Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC2A5	6518	broad.mit.edu	37	1	9129703	9129703	+	5'UTR	SNP	A	C	C	rs143295336	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9129703A>C	uc001apo.2	-	1					SLC2A5_uc010nzz.1_5'Flank|SLC2A5_uc010oaa.1_5'UTR|SLC2A5_uc010oab.1_Intron|SLC2A5_uc010oac.1_5'Flank|SLC2A5_uc001app.3_5'UTR	NM_003039	NP_003030	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated						carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		ATGCCAAATAACAGCCAATAG	0.458													9	23	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10364568	10364568	+	Intron	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10364568T>C	uc001aqx.3	+						KIF1B_uc001aqv.3_Silent_p.L1109L|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGGAGGTCAGTTAGAGGGCAA	0.507													13	33	---	---	---	---	PASS
UBIAD1	29914	broad.mit.edu	37	1	11333752	11333752	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11333752C>A	uc001asg.2	+	1	498	c.164C>A	c.(163-165)CCC>CAC	p.P55H		NM_013319	NP_037451	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	55					menaquinone biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrion|nucleus	prenyltransferase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		GCCCTGAGGCCCTGGAGCTTC	0.657													11	48	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16939401	16939401	+	Intron	SNP	C	A	A	rs656418	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16939401C>A	uc009vos.1	-						NBPF1_uc001aza.3_Intron|NBPF1_uc001azb.1_RNA|NBPF1_uc001azc.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CCTGGAGACACCGCCAGGAGC	0.612													2	0	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	20990992	20990992	+	3'UTR	SNP	T	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20990992T>G	uc001bdr.3	-	15					DDOST_uc001bdo.1_5'Flank|DDOST_uc009vpw.1_5'Flank|DDOST_uc010odd.1_5'Flank|DDOST_uc010ode.1_5'Flank|KIF17_uc001bdp.3_3'UTR|KIF17_uc001bdq.3_3'UTR|KIF17_uc009vpx.2_3'UTR|KIF17_uc001bds.3_3'UTR	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a						microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GTGTGGCAGGTGGGAGGAGAC	0.652													8	21	---	---	---	---	PASS
EIF2C1	26523	broad.mit.edu	37	1	36372649	36372649	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36372649G>A	uc001bzl.2	+	12	1724	c.1511G>A	c.(1510-1512)CGG>CAG	p.R504Q	EIF2C1_uc001bzk.2_Missense_Mutation_p.R429Q|EIF2C1_uc009vuy.2_RNA	NM_012199	NP_036331	Q9UL18	AGO1_HUMAN	eukaryotic translation initiation factor 2C, 1	504					negative regulation of translation involved in gene silencing by miRNA|nuclear-transcribed mRNA catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|polysome	protein binding|RNA binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CCTATGTTCCGGCATCTCAAG	0.532													4	171	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51887534	51887534	+	Intron	SNP	G	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51887534G>C	uc001csq.1	-						EPS15_uc009vyz.1_Intron|EPS15_uc001csp.3_Missense_Mutation_p.S32C	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway						cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						CTTTTCCCTAGAAGACCAGCA	0.368			T	MLL	ALL								78	233	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	63008322	63008322	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63008322C>T	uc001daq.2	-	25	3036	c.3002G>A	c.(3001-3003)CGG>CAG	p.R1001Q	DOCK7_uc001dan.2_Missense_Mutation_p.R862Q|DOCK7_uc001dao.2_Missense_Mutation_p.R862Q|DOCK7_uc001dap.2_Missense_Mutation_p.R970Q|DOCK7_uc001dam.2_Missense_Mutation_p.R181Q	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1001					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						AGCTGATTCCCGAACGCTGCC	0.378													4	163	---	---	---	---	PASS
SLC35D1	23169	broad.mit.edu	37	1	67486082	67486082	+	Silent	SNP	A	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67486082A>C	uc001ddk.2	-	10	1230	c.846T>G	c.(844-846)GCT>GCG	p.A282A	SLC35D1_uc010oph.1_Silent_p.A203A	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic	282	Helical; (Potential).				chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	TAGTTGTAAGAGCAGAATTAT	0.333													92	322	---	---	---	---	PASS
ACADM	34	broad.mit.edu	37	1	76228484	76228484	+	3'UTR	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76228484C>A	uc001dgw.3	+	12					ACADM_uc009wbp.2_3'UTR|ACADM_uc009wbr.2_3'UTR|ACADM_uc010ore.1_3'UTR|ACADM_uc010orf.1_3'UTR|ACADM_uc001dgx.3_3'UTR|ACADM_uc010org.1_3'UTR	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						AACTAGAACACAAGCCACTGT	0.308													11	31	---	---	---	---	PASS
RPL5	6125	broad.mit.edu	37	1	93298416	93298416	+	Intron	SNP	T	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93298416T>G	uc001doz.2	+						RPL5_uc001dpa.2_Intron|RPL5_uc001dpb.2_5'UTR	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		TTGTGGCAGGTAATTTAGGCT	0.448													7	13	---	---	---	---	PASS
SLC6A17	388662	broad.mit.edu	37	1	110740166	110740166	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110740166G>T	uc009wfq.2	+	11	2221	c.1760G>T	c.(1759-1761)AGC>ATC	p.S587I		NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17	587	Helical; Name=11; (Potential).				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		ACCACAGCCAGCATCATCCAG	0.602											OREG0013652	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	13	---	---	---	---	PASS
LOC647121	647121	broad.mit.edu	37	1	121304140	121304140	+	5'Flank	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121304140A>G	uc009wht.1	+						LOC647121_uc001eiu.1_RNA					Homo sapiens cDNA FLJ46881 fis, clone UTERU3015647, moderately similar to Embigin precursor.												0						TACAGTAGTAATGGGAGTGTA	0.323													5	220	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144892265	144892265	+	Intron	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144892265A>G	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_3'UTR|PDE4DIP_uc001elv.3_Intron|PDE4DIP_uc001emb.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGGGGAAGGAAGCAGAAGAAA	0.453			T	PDGFRB	MPD								6	347	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144931293	144931293	+	Intron	SNP	T	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144931293T>A	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Missense_Mutation_p.E139V|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CACCCAGCACTCAAACCCTGA	0.582			T	PDGFRB	MPD								19	115	---	---	---	---	PASS
