	0.085													4	2	---	---	---	---	
SAAL1	113174	broad.mit.edu	37	11	18102225	18102225	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18102225delC	uc001mnq.2	-						SAAL1_uc001mnr.2_Intron|SAAL1_uc001mns.2_Intron|SAAL1_uc009yhf.2_Intron	NM_138421	NP_612430	Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1						acute-phase response	extracellular region	binding				0						ACTATGCTTTCCCATTCCGTT	0.408													4	2	---	---	---	---	
TSG101	7251	broad.mit.edu	37	11	18529197	18529197	+	Intron	DEL	A	-	-	rs77538217		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18529197delA	uc001mor.2	-						TSG101_uc001mos.1_Intron|TSG101_uc009yhs.1_Intron	NM_006292	NP_006283	Q99816	TS101_HUMAN	tumor susceptibility gene 101						cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0						CTTAACTGACAAAAAAAAATA	0.343													4	3	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19527680	19527680	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19527680delG	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						ttttcctagtgggggttaact	0.000													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19763564	19763565	+	Intron	INS	-	T	T	rs145060056	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19763564_19763565insT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						tatcttttgactttttttggat	0.000													6	3	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19898355	19898355	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19898355delA	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TTGCATGGTTAAAAAAAAAAA	0.343													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20020251	20020251	+	Intron	DEL	C	-	-	rs80043950		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20020251delC	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						gactgtgcttccccccctctc	0.000													3	4	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20097782	20097787	+	Intron	DEL	TCTAAA	-	-	rs141829686		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20097782_20097787delTCTAAA	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron|NAV2_uc001mpt.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhy.1_Intron|NAV2_uc009yhz.2_Intron|NAV2_uc001mpu.2_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						gacctctaactctaaatcctgttccc	0.058													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22523278	22523279	+	IGR	INS	-	CG	CG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22523278_22523279insCG								SLC17A6 (122234 upstream) : FANCF (120800 downstream)																							acacacacacacacTATAAAAc	0.124													4	2	---	---	---	---	
FANCF	2188	broad.mit.edu	37	11	22647097	22647097	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22647097delC	uc001mql.1	-	1	291	c.260delG	c.(259-261)GGTfs	p.G87fs		NM_022725	NP_073562	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	87					DNA repair	nucleoplasm	protein binding			skin(1)	1						GTCACAGTGACCGAGGGCCTG	0.662			N|F			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24090754	24090754	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24090754delT								None (None upstream) : LUZP2 (427802 downstream)																							CAGTGAGATATTTTTTCTGAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24307533	24307534	+	IGR	INS	-	A	A	rs144667746	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24307533_24307534insA								None (None upstream) : LUZP2 (211022 downstream)																							ttaccacatacaaaaaaaaaac	0.000													4	2	---	---	---	---	
LUZP2	338645	broad.mit.edu	37	11	24784559	24784560	+	Intron	INS	-	A	A	rs11414450		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24784559_24784560insA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						TTTCTCaatttaaaaaaaaaat	0.198													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	28522510	28522510	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28522510delT								METT5D1 (167456 upstream) : None (None downstream)																							cctattaggatttttaaaagc	0.085													4	2	---	---	---	---	
CCDC73	493860	broad.mit.edu	37	11	32674380	32674380	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32674380delA	uc001mtv.2	-						CCDC73_uc001mtw.1_Intron	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79											ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					ATTCTAAGACAAAAAAAAAAT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	38274843	38274843	+	IGR	DEL	G	-	-	rs145824812	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38274843delG								None (None upstream) : None (None downstream)																							gagagagagagaaagagagag	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	38274845	38274847	+	IGR	DEL	AAG	-	-	rs11034650		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38274845_38274847delAAG								None (None upstream) : None (None downstream)																							gagagagagaaagagagagagaa	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	38863580	38863581	+	IGR	DEL	CC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38863580_38863581delCC								None (None upstream) : None (None downstream)																							tctggggaatccaccataaaaT	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	39509625	39509626	+	IGR	INS	-	A	A	rs143156899	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39509625_39509626insA								None (None upstream) : LRRC4C (626127 downstream)																							GAGTGATTTTGAAAAAAAAAAC	0.322													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43218485	43218485	+	IGR	DEL	A	-	-	rs75599159		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43218485delA								None (None upstream) : API5 (115020 downstream)																							ACTCAATACCAAAAAAAAACC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44444890	44444893	+	IGR	DEL	GACT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44444890_44444893delGACT								ALX4 (113174 upstream) : CD82 (142248 downstream)																							acacaatggggactataaATCTTT	0.211													4	2	---	---	---	---	
SLC39A13	91252	broad.mit.edu	37	11	47400660	47400660	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47400660delA	uc001nfd.2	+						SPI1_uc001nfb.1_5'Flank|SPI1_uc001nfc.1_5'Flank|SPI1_uc009ylp.1_5'Flank			Q96H72	S39AD_HUMAN	RecName: Full=Zinc transporter ZIP13; AltName: Full=Zrt- and Irt-like protein 13;          Short=ZIP-13; AltName: Full=Solute carrier family 39 member 13; AltName: Full=LIV-1 subfamily of ZIP zinc transporter 9; AltName: Full=LZT-Hs9;						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				Lung(87;0.0936)		CCACCAGAAGAGGGTCCTGGG	0.537													4	2	---	---	---	---	
NUP160	23279	broad.mit.edu	37	11	47868235	47868235	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47868235delT	uc001ngm.2	-						NUP160_uc009ylw.2_Intron|NUP160_uc001ngn.1_Intron	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						AAAAGCAAAATTTTTTTTGTA	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48357273	48357273	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48357273delT								OR4C3 (9793 upstream) : OR4C45 (9629 downstream)																							attcttttcctttgtgggaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50767619	50767619	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50767619delT								LOC646813 (387816 upstream) : OR4A5 (643829 downstream)																							tgaacctttcttttgatagag	0.000													5	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56301306	56301307	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56301306_56301307insT								OR5M8 (42460 upstream) : OR5M11 (8510 downstream)																							CGATATGGTGATTTTTTCctat	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56899809	56899809	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56899809delA								OR5AK2 (142493 upstream) : LRRC55 (49412 downstream)																							aaagaaaaggaaaaaaaaaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	57736893	57736893	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57736893delT								CTNND1 (150242 upstream) : OR9Q1 (54460 downstream)																							ATTTTGGTAAttttttttttt	0.199													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	58566913	58566913	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58566913delA								GLYAT (67466 upstream) : GLYATL2 (34629 downstream)																							caataaattcaaaaaaagtca	0.000													4	2	---	---	---	---	
SLC22A8	9376	broad.mit.edu	37	11	62762525	62762525	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62762525delA	uc001nwo.2	-						SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Intron|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Intron	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8						response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						AGACCAAAGGAGGCAGTAAAT	0.383													4	2	---	---	---	---	
ZNHIT2	741	broad.mit.edu	37	11	64886433	64886433	+	5'Flank	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64886433delC	uc001ocw.2	-							NM_014205	NP_055020	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT domain containing 2								metal ion binding			breast(1)	1						atcacctcttccccatcttcA	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	65582350	65582350	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65582350delT								OVOL1 (17667 upstream) : SNX32 (19060 downstream)																							CGCATTAATCTTCCTGTGCCT	0.498													4	2	---	---	---	---	
TSGA10IP	254187	broad.mit.edu	37	11	65715747	65715748	+	Intron	INS	-	CATC	CATC			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65715747_65715748insCATC	uc001ogk.1	+						TSGA10IP_uc009yqw.1_Intron|TSGA10IP_uc009yqx.1_Intron	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein												0						AACTTTTGGATcatccatccat	0.203													6	3	---	---	---	---	
PITPNM1	9600	broad.mit.edu	37	11	67262282	67262283	+	Intron	INS	-	GA	GA	rs67466581		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67262282_67262283insGA	uc001olx.2	-						PITPNM1_uc001olw.2_Intron|PITPNM1_uc001oly.2_Intron|PITPNM1_uc001olz.2_Intron	NM_004910	NP_004901	O00562	PITM1_HUMAN	phosphatidylinositol transfer protein,						brain development|lipid metabolic process|phototransduction|protein transport	cleavage furrow|endoplasmic reticulum membrane|Golgi cisterna membrane|lipid particle|membrane fraction|midbody	metal ion binding|phosphatidylinositol transporter activity			lung(2)|central_nervous_system(1)	3						CGAGAGTGGGCGAGTGGGCGAG	0.703													9	4	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70692906	70692906	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70692906delC	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CTCCCTCCCACccttctctga	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	76453686	76453686	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76453686delT								GUCY2E (20853 upstream) : TSKU (40599 downstream)																							ttgagacaaatttaacaaaag	0.000													4	2	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892814	76892820	+	Intron	DEL	TTTTTTT	-	-	rs10522799		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892814_76892820delTTTTTTT	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CCTTCTCAAGtttttttttttgttttt	0.295													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	77015398	77015399	+	IGR	INS	-	ACAA	ACAA	rs149522479	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77015398_77015399insACAA								GDPD4 (16935 upstream) : PAK1 (17662 downstream)																							CAAAAAGCAAGACAAAACTAAA	0.322													2	4	---	---	---	---	
PAK1	5058	broad.mit.edu	37	11	77113767	77113768	+	Intron	INS	-	CAT	CAT	rs147487394	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77113767_77113768insCAT	uc001oyh.3	-						PAK1_uc010rso.1_Intron|PAK1_uc001oyg.3_Intron|PAK1_uc001oyi.1_Intron	NM_002576	NP_002567	Q13153	PAK1_HUMAN	p21-activated kinase 1 isoform 2						apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)					ctgcctgaacatgtccTGATTT	0.203													4	2	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	78603556	78603557	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78603556_78603557insT	uc001ozl.3	-							NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						aacccttaacctttctttatct	0.045													4	2	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	78777810	78777811	+	Intron	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78777810_78777811delCA	uc001ozl.3	-						ODZ4_uc009yvc.2_Intron	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						cacaagcacgcacacacacaca	0.228													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79274517	79274517	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79274517delA								ODZ4 (122822 upstream) : None (None downstream)																							AATGGATAATAACAATAGCaa	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	81049624	81049624	+	IGR	DEL	A	-	-	rs148339947		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81049624delA								None (None upstream) : None (None downstream)																							TGAGTGGTCCAAAAAAAAAAA	0.388													3	4	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	83271551	83271551	+	Intron	DEL	G	-	-	rs5793069		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83271551delG	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc010rsw.1_Intron|DLG2_uc010rsx.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ATGTTAATGTGAGCTTGTGTT	0.378													1	5	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	84782713	84782713	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84782713delA	uc001pak.2	-							NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CCACTAAATGAAAAAAATTCA	0.323													4	2	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	85065144	85065144	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85065144delT	uc001pak.2	-							NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GCACTATTCATTTTTTTCTAT	0.328													4	2	---	---	---	---	
CCDC83	220047	broad.mit.edu	37	11	85573190	85573190	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85573190delA	uc001pbh.1	+						CCDC83_uc001pbg.1_Intron	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83											skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ACTACATATGAAAAAAATGAT	0.363													4	2	---	---	---	---	
PICALM	8301	broad.mit.edu	37	11	85719667	85719668	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85719667_85719668insA	uc001pbm.2	-						PICALM_uc001pbl.2_Intron|PICALM_uc001pbn.2_Intron|PICALM_uc010rtl.1_Intron|PICALM_uc001pbo.1_5'Flank	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly						clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				catctcaggagaaaaaaaaaaa	0.153			T	MLLT10|MLL	TALL|AML|								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	85818938	85818938	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85818938delA								PICALM (38038 upstream) : EED (136877 downstream)																							TCTTGACTGGAAAAAAAAAAC	0.338													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	86140070	86140070	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86140070delT								CCDC81 (5920 upstream) : ME3 (12082 downstream)																							ctgttaatgatttccagtttc	0.129													4	2	---	---	---	---	
TMEM135	65084	broad.mit.edu	37	11	87030705	87030705	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87030705delT	uc001pch.2	+						TMEM135_uc010rtt.1_Intron|TMEM135_uc001pci.2_Intron	NM_022918	NP_075069	Q86UB9	TM135_HUMAN	transmembrane protein 135							integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGTCCATTTCTTTTTGATTAA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	87305252	87305252	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87305252delA								TMEM135 (270684 upstream) : RAB38 (541179 downstream)																							aacaaacatgaaaaaaaaaag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88133033	88133033	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88133033delA								CTSC (62092 upstream) : GRM5 (104712 downstream)																							TTGAAGAACCAAAAAAATTAT	0.358													4	2	---	---	---	---	
GRM5	2915	broad.mit.edu	37	11	88642637	88642637	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88642637delT	uc001pcq.2	-						GRM5_uc009yvm.2_Intron	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	TTTTGTCTACTTTTTTTTTTT	0.279													4	3	---	---	---	---	
NOX4	50507	broad.mit.edu	37	11	89224131	89224132	+	Intron	INS	-	CTC	CTC	rs142894586	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89224131_89224132insCTC	uc001pct.2	-						NOX4_uc009yvr.2_5'Flank|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron|NOX4_uc009yvs.1_Intron|NOX4_uc001pcy.2_Intron	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TTCCTCCACATCTCTCCCATCA	0.431													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89340491	89340491	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89340491delA								NOX4 (17712 upstream) : FOLH1B (51974 downstream)																							AAAAACAAATAAAAAAATGGT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	91788807	91788808	+	IGR	INS	-	T	T	rs141260652	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91788807_91788808insT								None (None upstream) : FAT3 (296454 downstream)																							ACAACACTCGGTATTTTTCTTC	0.381													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	95108275	95108275	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95108275delG								SESN3 (142570 upstream) : FAM76B (393831 downstream)																							tagtgacACTGGGGATCCTGA	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	96639745	96639746	+	IGR	INS	-	T	T	rs137948873	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96639745_96639746insT								JRKL (513018 upstream) : None (None downstream)																							ccttctctacctttttttaaag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	98403450	98403450	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98403450delC								None (None upstream) : CNTN5 (488421 downstream)																							AGTAAATCATCCATTCACAAT	0.199													4	2	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	100056077	100056077	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100056077delC	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GATCAggtatcctccattctc	0.109													4	2	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100648034	100648034	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100648034delG	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						CTCTGAGGCTGGGTGTGCATC	0.463													4	2	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100808152	100808152	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100808152delT	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						Gaaatttttatttttttttta	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	101627682	101627682	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101627682delA								TRPC6 (173023 upstream) : ANGPTL5 (133724 downstream)																							ACCTGTAAAGAAAAAAAAAAA	0.184													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	105091556	105091556	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105091556delT								CARD18 (81750 upstream) : GRIA4 (389244 downstream)																							TTGTAAAGTATTTTTTTATAC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	107139872	107139872	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107139872delA								GUCY1A2 (250701 upstream) : CWF19L2 (57202 downstream)																							TCATGAATTGAAATCACAGTA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	108912027	108912027	+	IGR	DEL	T	-	-	rs72370194		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108912027delT								DDX10 (100381 upstream) : C11orf87 (380848 downstream)																							aagacttgacttttttttttg	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109744003	109744003	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109744003delA								C11orf87 (444165 upstream) : ZC3H12C (219923 downstream)																							taaaacatacaaatggccaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	109797548	109797548	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109797548delA								C11orf87 (497710 upstream) : ZC3H12C (166378 downstream)																							aagcataagcaataaaagcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	110787479	110787479	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110787479delT								ARHGAP20 (203567 upstream) : C11orf53 (339228 downstream)																							AATCTTGGCATTTTTTTTTCT	0.254													4	2	---	---	---	---	
SIK2	23235	broad.mit.edu	37	11	111549502	111549502	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111549502delA	uc001plt.2	+							NM_015191	NP_056006	Q9H0K1	SIK2_HUMAN	SNF1-like kinase 2						intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3						ACGTGACAGGAAAAAAAAATT	0.378													4	2	---	---	---	---	
BCO2	83875	broad.mit.edu	37	11	112069582	112069582	+	Intron	DEL	T	-	-	rs34582291		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112069582delT	uc001pnf.2	+						BCO2_uc001pne.1_Intron|BCO2_uc001png.2_Intron|BCO2_uc001pnh.2_Intron|BCO2_uc010rwt.1_Intron|BCO2_uc009yyn.2_Intron|BCO2_uc001pni.2_Intron	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN	beta-carotene dioxygenase 2 isoform a						carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GGCTGCTATCTTTTTTTTTTT	0.373													4	2	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116790875	116790875	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116790875delT	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CTGCTCACCCTTTTTTTTTTT	0.438													3	3	---	---	---	---	
TMEM136	219902	broad.mit.edu	37	11	120199388	120199389	+	Intron	DEL	GT	-	-	rs36145001		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120199388_120199389delGT	uc001pxh.1	+						TMEM136_uc001pxg.2_Intron|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_Intron|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		aacagtcatagtgtgtgtgtgt	0.045													3	3	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120213770	120213771	+	Intron	INS	-	T	T	rs143844482	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120213770_120213771insT	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GCTTAGCAGTATTTTTTTTTTC	0.277			T	MLL	AML								4	2	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120852520	120852520	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120852520delA	uc001pxn.2	+						GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	CCCTTTTCTTAAATGGTCCTC	0.418													4	2	---	---	---	---	