DNM3	26052	broad.mit.edu	37	1	171956945	171956945	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171956945G>A	uc001gie.2	+	3	561	c.385G>A	c.(385-387)GTG>ATG	p.V129M	DNM3_uc001gid.3_Missense_Mutation_p.V129M|DNM3_uc009wwb.2_Missense_Mutation_p.V129M|DNM3_uc001gif.2_Missense_Mutation_p.V129M	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a	129					endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						TTCCCCACACGGTAAGTAAAA	0.348													56	142	---	---	---	---	PASS
PIGR	5284	broad.mit.edu	37	1	207111003	207111003	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207111003T>C	uc001hez.2	-	4	666	c.482A>G	c.(481-483)AAG>AGG	p.K161R	PIGR_uc009xbz.2_Missense_Mutation_p.K161R	NM_002644	NP_002635	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor precursor	161	Ig-like V-type 2.|Extracellular (Potential).					extracellular region|integral to plasma membrane	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GGACTTCCTCTTTTGAGCATT	0.488													5	154	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220316404	220316404	+	Silent	SNP	C	T	T	rs113314730		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220316404C>T	uc001hmc.2	+	21	2783	c.2679C>T	c.(2677-2679)ATC>ATT	p.I893I	IARS2_uc001hmd.2_Silent_p.I229I	NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase	893					isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TTGGAAGCATCCCTGGCAAAA	0.438													123	308	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20180498	20180498	+	Silent	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20180498A>G	uc002rdi.2	-	4	369	c.261T>C	c.(259-261)ACT>ACC	p.T87T	WDR35_uc002rdj.2_Silent_p.T87T|WDR35_uc010ext.2_RNA	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	87	WD 2.									ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCACTGGTAGTCAACTTCT	0.308													6	297	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86719191	86719191	+	Silent	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86719191A>G	uc002sri.3	+	26	4242	c.3915A>G	c.(3913-3915)AAA>AAG	p.K1305K	KDM3A_uc010ytj.1_Silent_p.K1305K|KDM3A_uc010ytk.1_Silent_p.K1253K	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	1305					androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						ATGCAGTGAAAGATGCAGTTG	0.373													6	305	---	---	---	---	PASS
CKAP2L	150468	broad.mit.edu	37	2	113514635	113514635	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113514635A>G	uc002tie.2	-	4	392	c.313T>C	c.(313-315)TCA>CCA	p.S105P	CKAP2L_uc002tif.2_5'UTR|CKAP2L_uc010yxp.1_5'UTR|CKAP2L_uc010yxq.1_5'UTR	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	105						centrosome					0						ACACATTCTGAAGTCAGCCTT	0.473													5	199	---	---	---	---	PASS
LIMS2	55679	broad.mit.edu	37	2	128396655	128396655	+	3'UTR	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128396655T>C	uc002tpa.2	-	10					LIMS2_uc002tou.2_3'UTR|LIMS2_uc002tov.2_3'UTR|LIMS2_uc002tow.2_3'UTR|LIMS2_uc002tox.2_3'UTR|LIMS2_uc010fmb.2_3'UTR|LIMS2_uc002toy.2_3'UTR|LIMS2_uc010yzm.1_3'UTR|LIMS2_uc002toz.2_3'UTR|LIMS2_uc002tpb.2_3'UTR	NM_001161403	NP_001154875	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2						cell junction assembly	cytosol|focal adhesion|nucleus	zinc ion binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		TCCTGCCTCCTCACAGACAGA	0.393													2	0	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163291870	163291870	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163291870G>A	uc002uch.1	-	8	2004	c.1792C>T	c.(1792-1794)CGT>TGT	p.R598C	KCNH7_uc002uci.2_Missense_Mutation_p.R591C	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	598	Extracellular (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TCATTGTAACGTTTCCCAATT	0.433													16	483	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218713396	218713396	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218713396C>G	uc002vgt.2	-	17	1867	c.1469G>C	c.(1468-1470)GGG>GCG	p.G490A	TNS1_uc002vgr.2_Missense_Mutation_p.G490A|TNS1_uc002vgs.2_Missense_Mutation_p.G490A|TNS1_uc010zjv.1_Missense_Mutation_p.G490A|TNS1_uc010fvj.1_Missense_Mutation_p.G558A|TNS1_uc010fvk.1_Missense_Mutation_p.G615A|TNS1_uc010fvi.1_Missense_Mutation_p.G177A	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	490						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGCTAACGCCCCACCATTGAC	0.612													9	33	---	---	---	---	PASS
AAMP	14	broad.mit.edu	37	2	219134687	219134687	+	Intron	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219134687A>G	uc002vhk.2	-						PNKD_uc002vhn.2_5'Flank|AAMP_uc002vhj.2_5'Flank|AAMP_uc010fvo.2_Intron|AAMP_uc002vhl.2_Intron|PNKD_uc002vhm.1_5'Flank	NM_001087	NP_001078	Q13685	AAMP_HUMAN	angio-associated, migratory cell protein						angiogenesis|cell differentiation|positive regulation of endothelial cell migration|smooth muscle cell migration	cell surface|cytoplasm|plasma membrane	heparin binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCAGTTCTCACCTGGGTCCG	0.617													11	39	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219319673	219319673	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219319673T>C	uc002vie.2	-	26	3373	c.2920A>G	c.(2920-2922)ACT>GCT	p.T974A	USP37_uc010fvs.1_Missense_Mutation_p.T974A|USP37_uc010zkf.1_Missense_Mutation_p.T974A|USP37_uc002vif.2_Missense_Mutation_p.T974A|USP37_uc002vig.2_Missense_Mutation_p.T880A	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	974					ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TGACGGGTAGTCTTCCCCACT	0.463													5	182	---	---	---	---	PASS