GRAMD1B	57476	broad.mit.edu	37	11	123488352	123488352	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123488352delT	uc001pyx.2	+						GRAMD1B_uc001pyw.2_Intron|GRAMD1B_uc010rzw.1_Intron|GRAMD1B_uc010rzx.1_Intron|GRAMD1B_uc001pyy.2_Intron	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B							integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		aggataggtattactgtccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	124466125	124466125	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124466125delA								OR8A1 (25181 upstream) : PANX3 (15328 downstream)																							tcctattcccacctggattgc	0.124													4	2	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126604922	126604922	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126604922delC	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		GGGGCGTTTACCCATCCTCAG	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127472314	127472314	+	IGR	DEL	A	-	-	rs34724180		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127472314delA								KIRREL3 (598959 upstream) : ETS1 (856342 downstream)																							TCTTTGAATTAAAAAATTCTA	0.289													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127472614	127472615	+	IGR	DEL	AG	-	-	rs72126389		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127472614_127472615delAG								KIRREL3 (599259 upstream) : ETS1 (856041 downstream)																							ACAGGTTCTCagagagagagag	0.381													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128322144	128322144	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128322144delT								None (None upstream) : ETS1 (6512 downstream)																							atagagtccatttacatagca	0.159													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	132011132	132011133	+	Intron	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132011132_132011133delTC	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						tctctttctgtctctctctctc	0.233													4	2	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	132555567	132555567	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132555567delC	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TTAACACACTCCCCCCATCTT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	1650260	1650260	+	IGR	DEL	T	-	-	rs75263405		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1650260delT								ERC1 (45161 upstream) : FBXL14 (24900 downstream)																							GAATGCAAGCTTTTTTTTTTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	8136557	8136557	+	IGR	DEL	T	-	-	rs113183438		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8136557delT								SLC2A3 (47665 upstream) : FOXJ2 (48802 downstream)																							ttctctctccttttttttttg	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	9626720	9626720	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9626720delA								DDX12 (25952 upstream) : KLRB1 (121151 downstream)																							ttgcagccataaaaaaaaaac	0.045													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	10171414	10171440	+	IGR	DEL	ACTAGGGTGATATTTAAATATTTAAAA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10171414_10171440delACTAGGGTGATATTTAAATATTTAAAA								CLEC12B (15 upstream) : CLEC9A (11836 downstream)																							TCACGTGTGCACTAgggtgatatttaaatatttaaaaactagggtga	0.154													7	5	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11449668	11449668	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11449668delA	uc001qzf.1	-							NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						gacatatctcaaaaaaagaca	0.000										HNSCC(22;0.051)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13072298	13072298	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13072298delT								MIR614 (3446 upstream) : GPRC5D (21413 downstream)																							CCAGGCCAACTTTTTTTTTTC	0.358													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13584029	13584029	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13584029delC								C12orf36 (54384 upstream) : GRIN2B (130381 downstream)																							TAGATGGACACCCCAGGCACT	0.303													4	2	---	---	---	---	
ATF7IP	55729	broad.mit.edu	37	12	14640058	14640059	+	Intron	INS	-	T	T	rs145419010	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14640058_14640059insT	uc001rbw.2	+						ATF7IP_uc001rbx.2_Intron|ATF7IP_uc001rby.3_Intron|ATF7IP_uc001rca.2_Intron	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting						DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						tctattagaaccttttttttta	0.000													4	2	---	---	---	---	
ART4	420	broad.mit.edu	37	12	14999137	14999138	+	5'Flank	INS	-	TT	TT			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14999137_14999138insTT	uc001rcl.1	-						ART4_uc009zid.1_5'Flank|ART4_uc009zie.1_5'Flank|ART4_uc001rcm.1_5'Flank	NM_021071	NP_066549	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 precursor						arginine metabolic process|protein ADP-ribosylation	anchored to membrane|plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity				0						AGTTAACTTTATTTTTTTTTTT	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	18071915	18071915	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18071915delT								None (None upstream) : RERGL (161889 downstream)																							gggttttcccttgtaaaacca	0.000													4	2	---	---	---	---	
PIK3C2G	5288	broad.mit.edu	37	12	18517424	18517425	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18517424_18517425insT	uc001rdt.2	+						PIK3C2G_uc010sia.1_Intron|PIK3C2G_uc010sib.1_Intron|PIK3C2G_uc010sic.1_Intron	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				TAATACAAAGatttttttttta	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	19100486	19100486	+	IGR	DEL	T	-	-	rs35060904		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19100486delT								CAPZA3 (208365 upstream) : PLEKHA5 (182162 downstream)																							GTTTGAAGGATTTTTTTTTTT	0.234													3	3	---	---	---	---	
AEBP2	121536	broad.mit.edu	37	12	19602703	19602703	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19602703delT	uc001ref.2	+						AEBP2_uc001ree.2_Intron|AEBP2_uc001reg.1_Intron	NM_001114176	NP_001107648	Q6ZN18	AEBP2_HUMAN	AE binding protein 2 isoform b						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TTCCAGTTAATTTTTTTTGAA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	22232517	22232517	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22232517delA								CMAS (13916 upstream) : ST8SIA1 (113809 downstream)																							cttcagagagaaaaaaaaatg	0.000													4	2	---	---	---	---	
RASSF8	11228	broad.mit.edu	37	12	26112981	26112982	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26112981_26112982insA	uc001rgx.2	+						RASSF8_uc001rgy.2_Intron|RASSF8_uc001rgz.2_Intron|uc001rgu.1_5'Flank|uc001rgv.3_5'Flank|RASSF8_uc001rgw.1_Intron	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family						signal transduction						0	Colorectal(261;0.0847)					AGCATTTCATTAAAAAAAAAAA	0.401													4	2	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26591267	26591267	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26591267delA	uc001rhg.2	-						ITPR2_uc009zjg.1_Intron	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CATACCCACTAAAGTTGCTGA	0.333													4	2	---	---	---	---	
ITPR2	3709	broad.mit.edu	37	12	26677673	26677673	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26677673delC	uc001rhg.2	-							NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TTTTCAGATTCCATGACTTGT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	29106683	29106684	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29106683_29106684delTC								CCDC91 (403585 upstream) : FAR2 (195548 downstream)																							gttctctatttctctctctctc	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	30917966	30917966	+	IGR	DEL	A	-	-	rs34747593		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30917966delA								CAPRIN2 (10518 upstream) : TSPAN11 (161396 downstream)																							TCTGTGCCAGAAAAAAATTCA	0.333													0	7	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31595483	31595483	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31595483delA	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron|DENND5B_uc001rkj.2_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						CTTGAAAAAGAAAAAAAAATC	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33610379	33610379	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33610379delA								SYT10 (17625 upstream) : ALG10 (564837 downstream)																							tgaggaccagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	37889383	37889383	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37889383delT								None (None upstream) : ALG10B (821174 downstream)																							TTTTATTTTATTTTTTTTCAG	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	39847078	39847078	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39847078delT								KIF21A (10160 upstream) : ABCD2 (97944 downstream)																							CAAAAAGGTGTTTTTTTTTAT	0.378													4	2	---	---	---	---	
CNTN1	1272	broad.mit.edu	37	12	41101488	41101488	+	Intron	DEL	T	-	-	rs77731371		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41101488delT	uc001rmm.1	+						CNTN1_uc009zjy.1_Intron|CNTN1_uc001rmn.1_Intron	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TGTCCAGATATTTTTTTTGAT	0.323													4	2	---	---	---	---	
CNTN1	1272	broad.mit.edu	37	12	41452835	41452838	+	Intron	DEL	GATA	-	-	rs138596513		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41452835_41452838delGATA	uc001rmm.1	+						CNTN1_uc001rmn.1_Intron	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AATCCTTTTTGATAGATGGATGAC	0.299													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	41494213	41494213	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41494213delA								CNTN1 (30119 upstream) : PDZRN4 (88574 downstream)																							ggaagctgataaatgtagtcc	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	44877758	44877758	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44877758delT								TMEM117 (94218 upstream) : NELL2 (24300 downstream)																							agaaaatgactttttcttttg	0.000													4	2	---	---	---	---	
NELL2	4753	broad.mit.edu	37	12	44986306	44986307	+	Intron	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44986306_44986307delAG	uc001rog.2	-						NELL2_uc001rof.3_Intron|NELL2_uc001roh.2_Intron|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Intron|NELL2_uc010sla.1_Intron|NELL2_uc001roi.1_Intron|NELL2_uc010slb.1_Intron	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		AGAGGGAGATAGAGAGAGAGAG	0.421													4	2	---	---	---	---	
ANO6	196527	broad.mit.edu	37	12	45733542	45733542	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45733542delT	uc001roo.2	+						ANO6_uc010sld.1_Intron|ANO6_uc010sle.1_Intron|ANO6_uc010slf.1_Intron|ANO6_uc010slg.1_Intron	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a						activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						ATTAGACTAATTTTTTTTCCA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47114965	47114965	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47114965delA								SLC38A2 (348320 upstream) : SLC38A4 (43579 downstream)																							CCCTCATTGGAAAAAAAAAAT	0.383													4	2	---	---	---	---	
RPAP3	79657	broad.mit.edu	37	12	48083445	48083445	+	Intron	DEL	C	-	-	rs77474314		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48083445delC	uc001rpr.2	-						RPAP3_uc010slk.1_Intron|RPAP3_uc001rps.2_Intron	NM_024604	NP_078880	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3 isoform								binding			ovary(1)	1	Lung SC(27;0.192)					TTCTTCTTCTCCCCCCAGGGC	0.289													0	6	---	---	---	---	
BIN2	51411	broad.mit.edu	37	12	51682317	51682317	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51682317delT	uc001ryg.2	-						BIN2_uc009zlz.2_Intron|BIN2_uc001ryh.2_Intron|BIN2_uc010sng.1_Intron	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2							cytoplasm	protein binding			ovary(1)	1						ttatttattctttttttttgt	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55611035	55611035	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55611035delT								OR9K2 (86476 upstream) : OR10A7 (3774 downstream)																							CTTTTCAAGGTTTTTTTTGCC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59011961	59011961	+	Intron	DEL	A	-	-	rs34476858		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59011961delA	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																		cttgggattcaaataaagtct	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	60255434	60255435	+	IGR	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60255434_60255435delAC								SLC16A7 (80027 upstream) : None (None downstream)																							ACCCCcacatacacacacacac	0.158													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	61042140	61042140	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61042140delA								SLC16A7 (866733 upstream) : None (None downstream)																							aacagaagtgaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	63945980	63945981	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63945980_63945981insT								AVPR1A (399390 upstream) : DPY19L2 (6712 downstream)																							TCAGGAAACTCTTGTTTGTACC	0.361													3	3	---	---	---	---	
SRGAP1	57522	broad.mit.edu	37	12	64279624	64279625	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64279624_64279625delAC	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		atgaatgcctacacacacacaa	0.149													4	2	---	---	---	---	
TBK1	29110	broad.mit.edu	37	12	64895831	64895832	+	3'UTR	DEL	TA	-	-	rs35517559		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64895831_64895832delTA	uc001ssc.1	+	21						NM_013254	NP_037386	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1						I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5				GBM - Glioblastoma multiforme(28;0.0386)		TTTTAAGCTGTATATTTCTTTA	0.243													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	67330574	67330574	+	IGR	DEL	C	-	-	rs12825803	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67330574delC								GRIP1 (132680 upstream) : CAND1 (332487 downstream)																							CACCATGCCACCAGGGTAACC	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68392218	68392219	+	Intron	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68392218_68392219delAA	uc001stv.1	+											Homo sapiens cDNA FLJ42072 fis, clone SYNOV2014364.																		aagagagaccaaaaaaaaaaga	0.000													4	2	---	---	---	---	
MDM1	56890	broad.mit.edu	37	12	68692891	68692891	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68692891delG	uc001stz.2	-						MDM1_uc010stc.1_Intron|MDM1_uc009zqv.1_Intron	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1							nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		attcttaagaggggaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	70266020	70266020	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70266020delT								RAB3IP (49038 upstream) : CNOT2 (370757 downstream)																							cttggttaacttttgacttat	0.000													4	2	---	---	---	---	
PTPRR	5801	broad.mit.edu	37	12	71032764	71032764	+	3'UTR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71032764delG	uc001swi.1	-	14					PTPRR_uc001swf.1_RNA|PTPRR_uc001swg.1_RNA|PTPRR_uc001swh.1_3'UTR|PTPRR_uc009zrs.2_3'UTR|PTPRR_uc010stq.1_3'UTR|PTPRB_uc001swc.3_5'Flank|PTPRB_uc001swa.3_5'Flank|PTPRB_uc001swd.3_5'Flank|PTPRB_uc009zrr.1_5'Flank|PTPRB_uc001swe.2_5'Flank	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AGAATAATTTGGGGGATGCTT	0.403													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	71382570	71382570	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71382570delT								PTPRR (67986 upstream) : TSPAN8 (136307 downstream)																							tctgtgtatgtttttttttcc	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	71451460	71451460	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71451460delT								PTPRR (136876 upstream) : TSPAN8 (67417 downstream)																							TTCTTTGTTATTTTATTTCCA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	73460113	73460113	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73460113delA								TRHDE (400692 upstream) : None (None downstream)																							AGAATCTAAGAAAGAGGTGGT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74027588	74027588	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74027588delT								TRHDE (968167 upstream) : ATXN7L3B (903963 downstream)																							gccaacagactttccctaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74387166	74387166	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74387166delT								None (None upstream) : ATXN7L3B (544385 downstream)																							AATGTTGTTGttttttttgac	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74976415	74976415	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74976415delG								ATXN7L3B (41192 upstream) : KCNC2 (457482 downstream)																							ttagacagcaggagaatgcct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	75298775	75298775	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75298775delT								ATXN7L3B (363552 upstream) : KCNC2 (135122 downstream)																							TAAAGCTCTCTTTTTTTTTTG	0.378													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	78966994	78966994	+	IGR	DEL	C	-	-	rs34743124		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78966994delC								NAV3 (360206 upstream) : SYT1 (290779 downstream)																							aaggactcttcctctgaaggt	0.000													3	3	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79426443	79426443	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79426443delC	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						AATTAAAAATCCACATGTGAT	0.289													4	2	---	---	---	---	
PAWR	5074	broad.mit.edu	37	12	80069809	80069809	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80069809delA	uc001syx.2	-							NM_002583	NP_002574	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator						actin filament bundle assembly|apoptosis|induction of apoptosis|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	actin binding|enzyme binding|leucine zipper domain binding|transcription corepressor activity				0						GAAACAGAGGAAAAAAAAAAA	0.318													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80513846	80513846	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80513846delT								PPP1R12A (184611 upstream) : PTPRQ (324280 downstream)																							CTTTTTACCATTTTTTTTTTC	0.303													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	82319500	82319500	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82319500delT								PPFIA2 (166391 upstream) : CCDC59 (426590 downstream)																							gggctcgttcttTTTTTTTTC	0.010													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	82376096	82376096	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82376096delA								PPFIA2 (222987 upstream) : CCDC59 (369994 downstream)																							aagcttaaataaaaaaaaacc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	82629232	82629232	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82629232delT								PPFIA2 (476123 upstream) : CCDC59 (116858 downstream)																							ACTTTTTAAATTTTTtttaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	84038739	84038739	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84038739delT								TMTC2 (510676 upstream) : None (None downstream)																							gcccaaaatcttaagctgata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	84638517	84638518	+	IGR	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84638517_84638518delGT								None (None upstream) : SLC6A15 (614751 downstream)																							CTTTTTACTCgtgtgtgtgtgt	0.302													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	85752286	85752286	+	IGR	DEL	C	-	-	rs78636743		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85752286delC								ALX1 (56727 upstream) : RASSF9 (446045 downstream)																							ATACTGGCAACATTTTGGTGA	0.358													2	5	---	---	---	---	
MGAT4C	25834	broad.mit.edu	37	12	86418072	86418072	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86418072delT	uc001tai.3	-						MGAT4C_uc001tal.3_Intron|MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron|MGAT4C_uc010sum.1_Intron|MGAT4C_uc001tah.3_Intron	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						AATTAATACATTTTTTTTTCT	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	90763874	90763874	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90763874delT								LOC338758 (658146 upstream) : C12orf12 (582119 downstream)																							ACATTCTGGCTTTTTATTGCA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	91283198	91283199	+	IGR	INS	-	T	T	rs151123877	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91283198_91283199insT								None (None upstream) : C12orf12 (62794 downstream)																							gtctagttaactttttttattg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	91436487	91436487	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91436487delT								EPYC (37684 upstream) : KERA (7786 downstream)																							GTGACTGTCCTTTTTTTAATC	0.323													4	2	---	---	---	---	
NTN4	59277	broad.mit.edu	37	12	96113494	96113494	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96113494delT	uc001tei.2	-						NTN4_uc009ztf.2_Intron|NTN4_uc009ztg.2_Intron	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor						axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						AAATATGCCCTTTCCCATTAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	96548057	96548058	+	IGR	DEL	TC	-	-	rs111331011		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96548057_96548058delTC								LTA4H (110759 upstream) : ELK3 (40149 downstream)																							aattccattttctttttttttt	0.000													4	2	---	---	---	---	
UHRF1BP1L	23074	broad.mit.edu	37	12	100464068	100464069	+	Intron	INS	-	TT	TT			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100464068_100464069insTT	uc001tgq.2	-						UHRF1BP1L_uc001tgr.2_Intron|UHRF1BP1L_uc001tgp.2_Intron	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2						taattaattaattttttttttt	0.124													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103346094	103346094	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103346094delT								PAH (34713 upstream) : ASCL1 (5358 downstream)																							TTATTGTAAGTTTTTTTTTTC	0.378													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105337822	105337822	+	IGR	DEL	A	-	-	rs13377813	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105337822delA								SLC41A2 (15350 upstream) : C12orf45 (42276 downstream)																							ttgcaactacaAAAAAAAGGG	0.129													4	2	---	---	---	---	
POLR3B	55703	broad.mit.edu	37	12	106755895	106755895	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106755895delT	uc001tlp.2	+						POLR3B_uc001tlq.2_Intron	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						AAGTTTTAAATTTTTTTTTTA	0.393													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	111240902	111240903	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111240902_111240903insT								PPP1CC (60145 upstream) : CCDC63 (43908 downstream)																							TTTCTTCTACATTTTTTTTTTT	0.257													4	2	---	---	---	---	
CUX2	23316	broad.mit.edu	37	12	111522298	111522298	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111522298delT	uc001tsa.1	+							NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						AAACAGAATCTTTTTTTTTTT	0.363													4	2	---	---	---	---	
NAA25	80018	broad.mit.edu	37	12	112491626	112491626	+	Intron	DEL	A	-	-	rs4041251		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112491626delA	uc001ttm.2	-						NAA25_uc001ttn.3_Intron|NAA25_uc009zvz.1_Intron|NAA25_uc009zwa.1_Intron	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20							cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						GTTAAAATTTaaaaaaaaaaa	0.294													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114103445	114103446	+	IGR	DEL	AC	-	-	rs113277935		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114103445_114103446delAC								LHX5 (193568 upstream) : RBM19 (151097 downstream)																							tttccatgctacacacacacac	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	114566341	114566341	+	IGR	DEL	G	-	-	rs61930840	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114566341delG								RBM19 (162165 upstream) : TBX5 (225395 downstream)																							GAAGGCATCTGGATAAAGGCT	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116027462	116027462	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116027462delA								TBX3 (905493 upstream) : MED13L (368921 downstream)																							TCGATTGGTTAAAACAGTTGG	0.274													4	2	---	---	---	---	
NOS1	4842	broad.mit.edu	37	12	117722892	117722892	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117722892delA	uc001twm.1	-							NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal						multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	aaTAAAAAATAAAAAAAAAAG	0.259													6	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118261354	118261354	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118261354delA	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					catcaggtggaagggcaactg	0.000													4	2	---	---	---	---	
SUDS3	64426	broad.mit.edu	37	12	118855284	118855284	+	3'UTR	DEL	T	-	-	rs8467	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118855284delT	uc001twz.2	+	12						NM_022491	NP_071936	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3						chromatin modification|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	Sin3 complex	histone deacetylase binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCCTGATTAATTTTTTTTTTC	0.313													2	4	---	---	---	---	
LRRC43	254050	broad.mit.edu	37	12	122678761	122678761	+	Intron	DEL	T	-	-	rs77174217		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122678761delT	uc009zxm.2	+						LRRC43_uc001ubw.3_Intron|LRRC43_uc009zxn.2_Intron	NM_001098519	NP_001091989	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 1												0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		tataaagttgttttttttttt	0.000													3	3	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124923725	124923726	+	Intron	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124923725_124923726delAG	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		acagagacccagagagagagag	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126178025	126178026	+	IGR	INS	-	GT	GT	rs148160356	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126178025_126178026insGT								TMEM132B (34436 upstream) : LOC100128554 (749001 downstream)																							tctgtgtgtacgtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126392788	126392789	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126392788_126392789delTG								TMEM132B (249199 upstream) : LOC100128554 (534238 downstream)																							tgtatgtgattgtgtgtgtgtg	0.257													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127784980	127784980	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127784980delT								LOC100128554 (827650 upstream) : None (None downstream)																							tgttgggttcttttttttctt	0.045													4	2	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	131066882	131066882	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131066882delT	uc001uim.2	-									O15034	RIMB2_HUMAN	RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		atgaatCttgtttccttcatt	0.005													4	2	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132397937	132397937	+	Intron	DEL	A	-	-	rs80025522		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132397937delA	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		actctgtctcaaaaaaaaaaa	0.139													6	4	---	---	---	---	
GJB6	10804	broad.mit.edu	37	13	20798360	20798360	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20798360delA	uc001umz.3	-						GJB6_uc001unc.3_Intron|GJB6_uc001una.3_Intron|GJB6_uc001und.3_Intron|GJB6_uc001unb.3_Intron	NM_006783	NP_006774	O95452	CXB6_HUMAN	gap junction protein, beta 6						cell communication|sensory perception of sound	connexon complex|integral to membrane|intracellular membrane-bounded organelle				ovary(1)	1		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		ATTCAGGGGGAAAAAAAACTT	0.318													4	2	---	---	---	---	
ZDHHC20	253832	broad.mit.edu	37	13	21994879	21994879	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21994879delA	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		GAGAGTTTCTAAAAATAAACT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23575661	23575661	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23575661delA								None (None upstream) : SGCG (179399 downstream)																							AGAAAGTAGGAAAAAAAAAAT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23622966	23622967	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23622966_23622967insG								None (None upstream) : SGCG (132093 downstream)																							aatatgaaaaagatgtctactc	0.000													4	2	---	---	---	---	
ATP12A	479	broad.mit.edu	37	13	25268999	25269000	+	Intron	INS	-	CA	CA	rs57137379		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25268999_25269000insCA	uc001upp.2	+						ATP12A_uc010aaa.2_Intron	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A						ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	TCTCTCTCTCTcacacacacac	0.446													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27097544	27097544	+	IGR	DEL	A	-	-	rs34444214		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27097544delA								CDK8 (118975 upstream) : WASF3 (34296 downstream)																							ctgaggagttaaaaaaatgtc	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27434841	27434842	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27434841_27434842delTG								GPR12 (99919 upstream) : USP12 (207596 downstream)																							ATCAACCATCTGTCAATCATCC	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	30557037	30557037	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30557037delT								UBL3 (132217 upstream) : KATNAL1 (219731 downstream)																							gttgttgctatttttttggtg	0.000													4	2	---	---	---	---	
LOC100188949	100188949	broad.mit.edu	37	13	30928241	30928242	+	Intron	INS	-	T	T	rs145934484	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30928241_30928242insT	uc001usu.2	-							NR_024464				full-length cDNA clone CS0DG007YC17 of B cells (Ramos cell line) of Homo sapiens (human).												0						gcaagaatgggggggcaggagg	0.010													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31002795	31002795	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31002795delT								LOC100188949 (54759 upstream) : HMGB1 (30086 downstream)																							TAAGATGTTCTTAAAAAAAAA	0.333													4	2	---	---	---	---	
HSPH1	10808	broad.mit.edu	37	13	31734922	31734922	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31734922delA	uc001utj.2	-						HSPH1_uc001utk.2_Intron|HSPH1_uc010aaw.2_Intron|HSPH1_uc001utl.2_Intron|HSPH1_uc010tds.1_Intron|HSPH1_uc010tdt.1_Intron|HSPH1_uc010aax.1_Intron|HSPH1_uc010aay.1_Intron	NM_006644	NP_006635	Q92598	HS105_HUMAN	heat shock 105kD						positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding				0		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		GGCAAAGAGCAAAAAAAAAGA	0.343													4	2	---	---	---	---	
PDS5B	23047	broad.mit.edu	37	13	33332098	33332098	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33332098delT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TAACTGTTTCTTTTTTTTTTT	0.244													4	4	---	---	---	---	
NBEA	26960	broad.mit.edu	37	13	35549869	35549869	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35549869delA	uc001uvb.2	+							NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		aatcagcaagaaaaaaaaaat	0.000													4	2	---	---	---	---	
NBEA	26960	broad.mit.edu	37	13	36138197	36138197	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36138197delT	uc001uvb.2	+						NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_Intron|NBEA_uc010teg.1_Intron	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		agcagTATCCTTTTCTTTCTT	0.149													4	2	---	---	---	---	
POSTN	10631	broad.mit.edu	37	13	38165956	38165956	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38165956delA	uc001uwo.3	-						POSTN_uc001uwp.3_Intron|POSTN_uc001uwr.2_Intron|POSTN_uc001uwq.2_Intron|POSTN_uc010teu.1_Intron|POSTN_uc010tev.1_Intron|POSTN_uc010tew.1_Intron|POSTN_uc010tex.1_Intron	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1						cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		agacaagttcaaagaacagga	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	39255704	39255704	+	IGR	DEL	C	-	-	rs5802953		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39255704delC								UFM1 (318562 upstream) : FREM2 (5469 downstream)																							AAAATAGTAACAGGCACAAGA	0.408													4	2	---	---	---	---	
LOC646982	646982	broad.mit.edu	37	13	41033203	41033218	+	Intron	DEL	AGGGAGAGAGGGAGGG	-	-	rs67814385		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41033203_41033218delAGGGAGAGAGGGAGGG	uc010tfa.1	-						LOC646982_uc001uxj.3_Intron|LOC646982_uc001uxk.2_Intron	NR_024507				Homo sapiens cDNA, FLJ17553.												0						GAAAAAAGAAagggagagagggagggagggagagag	0.310													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	41873334	41873335	+	IGR	INS	-	AA	AA			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41873334_41873335insAA								MTRF1 (35592 upstream) : NAA16 (12006 downstream)																							atctaaaaaagaaaaaaaaaag	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	42554881	42554882	+	IGR	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42554881_42554882delCT								KIAA0564 (19660 upstream) : DGKH (59290 downstream)																							ggcccttggcctctctctctct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	43113677	43113678	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43113677_43113678insT								AKAP11 (216275 upstream) : TNFSF11 (23194 downstream)																							TATTAGGGGGATTTTTTTTTTT	0.302													4	2	---	---	---	---	
ENOX1	55068	broad.mit.edu	37	13	43819917	43819917	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43819917delG	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		GCAGATGTGTGGGGCTCCAAG	0.463													4	2	---	---	---	---	
ENOX1	55068	broad.mit.edu	37	13	43899241	43899241	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43899241delT	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron|ENOX1_uc010tfm.1_Intron	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		AACAGAGGACTCTTTTTTTTT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	46773989	46773989	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46773989delA								LCP1 (17530 upstream) : C13orf18 (142150 downstream)																							tatggaaatgaaaaaaaaaag	0.000													4	2	---	---	---	---	
RCBTB2	1102	broad.mit.edu	37	13	49090017	49090017	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49090017delA	uc001vch.2	-						RCBTB2_uc010tgg.1_Intron|RCBTB2_uc001vci.2_Intron|RCBTB2_uc010tgh.1_Intron|RCBTB2_uc001vcj.2_Intron|RCBTB2_uc010acv.1_Intron|RCBTB2_uc010tgi.1_Intron	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB								Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		TCGCAGCTGCAGGGATTGCCT	0.557													4	2	---	---	---	---	
CDADC1	81602	broad.mit.edu	37	13	49858801	49858801	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49858801delA	uc001vcu.2	+						CDADC1_uc010tgk.1_Intron|CDADC1_uc001vcv.2_Intron	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1								hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		GTGCTAGCCTAAACCATCCCA	0.373													4	2	---	---	---	---	
CAB39L	81617	broad.mit.edu	37	13	49971749	49971749	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49971749delA	uc001vcw.2	-						CAB39L_uc001vcx.2_Intron|CAB39L_uc010adf.2_Intron	NM_030925	NP_112187	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		GTAGTTCCAGAAAAAAAAact	0.119													4	2	---	---	---	---	
FAM124A	220108	broad.mit.edu	37	13	51807928	51807928	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51807928delA	uc001vfg.1	+						FAM124A_uc001vfe.2_Intron|FAM124A_uc001vff.1_Intron	NM_145019	NP_659456	Q86V42	F124A_HUMAN	hypothetical protein LOC220108											central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		CTACAATAAGAAAAAAAAATA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55284889	55284889	+	IGR	DEL	T	-	-	rs76229012		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55284889delT								MIR1297 (398706 upstream) : None (None downstream)																							TGTAAGACTGTTTTTTTTTTT	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55320961	55320961	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55320961delT								MIR1297 (434778 upstream) : None (None downstream)																							GAGTTATTGATTTTTTTTTCT	0.259													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	57201276	57201277	+	IGR	INS	-	A	A	rs140365277	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57201276_57201277insA								None (None upstream) : PRR20C (513775 downstream)																							accaaaataagaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	58637844	58637844	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58637844delA								PCDH17 (334779 upstream) : None (None downstream)																							CAGAATGCTGAAAAAAATAGA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	59083820	59083820	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59083820delC								PCDH17 (780755 upstream) : None (None downstream)																							atttagagctcctttcagcag	0.000													4	2	---	---	---	---	
DIAPH3	81624	broad.mit.edu	37	13	60498658	60498658	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60498658delT	uc001vht.2	-						DIAPH3_uc001vhu.2_Intron|DIAPH3_uc001vhv.2_Intron	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		AGAGTAGCTGTTTTTTTTTTT	0.244													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	60892366	60892366	+	IGR	DEL	T	-	-	rs34926376		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60892366delT								DIAPH3 (154247 upstream) : TDRD3 (78225 downstream)																							CTGCCAGTACTTTTTTTGCAA	0.358													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63621902	63621903	+	IGR	INS	-	A	A	rs138473052		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63621902_63621903insA								None (None upstream) : OR7E156P (689665 downstream)																							aggtccttgagaaaatattcct	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	65859137	65859137	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65859137delT								None (None upstream) : None (None downstream)																							caaaacaagATTTTTTTTTTA	0.070													4	2	---	---	---	---	
PCDH9	5101	broad.mit.edu	37	13	67425522	67425522	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67425522delA	uc001vik.2	-						PCDH9_uc010aei.2_Intron|PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AAAACTTCTCAAAAAAAAATA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	68238447	68238447	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68238447delA								PCDH9 (433979 upstream) : None (None downstream)																							GCTCAAAGACAAAACATGTCA	0.428													4	2	---	---	---	---	
KLF5	688	broad.mit.edu	37	13	73637032	73637032	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73637032delT	uc001vje.2	+						KLF5_uc001vjd.2_Intron	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5						transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		AAAAATTACCTTTTTTTTTTT	0.294													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	74111333	74111333	+	IGR	DEL	T	-	-	rs77805451		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74111333delT								KLF5 (459658 upstream) : KLF12 (148817 downstream)																							TCTCGGCTCCTTTTTTTTTAT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	75466283	75466284	+	IGR	INS	-	TT	TT	rs146511479	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75466283_75466284insTT								KLF12 (757889 upstream) : LOC647288 (345606 downstream)																							AGTACTACATGTTTTTCATGGA	0.401													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79438660	79438660	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79438660delT								RNF219 (203960 upstream) : RBM26 (455440 downstream)																							tactcatgtattttttttgta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81124288	81124288	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81124288delA								SPRY2 (209202 upstream) : None (None downstream)																							GAACTATAAGAAAAAAAAAAT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81674552	81674552	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81674552delT								SPRY2 (759466 upstream) : None (None downstream)																							acgagaaagatttagcaggcg	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	83882046	83882046	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83882046delT								None (None upstream) : SLITRK1 (569298 downstream)																							TGTATTTCACTTTTTTCATAA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	85761462	85761462	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85761462delA								None (None upstream) : SLITRK6 (605460 downstream)																							AGCTGGAAAGAAAAAAAAATT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	87597365	87597365	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87597365delA								None (None upstream) : SLITRK5 (727505 downstream)																							AAGTTGCAATAAAAAAATCTA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	87607012	87607012	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87607012delT								None (None upstream) : SLITRK5 (717858 downstream)																							aattttttcctctttctcaca	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	90766650	90766651	+	IGR	INS	-	A	A	rs150414814	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90766650_90766651insA								None (None upstream) : MIR622 (116785 downstream)																							TGGTCAGCCACAAAAAAGCTCC	0.396													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	93575431	93575433	+	IGR	DEL	GAA	-	-	rs67486180		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93575431_93575433delGAA								GPC5 (55946 upstream) : GPC6 (303645 downstream)																							GCATGAAAATGAAGAAGAAGAAA	0.330													3	4	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	94848440	94848440	+	Intron	DEL	T	-	-	rs34583361		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94848440delT	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				ACCTTTTCAGTTTTTTTTTTT	0.289													2	4	---	---	---	---	
DNAJC3	5611	broad.mit.edu	37	13	96422082	96422082	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96422082delT	uc001vmq.2	+						DNAJC3_uc001vmr.2_Intron	NM_006260	NP_006251	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3						protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			GATTAGCACATTTGCTGACCA	0.453													4	2	---	---	---	---	
MBNL2	10150	broad.mit.edu	37	13	98009476	98009476	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98009476delT	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron|MBNL2_uc001vnc.2_Intron	NM_144778	NP_659002	Q5VZF2	MBNL2_HUMAN	muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			GCTGAAGCCATTTTTTTTGTT	0.323													4	2	---	---	---	---	
FARP1	10160	broad.mit.edu	37	13	99098111	99098112	+	Intron	INS	-	TGTC	TGTC	rs143950346	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99098111_99098112insTGTC	uc001vnj.2	+						FARP1_uc001vnh.2_Intron	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			ggacctcaacgtgtcttttggg	0.243											OREG0022474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	100656274	100656274	+	IGR	DEL	T	-	-	rs35278577		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100656274delT								ZIC2 (17256 upstream) : PCCA (85063 downstream)																							aatttaccacttaaagacctt	0.040													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101384722	101384722	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101384722delA								TMTC4 (57619 upstream) : NALCN (321408 downstream)																							TTCCCTACTTAAAATCTCACC	0.299													4	2	---	---	---	---	
DAOA	267012	broad.mit.edu	37	13	106115444	106115445	+	5'Flank	DEL	AC	-	-	rs35320054		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106115444_106115445delAC	uc001vqb.2	+						DAOA_uc010tjf.1_5'Flank|DAOA_uc001vpz.2_5'Flank	NM_172370	NP_758958	P59103	DAOA_HUMAN	D-amino acid oxidase activator isoform 1							Golgi apparatus					0	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					acacacacatacacacacacac	0.272													1	6	---	---	---	---	
FAM155A	728215	broad.mit.edu	37	13	108092009	108092009	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108092009delA	uc001vql.2	-							NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1						CATTGATCTGAAAAACTCTCA	0.368													4	2	---	---	---	---	
MYO16	23026	broad.mit.edu	37	13	109412733	109412734	+	Intron	INS	-	T	T	rs141873963	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109412733_109412734insT	uc001vqt.1	+						MYO16_uc010agk.1_Intron	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCACATGCCTCTTGCTTCTGTT	0.332													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19622325	19622325	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19622325delA	uc001vvi.2	+											Homo sapiens prostate-specific P775P mRNA sequence.																		cagcctttttaaaacccctcc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20529304	20529305	+	IGR	INS	-	TAAT	TAAT	rs150190820	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20529304_20529305insTAAT								OR4L1 (162 upstream) : OR4K17 (56261 downstream)																							aaacataaggatagagatctgc	0.129													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28483655	28483655	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28483655delA								None (None upstream) : FOXG1 (752632 downstream)																							CAATGGAAAGAAAAAAAAATC	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	29922777	29922777	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29922777delT								C14orf23 (658778 upstream) : PRKD1 (122912 downstream)																							CCACACTTCATTTTTTTAGAT	0.368													4	2	---	---	---	---	
SCFD1	23256	broad.mit.edu	37	14	31166993	31166993	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31166993delA	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_Intron|SCFD1_uc010ame.1_Intron	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		ctatagtcttaaaaagtaacc	0.000													4	2	---	---	---	---	
NPAS3	64067	broad.mit.edu	37	14	34055102	34055102	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34055102delG	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TTAAGCCCCTGGACTTTGATG	0.348													4	2	---	---	---	---	
PSMA6	5687	broad.mit.edu	37	14	35781145	35781145	+	Intron	DEL	A	-	-	rs74043873		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35781145delA	uc001wtd.2	+						KIAA0391_uc001wta.2_Intron|PSMA6_uc010tpt.1_Intron|PSMA6_uc010tpu.1_Intron	NM_002791	NP_002782	P60900	PSA6_HUMAN	proteasome alpha 6 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nuclear matrix|polysome|proteasome core complex, alpha-subunit complex|sarcomere	NF-kappaB binding|purine ribonucleoside triphosphate binding|RNA binding|threonine-type endopeptidase activity				0	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		tttctattttaaaaaaaaagt	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	40324660	40324662	+	IGR	DEL	TCC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40324660_40324662delTCC								FBXO33 (422956 upstream) : None (None downstream)																							TGTTTTACCTTCCTCCTCCTCCT	0.379													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	41676570	41676571	+	IGR	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41676570_41676571delAG								None (None upstream) : LRFN5 (400193 downstream)																							ATGTAAATTCAGAGAGAGAGGG	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	43413287	43413287	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43413287delT								None (None upstream) : None (None downstream)																							aacttagtggtttaaaacaat	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	46010078	46010078	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46010078delA								C14orf106 (287473 upstream) : None (None downstream)																							attaaaaaTTAAAAAAAAAct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	46175216	46175216	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46175216delA								C14orf106 (452611 upstream) : RPL10L (945006 downstream)																							AAAGAGAATTAAAAAAAAAAG	0.393													4	2	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	47869166	47869166	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47869166delT	uc001wwj.3	-						MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CCTAAAAGGCTTACATATGGT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49863841	49863841	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49863841delA								None (None upstream) : SDCCAG1 (169186 downstream)																							aagacacaacaaaaaaagaaa	0.000													1	6	---	---	---	---	
SDCCAG1	9147	broad.mit.edu	37	14	50117350	50117350	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50117350delA	uc010anj.1	-						POLE2_uc010ann.2_Intron|POLE2_uc001wwu.2_Intron|POLE2_uc001wwv.2_Intron|POLE2_uc010ano.2_Intron	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		GTATTTTAGGAAAAAAAATCT	0.194													5	3	---	---	---	---	
GNG2	54331	broad.mit.edu	37	14	52392836	52392836	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52392836delA	uc001wzi.2	+						GNG2_uc001wzh.2_Intron|GNG2_uc010aoc.1_Intron|GNG2_uc001wzj.2_Intron|GNG2_uc001wzk.2_Intron|GNG2_uc010aob.1_Intron	NM_053064	NP_444292	P59768	GBG2_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|platelet activation|synaptic transmission	heterotrimeric G-protein complex	protein binding|signal transducer activity				0	all_epithelial(31;0.0659)|Breast(41;0.0684)				Halothane(DB01159)	TCCAATTTTTAAAAAAATTGT	0.264													4	2	---	---	---	---	
FBXO34	55030	broad.mit.edu	37	14	55765098	55765098	+	Intron	DEL	T	-	-	rs112310781		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55765098delT	uc001xbu.2	+						FBXO34_uc010aoo.2_Intron	NM_017943	NP_060413	Q9NWN3	FBX34_HUMAN	F-box only protein 34											ovary(2)|lung(2)|skin(1)	5						GGATTATTTCTTTTTTTTTTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56396171	56396171	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56396171delA								C14orf34 (132779 upstream) : PELI2 (188922 downstream)																							TACCTGCTAGAAAaaaaaaat	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62111917	62111917	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62111917delT	uc001xfp.2	+											Homo sapiens cDNA: FLJ22447 fis, clone HRC09479.																		ACTGATGGGATTTTTTTTTTT	0.259													4	4	---	---	---	---	