EPHA4	2043	broad.mit.edu	37	2	222310860	222310860	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222310860T>C	uc002vmq.2	-	9	1799	c.1757A>G	c.(1756-1758)GAG>GGG	p.E586G	EPHA4_uc002vmr.2_Missense_Mutation_p.E586G|EPHA4_uc010zlm.1_Missense_Mutation_p.E527G|EPHA4_uc010zln.1_Missense_Mutation_p.E586G	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor	586	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CAAATGTTTCTCTTCATCCGC	0.274													8	731	---	---	---	---	PASS
HDLBP	3069	broad.mit.edu	37	2	242168842	242168842	+	3'UTR	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242168842C>A	uc002waz.2	-	28					HDLBP_uc002wba.2_3'UTR|HDLBP_uc002wbb.2_3'UTR	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CACGGCCAGGCCTGGAGGAGC	0.622													5	54	---	---	---	---	PASS
SEMA3G	56920	broad.mit.edu	37	3	52472210	52472210	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52472210C>T	uc003dea.1	-	14	1515	c.1515G>A	c.(1513-1515)ATG>ATA	p.M505I		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	505	Sema.				multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		CCACGTATAGCATTTGCTGGG	0.652													6	5	---	---	---	---	PASS
DNAH12	201625	broad.mit.edu	37	3	57456280	57456280	+	Silent	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57456280A>G	uc003dit.2	-	16	2176	c.1995T>C	c.(1993-1995)CTT>CTC	p.L665L		NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1	665	Potential.|Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						CCCACTTGAAAAGTTCCTCTT	0.318													5	225	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113049451	113049451	+	Missense_Mutation	SNP	A	C	C	rs79365690		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113049451A>C	uc003ead.1	-	8	1236	c.1223T>G	c.(1222-1224)GTT>GGT	p.V408G	WDR52_uc010hqk.1_5'Flank			Q96MT7	WDR52_HUMAN	RecName: Full=WD repeat protein 52.; Flags: Fragment;	Error:Variant_position_missing_in_Q96MT7_after_alignment										central_nervous_system(1)	1						TTCCTCAACAACAGCCACTTT	0.408													31	183	---	---	---	---	PASS
GAP43	2596	broad.mit.edu	37	3	115394971	115394971	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115394971A>G	uc003ebq.2	+	2	528	c.142A>G	c.(142-144)AGG>GGG	p.R48G	GAP43_uc003ebr.2_Missense_Mutation_p.R84G	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	48	IQ.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		ACACATAACAAGGAAAAAGCT	0.453													63	115	---	---	---	---	PASS
DHX36	170506	broad.mit.edu	37	3	154018911	154018911	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154018911A>T	uc003ezy.3	-	10	1304	c.1223T>A	c.(1222-1224)GTT>GAT	p.V408D	DHX36_uc010hvq.2_Missense_Mutation_p.V408D|DHX36_uc003ezz.3_Missense_Mutation_p.V408D	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	408						cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTGTTCTGGAACATACCTAAA	0.289													69	224	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193039503	193039503	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193039503C>A	uc011bsq.1	-	16	1882	c.1882G>T	c.(1882-1884)GAA>TAA	p.E628*		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	628					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GCCACCATTTCTGGGGCACCT	0.393													19	74	---	---	---	---	PASS
PAK2	5062	broad.mit.edu	37	3	196528816	196528816	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196528816A>G	uc003fwy.3	+	3	528	c.206A>G	c.(205-207)AAG>AGG	p.K69R		NM_002577	NP_002568	Q13177	PAK2_HUMAN	p21-activated kinase 2	69	GTPase-binding (By similarity).|Autoregulatory region (By similarity).				axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AAGAAAGAAAAGGAACGGCCA	0.353													6	347	---	---	---	---	PASS
TLR10	81793	broad.mit.edu	37	4	38776455	38776455	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38776455C>T	uc003gti.2	-	2	1136	c.757G>A	c.(757-759)GAT>AAT	p.D253N	TLR10_uc003gtj.2_Missense_Mutation_p.D253N|TLR10_uc003gtk.2_Missense_Mutation_p.D253N	NM_030956	NP_112218	Q9BXR5	TLR10_HUMAN	toll-like receptor 10 precursor	253	Extracellular (Potential).				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity			lung(1)|breast(1)	2						CAGAGTAAATCAACTTTATTA	0.348													55	170	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85758222	85758222	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85758222T>C	uc003hpd.2	-	7	844	c.436A>G	c.(436-438)ACA>GCA	p.T146A	WDFY3_uc003hpf.2_Missense_Mutation_p.T146A	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	146						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ACTGACATTGTTGTCATGCAG	0.398													27	63	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146059074	146059074	+	Silent	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146059074A>G	uc003ika.3	-	21	2796	c.2658T>C	c.(2656-2658)GCT>GCC	p.A886A	OTUD4_uc003ijz.3_Silent_p.A885A	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	950							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					GAGGGATGGAAGCCAATGCCG	0.502													4	70	---	---	---	---	PASS
PRKAA1	5562	broad.mit.edu	37	5	40775066	40775066	+	Intron	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40775066A>G	uc003jmc.2	-						PRKAA1_uc003jmb.2_Silent_p.D124D	NM_006251	NP_006242	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic						activation of MAPK activity|cell cycle arrest|cholesterol biosynthetic process|fatty acid biosynthetic process|insulin receptor signaling pathway|negative regulation of glucosylceramide biosynthetic process|positive regulation of anti-apoptosis|positive regulation of cholesterol biosynthetic process|regulation of fatty acid oxidation|response to hypoxia	cytosol	ATP binding|cAMP-dependent protein kinase activity|metal ion binding|protein binding			breast(1)	1					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	CTCCAGGTACATCAGATTTCT	0.249													6	408	---	---	---	---	PASS
KLHL3	26249	broad.mit.edu	37	5	137028117	137028117	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137028117C>T	uc010jek.2	-	5	827	c.383G>A	c.(382-384)AGC>AAC	p.S128N	KLHL3_uc003lbr.3_Missense_Mutation_p.S46N|KLHL3_uc011cyd.1_RNA|MYOT_uc011cye.1_Intron|KLHL3_uc010jem.1_Missense_Mutation_p.S88N|KLHL3_uc010jen.1_RNA|KLHL3_uc003lbs.1_5'UTR	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3	128						cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		CTGCAGCAAGCTGGCTGCCGG	0.522													3	40	---	---	---	---	PASS