KCNH5	27133	broad.mit.edu	37	14	63253062	63253062	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63253062delA	uc001xfx.2	-						KCNH5_uc001xfy.2_Intron|KCNH5_uc001xfz.1_Intron	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GCTCTATTTGAAGATTTTTCT	0.239													4	2	---	---	---	---	
FUT8	2530	broad.mit.edu	37	14	66122940	66122940	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66122940delA	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		agactcttccaaaaaaaaaac	0.000													4	2	---	---	---	---	
GPHN	10243	broad.mit.edu	37	14	67112827	67112827	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67112827delA	uc001xiy.2	+						GPHN_uc001xiw.2_Intron|GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron	NM_001024218	NP_001019389	Q9NQX3	GEPH_HUMAN	gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		caacagcaacaaaaaaaaact	0.104			T	MLL	AL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	68208182	68208182	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68208182delG								RDH12 (7015 upstream) : ZFYVE26 (5055 downstream)																							CATGTCCACTGGGGGCCTAAC	0.338													4	2	---	---	---	---	
RAD51L1	5890	broad.mit.edu	37	14	69058647	69058648	+	Intron	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69058647_69058648insG	uc001xkf.1	+						RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		AAATGGAGCCCGGGGAAACTGT	0.554			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	69216979	69216982	+	IGR	DEL	ATAG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69216979_69216982delATAG								RAD51L1 (20044 upstream) : ZFP36L1 (37393 downstream)																							GGCCCAGGACatagatagatagat	0.314													5	3	---	---	---	---	
SLC8A3	6547	broad.mit.edu	37	14	70558988	70558988	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70558988delC	uc001xly.2	-						SLC8A3_uc001xlw.2_Intron|SLC8A3_uc001xlx.2_Intron|SLC8A3_uc001xlz.2_Intron|SLC8A3_uc010ara.2_Intron	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		tacctcatgacccccagtcat	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	71766656	71766657	+	IGR	DEL	GA	-	-	rs139752043		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71766656_71766657delGA								PCNX (184557 upstream) : SNORD56B (98397 downstream)																							ctccattcctgagagatcccat	0.015													5	4	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72473268	72473269	+	Intron	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72473268_72473269delCA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		ggaagctggccacacacatgtg	0.000													4	2	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72512425	72512425	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72512425delA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		tttcttaaagaaaaaaaaaaa	0.000													4	3	---	---	---	---	
KIAA0317	9870	broad.mit.edu	37	14	75158612	75158612	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75158612delG	uc001xqb.2	-						KIAA0317_uc010tut.1_Intron|KIAA0317_uc001xqc.2_Intron|KIAA0317_uc001xqd.1_Intron	NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)		TTGCTCTGCTGGGGACAAAGT	0.383													4	2	---	---	---	---	
ESRRB	2103	broad.mit.edu	37	14	76860593	76860593	+	Intron	DEL	T	-	-	rs35206648		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76860593delT	uc001xsr.2	+						ESRRB_uc001xso.2_Intron	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CCCATCCTTCTTTCTTTCTAG	0.443													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	80431916	80431917	+	IGR	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80431916_80431917delAG								NRXN3 (101158 upstream) : DIO2 (231953 downstream)																							TGGATgagaaagagagagagag	0.292													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	83320084	83320084	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83320084delA								None (None upstream) : None (None downstream)																							CAAAACTCTGAAAAAAAAATC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	84002342	84002342	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84002342delT								None (None upstream) : None (None downstream)																							TGACtttttatttttttattt	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	85740997	85740997	+	IGR	DEL	T	-	-	rs147620833		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85740997delT								None (None upstream) : FLRT2 (255491 downstream)																							tttctttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86231169	86231169	+	IGR	DEL	C	-	-	rs10135948		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86231169delC								FLRT2 (136900 upstream) : None (None downstream)																							AACAAACAAACAAAAAAAAAC	0.333													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87025327	87025327	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87025327delA								FLRT2 (931058 upstream) : None (None downstream)																							atataaacataaacacaagga	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	88802291	88802291	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88802291delT								KCNK10 (9035 upstream) : SPATA7 (49721 downstream)																							TCACAAATGCTTTTTTAGCTA	0.289													4	2	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89086601	89086601	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89086601delA	uc001xxg.2	-						EML5_uc001xxf.2_Intron|EML5_uc001xxd.2_5'Flank|EML5_uc001xxe.2_Intron	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						GCCACTGTTGAAAAATGCTTA	0.299													4	2	---	---	---	---	
RPS6KA5	9252	broad.mit.edu	37	14	91479808	91479808	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91479808delA	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		acagcagggtaaaaaaaaaag	0.000													4	3	---	---	---	---	
C14orf159	80017	broad.mit.edu	37	14	91623963	91623964	+	Intron	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91623963_91623964delTT	uc001xzb.2	+						C14orf159_uc010atu.1_Intron|C14orf159_uc010atv.1_Intron|C14orf159_uc001xyy.2_Intron|C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Intron|C14orf159_uc001xzc.2_Intron|C14orf159_uc001xza.2_Intron|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Intron|C14orf159_uc010twj.1_Intron|C14orf159_uc001xze.2_Intron	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a							mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		ATTGAAGGCATTTTTTTTTTGA	0.327													4	2	---	---	---	---	
OTUB2	78990	broad.mit.edu	37	14	94504012	94504012	+	Intron	DEL	T	-	-	rs34432698		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94504012delT	uc001yci.2	+						OTUB2_uc001ych.2_Intron	NM_023112	NP_075601	Q96DC9	OTUB2_HUMAN	OTU domain, ubiquitin aldehyde binding 2						cellular amino acid metabolic process|protein K48-linked deubiquitination|protein K63-linked deubiquitination		omega peptidase activity|protein binding|ubiquitin-specific protease activity				0		all_cancers(154;0.12)		Epithelial(152;0.124)|all cancers(159;0.21)|COAD - Colon adenocarcinoma(157;0.215)		AAAAAAAGGATTTTTTTTTGT	0.204													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	94892032	94892032	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94892032delT								SERPINA1 (35003 upstream) : SERPINA11 (16769 downstream)																							tggaagggcctccttcaagca	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95404767	95404768	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95404767_95404768delTG								GSC (168268 upstream) : DICER1 (147797 downstream)																							gcatatctattgtgtgtgtgtg	0.045													4	2	---	---	---	---	
C14orf64	388011	broad.mit.edu	37	14	98422285	98422286	+	Intron	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98422285_98422286delAG	uc001yfw.2	-						C14orf64_uc001yfx.2_Intron	NR_015430				Homo sapiens cDNA FLJ34349 fis, clone FEBRA2011063.												0						tcctgcccttagggagcctggt	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98840555	98840556	+	IGR	INS	-	T	T	rs36023093		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98840555_98840556insT								C14orf64 (396094 upstream) : C14orf177 (337394 downstream)																							CAAGAGTTGAATTTTTTTTTTT	0.267													4	2	---	---	---	---	
EML1	2009	broad.mit.edu	37	14	100306613	100306613	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100306613delA	uc001ygs.2	+						EML1_uc010avt.1_Intron|EML1_uc010tww.1_Intron|EML1_uc001ygq.2_Intron|EML1_uc001ygr.2_Intron	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1							cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)				AAAATGATGTAAAAATTCTAT	0.303													4	2	---	---	---	---	
PACS2	23241	broad.mit.edu	37	14	105789582	105789583	+	Intron	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105789582_105789583delTC	uc001yqt.2	+						PACS2_uc001yqs.2_Intron|PACS2_uc001yqv.2_Intron|PACS2_uc001yqu.2_Intron	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2						apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		tctgcgctattctctctctcac	0.257													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106491274	106491277	+	Intron	DEL	ACCA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106491274_106491277delACCA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						acacacacacaccacacacacaca	0.147													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20133476	20133478	+	IGR	DEL	AAT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20133476_20133478delAAT								None (None upstream) : GOLGA6L6 (603616 downstream)																							ggcattgtaaaatagcaagagaa	0.108													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20397847	20397849	+	IGR	DEL	TAT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20397847_20397849delTAT								None (None upstream) : GOLGA6L6 (339245 downstream)																							TTGTGGTAAATATTAAGTAAGAT	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20408300	20408300	+	IGR	DEL	T	-	-	rs141150735		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20408300delT								None (None upstream) : GOLGA6L6 (328794 downstream)																							GTTTATTCTCTTTTTTTTCAT	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20515634	20515637	+	IGR	DEL	TAAT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20515634_20515637delTAAT								None (None upstream) : GOLGA6L6 (221457 downstream)																							tgaaatgaaataattaaaggaaat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20564458	20564459	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20564458_20564459insA								None (None upstream) : GOLGA6L6 (172635 downstream)																							GGTGTATTTCCAAAAAACACTT	0.361													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20853301	20853303	+	IGR	DEL	TGT	-	-	rs113019325		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20853301_20853303delTGT								GOLGA8C (72275 upstream) : BCL8 (16753 downstream)																							tcctaacagatgttctttttcta	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20855349	20855350	+	IGR	DEL	CT	-	-	rs141108508		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20855349_20855350delCT								GOLGA8C (74323 upstream) : BCL8 (14706 downstream)																							CTTGCCGTTACTCTGTTTAATA	0.366													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20855626	20855627	+	IGR	DEL	AC	-	-	rs147521247		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20855626_20855627delAC								GOLGA8C (74600 upstream) : BCL8 (14429 downstream)																							tatttagaagacacatatttct	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20856463	20856464	+	IGR	INS	-	A	A	rs145608334		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20856463_20856464insA								GOLGA8C (75437 upstream) : BCL8 (13592 downstream)																							ACAGACAGCATTTTTTTTAAGT	0.277													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20864117	20864118	+	IGR	INS	-	AAG	AAG	rs140480090	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20864117_20864118insAAG								GOLGA8C (83091 upstream) : BCL8 (5938 downstream)																							TTCTAGAATATAAGGTTCTTTA	0.218													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21115442	21115443	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21115442_21115443insT								POTEB (43465 upstream) : NF1P1 (6578 downstream)																							TGTTTTTTTGGTTTTTTTTCCC	0.287													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21903809	21903812	+	IGR	DEL	GAGA	-	-	rs147979696	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21903809_21903812delGAGA								NF1P1 (769184 upstream) : LOC646214 (28702 downstream)																							GAGATTGCAGGAGAAAGGGGGAGA	0.299													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21914638	21914639	+	IGR	INS	-	CT	CT	rs112777882		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21914638_21914639insCT								NF1P1 (780013 upstream) : LOC646214 (17875 downstream)																							tcctccttctcctcttccttct	0.282													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21918463	21918464	+	IGR	DEL	CA	-	-	rs150921370		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21918463_21918464delCA								NF1P1 (783838 upstream) : LOC646214 (14050 downstream)																							tttatttactcacagttccaga	0.074													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22097765	22097766	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22097765_22097766insT								CXADRP2 (80887 upstream) : LOC727924 (180266 downstream)																							ataggcataggttttttttttc	0.000													4	2	---	---	---	---	
OR4N4	283694	broad.mit.edu	37	15	22311079	22311080	+	Intron	INS	-	T	T	rs138972545	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22311079_22311080insT	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		agtgacagctattttgatattc	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22567508	22567509	+	IGR	INS	-	T	T	rs142681987	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22567508_22567509insT								MIR1268 (54228 upstream) : GOLGA8DP (134776 downstream)																							TCTGCTTAGTATTTTTTTGTCT	0.371													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23179229	23179229	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23179229delG								NIPA1 (92386 upstream) : WHAMML1 (8502 downstream)																							AAAAAATTATGGCCAGTTGAT	0.353													4	6	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27500035	27500036	+	Intron	INS	-	ACAG	ACAG	rs141329845	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27500035_27500036insACAG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		gagagacagacacagacagaca	0.431													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	27883432	27883434	+	IGR	DEL	AAG	-	-	rs60207952		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27883432_27883434delAAG								GABRG3 (105298 upstream) : OCA2 (116591 downstream)																							aaaaaaaaaaaaGCATATACAAA	0.118													4	2	---	---	---	---	
TJP1	7082	broad.mit.edu	37	15	30086148	30086148	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30086148delT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		tgtagttttctttttttgttg	0.000													4	2	---	---	---	---	
TRPM1	4308	broad.mit.edu	37	15	31303539	31303539	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31303539delT	uc001zfm.2	-						TRPM1_uc010azy.2_Intron|TRPM1_uc001zfl.2_Intron	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		atgttatgtctttttttttgt	0.000													4	2	---	---	---	---	
TRPM1	4308	broad.mit.edu	37	15	31378237	31378238	+	Intron	INS	-	A	A	rs148887135	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31378237_31378238insA	uc001zfm.2	-						TRPM1_uc001zfn.3_Intron	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		AAAAGCAAAGGAAAACTGGGCT	0.485													2	4	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	32070971	32070972	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32070971_32070972delAC	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		acacgcacatacacacacacac	0.327													4	2	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33744154	33744154	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33744154delT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTCTGGTGACTTTTTAAAAAT	0.229													4	2	---	---	---	---	
SLC12A6	9990	broad.mit.edu	37	15	34561922	34561923	+	Intron	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34561922_34561923delTT	uc001zhw.2	-						SLC12A6_uc001zhv.2_Intron|SLC12A6_uc001zhx.2_Intron|SLC12A6_uc001zhy.2_Intron|SLC12A6_uc001zhz.2_Intron|SLC12A6_uc001zia.2_Intron|SLC12A6_uc001zib.2_Intron|SLC12A6_uc001zic.2_Intron|SLC12A6_uc010bau.2_Intron|SLC12A6_uc001zid.2_Intron|SLC12A6_uc001zhu.2_Intron	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a						angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	taacatgctctttttttttttg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38145341	38145342	+	IGR	DEL	AG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38145341_38145342delAG								MEIS2 (751841 upstream) : TMCO5A (81485 downstream)																							AACTTAGAAAAGAGAGAGAGAG	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39050084	39050084	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39050084delT								C15orf53 (57845 upstream) : C15orf54 (492801 downstream)																							tCCTGCTGCATTTTTTTTTCT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39156940	39156941	+	IGR	INS	-	T	T	rs66807263		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39156940_39156941insT								C15orf53 (164701 upstream) : C15orf54 (385944 downstream)																							aataaagccacccaggtggtaa	0.153													5	3	---	---	---	---	
CASC4	113201	broad.mit.edu	37	15	44683797	44683797	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44683797delA	uc001zto.1	+						CASC4_uc001ztp.2_Intron|CASC4_uc001ztq.2_Intron	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a							integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		aacaaaaatgaaaaaaaaaga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	46836826	46836826	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46836826delT								SQRDL (853348 upstream) : SEMA6D (639577 downstream)																							ttgatgtggattttttttttc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	48283952	48283953	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48283952_48283953insG								SEMA6D (217533 upstream) : SLC24A5 (129216 downstream)																							CAGCAAGTTTTGGGGGGGACTG	0.465													4	2	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50933438	50933440	+	Intron	DEL	GCG	-	-	rs144413858		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50933438_50933440delGCG	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		aaggcctcatgcgatgaactgcc	0.000													4	2	---	---	---	---	
CYP19A1	1588	broad.mit.edu	37	15	51508348	51508348	+	Intron	DEL	A	-	-	rs57876839		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51508348delA	uc001zyz.3	-						CYP19A1_uc001zza.3_Intron|CYP19A1_uc001zzb.2_Intron|CYP19A1_uc001zzc.1_Intron	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19						estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	TGTTTAAATTAAAAAAACAAA	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	53240155	53240156	+	IGR	INS	-	T	T	rs146244051	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53240155_53240156insT								ONECUT1 (157946 upstream) : WDR72 (565782 downstream)																							CTTTGAGTGAATTTTGTGTGTA	0.450													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	54151721	54151721	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54151721delA								WDR72 (99862 upstream) : UNC13C (153380 downstream)																							ATTATTTTATAAAACAGAGGG	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	54291022	54291022	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54291022delT								WDR72 (239163 upstream) : UNC13C (14079 downstream)																							ttgaattttgttaagtgcctt	0.000													4	2	---	---	---	---	
CCPG1	9236	broad.mit.edu	37	15	55704977	55704977	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55704977delA	uc002acy.2	-						DYX1C1_uc010ugh.1_Intron|uc002ada.2_Intron|DYX1C1_uc010ugi.1_Intron	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2						cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		tctctgtctcaaaaaaaagaa	0.095													4	2	---	---	---	---	
PRTG	283659	broad.mit.edu	37	15	55910931	55910931	+	3'UTR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55910931delA	uc002adg.2	-	20						NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		ACCTGCACTTAAAAAAAATGC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60378293	60378294	+	IGR	DEL	TC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60378293_60378294delTC								FOXB1 (49885 upstream) : ANXA2 (261057 downstream)																							AAGAATGCAGtctctctctctc	0.312													5	3	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	61278337	61278337	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61278337delT	uc002agx.2	-							NM_134261	NP_599023	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TGAtttcttcttttttttttc	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	61954842	61954844	+	IGR	DEL	TGT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61954842_61954844delTGT								RORA (433340 upstream) : VPS13C (189748 downstream)																							ttcatagagctgttgttgtaaag	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62410146	62410146	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62410146delA								C2CD4A (47037 upstream) : C2CD4B (45591 downstream)																							GAAAACAAACAAAAAAAAAGG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62483695	62483695	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62483695delT								C2CD4B (26213 upstream) : MGC15885 (445676 downstream)																							GTAAGAGTAAttttttttttg	0.139													4	2	---	---	---	---	
MAP2K1	5604	broad.mit.edu	37	15	66753106	66753106	+	Intron	DEL	G	-	-	rs147536623		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66753106delG	uc010bhq.2	+						MAP2K1_uc010ujp.1_Intron	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						tgagagataagggggggtctg	0.139									Cardiofaciocutaneous_syndrome				4	2	---	---	---	---	
SMAD3	4088	broad.mit.edu	37	15	67471864	67471865	+	Intron	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67471864_67471865delGT	uc002aqj.2	+						SMAD3_uc010ujr.1_Intron|SMAD3_uc010ujs.1_Intron|SMAD3_uc010ujt.1_Intron	NM_005902	NP_005893	P84022	SMAD3_HUMAN	mothers against decapentaplegic homolog 3						activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CACTTCCTGGGTGTGTGTGGAG	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	68332115	68332115	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68332115delA								LBXCOR1 (205941 upstream) : PIAS1 (14457 downstream)																							tagactaagcaaaaaaaaaag	0.000													4	2	---	---	---	---	
PIAS1	8554	broad.mit.edu	37	15	68346703	68346704	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68346703_68346704insA	uc002aqz.2	+						PIAS1_uc010ujx.1_Intron	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1						androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						AGCGCAGCTCGAATTCACTTCT	0.629													15	7	---	---	---	---	
ITGA11	22801	broad.mit.edu	37	15	68617750	68617750	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68617750delG	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	GTCTGTTGGTGGGAAGAGTGT	0.572													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70580500	70580500	+	IGR	DEL	A	-	-	rs112816433		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70580500delA								TLE3 (190244 upstream) : UACA (366395 downstream)																							AATTTCTTTTAAAAAAAATCT	0.264													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73201928	73201928	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73201928delT								ADPGK (125261 upstream) : NEO1 (142947 downstream)																							tggtttcttctttttttttaa	0.000													4	2	---	---	---	---	
HCN4	10021	broad.mit.edu	37	15	73643003	73643003	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73643003delC	uc002avp.2	-							NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic						blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		tgaagcatctccccaatccca	0.000													4	2	---	---	---	---	
CCDC33	80125	broad.mit.edu	37	15	74575372	74575372	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74575372delA	uc002axo.2	+						CCDC33_uc002axp.2_Intron	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)|skin(2)	5						CTCACTCATGAAGAACACAGG	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	77215755	77215755	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77215755delT								SCAPER (18011 upstream) : RCN2 (8207 downstream)																							tttttcagagttttgaaagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80276678	80276678	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80276678delG								BCL2A1 (13035 upstream) : ZFAND6 (75343 downstream)																							CATGGAAGACGAGCGAAAACT	0.443													4	2	---	---	---	---	
SH3GL3	6457	broad.mit.edu	37	15	84163847	84163847	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84163847delC	uc002bjw.2	+						SH3GL3_uc010bms.2_Intron|SH3GL3_uc010uot.1_Intron|SH3GL3_uc002bjx.2_Intron|SH3GL3_uc002bju.2_Intron|SH3GL3_uc002bjv.2_Intron	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3						central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						TTGCTGTGGTCCCCCCGGTTC	0.423													4	2	---	---	---	---	
AGBL1	123624	broad.mit.edu	37	15	86759949	86759949	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86759949delA	uc002blz.1	+							NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						ctagtcctttaaaaaaaatgt	0.015													4	2	---	---	---	---	
MRPS11	64963	broad.mit.edu	37	15	89010749	89010749	+	5'UTR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89010749delA	uc002bml.2	+	1					MRPL46_uc002bmi.1_5'Flank|MRPL46_uc002bmj.2_5'Flank|MRPL46_uc002bmk.2_5'Flank|MRPS11_uc002bmm.2_5'UTR|MRPS11_uc002bmn.2_5'UTR|MRPS11_uc010bnj.2_RNA	NM_022839	NP_073750	P82912	RT11_HUMAN	mitochondrial ribosomal protein S11 isoform a						DNA damage response, detection of DNA damage|translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TCAGAACATTAAAAAAGGGAA	0.453													4	2	---	---	---	---	
CRTC3	64784	broad.mit.edu	37	15	91118755	91118755	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91118755delT	uc002bpp.2	+						CRTC3_uc002bpn.2_Intron|CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606	Q6UUV7	CRTC3_HUMAN	transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			atctggcttattttttttcca	0.000			T	MAML2	salivary gland mucoepidermoid								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94078489	94078490	+	Intron	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94078489_94078490delCT	uc002bsu.1	+											Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																		TATTTTCTCCCTCTCTCTGGGG	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	94457329	94457329	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94457329delA	uc002btf.1	+											Homo sapiens cDNA clone IMAGE:4827883.																		AAAGTCCATTAAAAAATTAAA	0.368													4	2	---	---	---	---	
MCTP2	55784	broad.mit.edu	37	15	94796926	94796926	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94796926delA	uc010boj.2	+						MCTP2_uc010urg.1_Intron|MCTP2_uc002bti.2_Intron|MCTP2_uc002btg.3_Intron|MCTP2_uc002bth.3_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TAGGGGAACTAAAGGATACTG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95155175	95155176	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95155175_95155176delTG								MCTP2 (127995 upstream) : LOC145820 (821146 downstream)																							TCTTTTTAATTGTGTGTGTGTG	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95388845	95388846	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95388845_95388846insT								MCTP2 (361665 upstream) : LOC145820 (587476 downstream)																							TGCCTAACAGATTTTTTTTTCG	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98890196	98890196	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98890196delA								ARRDC4 (373129 upstream) : FAM169B (90195 downstream)																							TTCAGGGTCTAAAGTGGACAT	0.090													4	2	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99460532	99460533	+	Intron	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99460532_99460533insG	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	GTGAAGCAAGAGGGAAAAAAGT	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	101258544	101258544	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101258544delA								ASB7 (66642 upstream) : ALDH1A3 (161465 downstream)																							ttaaaaaaggaggagtggacg	0.000													4	2	---	---	---	---	
LRRK1	79705	broad.mit.edu	37	15	101582349	101582349	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101582349delG	uc002bwr.2	+						LRRK1_uc010usb.1_Intron|LRRK1_uc010usc.1_Intron	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1						small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ctttccatctggtataatctc	0.000													4	2	---	---	---	---	
PCSK6	5046	broad.mit.edu	37	15	101953671	101953671	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101953671delA	uc002bwy.2	-						PCSK6_uc010bpd.2_Intron|PCSK6_uc010bpe.2_Intron|PCSK6_uc002bxa.2_Intron|PCSK6_uc002bxb.2_Intron|PCSK6_uc002bxc.1_Intron|PCSK6_uc002bxd.1_Intron|PCSK6_uc002bxe.2_Intron|PCSK6_uc002bxg.1_Intron	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4						glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ggaaggcaggaaaaaaaaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102372614	102372614	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102372614delT								OR4F15 (13288 upstream) : OR4F4 (89731 downstream)																							gtgagcaaactttttactcga	0.000													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	7170479	7170479	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7170479delA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		cacataaattaaaaagattat	0.000													4	2	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	9957250	9957251	+	Intron	INS	-	A	A	rs141510628	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9957250_9957251insA	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GAGGTGGTCTTACAGTGTGCTT	0.465													4	2	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	9979581	9979581	+	Intron	DEL	G	-	-	rs71402409		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9979581delG	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GTGTAGTGCTGGGGGGGCAGC	0.517													3	4	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	10089526	10089527	+	Intron	INS	-	A	A	rs139906650	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10089526_10089527insA	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TCTGATCTCCCAGTGTATGCTA	0.441													3	5	---	---	---	---	
CIITA	4261	broad.mit.edu	37	16	11015774	11015774	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11015774delG	uc002dai.3	+						CIITA_uc002daj.3_Intron|CIITA_uc002dak.3_Intron	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator						interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						AGTGGGACCTGGGGACAGAAa	0.388			T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								4	2	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12417574	12417574	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12417574delG	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						gattaagggtgtgggcactga	0.234													4	2	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13244798	13244798	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13244798delC	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						TCAAACCTCTCCCAAACACCA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13723049	13723049	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13723049delT								SHISA9 (388777 upstream) : ERCC4 (290965 downstream)																							AACGAATCAGTTTTTAAAAAG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	15313839	15313839	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15313839delA								PDXDC1 (80644 upstream) : MPV17L (175772 downstream)																							aacaatgaccaaaaaaaaccc	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16701472	16701472	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16701472delC								LOC339047 (257035 upstream) : XYLT1 (494711 downstream)																							TGGAATCTGGCAGCATGGGGC	0.443													3	5	---	---	---	---	
XYLT1	64131	broad.mit.edu	37	16	17275616	17275616	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17275616delT	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						ATTGCACTTCTTTTTTTTTTA	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	19112231	19112231	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19112231delT								COQ7 (20881 upstream) : ITPRIPL2 (13023 downstream)																							caatatttgcttttttttctt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21570192	21570192	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21570192delA	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																		atcttgtctcaaaaaaaaaaG	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21799404	21799404	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21799404delA	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																		acaccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21948805	21948805	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21948805delT								RRN3P1 (117074 upstream) : UQCRC2 (15804 downstream)																							tgatctttccttttttttttt	0.000													6	3	---	---	---	---	
UQCRC2	7385	broad.mit.edu	37	16	21993533	21993535	+	Intron	DEL	CCA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21993533_21993535delCCA	uc002djx.2	+						UQCRC2_uc002djy.2_Intron|UQCRC2_uc010bxa.2_Intron	NM_003366	NP_003357	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II						aerobic respiration|oxidative phosphorylation|proteolysis|respiratory electron transport chain|transport		metalloendopeptidase activity|zinc ion binding			large_intestine(2)	2				GBM - Glioblastoma multiforme(48;0.0264)		CCGACTGCTTCCACCACCACCTC	0.394													4	2	---	---	---	---	
RBBP6	5930	broad.mit.edu	37	16	24548695	24548696	+	5'Flank	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24548695_24548696insT	uc002dmh.2	+						RBBP6_uc010vcb.1_5'Flank|RBBP6_uc002dmg.2_5'Flank|RBBP6_uc002dmi.2_5'Flank|RBBP6_uc010bxr.2_5'Flank	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		aaaataaaaagtttttttttta	0.183													4	2	---	---	---	---	
TNRC6A	27327	broad.mit.edu	37	16	24785184	24785184	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24785184delT	uc002dmm.2	+							NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		tcctctctactttttttttta	0.000													4	3	---	---	---	---	
HS3ST4	9951	broad.mit.edu	37	16	25911832	25911832	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25911832delC	uc002dof.2	+							NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		CTTGAGCTTTCAGGGAGGCAT	0.368													4	2	---	---	---	---	
KIAA0556	23247	broad.mit.edu	37	16	27584794	27584794	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27584794delG	uc002dow.2	+							NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						TCACCTATGTGGTGGATTTGG	0.438													4	2	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27842384	27842385	+	Intron	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27842384_27842385insG	uc002doz.2	-						GSG1L_uc010bya.1_Intron|GSG1L_uc010bxz.1_Intron|GSG1L_uc002doy.2_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						agtaattggttggggggtgggc	0.000													4	2	---	---	---	---	
BCL7C	9274	broad.mit.edu	37	16	30855000	30855000	+	Intron	DEL	C	-	-	rs139915677	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30855000delC	uc002dzt.1	-							NM_004765	NP_004756	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C						apoptosis						0			Colorectal(24;0.198)			acacagtagaccagcatgtga	0.080													4	2	---	---	---	---	
ITGAM	3684	broad.mit.edu	37	16	31342128	31342129	+	Intron	INS	-	AC	AC	rs139593799	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31342128_31342129insAC	uc002ebq.2	+						ITGAM_uc002ebr.2_Intron|ITGAM_uc010can.2_Intron	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						cacagagacagacaaaggagag	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32105189	32105189	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32105189delG								ZNF267 (176563 upstream) : HERC2P4 (57421 downstream)																							TAATCTCATTGGATTTGGTTC	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32208007	32208007	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32208007delA								HERC2P4 (44133 upstream) : TP53TG3B (476834 downstream)																							ATCTACCACCAAAAAAAAAAG	0.353													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32817862	32817864	+	IGR	DEL	TTT	-	-	rs150100349		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32817862_32817864delTTT								TP53TG3B (128984 upstream) : SLC6A10P (70933 downstream)																							catttcattatttcatcatttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33053557	33053557	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33053557delA								SLC6A10P (157094 upstream) : MIR1826 (911951 downstream)																							ttttctaaataaaaaataaaa	0.224													16	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33537914	33537914	+	IGR	DEL	A	-	-	rs111565786		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33537914delA								SLC6A10P (641451 upstream) : MIR1826 (427594 downstream)																							AGCTGAGTGTAAAAAAAGTCA	0.338													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33958582	33958585	+	IGR	DEL	TCTC	-	-	rs144904177		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33958582_33958585delTCTC								None (None upstream) : MIR1826 (6923 downstream)																							tatctgtctgtctctctctctctt	0.000													7	4	---	---	---	---	
LOC283914	283914	broad.mit.edu	37	16	34616777	34616777	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34616777delT	uc010vgc.1	+						LOC283914_uc002edw.2_Intron	NR_027080				Homo sapiens cDNA clone IMAGE:5271062.												0						gcttaagttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34955304	34955305	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34955304_34955305insT								LOC146481 (240337 upstream) : None (None downstream)																							tttctgttctgttttttttccc	0.000													4	2	---	---	---	---	
VPS35	55737	broad.mit.edu	37	16	46704205	46704205	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46704205delT	uc002eef.3	-						VPS35_uc002eed.2_Intron|VPS35_uc002eee.2_Intron	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GAAGGCATAAttttttttgag	0.219													4	2	---	---	---	---	
N4BP1	9683	broad.mit.edu	37	16	48594288	48594288	+	Intron	DEL	A	-	-	rs3842356		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48594288delA	uc002efp.2	-							NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				ATAATAAGATAAAAAAAAATC	0.333													4	2	---	---	---	---	
PAPD5	64282	broad.mit.edu	37	16	50245569	50245569	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50245569delT	uc010vgo.1	+						PAPD5_uc010cbi.2_Intron|PAPD5_uc002efz.2_Intron|PAPD5_uc002ega.2_Intron	NM_001040284	NP_001035374	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5 isoform a						cell division|DNA replication|histone mRNA catabolic process|mitosis	cytoplasm|nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding				0		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		CTAACAACTATTTTTTTTTTG	0.308													4	2	---	---	---	---	
CYLD	1540	broad.mit.edu	37	16	50794646	50794647	+	Intron	DEL	GC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50794646_50794647delGC	uc002egp.1	+						CYLD_uc002egn.1_Intron|CYLD_uc002ego.2_Intron|CYLD_uc010cbs.1_Intron|CYLD_uc002egq.1_Intron|CYLD_uc002egr.1_Intron|CYLD_uc002egs.1_Intron	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD						cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				ttttgatattgcacacaatgtt	0.000			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	53568139	53568139	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53568139delA								AKTIP (30969 upstream) : RPGRIP1L (65684 downstream)																							tacaagaaggaaaaaaaaaaa	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54849956	54849973	+	IGR	DEL	ACACACACACACACACAC	-	-	rs10524437		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54849956_54849973delACACACACACACACACAC								IRX3 (529578 upstream) : IRX5 (115138 downstream)																							taatcctcatacacacacacacacacacacacacacac	0.028													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55013719	55013720	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55013719_55013720delTG								IRX5 (45326 upstream) : IRX6 (344751 downstream)																							ctcatttgcctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55303476	55303477	+	IGR	INS	-	T	T	rs143995926	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55303476_55303477insT								IRX5 (335083 upstream) : IRX6 (54994 downstream)																							ccatctacacatttacttatct	0.000													4	2	---	---	---	---	
LOC283856	283856	broad.mit.edu	37	16	56148143	56148143	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56148143delT	uc002eis.1	-							NR_027078				Homo sapiens hypothetical protein LOC283856, mRNA (cDNA clone IMAGE:5263025).												0						ggggtttgcatttttttttta	0.134													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	56728836	56728836	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56728836delT								MT1X (10729 upstream) : NUP93 (35181 downstream)																							acggactatcttttttttttc	0.000													5	3	---	---	---	---	
NLRC5	84166	broad.mit.edu	37	16	57065030	57065030	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57065030delA	uc002ekk.1	+						NLRC5_uc010ccq.1_Intron|NLRC5_uc002ekn.2_Intron|NLRC5_uc002ekl.2_Intron|NLRC5_uc002ekm.2_Intron|NLRC5_uc010ccr.1_Intron	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				aaaagaaaggaaaaaaaaaaa	0.119													3	3	---	---	---	---	
CPNE2	221184	broad.mit.edu	37	16	57146758	57146758	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57146758delA	uc002eks.1	+						CPNE2_uc010cct.1_Intron|CPNE2_uc010ccu.1_Intron	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II											central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				ACATGGTTTGAAAAAGGGTTT	0.348													4	2	---	---	---	---	
RSPRY1	89970	broad.mit.edu	37	16	57260096	57260096	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57260096delC	uc002elb.2	+						RSPRY1_uc002elc.2_Intron|RSPRY1_uc002eld.2_Intron	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1							extracellular region	zinc ion binding			ovary(1)	1						TCTCTTATCTCCAGTTTTGAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	58695711	58695712	+	IGR	DEL	AT	-	-	rs145060145		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58695711_58695712delAT								CNOT1 (31961 upstream) : SLC38A7 (4586 downstream)																							gtgaatcagaatttatagccca	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	64555258	64555259	+	IGR	DEL	TG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64555258_64555259delTG								None (None upstream) : CDH11 (425426 downstream)																							catttgcacatgtgtgtgtgtt	0.000													4	2	---	---	---	---	
CDH11	1009	broad.mit.edu	37	16	65114187	65114187	+	Intron	DEL	A	-	-	rs68148670		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65114187delA	uc002eoi.2	-						CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		gtacaaatgcaaaaaaaaaaa	0.000			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			3	3	---	---	---	---	
ZNRF1	84937	broad.mit.edu	37	16	75100055	75100055	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75100055delA	uc002fdk.2	+						ZNRF1_uc010vmz.1_Intron|ZNRF1_uc002fdl.1_Intron|ZNRF1_uc010cgr.1_Intron	NM_032268	NP_115644	Q8ND25	ZNRF1_HUMAN	zinc and ring finger protein 1							cell junction|endosome|lysosome|synaptic vesicle membrane	ligase activity|protein binding|zinc ion binding				0						AATACTACATAAAAAAGACTA	0.323													4	2	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77350157	77350158	+	Intron	DEL	TT	-	-	rs72001583		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77350157_77350158delTT	uc002ffc.3	-						ADAMTS18_uc010chc.1_Intron|ADAMTS18_uc002ffe.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						cctggttgaatttttttttttt	0.000													3	3	---	---	---	---	
VAT1L	57687	broad.mit.edu	37	16	77820874	77820874	+	5'Flank	DEL	A	-	-	rs68139215		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77820874delA	uc002ffg.1	+							NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1						ggtctagcccaaatgttccct	0.010													3	3	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78862135	78862136	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78862135_78862136insA	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		GTCACAGTGGCAAAGACAATGA	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	84563730	84563730	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84563730delA								KIAA1609 (25442 upstream) : COTL1 (35476 downstream)																							agcctgtgggaaagggcctat	0.134													4	2	---	---	---	---	
USP10	9100	broad.mit.edu	37	16	84771705	84771706	+	Intron	INS	-	TGCTGGCTTT	TGCTGGCTTT	rs145979270	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84771705_84771706insTGCTGGCTTT	uc002fii.2	+						USP10_uc010voe.1_Intron|USP10_uc010vof.1_Intron|USP10_uc002fij.2_Intron	NM_005153	NP_005144	Q14694	UBP10_HUMAN	ubiquitin specific protease 10						DNA damage response, signal transduction by p53 class mediator|DNA repair|protein deubiquitination|ubiquitin-dependent protein catabolic process	early endosome|intermediate filament cytoskeleton|nucleus	cystic fibrosis transmembrane conductance regulator binding|p53 binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						TCTCTGCCTTGTGAAGTGGATG	0.550											OREG0023989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86290943	86290944	+	IGR	INS	-	AA	AA	rs145127556	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86290943_86290944insAA								IRF8 (334734 upstream) : LOC732275 (74512 downstream)																							tggcaggaaccaagtctccTCA	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86655961	86655962	+	IGR	INS	-	C	C			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86655961_86655962insC								FOXL1 (40658 upstream) : FBXO31 (706982 downstream)																							ACTCCTTTAGGCCCCCATGCTA	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87287491	87287491	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87287491delA	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		TTGACACAAGAAAAAAAAAGA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88468692	88468692	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88468692delA								BANP (357769 upstream) : ZNF469 (25187 downstream)																							gtcctactctaccctctcctt	0.109													4	2	---	---	---	---	
ANKRD11	29123	broad.mit.edu	37	16	89450963	89450963	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89450963delG	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		gggatgggatgggaatgggac	0.209													4	2	---	---	---	---	
SMG6	23293	broad.mit.edu	37	17	2065071	2065071	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2065071delT	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						TTTGAGGTGCTTTTGAATCCA	0.358													4	2	---	---	---	---	