NMUR2	56923	broad.mit.edu	37	5	151784061	151784061	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151784061G>A	uc003luv.2	-	1	780	c.614C>T	c.(613-615)ACG>ATG	p.T205M		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	205	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity	p.T205M(1)		ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CTTGATGACCGTACAGGTGGC	0.542													52	169	---	---	---	---	PASS
FAM114A2	10827	broad.mit.edu	37	5	153372626	153372626	+	Silent	SNP	G	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153372626G>C	uc003lvb.2	-	14	2016	c.1428C>G	c.(1426-1428)CTC>CTG	p.L476L	FAM114A2_uc003lvc.2_Silent_p.L476L|FAM114A2_uc003lvd.2_Silent_p.L476L|FAM114A2_uc003lve.2_Silent_p.L292L|FAM114A2_uc011dda.1_Silent_p.L406L	NM_018691	NP_061161	Q9NRY5	F1142_HUMAN	hypothetical protein LOC10827	476							purine nucleotide binding				0						GCACAGGTAAGAGTAGCTGAA	0.398													70	269	---	---	---	---	PASS
LARP1	23367	broad.mit.edu	37	5	154183854	154183854	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154183854A>T	uc003lvp.2	+	14	2962	c.2533A>T	c.(2533-2535)ACT>TCT	p.T845S	LARP1_uc003lvo.2_Missense_Mutation_p.T768S	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	845							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGGCCCCGTACTGCTTCCAT	0.547													20	72	---	---	---	---	PASS
CCDC99	54908	broad.mit.edu	37	5	169028336	169028336	+	Missense_Mutation	SNP	T	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169028336T>A	uc003mae.3	+	11	1656	c.1377T>A	c.(1375-1377)GAT>GAA	p.D459E	CCDC99_uc010jjj.2_Missense_Mutation_p.D388E|CCDC99_uc011deq.1_Missense_Mutation_p.D276E|CCDC99_uc010jjk.2_Missense_Mutation_p.D185E	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	coiled-coil domain containing 99	459					cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding			ovary(1)|liver(1)	2	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCCTGTGGATATAACCACCG	0.453													48	219	---	---	---	---	PASS
BTN3A1	11119	broad.mit.edu	37	6	26408092	26408092	+	Silent	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26408092C>T	uc003nhv.2	+	4	995	c.627C>T	c.(625-627)ATC>ATT	p.I209I	BTN3A1_uc011dkj.1_Silent_p.I209I|BTN3A1_uc011dkk.1_Silent_p.I157I|BTN3A1_uc010jqj.2_Silent_p.I209I	NM_007048	NP_008979	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1 isoform a	209	Ig-like V-type 2.|Extracellular (Potential).				lipid metabolic process	integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2						CATCTGTGATCATGAGAGGCA	0.542													4	209	---	---	---	---	PASS
GSTA2	2939	broad.mit.edu	37	6	52615426	52615426	+	Silent	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52615426A>G	uc003pay.2	-	7	768	c.618T>C	c.(616-618)CCT>CCC	p.P206P		NM_000846	NP_000837	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	206	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Aminophenazone(DB01424)|Amsacrine(DB00276)|Busulfan(DB01008)|Chlorambucil(DB00291)|Chloroquine(DB00608)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Mechlorethamine(DB00888)|Praziquantel(DB01058)|Vitamin E(DB00163)	CATCCATGGGAGGCTTCCTTG	0.433													10	488	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79770525	79770525	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79770525T>C	uc003pir.2	-	5	426	c.200A>G	c.(199-201)TAC>TGC	p.Y67C	PHIP_uc011dyp.1_Missense_Mutation_p.Y67C	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	67					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TAAGTGTCTGTAATACTTCAC	0.318													4	215	---	---	---	---	PASS
LYRM2	57226	broad.mit.edu	37	6	90346959	90346959	+	3'UTR	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90346959A>G	uc003pnm.2	-	3					LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|LYRM2_uc010kcf.1_Intron|LYRM2_uc010kcg.2_RNA|LYRM2_uc003pnl.3_RNA	NM_020466	NP_065199	Q9NU23	LYRM2_HUMAN	LYR motif containing 2												0		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		AAACACATGGAGACTTTGAAA	0.338													7	323	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117609777	117609777	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117609777C>G	uc003pxp.1	-	43	7121	c.6922G>C	c.(6922-6924)GAA>CAA	p.E2308Q	ROS1_uc011ebi.1_RNA	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	2308	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GCATGTGGTTCCTTCTCTTCT	0.483			T	GOPC|ROS1	glioblastoma|NSCLC								75	200	---	---	---	---	PASS
CENPW	387103	broad.mit.edu	37	6	126667412	126667412	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126667412G>C	uc003qao.2	+	2	355	c.188G>C	c.(187-189)TGT>TCT	p.C63S	CENPW_uc003qap.3_RNA	NM_001012507	NP_001012525	Q5EE01	CENPW_HUMAN	hypothetical protein LOC387103	63						chromosome, centromeric region|nucleus	DNA binding				0						ACAAACGCTTGTGCGAGTAAA	0.368													84	391	---	---	---	---	PASS
RSPO3	84870	broad.mit.edu	37	6	127517220	127517220	+	3'UTR	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127517220C>T	uc003qar.2	+	5					RSPO3_uc003qas.1_Intron	NM_032784	NP_116173	Q9BXY4	RSPO3_HUMAN	R-spondin 3 precursor							extracellular region	heparin binding				0				GBM - Glioblastoma multiforme(226;0.0555)		GACAGGTGCTCTAGCCATTAG	0.418													21	131	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146264471	146264471	+	Silent	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146264471C>A	uc003qlf.2	-	9	2445	c.2046G>T	c.(2044-2046)CTG>CTT	p.L682L	SHPRH_uc003qld.2_Silent_p.L682L|SHPRH_uc003qle.2_Silent_p.L682L|SHPRH_uc003qlg.1_Silent_p.L238L|SHPRH_uc003qlj.1_Silent_p.L571L	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	682	PHD-type.				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		CATGTTGCCACAGGTGACACT	0.433													6	154	---	---	---	---	PASS