SPNS3	201305	broad.mit.edu	37	17	4360016	4360017	+	Intron	DEL	GG	-	-	rs78116121	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4360016_4360017delGG	uc002fxt.2	+						SPNS3_uc002fxu.2_Intron|SPNS3_uc002fxv.2_Intron	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3						lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						tgttttttttggtttttttttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6914115	6914115	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6914115delA	uc002gdy.1	-						RNASEK_uc002gea.2_5'Flank|C17orf49_uc002geb.3_5'Flank|C17orf49_uc002gec.2_5'Flank					Homo sapiens cDNA FLJ90099 fis, clone HEMBA1006016.																		tttaaaatgcaaaaaaaatcc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7858598	7858598	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7858598delA								CNTROB (5703 upstream) : GUCY2D (47390 downstream)																							aaaaaaaaagaaaaaaaaaGA	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	8579300	8579300	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8579300delT								MYH10 (45264 upstream) : CCDC42 (53947 downstream)																							AATTTGACCCttttttttttg	0.164													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	11094143	11094144	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11094143_11094144insA								PIRT (352725 upstream) : SHISA6 (50596 downstream)																							aatttacagtgaaaatggcaat	0.030													4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11804259	11804260	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11804259_11804260delAC	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron|DNAH9_uc010vvh.1_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		cagacctcctacacacacaccc	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14851004	14851004	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14851004delT								HS3ST3B1 (601512 upstream) : PMP22 (282093 downstream)																							CAGAACATGATTTTTTTTTAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21326042	21326042	+	IGR	DEL	A	-	-	rs66464342		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21326042delA								KCNJ12 (2863 upstream) : C17orf51 (105530 downstream)																							tcattccttcaaacaagtgtt	0.075													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21549031	21549032	+	IGR	INS	-	G	G	rs149320251		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21549031_21549032insG								C17orf51 (71300 upstream) : FAM27L (276338 downstream)																							CCCTGTGGCCAGGGGCACAGCT	0.114													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21563911	21563911	+	IGR	DEL	T	-	-	rs112625646		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21563911delT								C17orf51 (86180 upstream) : FAM27L (261459 downstream)																							ctcttatggatttttttctgt	0.000													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21674875	21674875	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21674875delT								C17orf51 (197144 upstream) : FAM27L (150495 downstream)																							TTCTTGCACATTTTTTCTTGC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21715726	21715727	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21715726_21715727insA								C17orf51 (237995 upstream) : FAM27L (109643 downstream)																							AAAGTTCACATAAAAAAATGAG	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25301035	25301036	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25301035_25301036insT								None (None upstream) : WSB1 (320070 downstream)																							CTTCTAATTTATTTAGACATGT	0.243													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25350662	25350662	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25350662delA								None (None upstream) : WSB1 (270444 downstream)																							TCAAAAGTCTAAAAAAAATAT	0.299													4	2	---	---	---	---	
NLK	51701	broad.mit.edu	37	17	26389471	26389471	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26389471delA	uc010crj.2	+						NLK_uc010cri.1_Intron	NM_016231	NP_057315	Q9UBE8	NLK_HUMAN	nemo like kinase						intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TTTAAAAATCAAAACCTGGAA	0.269													4	2	---	---	---	---	
SUPT6H	6830	broad.mit.edu	37	17	26991871	26991873	+	Intron	DEL	CTC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26991871_26991873delCTC	uc002hby.2	+						SUPT6H_uc010crt.2_Intron|SDF2_uc002hbw.2_5'Flank|SDF2_uc002hbx.2_5'Flank|SDF2_uc010crs.1_5'Flank	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog						chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					ctttgttcttctcctttactact	0.000													4	2	---	---	---	---	
CRYBA1	1411	broad.mit.edu	37	17	27577765	27577765	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27577765delA	uc002hdw.2	+							NM_005208	NP_005199	P05813	CRBA1_HUMAN	crystallin, beta A3						visual perception	soluble fraction	structural constituent of eye lens				0			BRCA - Breast invasive adenocarcinoma(11;3.3e-05)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			TTTCTTTATGAAAAAAAAAAC	0.423													6	4	---	---	---	---	
RHOT1	55288	broad.mit.edu	37	17	30549682	30549682	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30549682delT	uc002hgz.2	+						RHOT1_uc002hgw.2_Intron|RHOT1_uc002hgy.2_Intron|RHOT1_uc002hha.2_Intron|RHOT1_uc010csv.2_Intron|RHOT1_uc002hgx.2_Intron|RHOT1_uc010wby.1_Intron|RHOT1_uc002hhb.2_Intron	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3						apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				GGCAACTCAATTTATGTGTGG	0.313													4	2	---	---	---	---	
IKZF3	22806	broad.mit.edu	37	17	38020058	38020059	+	Intron	INS	-	C	C	rs138996149	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38020058_38020059insC	uc002hsu.2	-						IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Intron|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Intron|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Intron|IKZF3_uc002htb.2_Intron|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_Intron	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1						B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGATTATTCCACCCCAGATTTG	0.411													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	38585291	38585291	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38585291delA								TOP2A (11122 upstream) : IGFBP4 (14385 downstream)																							accccgtctcaaaaaaaaaaT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39190120	39190120	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39190120delA								KRTAP1-5 (6666 upstream) : KRTAP1-3 (19 downstream)																							ACACTCAATGAAAAAAAAAAG	0.318													4	2	---	---	---	---	
CDC27	996	broad.mit.edu	37	17	45217204	45217204	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45217204delT	uc002ild.3	-						CDC27_uc002ile.3_Intron|CDC27_uc002ilf.3_Intron|CDC27_uc010wkp.1_Intron|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						GCCTCATCAATTTTTTTCCTC	0.388													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													13	10	---	---	---	---	
SKAP1	8631	broad.mit.edu	37	17	46261671	46261672	+	Intron	INS	-	T	T	rs151104312	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46261671_46261672insT	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0						TGGGAAAATAATTTTTTTTCAC	0.322													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47498803	47498804	+	IGR	DEL	TC	-	-	rs71352510		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47498803_47498804delTC								PHB (6561 upstream) : NGFR (73851 downstream)																							gtccatttggtctggagtatag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48326198	48326198	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48326198delT								COL1A1 (47198 upstream) : TMEM92 (25639 downstream)																							CATAGTAGAATTTTTTTTAAC	0.134													4	2	---	---	---	---	
ABCC3	8714	broad.mit.edu	37	17	48727167	48727168	+	Intron	DEL	CA	-	-	rs146673570	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48727167_48727168delCA	uc002isl.2	+						ABCC3_uc002isk.3_Intron	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3						bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	ttaataggatcacaggtcactg	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49015638	49015639	+	IGR	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49015638_49015639delCT								TOB1 (70299 upstream) : SPAG9 (23897 downstream)																							tttgatacccctctctccagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49504793	49504794	+	IGR	INS	-	AAAAC	AAAAC	rs148162959	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49504793_49504794insAAAAC								UTP18 (129503 upstream) : CA10 (202881 downstream)																							aaacaaaaacaaaaacaaaaca	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51210098	51210098	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51210098delA								CA10 (972721 upstream) : KIF2B (690141 downstream)																							TGGAATGATTAAAAAATGAAC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	56178144	56178145	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56178144_56178145insT								DYNLL2 (10526 upstream) : OR4D1 (54370 downstream)																							tcaaaagactcttttttctcca	0.035													4	2	---	---	---	---	
DHX40	79665	broad.mit.edu	37	17	57640567	57640568	+	5'Flank	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57640567_57640568insT	uc002ixn.1	+						DHX40_uc010woe.1_5'Flank|DHX40_uc002ixo.1_5'Flank	NM_024612	NP_078888	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					taactcttttctttttttttct	0.000													4	2	---	---	---	---	
USP32	84669	broad.mit.edu	37	17	58442444	58442445	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58442444_58442445insT	uc002iyo.1	-						USP32_uc010wov.1_Intron	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32						protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AAAAGGGAAAGTTTTTTTTAAA	0.252													4	2	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60023567	60023568	+	3'UTR	INS	-	A	A	rs1044520		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60023567_60023568insA	uc002izo.2	-	30						NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						ACTGTGACTGGAAAAAAAAAAG	0.317													6	4	---	---	---	---	
DDX42	11325	broad.mit.edu	37	17	61888766	61888766	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61888766delT	uc002jbu.2	+						DDX42_uc002jbv.2_Intron|DDX42_uc002jbw.1_Intron|DDX42_uc002jbx.2_Intron|DDX42_uc002jby.2_5'UTR	NM_007372	NP_031398	Q86XP3	DDX42_HUMAN	DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5						tcattttgtgttttttttgtt	0.139													5	4	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	63870480	63870480	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63870480delG	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			CCAGTGACGAGGGCACTTTCT	0.313													4	2	---	---	---	---	
HELZ	9931	broad.mit.edu	37	17	65120988	65120989	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65120988_65120989insA	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					atttCTGGATTAAAAAAAAAAT	0.203													4	2	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65688248	65688248	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65688248delG	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			TGTCATTTCAGGGCCATTGAT	0.254													4	2	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67422113	67422113	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67422113delA	uc002jij.2	+						MAP2K6_uc002jii.2_Intron	NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					TTGCCATTTGAAAAAAAAAAA	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	67815899	67815900	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67815899_67815900insT								MAP2K6 (277437 upstream) : KCNJ16 (255526 downstream)																							TTTTGTTTCCATTTTTTTTTTC	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68442684	68442685	+	IGR	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68442684_68442685delAA								KCNJ2 (266503 upstream) : None (None downstream)																							CTCTTTATCTAAACCATCTCTC	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70134307	70134307	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70134307delT								SOX9 (11755 upstream) : SLC39A11 (507779 downstream)																							AACTTTCTAATTTTTTTCAAG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71092330	71092331	+	IGR	INS	-	G	G	rs141707910	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71092330_71092331insG								SLC39A11 (3477 upstream) : SSTR2 (68829 downstream)																							attgaggctcaggaaagctctg	0.054													7	6	---	---	---	---	
SEPT9	10801	broad.mit.edu	37	17	75468961	75468961	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75468961delC	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc002jtx.1_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_5'Flank	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			AGTCCTTGATCCCCCACCCAC	0.383													4	2	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76002049	76002049	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76002049delT	uc002jud.2	+						TNRC6C_uc002juc.2_Intron|TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TATTCTGAAGTTTTTTTCCAC	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77724183	77724183	+	IGR	DEL	A	-	-	rs67769869		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77724183delA								ENPP7 (8163 upstream) : CBX2 (27810 downstream)																							aagacgatgcagcttccatgc	0.025													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78232071	78232071	+	5'Flank	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78232071delT	uc002jye.1	+						uc002jyf.2_5'Flank					Homo sapiens mRNA for KIAA1618 protein, partial cds.																		tgaagggagataggggtgggg	0.000													4	2	---	---	---	---	
NPLOC4	55666	broad.mit.edu	37	17	79579760	79579761	+	Intron	INS	-	A	A	rs149086292	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79579760_79579761insA	uc002kat.3	-						NPLOC4_uc002kau.3_Intron|NPLOC4_uc010wur.1_Intron	NM_017921	NP_060391	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4						cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CTAAAATAAACAATGTACATAT	0.406													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79999262	79999263	+	IGR	DEL	TT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79999262_79999263delTT								DCXR (3689 upstream) : RFNG (6516 downstream)																							tcagttttGGTTTTTTTTTTTg	0.010													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3909549	3909552	+	Intron	DEL	TTTA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3909549_3909552delTTTA	uc010wyz.1	-							NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TTTTGATTTTTTTATTAATTAGTG	0.294													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	7526993	7526993	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7526993delT								LRRC30 (294952 upstream) : PTPRM (40321 downstream)																							ttcaatccagttttttttttt	0.000													3	3	---	---	---	---	
KIAA0802	23255	broad.mit.edu	37	18	8821082	8821083	+	Intron	DEL	CT	-	-	rs72938187	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8821082_8821083delCT	uc002knr.2	+						KIAA0802_uc002knq.2_Intron|KIAA0802_uc002kns.2_Intron	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255												0						CACATGCACACTCTCTCTCTCT	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10100671	10100671	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10100671delA								VAPA (140654 upstream) : APCDD1 (353954 downstream)																							AGCACTAAGTAAAAAACAAAA	0.328													4	2	---	---	---	---	
FAM38B	63895	broad.mit.edu	37	18	10829783	10829783	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10829783delA	uc002kow.1	-									Q9H5I5	PIEZ2_HUMAN	RecName: Full=Uncharacterized protein C18orf58;							integral to membrane	ion channel activity			ovary(1)	1						acattgatggaaaaaattgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11238047	11238047	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11238047delT								FAM38B (536068 upstream) : GNAL (451089 downstream)																							AGAAAAAGGATAAGGGCACCA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12225490	12225490	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12225490delT								IMPA2 (194614 upstream) : CIDEA (28828 downstream)																							acaaatttaattataatttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14234003	14234003	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14234003delT								ZNF519 (101574 upstream) : LOC284233 (103419 downstream)																							TGTGTTTTACTTTTTTATCTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	20366787	20366787	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20366787delT								CTAGE1 (368909 upstream) : RBBP8 (146508 downstream)																							TTTAGCATTGTTTTTTTTTTT	0.313													4	2	---	---	---	---	
CABLES1	91768	broad.mit.edu	37	18	20781386	20781386	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20781386delC	uc002kuc.2	+						C18orf45_uc010xaq.1_Intron|CABLES1_uc002kub.2_Intron|CABLES1_uc002kud.2_Intron	NM_001100619	NP_001094089	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1 isoform 2						blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding			breast(1)	1	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TTAGGATGGTCCCCCAGCAGT	0.179													4	2	---	---	---	---	
C18orf45	85019	broad.mit.edu	37	18	20976829	20976829	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20976829delA	uc002kuf.2	-						C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_Intron|C18orf45_uc002kug.2_Intron|C18orf45_uc002kuh.2_Intron	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					aatgtcttgcaaaaaaaaaaa	0.020													5	4	---	---	---	---	
ZNF521	25925	broad.mit.edu	37	18	22724645	22724645	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22724645delA	uc002kvk.2	-						ZNF521_uc010xbe.1_Intron|ZNF521_uc010dly.2_Intron|ZNF521_uc002kvl.2_Intron	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGCTTTAAAGAAAAAAAAAAT	0.303			T	PAX5	ALL								4	3	---	---	---	---	
KCTD1	284252	broad.mit.edu	37	18	24111830	24111830	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24111830delA	uc002kvw.2	-						KCTD1_uc010xbj.1_Intron|KCTD1_uc010xbk.1_Intron	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			ACGATTCTTTAGCATTACAAA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	24225856	24225856	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24225856delT								KCTD1 (5548 upstream) : LOC728606 (41729 downstream)																							gaaatctgtgttttaacaagc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	24952222	24952222	+	Intron	DEL	A	-	-	rs34960045		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24952222delA	uc002kwf.1	-											Homo sapiens cDNA FLJ45994 fis, clone SKMUS2009557.																		AGAGGAAGTTAAAAAAAAACA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	25792673	25792673	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25792673delA								CDH2 (35228 upstream) : None (None downstream)																							TTACAGTAATAAAAAAAAAAG	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	25923471	25923472	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25923471_25923472insT								CDH2 (166026 upstream) : None (None downstream)																							GTGTTTTTGAATTTTTTTTTAA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	26009811	26009811	+	IGR	DEL	T	-	-	rs76504676		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26009811delT								CDH2 (252366 upstream) : None (None downstream)																							ggatgccttgttttttttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	27342660	27342661	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27342660_27342661insT								None (None upstream) : MIR302F (536215 downstream)																							taggagtgtgattttttttttt	0.084													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	27956569	27956569	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27956569delT								MIR302F (77643 upstream) : DSC3 (613484 downstream)																							gcccatttaatttttttttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	29312699	29312700	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29312699_29312700insA								B4GALT6 (48013 upstream) : MCART2 (26959 downstream)																							gaaaaaaaaagaaaaaaaaagg	0.000													4	2	---	---	---	---	
C18orf34	374864	broad.mit.edu	37	18	30680331	30680332	+	Intron	DEL	TG	-	-	rs116801135	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30680331_30680332delTG	uc002kxn.2	-						C18orf34_uc010xbq.1_Intron|C18orf34_uc010dme.1_Intron|C18orf34_uc010xbr.1_Intron|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Intron|C18orf34_uc002kxp.2_Intron	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1											ovary(1)	1						TTGTCTCTGTTGTATATATTTG	0.327													4	2	---	---	---	---	
ASXL3	80816	broad.mit.edu	37	18	31179631	31179632	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31179631_31179632insT	uc010dmg.1	+						ASXL3_uc002kxq.2_Intron	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TTTGCAGCAGGTTTTTTTGGGG	0.248													4	2	---	---	---	---	
MAPRE2	10982	broad.mit.edu	37	18	32675808	32675808	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32675808delT	uc002kyg.2	+						MAPRE2_uc010xcb.1_Intron|MAPRE2_uc010xcc.1_Intron|MAPRE2_uc002kyf.2_Intron|MAPRE2_uc002kyh.2_Intron|MAPRE2_uc010xcd.1_Intron	NM_014268	NP_055083	Q15555	MARE2_HUMAN	microtubule-associated protein, RP/EB family,						cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding			ovary(1)	1						CCCCAGTGTCTTTTTTTTTCC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33420027	33420028	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33420027_33420028insA								GALNT1 (128230 upstream) : MIR187 (64753 downstream)																							agataagcttgaaaaaaaaatg	0.104													6	3	---	---	---	---	
KIAA1328	57536	broad.mit.edu	37	18	34545879	34545879	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34545879delA	uc002kzz.2	+						KIAA1328_uc002lab.2_Intron|KIAA1328_uc002lac.1_Intron|KIAA1328_uc010dnc.1_Intron	NM_020776	NP_065827	Q86T90	K1328_HUMAN	hypothetical protein LOC57536											central_nervous_system(1)	1				COAD - Colon adenocarcinoma(74;0.195)		TCTAATTGACAAAAAAAAAAA	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	35414151	35414152	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35414151_35414152insG								CELF4 (268151 upstream) : None (None downstream)																							TTAATTTTTTTACAGATTTAAT	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36044145	36044146	+	IGR	DEL	CA	-	-	rs71383569		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36044145_36044146delCA								CELF4 (898145 upstream) : LOC647946 (742742 downstream)																							TTCCATTCAGCATCATCACTTT	0.416													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36044148	36044148	+	IGR	DEL	C	-	-	rs33943513		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36044148delC								CELF4 (898148 upstream) : LOC647946 (742740 downstream)																							CATTCAGCATCATCACTTTCA	0.423													3	4	---	---	---	---	
LOC647946	647946	broad.mit.edu	37	18	37034742	37034742	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37034742delC	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0						gcctaatagtcctggcatacc	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39210958	39210958	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39210958delA								KC6 (110397 upstream) : PIK3C3 (324241 downstream)																							cacgatcaagaaaaaaaaatc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39463561	39463561	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39463561delT								KC6 (363000 upstream) : PIK3C3 (71638 downstream)																							gttttgaggatttttttgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39484727	39484727	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39484727delA								KC6 (384166 upstream) : PIK3C3 (50472 downstream)																							aacaggaggcaggccctccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	39844785	39844785	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39844785delT	uc002las.1	+						uc002lat.2_Intron|uc002lau.2_Intron					Homo sapiens hypothetical gene supported by BC011527; BC021928; BC011527; BC021928, mRNA (cDNA clone IMAGE:3872963), with apparent retained intron.																		CAAATAAGAATTTTTTTTTCC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41468345	41468346	+	IGR	INS	-	TT	TT	rs146303765	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41468345_41468346insTT								SYT4 (610730 upstream) : SETBP1 (791792 downstream)																							TTTCGTTTGTCTTTTTTTGTCA	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	44851011	44851018	+	Intron	DEL	ATCCATCC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44851011_44851018delATCCATCC	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																		AGATCATGATatccatccatccatccat	0.327													8	4	---	---	---	---	
ZBTB7C	201501	broad.mit.edu	37	18	45859397	45859398	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45859397_45859398insT	uc010dnw.2	-						ZBTB7C_uc010dny.1_Intron|ZBTB7C_uc010dnz.1_Intron|ZBTB7C_uc010dob.1_Intron|ZBTB7C_uc010doc.1_Intron|ZBTB7C_uc010dod.1_Intron|ZBTB7C_uc010doe.1_Intron|ZBTB7C_uc010dof.1_Intron|ZBTB7C_uc010dog.1_Intron|ZBTB7C_uc010doh.1_Intron|ZBTB7C_uc010doi.1_Intron|ZBTB7C_uc010doj.1_Intron|ZBTB7C_uc010dok.1_Intron|ZBTB7C_uc010dol.1_Intron|ZBTB7C_uc010doa.1_Intron|ZBTB7C_uc010don.1_Intron|ZBTB7C_uc010doo.1_Intron|ZBTB7C_uc010dop.1_Intron|ZBTB7C_uc010doq.1_Intron|ZBTB7C_uc010dor.1_Intron|ZBTB7C_uc010dos.1_Intron|ZBTB7C_uc010dot.1_Intron|ZBTB7C_uc010dou.1_Intron|ZBTB7C_uc010dom.1_Intron	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						GTGGTTTTCACTTTTTTTTTCA	0.327													4	2	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47540649	47540649	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47540649delA	uc002leb.2	-						MYO5B_uc002lec.1_Intron	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		ATGAGAAAGGAAAAAAAAAAA	0.284													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50578368	50578368	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50578368delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ctttgtactctttttttttgt	0.000													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	51050668	51050668	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51050668delA	uc002lfe.1	+						DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGAATACATGAAAAAAAAAAG	0.169													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51575426	51575426	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51575426delG								DCC (517644 upstream) : MBD2 (105149 downstream)																							TTTAAATTCTGGGCTAAAATG	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	53651055	53651055	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53651055delA								TCF4 (347870 upstream) : TXNL1 (619000 downstream)																							AGTAAGGTGGAAATGAGTTGA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	53721452	53721452	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53721452delT								TCF4 (418267 upstream) : TXNL1 (548603 downstream)																							tctagttttattttttgaaca	0.090													4	2	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	55883214	55883214	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55883214delT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						aaaacaagaattttttttttt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57435831	57435831	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57435831delC								CCBE1 (71187 upstream) : PMAIP1 (131361 downstream)																							tgtgcatctgcccaaagacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57639984	57639985	+	IGR	DEL	AA	-	-	rs34111849		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57639984_57639985delAA								PMAIP1 (68446 upstream) : MC4R (398579 downstream)																							TTTTTTTCCCAAAAAAAAAAAA	0.297													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	62498145	62498145	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62498145delT								C18orf20 (681885 upstream) : CDH7 (919343 downstream)																							aggctttaccttttttttctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65552262	65552262	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65552262delT								DSEL (368295 upstream) : TMX3 (788665 downstream)																							gttaatttcatttctttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65767167	65767167	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65767167delA								DSEL (583200 upstream) : TMX3 (573760 downstream)																							TTCAAGGATCAAAAAAAGCAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	70126490	70126491	+	IGR	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70126490_70126491delAC								None (None upstream) : CBLN2 (77424 downstream)																							TCCAGAACCTacacacacacac	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	70715769	70715769	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70715769delC								NETO1 (180959 upstream) : None (None downstream)																							AAATATTCCACCCGTACTGCT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	71393217	71393217	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71393217delA								NETO1 (858407 upstream) : FBXO15 (347371 downstream)																							aaagagatacaaaaaagcctt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	71575392	71575392	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71575392delT								None (None upstream) : FBXO15 (165196 downstream)																							AGACATAAAATTTTTTTCAGA	0.383													4	2	---	---	---	---	
ZNF407	55628	broad.mit.edu	37	18	72426835	72426836	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72426835_72426836insT	uc002llw.2	+						ZNF407_uc010xfc.1_Intron|ZNF407_uc010dqu.1_Intron	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AAGTTGGTAAATTTTTTTTGCT	0.446													4	2	---	---	---	---	
ZNF407	55628	broad.mit.edu	37	18	72427102	72427102	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72427102delT	uc002llw.2	+						ZNF407_uc010xfc.1_Intron|ZNF407_uc010dqu.1_Intron	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CAGTATCCCCTTTTCCTGGAA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76227339	76227339	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76227339delT								None (None upstream) : SALL3 (512936 downstream)																							ctgccagggatttttttcttt	0.035													4	2	---	---	---	---	
ZNF426	79088	broad.mit.edu	37	19	9644889	9644890	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9644889_9644890insT	uc002mlq.2	-						ZNF426_uc010dws.2_Intron	NM_024106	NP_077011	Q9BUY5	ZN426_HUMAN	zinc finger protein 426						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TAGGAGATCTCttttttttttg	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14969483	14969484	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14969483_14969484insT								OR7A10 (16794 upstream) : OR7A17 (21756 downstream)																							ATAGTGAGTTGTTTTTTTTAAC	0.327													4	2	---	---	---	---	
NWD1	284434	broad.mit.edu	37	19	16872616	16872616	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16872616delA	uc002neu.3	+						NWD1_uc002net.3_Intron|NWD1_uc002nev.3_Intron			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;								ATP binding			skin(3)|ovary(2)|pancreas(2)	7						TGATGTAAGGAAAAAAAAAAC	0.269													5	5	---	---	---	---	
FCHO1	23149	broad.mit.edu	37	19	17882984	17882985	+	Intron	DEL	TG	-	-	rs10537480		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17882984_17882985delTG	uc010ebb.2	+						FCHO1_uc002nhg.3_Intron|FCHO1_uc002nhh.2_Intron|FCHO1_uc010xpw.1_Intron|FCHO1_uc010ebc.1_Intron	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN	FCH domain only 1 isoform b											breast(1)	1						gacatccccttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
ZNF493	284443	broad.mit.edu	37	19	21587518	21587518	+	Intron	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21587518delG	uc002npx.2	+						ZNF493_uc002npu.2_Intron|ZNF493_uc002npw.2_Intron|ZNF493_uc002npy.2_Intron	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						cagatcttctgggaaaaaaga	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22484558	22484558	+	IGR	DEL	G	-	-	rs113212589		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22484558delG								ZNF676 (104805 upstream) : ZNF98 (89341 downstream)																							AGGCATCTTAGGAGTGAGAGA	0.383													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27874132	27874132	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27874132delT								None (None upstream) : LOC148189 (407270 downstream)																							gattgagcagttttgaaacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29649843	29649843	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29649843delG								LOC148145 (189788 upstream) : UQCRFS1 (48324 downstream)																							TCTAAAGAGTGGAGTGGTGAG	0.418													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30828807	30828809	+	IGR	DEL	TGA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30828807_30828809delTGA								C19orf2 (322196 upstream) : ZNF536 (34519 downstream)																							atgatggtggtgatgatgatgat	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34734013	34734013	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34734013delC								LSM14A (13594 upstream) : KIAA0355 (11443 downstream)																							tctgcctctaccctggttcaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36196222	36196223	+	IGR	INS	-	A	A	rs143334111	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36196222_36196223insA								UPK1A (26857 upstream) : ZBTB32 (7607 downstream)																							cctgtctcaagaaaaaaaatga	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	40822854	40822855	+	IGR	DEL	TG	-	-	rs10417028	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40822854_40822855delTG								AKT2 (31589 upstream) : C19orf47 (4118 downstream)																							GCTCCTCTGCtgtgtgtgtgtg	0.287													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42147491	42147492	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42147491_42147492delCA								CEACAM4 (14049 upstream) : CEACAM7 (29743 downstream)																							CCTAGAAATGCACACATGGGGC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43158001	43158002	+	IGR	DEL	TG	-	-	rs71973909		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43158001_43158002delTG								CEACAM8 (58919 upstream) : PSG3 (67793 downstream)																							tctgtgtctctgtgtgtgtgtg	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43166869	43166869	+	IGR	DEL	T	-	-	rs113662420		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43166869delT								CEACAM8 (67787 upstream) : PSG3 (58926 downstream)																							TACCAACACATTTTTTTTTCT	0.438													6	5	---	---	---	---	
IRGQ	126298	broad.mit.edu	37	19	44093268	44093269	+	3'UTR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44093268_44093269insG	uc002oww.2	-	2					IRGQ_uc010eiv.2_3'UTR	NM_001007561	NP_001007562	Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q								protein binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0199)				atttcacagatgggaaaataag	0.124													4	2	---	---	---	---	
ZNF234	10780	broad.mit.edu	37	19	44656369	44656370	+	Intron	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44656369_44656370delCT	uc002oym.2	+						ZNF234_uc002oyl.3_Intron	NM_006630	NP_006621	Q14588	ZN234_HUMAN	zinc finger protein 234						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				tgcttgtcccctctctctcccc	0.000													4	2	---	---	---	---	
KLC3	147700	broad.mit.edu	37	19	45844443	45844444	+	Intron	DEL	TT	-	-	rs369335		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45844443_45844444delTT	uc002pbf.1	+						KLC3_uc002pbe.2_Intron|KLC3_uc010ejy.1_Intron	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCTGCCtgtgtttgtgtgtgtg	0.495													3	4	---	---	---	---	
EML2	24139	broad.mit.edu	37	19	46144655	46144656	+	5'Flank	INS	-	GACCT	GACCT	rs138124478	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46144655_46144656insGACCT	uc002pcn.2	-						EML2_uc002pco.2_5'Flank|EML2_uc002pcp.2_5'Flank|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_5'Flank|EML2_uc010ekj.2_5'Flank|uc002pcr.1_5'Flank|MIR330_hsa-mir-330|MI0000803_5'Flank|uc010ekl.2_3'UTR|uc002pcs.2_5'Flank	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CTCACCCAGTAGACCTGACCGT	0.554													5	5	---	---	---	---	
KLK12	43849	broad.mit.edu	37	19	51538859	51538859	+	5'Flank	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51538859delA	uc002pvg.1	-						KLK12_uc010ycp.1_5'Flank|KLK12_uc010ycq.1_5'Flank|KLK12_uc010ycr.1_5'Flank|KLK12_uc010ycs.1_5'Flank|KLK12_uc002pvh.1_5'Flank|KLK12_uc002pvi.1_5'Flank|KLK12_uc002pvj.1_5'Flank	NM_145894	NP_665901	Q9UKR0	KLK12_HUMAN	kallikrein 12 isoform 2						proteolysis	extracellular region|soluble fraction	serine-type endopeptidase activity			ovary(1)	1		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		CCACagagagaaaaaaaaaag	0.204													4	4	---	---	---	---	
PPP2R1A	5518	broad.mit.edu	37	19	52705524	52705532	+	Intron	DEL	CAGCTCCAA	-	-	rs140166686		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52705524_52705532delCAGCTCCAA	uc002pyp.2	+						PPP2R1A_uc010ydk.1_Intron|PPP2R1A_uc010epm.1_Intron|PPP2R1A_uc002pyq.2_Intron	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein						ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		gtttgagttgcagctccaacagttggaag	0.134			Mis		clear cell ovarian carcinoma								4	4	---	---	---	---	
ZNF160	90338	broad.mit.edu	37	19	53573669	53573669	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53573669delT	uc010eqk.2	-						ZNF160_uc002qaq.3_Intron|ZNF160_uc002qar.3_Intron	NM_001102603	NP_001096073	Q9HCG1	ZN160_HUMAN	zinc finger protein 160						hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(134;0.02)		AACAAAAATGttttttttttt	0.134													6	3	---	---	---	---	
ZNF761	388561	broad.mit.edu	37	19	53932878	53932879	+	5'Flank	INS	-	A	A	rs141186010	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53932878_53932879insA	uc010eqp.2	+						LOC147804_uc002qbo.2_5'Flank|LOC147804_uc002qbq.2_5'Flank|LOC147804_uc002qbp.2_5'Flank|ZNF761_uc002qbr.2_5'Flank	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		ACCCTGCCCCCAGGTGATTCTA	0.480													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54861176	54861177	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54861176_54861177insG								LILRA4 (10755 upstream) : LAIR1 (4058 downstream)																							ATCCTGAGGGTGAATGGATGGA	0.569													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54861178	54861179	+	IGR	INS	-	TGG	TGG	rs146571521	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54861178_54861179insTGG								LILRA4 (10757 upstream) : LAIR1 (4056 downstream)																							CCTGAGGGTGAATGGATGGAGG	0.579													7	4	---	---	---	---	
NLRP5	126206	broad.mit.edu	37	19	56531052	56531053	+	Intron	DEL	AT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56531052_56531053delAT	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GATGTTAAACATATGGCCAAGA	0.267													4	2	---	---	---	---	
SDCBP2	27111	broad.mit.edu	37	20	1302967	1302967	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1302967delT	uc002wev.3	-						FKBP1A_uc010gac.2_Intron|SDCBP2_uc010zpq.1_Intron	NM_080489	NP_536737	Q9H190	SDCB2_HUMAN	syndecan binding protein 2 isoform a						intracellular signal transduction|intracellular transport|nervous system development	cytoplasm	protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity			large_intestine(1)|skin(1)	2						actcttgtggttgcctcttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	5718569	5718570	+	IGR	DEL	AA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5718569_5718570delAA								GPCPD1 (126897 upstream) : C20orf196 (12473 downstream)																							TATTAAAAAGAAAAAAAAAAAG	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6699739	6699739	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6699739delT								FERMT1 (595548 upstream) : BMP2 (49006 downstream)																							atatagtaggttttcataagc	0.005													4	2	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8605502	8605502	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8605502delA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						TTAAAAGTGGAATTCAATTAT	0.353													4	2	---	---	---	---	
PLCB4	5332	broad.mit.edu	37	20	9353449	9353449	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9353449delA	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron|PLCB4_uc002wnh.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TGAAAACGGTAAAAAAAAAAA	0.239													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12168351	12168352	+	IGR	INS	-	T	T	rs75278604		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12168351_12168352insT								BTBD3 (261109 upstream) : SPTLC3 (821275 downstream)																							gtccacgtgtcttttttttttt	0.000													1	5	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	14505490	14505490	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14505490delC	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CAAATCAGAGCCCCTTGCCCT	0.512													7	5	---	---	---	---	
PCSK2	5126	broad.mit.edu	37	20	17368754	17368755	+	Intron	INS	-	GT	GT			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17368754_17368755insGT	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	gaagaaggccagtgtgtgtgtg	0.000													4	2	---	---	---	---	
C20orf12	55184	broad.mit.edu	37	20	18407990	18407990	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18407990delT	uc010zsa.1	-						C20orf12_uc002wqp.3_Intron|C20orf12_uc002wqr.3_Intron|C20orf12_uc002wqs.3_Intron|C20orf12_uc002wqq.3_Intron|C20orf12_uc002wqu.1_Intron|C20orf12_uc010gct.1_Intron	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184							intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				TTTTTTTGGGttttttttttt	0.214													6	4	---	---	---	---	
RALGAPA2	57186	broad.mit.edu	37	20	20624489	20624489	+	Intron	DEL	T	-	-	rs147932263		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20624489delT	uc002wrz.2	-						RALGAPA2_uc010zsg.1_Intron	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250						activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						AAATGGATGCTTTTTTTTTTA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	20864694	20864694	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20864694delA								RALGAPA2 (171428 upstream) : PLK1S1 (241930 downstream)																							ctgagatagtaaaaaaaaaag	0.000													4	2	---	---	---	---	
XRN2	22803	broad.mit.edu	37	20	21327382	21327383	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21327382_21327383insA	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						ctcagcctcctgagtagctagg	0.000													4	2	---	---	---	---	
XRN2	22803	broad.mit.edu	37	20	21327389	21327389	+	Intron	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21327389delC	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						tcctgagtagctaggattaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	22869344	22869344	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22869344delC								FOXA2 (303243 upstream) : SSTR4 (146713 downstream)																							aaaacagtgacacattcagct	0.139													4	2	---	---	---	---	
FAM182A	284800	broad.mit.edu	37	20	26054990	26054992	+	Intron	DEL	CAC	-	-	rs111574025		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26054990_26054992delCAC	uc010gdq.2	+							NR_026713				Homo sapiens cDNA FLJ38374 fis, clone FEBRA2002552.												0						acttcattatcaccacctCcacc	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26083662	26083662	+	IGR	DEL	A	-	-	rs113870800		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26083662delA								FAM182A (16110 upstream) : C20orf191 (391 downstream)																							tattcaactgaaaaaaatgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26110807	26110807	+	IGR	DEL	G	-	-	rs113689621		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26110807delG								C20orf191 (16130 upstream) : MIR663 (78015 downstream)																							GTTTGGAAGAGTAAGGGAGGA	0.348													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26147302	26147303	+	IGR	INS	-	T	T	rs140404828	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26147302_26147303insT								C20orf191 (52625 upstream) : MIR663 (41519 downstream)																							ATTTGGAGGACTTGCATACTTG	0.371													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26210810	26210812	+	IGR	DEL	ACA	-	-	rs149589991		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26210810_26210812delACA								MIR663 (21896 upstream) : None (None downstream)																							CTTCAAAATCACAACAACTTTAT	0.177													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26240772	26240773	+	IGR	INS	-	TT	TT			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26240772_26240773insTT								MIR663 (51858 upstream) : None (None downstream)																							attgatgggcatttggattggt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29481569	29481569	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29481569delG								None (None upstream) : FRG1B (130310 downstream)																							aaaatgtgttggaaagggttt	0.000													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29584135	29584136	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29584135_29584136insA								None (None upstream) : FRG1B (27743 downstream)																							gaccctatttcaaaaaaaTTAT	0.094													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29590448	29590448	+	IGR	DEL	A	-	-	rs75870984	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29590448delA								None (None upstream) : FRG1B (21431 downstream)																							TTATCAATACAAAAAAAAAGA	0.328													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31529256	31529256	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31529256delA	uc010zub.1	+							NM_001143967	NP_001137439			EF-hand calcium binding domain 8																		cattatttataatacaaaagt	0.000													4	2	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33220729	33220729	+	Intron	DEL	A	-	-	rs74908424		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33220729delA	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron|PIGU_uc010gev.1_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						ttgttaaaagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
C20orf24	55969	broad.mit.edu	37	20	35226872	35226872	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35226872delA	uc002xfo.2	+							NM_018840	NP_061328	Q9BUV8	CT024_HUMAN	RAB5-interacting protein isoform a								protein binding				0	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GGCCAAAAAGAAAAAAAAAGA	0.388													4	2	---	---	---	---	
BLCAP	10904	broad.mit.edu	37	20	36150594	36150594	+	5'Flank	DEL	T	-	-	rs2344098	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36150594delT	uc002xha.2	-						BLCAP_uc002xhb.2_Intron|BLCAP_uc002xhc.2_Intron|NNAT_uc002xhd.2_Intron|NNAT_uc002xhe.2_Intron	NM_006698	NP_006689	P62952	BLCAP_HUMAN	bladder cancer associated protein						apoptosis|cell cycle	integral to membrane					0		Myeloproliferative disorder(115;0.00878)				aaaaaaaaaataataataaaa	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36895844	36895845	+	Intron	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36895844_36895845delCT	uc002xia.1	+											Homo sapiens cDNA FLJ31292 fis, clone KIDNE2007422.																		CACTTCCTTCCTCTCTCTCTCT	0.416													4	2	---	---	---	---	
ACTR5	79913	broad.mit.edu	37	20	37388217	37388217	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37388217delT	uc002xjd.2	+							NM_024855	NP_079131	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog						DNA recombination|double-strand break repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent|UV-damage excision repair	cytoplasm|Ino80 complex	ATP binding|protein binding				0		Myeloproliferative disorder(115;0.00878)				TGAATGTTGATTTTTTTTTGG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37732814	37732814	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37732814delT								DHX35 (64451 upstream) : LOC339568 (109610 downstream)																							tggacatatcttttttttgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37921314	37921314	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37921314delT								LOC339568 (67923 upstream) : None (None downstream)																							AATGGAATTATTTTTTTTTTG	0.378													2	4	---	---	---	---	
ZHX3	23051	broad.mit.edu	37	20	39862213	39862213	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39862213delA	uc002xjs.1	-						ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Intron|ZHX3_uc002xjt.1_Intron|ZHX3_uc002xju.1_Intron|ZHX3_uc002xjv.1_Intron|ZHX3_uc002xjw.1_Intron	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3						negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Myeloproliferative disorder(115;0.00425)				CTAGGTGAATAAAACATATGC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	40498277	40498278	+	IGR	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40498277_40498278insA								CHD6 (251144 upstream) : PTPRT (203115 downstream)																							catttcaaaggaaaaaaaatca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42428940	42428940	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42428940delC								GTSF1L (73298 upstream) : TOX2 (114552 downstream)																							aggagcttttctgctagtggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46976307	46976308	+	IGR	INS	-	T	T	rs147276021	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46976307_46976308insT								SULF2 (560947 upstream) : LOC284749 (12346 downstream)																							tgctttcaagatttttttttta	0.000													2	5	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47879748	47879748	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47879748delT	uc002xui.2	-							NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AAAAGGGAACTTTACACATTG	0.284													8	7	---	---	---	---	