MRPL18	29074	broad.mit.edu	37	6	160219197	160219197	+	3'UTR	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160219197T>C	uc003qsw.3	+	4					MRPL18_uc010kkb.2_RNA|PNLDC1_uc003qsx.1_5'Flank|PNLDC1_uc003qsy.1_5'Flank	NM_014161	NP_054880	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18 precursor						rRNA transport|translation	mitochondrial ribosome	5S rRNA binding|structural constituent of ribosome				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		TATAAATCTGTCAGCCACTAC	0.383													10	101	---	---	---	---	PASS
RNF216L	441191	broad.mit.edu	37	7	5015977	5015977	+	RNA	SNP	G	A	A	rs4036447		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5015977G>A	uc003snp.3	+	2		c.223G>A			RNF216L_uc003snq.3_RNA|RNF216L_uc010ksr.2_RNA|RNF216L_uc011jwe.1_RNA	NR_023384				Homo sapiens cDNA FLJ42538 fis, clone BRACE3004113.												0						TAGCAGTCCCGTATGTGCATG	0.408													6	450	---	---	---	---	PASS
RNF216L	441191	broad.mit.edu	37	7	5015981	5015981	+	RNA	SNP	G	A	A	rs4036448		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5015981G>A	uc003snp.3	+	2		c.227G>A			RNF216L_uc003snq.3_RNA|RNF216L_uc010ksr.2_RNA|RNF216L_uc011jwe.1_RNA	NR_023384				Homo sapiens cDNA FLJ42538 fis, clone BRACE3004113.												0						AGTCCCGTATGTGCATGTCTG	0.398													5	475	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20768019	20768019	+	Silent	SNP	G	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20768019G>T	uc003suw.3	+	14	2019	c.1473G>T	c.(1471-1473)GGG>GGT	p.G491G	ABCB5_uc010kuh.2_Silent_p.G936G|ABCB5_uc003sux.1_Silent_p.G114G	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	491	Helical; (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						ATGCGGCAGGGTTTCGATTTG	0.358													8	533	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45742998	45742998	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45742998G>A	uc003tne.3	+	15	2496	c.2478G>A	c.(2476-2478)ATG>ATA	p.M826I		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	826	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GAGAGGACATGGAGAAGGTGA	0.577													4	230	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48685100	48685100	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48685100C>T	uc003toq.2	+	62	15194	c.15169C>T	c.(15169-15171)CCC>TCC	p.P5057S	ABCA13_uc010kys.1_Missense_Mutation_p.P2132S|ABCA13_uc010kyu.1_Missense_Mutation_p.P787S	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	5057					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ACATCACTTGCCCATCTGAGC	0.393													6	425	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101460891	101460891	+	5'UTR	SNP	C	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101460891C>G	uc003uyx.3	+	1					CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						CCCGCGGCGCCGGGACAGCCC	0.746													10	22	---	---	---	---	PASS
LRWD1	222229	broad.mit.edu	37	7	102108803	102108803	+	Missense_Mutation	SNP	T	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102108803T>A	uc003uzn.2	+	7	1036	c.898T>A	c.(898-900)TTC>ATC	p.F300I	LRWD1_uc003uzo.2_Missense_Mutation_p.F148I	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain	300					chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GGCCTGTGCCTTCGAGCCGGC	0.672													3	23	---	---	---	---	PASS
CDHR3	222256	broad.mit.edu	37	7	105653367	105653367	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105653367T>C	uc003vdl.3	+	9	1222	c.1114T>C	c.(1114-1116)TTT>CTT	p.F372L	CDHR3_uc003vdk.2_Missense_Mutation_p.F20L|CDHR3_uc011kls.1_RNA|CDHR3_uc003vdm.3_Missense_Mutation_p.F359L|CDHR3_uc011klt.1_Missense_Mutation_p.F284L|CDHR3_uc003vdn.2_Missense_Mutation_p.F89L	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	372	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						CAAGTTCTGCTTTGATGATGA	0.478													7	332	---	---	---	---	PASS
ST7	7982	broad.mit.edu	37	7	116593736	116593736	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116593736T>G	uc003vin.2	+	1	356	c.142T>G	c.(142-144)TTG>GTG	p.L48V	ST7_uc011knl.1_Missense_Mutation_p.L48V|ST7_uc003vio.2_Missense_Mutation_p.L48V|ST7OT1_uc003vim.2_RNA|ST7OT4_uc003vip.1_5'Flank	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b	48						integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CAACGACAACTTGAGCACAGG	0.333													7	173	---	---	---	---	PASS
AGBL3	340351	broad.mit.edu	37	7	134672704	134672704	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134672704A>G	uc011kpw.1	+	2	273	c.20A>G	c.(19-21)AAG>AGG	p.K7R		NM_178563	NP_848658	Q8NEM8	CBPC3_HUMAN	carboxypeptidase 3, cytosolic	7					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0						GATTCAGAAAAGGAAGACTAT	0.313													7	379	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151873651	151873651	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151873651G>A	uc003wla.2	-	38	9106	c.8887C>T	c.(8887-8889)CGT>TGT	p.R2963C	MLL3_uc003wkz.2_Missense_Mutation_p.R2024C|MLL3_uc003wky.2_Missense_Mutation_p.R472C	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2963					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TCCAAAACACGGCCAGGCGGT	0.507			N		medulloblastoma								19	36	---	---	---	---	PASS
LYN	4067	broad.mit.edu	37	8	56922647	56922647	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56922647G>A	uc003xsk.3	+	13	1799	c.1517G>A	c.(1516-1518)GGG>GAG	p.G506E	LYN_uc003xsl.3_Missense_Mutation_p.G485E	NM_002350	NP_002341	P07948	LYN_HUMAN	Yamaguchi sarcoma viral (v-yes-1) oncogene	506					erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)			GCCACGGAAGGGCAATACCAG	0.483													3	41	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101083737	101083737	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101083737A>T	uc003yjb.1	-	6	649	c.454T>A	c.(454-456)TGG>AGG	p.W152R	RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Missense_Mutation_p.W152R|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	152					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GACTTGCTCCATCTTACTTGT	0.378													7	441	---	---	---	---	PASS
EIF3H	8667	broad.mit.edu	37	8	117657101	117657101	+	3'UTR	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117657101G>A	uc003yoa.2	-	8					EIF3H_uc003yob.2_3'UTR	NM_003756	NP_003747	O15372	EIF3H_HUMAN	eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(3)	3	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					ATTATGGCTAGAAAGACACTG	0.328													6	25	---	---	---	---	PASS
MIR1296	100302150	broad.mit.edu	37	10	65132766	65132766	+	RNA	SNP	C	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65132766C>G	hsa-mir-1296|MI0003780	-			c.43C>G			JMJD1C_uc009xpi.2_Intron|JMJD1C_uc001jmn.2_Intron																	0						AGAAGGTTTTCCTAAAGGAGA	0.488													18	59	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134902394	134902394	+	5'UTR	SNP	T	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134902394T>A	uc001llx.3	+	2					GPR123_uc001llw.2_Missense_Mutation_p.F538Y	NM_001083909	NP_001077378	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123							integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CGCTCACGCTTCCGCAACTTT	0.711													3	4	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1093271	1093271	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093271C>G	uc001lsx.1	+	31	12203	c.12176C>G	c.(12175-12177)ACC>AGC	p.T4059S		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4059						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cagaccccaacatcgacaccc	0.015													6	248	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	5152922	5152922	+	IGR	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5152922T>C								OR52A4 (7180 upstream) : OR52A5 (1 downstream)																							TCACTAACGATCAAGTTACTT	0.348													48	135	---	---	---	---	PASS
ARFIP2	23647	broad.mit.edu	37	11	6500511	6500511	+	Intron	SNP	A	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6500511A>C	uc001mdk.2	-						ARFIP2_uc001mdl.2_Intron|ARFIP2_uc010ral.1_Intron|ARFIP2_uc010ram.1_Intron|ARFIP2_uc010ran.1_Silent_p.G91G|ARFIP2_uc001mdm.2_Intron|ARFIP2_uc009yfe.1_3'UTR|FXC1_uc001mdn.3_5'Flank|FXC1_uc001mdo.3_5'Flank	NM_012402	NP_036534	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2						actin cytoskeleton organization|cellular component movement|lamellipodium assembly|ruffle organization|small GTPase mediated signal transduction	cell cortex|plasma membrane|ruffle	GTP binding|GTP-dependent protein binding|Rac GTPase binding				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GTTCTCTGACACCAGCCTCTC	0.537													10	33	---	---	---	---	PASS
MICAL2	9645	broad.mit.edu	37	11	12229545	12229545	+	Intron	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12229545T>C	uc001mjz.2	+						MICAL2_uc010rch.1_Intron|MICAL2_uc001mjy.2_Intron|MICAL2_uc001mka.2_Intron|MICAL2_uc010rci.1_Intron|MICAL2_uc001mkb.2_Intron|MICAL2_uc001mkc.2_Intron|MICAL2_uc001mkd.2_5'UTR	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		GCTGTGACAGTTCCTCTCTCC	0.453													6	241	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18738324	18738324	+	Silent	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18738324G>A	uc009yht.2	-	10	1387	c.1197C>T	c.(1195-1197)TTC>TTT	p.F399F	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	399										ovary(4)|large_intestine(2)|kidney(1)	7						CCTCAGCAGAGAACTCGCCGC	0.542													32	122	---	---	---	---	PASS
MYBPC3	4607	broad.mit.edu	37	11	47364234	47364234	+	Missense_Mutation	SNP	C	T	T	rs35736435	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47364234C>T	uc001nfa.3	-	16	1574	c.1519G>A	c.(1519-1521)GGG>AGG	p.G507R	MYBPC3_uc010rhl.1_RNA	NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	506	Ig-like C2-type 3.				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		TGTCTCTGCCCGTCCTTCTTG	0.627													4	198	---	---	---	---	PASS
SLC15A3	51296	broad.mit.edu	37	11	60709588	60709588	+	Silent	SNP	A	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60709588A>C	uc001nqn.2	-	4	1260	c.1026T>G	c.(1024-1026)CTT>CTG	p.L342L	SLC15A3_uc001nqo.2_Silent_p.L342L	NM_016582	NP_057666	Q8IY34	S15A3_HUMAN	solute carrier family 15, member 3	342					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0						TGTGGAGGTGAAGACCCTGCA	0.577													48	216	---	---	---	---	PASS
NEU3	10825	broad.mit.edu	37	11	74717078	74717078	+	Silent	SNP	A	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74717078A>T	uc001ovw.2	+	3	1083	c.927A>T	c.(925-927)CCA>CCT	p.P309P	NEU3_uc001ovv.2_Silent_p.P299P|NEU3_uc010rrl.1_Silent_p.P200P	NM_006656	NP_006647	A8K327	A8K327_HUMAN	sialidase 3	309										ovary(2)	2						GTGAGCCCCCACATGGTTGCC	0.597													8	30	---	---	---	---	PASS
FEZ1	9638	broad.mit.edu	37	11	125325646	125325646	+	Intron	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125325646A>G	uc001qbx.2	-						FEZ1_uc001qbw.2_Intron|FEZ1_uc010sbc.1_Missense_Mutation_p.S313P	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1						axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		AACGTTGATGAGTCCCCTGCA	0.567													13	27	---	---	---	---	PASS
PARP11	57097	broad.mit.edu	37	12	3921218	3921218	+	3'UTR	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3921218G>A	uc001qmk.1	-	7					PARP11_uc001qml.2_3'UTR|PARP11_uc009zef.2_RNA|PARP11_uc001qmm.2_3'UTR|PARP11_uc001qmn.2_3'UTR	NM_020367	NP_065100	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11								NAD+ ADP-ribosyltransferase activity			ovary(1)|central_nervous_system(1)	2			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TTAGTGGCTAGATGACTGAAG	0.348													10	62	---	---	---	---	PASS
HIST4H4	121504	broad.mit.edu	37	12	14923794	14923794	+	Silent	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14923794C>T	uc001rcf.3	-	1	272	c.225G>A	c.(223-225)GAG>GAA	p.E75E	HIST4H4_uc001rce.2_RNA	NM_175054	NP_778224	P62805	H4_HUMAN	histone cluster 4, H4	75					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						GCTTGGCGTGCTCCGTGTAAG	0.602											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	26	---	---	---	---	PASS