PTPN1	5770	broad.mit.edu	37	20	49165948	49165948	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49165948delT	uc002xvl.2	+						PTPN1_uc010zys.1_Intron	NM_002827	NP_002818	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type						blood coagulation|interferon-gamma-mediated signaling pathway|negative regulation of insulin receptor signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol|endoplasmic reticulum membrane	protein tyrosine phosphatase activity|zinc ion binding				0		Lung NSC(126;0.163)			Clodronate(DB00720)|Tiludronate(DB01133)	CAGTTGATTGTTTTTTTTCCA	0.438													4	2	---	---	---	---	
NFATC2	4773	broad.mit.edu	37	20	50102070	50102070	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50102070delT	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					TTCTTGTTGATTTTTTTTTTT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	53484491	53484492	+	IGR	DEL	TG	-	-	rs151190805	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53484491_53484492delTG								DOK5 (216782 upstream) : None (None downstream)																							CACTAAAGATTGTTTTTTTTAA	0.277													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54397614	54397615	+	IGR	DEL	GT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54397614_54397615delGT								None (None upstream) : CBLN4 (174882 downstream)																							TATGTtgtgagtgtgtgtgtgt	0.282													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55336461	55336463	+	IGR	DEL	TGC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55336461_55336463delTGC								TFAP2C (122125 upstream) : BMP7 (407346 downstream)																							ataaaggtgatgctgctgctgct	0.123													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55731172	55731172	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55731172delC								TFAP2C (516836 upstream) : BMP7 (12637 downstream)																							GGTCCTGAATCCCAGGCATTG	0.383													4	2	---	---	---	---	
RAE1	8480	broad.mit.edu	37	20	55950632	55950633	+	Intron	INS	-	CCGTCCA	CCGTCCA	rs144750956	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55950632_55950633insCCGTCCA	uc002xyg.2	+						RAE1_uc002xyh.2_Intron|RAE1_uc002xyi.2_Intron	NM_003610	NP_003601	P78406	RAE1L_HUMAN	RAE1 (RNA export 1, S.pombe) homolog						carbohydrate metabolic process|glucose transport|mRNA export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|cytoskeleton|nuclear outer membrane|nuclear pore	microtubule binding|RNA binding				0	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			GTCTTCTGTCCCCGTCCACCAG	0.564													3	3	---	---	---	---	
EDN3	1908	broad.mit.edu	37	20	57887421	57887421	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57887421delT	uc002yap.2	+						EDN3_uc002yao.1_Intron|EDN3_uc002yaq.2_Intron|EDN3_uc002yar.2_Intron|EDN3_uc002yas.2_Intron	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					GTTTCTCTAATTTTTTTTTTA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58020135	58020135	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58020135delG								EDN3 (119089 upstream) : PHACTR3 (132429 downstream)																							TCCCAACCCAGGGACAGAGGG	0.259													4	2	---	---	---	---	
SYCP2	10388	broad.mit.edu	37	20	58460695	58460696	+	Intron	DEL	AC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58460695_58460696delAC	uc002yaz.2	-							NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2						cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TTAAAAAAATACACACACACAC	0.317													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60347872	60347872	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60347872delT	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TCTCACTTGATTTTTTTTTTT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60804539	60804540	+	5'Flank	INS	-	CA	CA	rs138660444	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60804539_60804540insCA	uc002ycj.1	+											Homo sapiens cDNA FLJ44790 fis, clone BRACE3039288.																		cattccacactcacactcacac	0.114													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61740507	61740507	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61740507delT								HAR1A (4770 upstream) : MIR124-3 (69345 downstream)																							aggtaaatgatttttttttgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9414623	9414624	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9414623_9414624insG								None (None upstream) : None (None downstream)																							CATTGAAAAAAAGTTTAGAGAT	0.233													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9581764	9581764	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9581764delC								None (None upstream) : None (None downstream)																							aagagtcaagcccacttactt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9828206	9828207	+	IGR	INS	-	TA	TA			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9828206_9828207insTA								None (None upstream) : None (None downstream)																							ccactccctgttatagttgcat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9840286	9840287	+	IGR	INS	-	AG	AG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9840286_9840287insAG								None (None upstream) : None (None downstream)																							atgcagccaaaaaaacacatga	0.000													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9843638	9843638	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9843638delA								None (None upstream) : None (None downstream)																							AAATGCATGCACTTTCAAATG	0.194													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9856378	9856380	+	IGR	DEL	CTC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9856378_9856380delCTC								None (None upstream) : None (None downstream)																							CCTCTGCCTTCTCCTCCAGGGCA	0.581													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10410514	10410515	+	IGR	DEL	AC	-	-	rs4913146	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10410514_10410515delAC								None (None upstream) : TPTE (496228 downstream)																							AAACAAACAAACAAAAAAAAAC	0.168													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10446924	10446924	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10446924delA								None (None upstream) : TPTE (459819 downstream)																							TACTCAAACTAATCTTTTTTT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10572021	10572022	+	Intron	INS	-	A	A			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10572021_10572022insA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		attcattatgTAAAAAAAAGAA	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10795806	10795807	+	IGR	INS	-	GAGTGGAGTG	GAGTGGAGTG			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10795806_10795807insGAGTGGAGTG								None (None upstream) : TPTE (110936 downstream)																							agaattgaactgagtggagtgg	0.000													5	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11037608	11037609	+	Intron	INS	-	GA	GA	rs56247503		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11037608_11037609insGA	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAACTGTCAAGGAAAATACTTA	0.332													13	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11045983	11045983	+	Intron	DEL	A	-	-	rs111961463		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11045983delA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTCAAGTATCAAAACATTTAT	0.244													9	7	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11051168	11051168	+	Intron	DEL	T	-	-	rs139496343		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11051168delT	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		agaccttttgtttttatttac	0.100													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11060026	11060026	+	Intron	DEL	G	-	-	rs146956675		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11060026delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAGAAACACAGAAAAAATATT	0.259													11	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14373499	14373500	+	IGR	INS	-	A	A	rs138382892	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14373499_14373500insA								None (None upstream) : C21orf99 (36987 downstream)																							aagaaagaaagaaagaaaagaa	0.094													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14578930	14578931	+	IGR	INS	-	A	A	rs113017407		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14578930_14578931insA								C21orf99 (88361 upstream) : POTED (403567 downstream)																							gacatttagccaaaaaaaaacc	0.000													4	2	---	---	---	---	
C21orf81	391267	broad.mit.edu	37	21	15346964	15346964	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15346964delA	uc002yji.2	-							NR_027270				Homo sapiens C21orf81 protein (C21orf81) mRNA, complete cds.												0						AAACTAAGAGAAAAAAAAAAA	0.373													4	2	---	---	---	---	
LIPI	149998	broad.mit.edu	37	21	15571928	15571928	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15571928delA	uc002yjm.2	-							NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I						lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		cctaccaaccaaaaaaaaaaa	0.000													4	3	---	---	---	---	
CHODL	140578	broad.mit.edu	37	21	19535755	19535755	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19535755delT	uc002ykt.2	+						CHODL_uc002ykr.2_Intron|CHODL_uc002yks.2_Intron|CHODL_uc002yku.2_Intron			Q9H9P2	CHODL_HUMAN	RecName: Full=Chondrolectin; AltName: Full=Transmembrane protein MT75; Flags: Precursor;						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		ttcaattgcctttTTTTTCCC	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20190932	20190932	+	IGR	DEL	G	-	-	rs5842711		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20190932delG								TMPRSS15 (414962 upstream) : None (None downstream)																							AGTTGGCTTAGGAAAATAATT	0.264													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20220881	20220881	+	IGR	DEL	C	-	-	rs67635561		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20220881delC								TMPRSS15 (444911 upstream) : None (None downstream)																							aaaaaaaaaaccagaaaaagt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	24290026	24290027	+	IGR	INS	-	C	C	rs149235091	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24290026_24290027insC								None (None upstream) : None (None downstream)																							CACTACCCTAAAAAATTGACCA	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	24488098	24488098	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24488098delT								None (None upstream) : None (None downstream)																							ATTGCTTTTATTTTATTTACC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	25468816	25468817	+	IGR	INS	-	T	T	rs149696360	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25468816_25468817insT								None (None upstream) : None (None downstream)																							TAAAATGCAAATTTTTTTTCTT	0.356													3	4	---	---	---	---	
GABPA	2551	broad.mit.edu	37	21	27116999	27116999	+	Intron	DEL	T	-	-	rs71327961		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27116999delT	uc002ylx.3	+						GABPA_uc002yly.3_Intron	NM_002040	NP_002031	Q06546	GABPA_HUMAN	GA binding protein transcription factor, alpha						positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)|central_nervous_system(1)	2						AGAATATACATTTTTTTTTTA	0.259													3	3	---	---	---	---	
APP	351	broad.mit.edu	37	21	27329674	27329674	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27329674delA	uc002ylz.2	-						APP_uc011acg.1_Intron|APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)				CATGTGAATTAAAAAAAAAGA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33218701	33218702	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33218701_33218702insT								SFRS15 (114270 upstream) : HUNK (26926 downstream)																							AGTTTATCAGGTTTTTTTTTCC	0.233													4	2	---	---	---	---	
TMEM50B	757	broad.mit.edu	37	21	34817111	34817112	+	Intron	DEL	AA	-	-	rs112608102		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34817111_34817112delAA	uc002yrs.1	-							NM_006134		P56557	TM50B_HUMAN	transmembrane protein 50B							endoplasmic reticulum|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						atctctttacaaaaaaaaaaaa	0.015													4	3	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	36593990	36593991	+	Intron	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36593990_36593991insG	uc002yut.1	-									Q01196	RUNX1_HUMAN	Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						ATAAACTACATGGGGAAATTTT	0.351			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	2	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	37278022	37278022	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37278022delA	uc002yut.1	-									Q01196	RUNX1_HUMAN	Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						AGGTAAGGGGAAGGCTTAAAC	0.483			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	39622196	39622196	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39622196delG								DSCR10 (41460 upstream) : KCNJ15 (6468 downstream)																							GGTAGAAGGAGGGGTATTAGT	0.423													4	2	---	---	---	---	
NCRNA00114	400866	broad.mit.edu	37	21	40118729	40118730	+	Intron	DEL	CT	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40118729_40118730delCT	uc010goa.2	-						NCRNA00114_uc011aen.1_Intron|NCRNA00114_uc002yxd.3_Intron	NR_027067				Homo sapiens chromosome 21 open reading frame 24 isoform 1 (C21orf24) mRNA, complete sequence.												0						ttctccttcgctctctctctct	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40737065	40737065	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40737065delT								HMGN1 (15795 upstream) : WRB (15148 downstream)																							TATGTGTCCCTTCAAAATGCT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42666453	42666456	+	IGR	DEL	TGTG	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42666453_42666456delTGTG								BACE2 (17930 upstream) : FAM3B (9721 downstream)																							GAAAtgtgcttgtgtgtgtgtgtg	0.294													4	2	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45526076	45526076	+	3'UTR	DEL	C	-	-	rs2516520	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45526076delC	uc002zea.2	+	23					TRAPPC10_uc010gpo.2_3'UTR|TRAPPC10_uc011afa.1_3'UTR|PWP2_uc002zeb.2_5'Flank	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CTACTTTTTACAAAAGGGCAA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	46790249	46790249	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46790249delC								LOC642852 (72981 upstream) : COL18A1 (34848 downstream)																							ggcttcccttcctgttccaag	0.000													4	2	---	---	---	---	
PRMT2	3275	broad.mit.edu	37	21	48063387	48063388	+	Intron	INS	-	A	A	rs113903382		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48063387_48063388insA	uc002zjx.2	+						PRMT2_uc002zjw.2_Intron|PRMT2_uc002zjy.2_Intron|PRMT2_uc010gqm.2_Intron|PRMT2_uc011aga.1_Intron|PRMT2_uc011agb.1_Intron|PRMT2_uc011agc.1_Intron|PRMT2_uc002zjz.1_5'UTR	NM_206962	NP_996845	P55345	ANM2_HUMAN	HMT1 hnRNP methyltransferase-like 1						developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity			ovary(1)	1	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		ATAATATAGCCAAAAAAAAAAA	0.391													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17031191	17031191	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17031191delC								OR11H1 (581387 upstream) : CCT8L2 (40457 downstream)																							tcctctccttccctccctgga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21024933	21024933	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21024933delC								MED15 (83015 upstream) : POM121L4P (18910 downstream)																							GAGAAGAAGACCGTGTACCTG	0.607													25	14	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	23247455	23247456	+	Intron	DEL	TG	-	-	rs138768797		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23247455_23247456delTG	uc011aim.1	+						uc002zws.2_Intron					Parts of antibodies, mostly variable regions.												0						tctgtctgtctgtctctctctc	0.416													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25921976	25921977	+	IGR	INS	-	A	A	rs139753830	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25921976_25921977insA								LRP5L (144432 upstream) : ADRBK2 (38884 downstream)																							agagcgggctgacttaatgatt	0.000													5	3	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29763452	29763452	+	Intron	DEL	T	-	-	rs3963295		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29763452delT	uc003afj.2	-						AP1B1_uc003afi.2_5'Flank|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						TCTATCAACCTTTTttttttt	0.179													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	31378715	31378716	+	IGR	INS	-	CTCC	CTCC	rs143656884	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31378715_31378716insCTCC								TUG1 (3338 upstream) : SMTN (98589 downstream)																							taaaatctgctctccagtgttc	0.000													6	5	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33278976	33278976	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33278976delT	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						TAGCAGTTGAtttacttccca	0.284													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34053924	34053924	+	Intron	DEL	A	-	-	rs71769477		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34053924delA	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				ttgactaatgaaaaaaaaaaa	0.045													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36098700	36098700	+	IGR	DEL	G	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36098700delG								APOL6 (34245 upstream) : APOL5 (15219 downstream)																							ctgcaatattgggcataatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36126986	36126986	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36126986delA								APOL5 (1459 upstream) : RBM9 (7798 downstream)																							aacaacaaccaaaaaGGACAA	0.209													4	2	---	---	---	---	
PACSIN2	11252	broad.mit.edu	37	22	43305655	43305655	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43305655delA	uc010gzg.2	-						PACSIN2_uc003bdg.3_Intron|PACSIN2_uc003bde.3_Intron|PACSIN2_uc003bdf.3_Intron	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				GTTCTTGTCTACTGACATTAT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	44780135	44780135	+	IGR	DEL	C	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44780135delC								KIAA1644 (71404 upstream) : LDOC1L (108315 downstream)																							CTGCTGATTTCCCAGGGTTCC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	47954275	47954276	+	IGR	INS	-	A	A	rs6008267	by1000genomes	TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47954275_47954276insA								TBC1D22A (384553 upstream) : FAM19A5 (931012 downstream)																							GTAAAGTATGCAAAAAAAAAAT	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48636645	48636647	+	IGR	DEL	CAC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48636645_48636647delCAC								None (None upstream) : FAM19A5 (248641 downstream)																							GTTTAGAGTGCACCACCACCGCT	0.369													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49647736	49647737	+	IGR	INS	-	G	G			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49647736_49647737insG								FAM19A5 (499994 upstream) : C22orf34 (160439 downstream)																							AGACACTGGCTGGCAAACTGGA	0.485													4	2	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2778180	2778180	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2778180delT	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTGGCGTGGTTTTTTTTTGA	0.423													5	3	---	---	---	---	
ARHGAP6	395	broad.mit.edu	37	X	11160664	11160664	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11160664delA	uc004cup.1	-						ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cum.1_Intron|ARHGAP6_uc004cun.1_Intron	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						ccccaaagatatctgtgtcat	0.139													4	2	---	---	---	---	
OFD1	8481	broad.mit.edu	37	X	13776301	13776301	+	Intron	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13776301delT	uc004cvp.3	+						OFD1_uc004cvr.3_Intron|OFD1_uc011mil.1_Intron|OFD1_uc004cvq.3_Intron|OFD1_uc010nen.2_Intron|OFD1_uc004cvs.3_Intron|OFD1_uc004cvu.3_Intron|OFD1_uc004cvv.3_Intron	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1						cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						TCTGCTTGTGTTTTTTTTTAA	0.358													4	2	---	---	---	---	
GAGE1	2543	broad.mit.edu	37	X	49355488	49355489	+	Intron	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49355488_49355489insT	uc004doj.2	+						GAGE1_uc011mnu.1_Intron|GAGE2A_uc004doi.3_Intron	NM_012196	NP_036328	Q13065	GAGE1_HUMAN	G antigen 8						cellular defense response						0	Ovarian(276;0.236)					ATTCTGGAGGATTTTTTTTTTC	0.386													6	10	---	---	---	---	
TRPC5	7224	broad.mit.edu	37	X	111218161	111218161	+	Intron	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111218161delA	uc004epl.1	-						TRPC5_uc004epm.1_Intron	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,						axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						agaggatgacaaaaaacttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	6210550	6210550	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:6210550delT								TSPY2 (93497 upstream) : TTTY1B (47892 downstream)																							AAAAGAAACCTTTTTTTTTTT	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9941802	9941802	+	IGR	DEL	G	-	-	rs113135217		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9941802delG								TTTY22 (290948 upstream) : None (None downstream)																							AAAACTTTTTGGTTAGTGATT	0.338													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9954147	9954147	+	IGR	DEL	A	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9954147delA								TTTY22 (303293 upstream) : None (None downstream)																							caaaaaaaataaaaataaaat	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9976409	9976409	+	IGR	DEL	C	-	-	rs78736390		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9976409delC								TTTY22 (325555 upstream) : None (None downstream)																							tcaatttgggcttttgttgcc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9997453	9997454	+	IGR	INS	-	T	T			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9997453_9997454insT								TTTY22 (346599 upstream) : None (None downstream)																							ccttggcagtgttttttaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10056983	10056986	+	IGR	DEL	ACAA	-	-	rs111895047		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10056983_10056986delACAA								TTTY22 (406129 upstream) : None (None downstream)																							tgcagtttccacaaacagaccatt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13446680	13446681	+	IGR	DEL	CA	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13446680_13446681delCA								None (None upstream) : None (None downstream)																							cactccattccattccattcca	0.000													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13446683	13446685	+	IGR	DEL	TCC	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13446683_13446685delTCC								None (None upstream) : None (None downstream)																							tccattccattccattccattcc	0.000													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	16980926	16980926	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:16980926delT								NLGN4Y (25078 upstream) : None (None downstream)																							tttttttgtgttttttttttg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28792729	28792729	+	IGR	DEL	T	-	-			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28792729delT								None (None upstream) : None (None downstream)																							aaatcgaatGTAAAAATGGAA	0.144													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58979593	58979594	+	IGR	INS	-	CCATT	CCATT			TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58979593_58979594insCCATT								None (None upstream) : None (None downstream)																							atttcatttcaccattccattc	0.005													16	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59005360	59005361	+	IGR	INS	-	AA	AA	rs9320085		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59005360_59005361insAA								None (None upstream) : None (None downstream)																							cataccacaataaaaaAAATTA	0.059													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59030837	59030837	+	IGR	DEL	T	-	-	rs147048784		TCGA-B0-5696-01A-11D-1534-10	TCGA-B0-5696-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59030837delT								None (None upstream) : None (None downstream)																							GTGATGTACATTTTCCATGTT	0.299													5	3	---	---	---	---	