C12orf42	374470	broad.mit.edu	37	12	103762691	103762691	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103762691C>T	uc001tjt.2	-	4	321	c.233G>A	c.(232-234)CGT>CAT	p.R78H	C12orf42_uc001tjs.2_RNA|C12orf42_uc009zuf.1_Missense_Mutation_p.R78H|C12orf42_uc001tju.2_5'UTR	NM_198521	NP_940923	Q96LP6	CL042_HUMAN	hypothetical protein LOC374470	78										ovary(1)|central_nervous_system(1)	2						GTGTAGACTACGAAATTTAGG	0.363													11	297	---	---	---	---	PASS
SNRNP35	11066	broad.mit.edu	37	12	123944363	123944363	+	Intron	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123944363A>G	uc001ufb.1	+						SNRNP35_uc010tar.1_5'UTR|SNRNP35_uc009zxz.2_5'UTR|SNRNP35_uc001ufc.1_Intron	NM_022717	NP_073208	Q16560	U1SBP_HUMAN	small nuclear ribonucleoprotein 35kDa (U11/U12)						mRNA processing	U12-type spliceosomal complex	nucleotide binding|RNA binding				0						aaaaaTCGAAAGAGATTGTTG	0.209													5	189	---	---	---	---	PASS
CHFR	55743	broad.mit.edu	37	12	133454165	133454165	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133454165C>T	uc001ulf.2	-	3	293	c.209G>A	c.(208-210)GGT>GAT	p.G70D	CHFR_uc001ulc.1_RNA|CHFR_uc001ule.2_Missense_Mutation_p.G70D|CHFR_uc010tbs.1_Missense_Mutation_p.G70D|CHFR_uc001uld.2_Missense_Mutation_p.G70D|CHFR_uc010tbt.1_Missense_Mutation_p.G70D	NM_001161344	NP_001154816	Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains	70	FHA.				cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TGTCACCTGACCTGATTTTTC	0.453													75	248	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23910188	23910188	+	Silent	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23910188T>C	uc001uon.2	-	10	8416	c.7827A>G	c.(7825-7827)AAA>AAG	p.K2609K	SACS_uc001uoo.2_Silent_p.K2462K|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	2609					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTTTCGTGCCTTTTCCAAGAT	0.408													5	183	---	---	---	---	PASS
FARP1	10160	broad.mit.edu	37	13	99083480	99083480	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99083480G>T	uc001vnj.2	+	18	2425	c.2089G>T	c.(2089-2091)GAG>TAG	p.E697*	FARP1_uc001vnh.2_Nonsense_Mutation_p.E697*	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	697	DH.				regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GCAGGTCCTGGAGCGGCTGTG	0.622													5	7	---	---	---	---	PASS
OR11G2	390439	broad.mit.edu	37	14	20665558	20665558	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20665558C>T	uc010tlb.1	+	1	64	c.64C>T	c.(64-66)CAT>TAT	p.H22Y		NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTTGCACCGTCATTCAGTAAT	0.363													6	119	---	---	---	---	PASS
PRPF39	55015	broad.mit.edu	37	14	45576662	45576662	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45576662A>G	uc001wvz.3	+	6	916	c.746A>G	c.(745-747)GAA>GGA	p.E249G	PRPF39_uc001wvy.3_Missense_Mutation_p.E128G|PRPF39_uc010and.2_Missense_Mutation_p.E39G|PRPF39_uc001wwa.1_5'Flank	NM_017922	NP_060392	Q86UA1	PRP39_HUMAN	PRP39 pre-mRNA processing factor 39 homolog	249	HAT 4.				mRNA processing|RNA splicing	nucleus	binding			ovary(1)|breast(1)	2						AGATTTAAAGAACATGTACAG	0.294													6	320	---	---	---	---	PASS
SMEK1	55671	broad.mit.edu	37	14	91929165	91929165	+	Silent	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91929165T>C	uc001xzn.2	-	12	2709	c.1887A>G	c.(1885-1887)GAA>GAG	p.E629E	SMEK1_uc001xzm.2_Silent_p.E616E|SMEK1_uc001xzo.2_Silent_p.E616E|SMEK1_uc010atz.2_Silent_p.E390E|SMEK1_uc001xzp.1_RNA	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1	629						microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		AATCTACATCTTCCAGTGCTT	0.294													7	522	---	---	---	---	PASS
SMEK1	55671	broad.mit.edu	37	14	91942053	91942053	+	Intron	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91942053C>A	uc001xzn.2	-						SMEK1_uc001xzm.2_Intron|SMEK1_uc001xzo.2_Intron|SMEK1_uc010atz.2_Intron|SMEK1_uc001xzp.1_Intron|SMEK1_uc001xzq.1_Silent_p.V332V	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		ATTATGGCTACACTTTTCCCA	0.284													6	30	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102493818	102493818	+	Silent	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102493818T>C	uc001yks.2	+	46	9149	c.8985T>C	c.(8983-8985)GAT>GAC	p.D2995D		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2995	AAA 4 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TTATAATGGATGAATCTAATG	0.418													6	141	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106714600	106714600	+	RNA	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106714600G>A	uc010tyt.1	-	645		c.19005C>T								Parts of antibodies, mostly variable regions.												0						GGCTGCACAGGAGAGTCTCAG	0.562													8	31	---	---	---	---	PASS
AVEN	57099	broad.mit.edu	37	15	34158738	34158738	+	3'UTR	SNP	T	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34158738T>G	uc001zhj.2	-	6						NM_020371	NP_065104	Q9NQS1	AVEN_HUMAN	cell death regulator aven						anti-apoptosis|apoptosis	endomembrane system|intracellular|membrane|membrane fraction	protein binding			kidney(1)	1		all_lung(180;1.78e-08)		all cancers(64;1.66e-15)|GBM - Glioblastoma multiforme(113;1.42e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0359)		AACTGGCTGGTCCTGAAGGAC	0.448													15	99	---	---	---	---	PASS
ADAL	161823	broad.mit.edu	37	15	43644189	43644189	+	3'UTR	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43644189T>C	uc010udo.1	+	12					ADAL_uc001zri.1_3'UTR	NM_001159280	NP_001152752	Q6DHV7	ADAL_HUMAN	adenosine deaminase-like isoform 1						adenosine catabolic process|inosine biosynthetic process|purine ribonucleoside monophosphate biosynthetic process		adenosine deaminase activity|metal ion binding				0		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		TCAATCAAGTTCCTGCCATAT	0.353													7	42	---	---	---	---	PASS
SLC24A5	283652	broad.mit.edu	37	15	48428782	48428782	+	Intron	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48428782C>A	uc001zwe.2	+						SLC24A5_uc010bel.2_Intron|uc001zwf.1_RNA	NM_205850	NP_995322	Q71RS6	NCKX5_HUMAN	solute carrier family 24, member 5 precursor						response to stimulus	integral to membrane|melanosome|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity				0		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		TCTATGGCTACTTTTGTTAGA	0.279													8	81	---	---	---	---	PASS
LACTB	114294	broad.mit.edu	37	15	63421946	63421946	+	Intron	SNP	A	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63421946A>C	uc002alw.2	+						LACTB_uc002alv.2_3'UTR	NM_032857	NP_116246	P83111	LACTB_HUMAN	lactamase, beta isoform a							mitochondrion	hydrolase activity				0						TCCAAAATCAACCTGCCACAT	0.323													8	10	---	---	---	---	PASS
NFAT5	10725	broad.mit.edu	37	16	69725994	69725994	+	Missense_Mutation	SNP	T	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69725994T>A	uc002exm.1	+	12	3420	c.2212T>A	c.(2212-2214)TCA>ACA	p.S738T	NFAT5_uc002exi.2_Missense_Mutation_p.S662T|NFAT5_uc002exj.1_Missense_Mutation_p.S662T|NFAT5_uc002exk.1_Missense_Mutation_p.S662T|NFAT5_uc002exl.1_Missense_Mutation_p.S756T|NFAT5_uc002exn.1_Missense_Mutation_p.S755T|NFAT5_uc002exo.1_5'Flank	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c	738					excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						GACTGAGGCATCACAACAACA	0.413													102	278	---	---	---	---	PASS
NFAT5	10725	broad.mit.edu	37	16	69725995	69725995	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69725995C>A	uc002exm.1	+	12	3421	c.2213C>A	c.(2212-2214)TCA>TAA	p.S738*	NFAT5_uc002exi.2_Nonsense_Mutation_p.S662*|NFAT5_uc002exj.1_Nonsense_Mutation_p.S662*|NFAT5_uc002exk.1_Nonsense_Mutation_p.S662*|NFAT5_uc002exl.1_Nonsense_Mutation_p.S756*|NFAT5_uc002exn.1_Nonsense_Mutation_p.S755*|NFAT5_uc002exo.1_5'Flank	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c	738					excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						ACTGAGGCATCACAACAACAG	0.413													101	283	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76555114	76555114	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76555114G>A	uc002feu.1	+	18	2828	c.2443G>A	c.(2443-2445)GCG>ACG	p.A815T	CNTNAP4_uc002fev.1_Missense_Mutation_p.A679T|CNTNAP4_uc010chb.1_Missense_Mutation_p.A742T|CNTNAP4_uc002fex.1_Missense_Mutation_p.A818T	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	815	Extracellular (Potential).|Laminin G-like 3.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						AGAACTTAGCGCGGATGTATC	0.383													19	740	---	---	---	---	PASS
ZC3H18	124245	broad.mit.edu	37	16	88666203	88666203	+	Nonsense_Mutation	SNP	T	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88666203T>G	uc002fky.2	+	6	1135	c.935T>G	c.(934-936)TTA>TGA	p.L312*	ZC3H18_uc010voy.1_Nonsense_Mutation_p.L195*|ZC3H18_uc010voz.1_Nonsense_Mutation_p.L336*	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	312						nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TGGTAGGTTTTAAAAAAAGCA	0.448													5	210	---	---	---	---	PASS
GALNS	2588	broad.mit.edu	37	16	88891256	88891256	+	Silent	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88891256G>A	uc002fly.3	-	11	1250	c.1161C>T	c.(1159-1161)GGC>GGT	p.G387G	GALNS_uc002flx.2_5'Flank|GALNS_uc010cid.2_Silent_p.G393G|GALNS_uc002flz.3_Silent_p.G70G	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	387						lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	TCAGCGTGTCGCCACGGTAAT	0.617													4	101	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10535008	10535008	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10535008T>C	uc002gmq.1	-	35	5283	c.5206A>G	c.(5206-5208)ATG>GTG	p.M1736V		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1736	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						TGGAGCTGCATGAGGTCTGTC	0.572											OREG0024180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	217	---	---	---	---	PASS
MARCH10	162333	broad.mit.edu	37	17	60821788	60821788	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60821788T>C	uc010ddr.2	-	5	722	c.484A>G	c.(484-486)AGC>GGC	p.S162G	MARCH10_uc002jag.3_Missense_Mutation_p.S162G|MARCH10_uc010dds.2_Missense_Mutation_p.S200G|MARCH10_uc002jah.2_Missense_Mutation_p.S161G	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	162							ligase activity|zinc ion binding				0						TTCTGTCTGCTTCTGTCCCCA	0.547													6	192	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21417039	21417039	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21417039G>A	uc002kuq.2	+	25	3165	c.3079G>A	c.(3079-3081)GCC>ACC	p.A1027T	LAMA3_uc002kur.2_Missense_Mutation_p.A1027T	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1027	Domain IV 1 (domain IV B).				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGGACACATGGCCCGATTCCT	0.313													84	123	---	---	---	---	PASS
C19orf46	163183	broad.mit.edu	37	19	36499618	36499618	+	5'UTR	SNP	G	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36499618G>C	uc002ocq.1	-	1					C19orf46_uc002ocr.1_5'UTR|C19orf46_uc002ocs.1_5'UTR|C19orf46_uc010een.1_Intron	NM_001039876	NP_001034965	Q8N205	SYNE4_HUMAN	hypothetical protein LOC163183						establishment of epithelial cell apical/basal polarity	integral to nuclear outer membrane	actin binding			ovary(1)	1	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCAGGTGAGGGCAGCCAGTAA	0.662													6	26	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39205178	39205178	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39205178G>A	uc002oja.1	+	9	948	c.889G>A	c.(889-891)GAC>AAC	p.D297N	ACTN4_uc010egc.1_Missense_Mutation_p.D297N	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	297	Spectrin 1.				platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTGATGGAGGACTACGAGAA	0.587													4	68	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41631168	41631168	+	Intron	SNP	T	G	G	rs150735001	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41631168T>G	uc002opu.1	+						CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_3'UTR|CYP2F1_uc002opv.1_Intron	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						CCCACAAAGGTTGGGGGTTTC	0.537													4	7	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43411260	43411260	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43411260A>G	uc002ovj.1	-	5	1106	c.1054T>C	c.(1054-1056)TCC>CCC	p.S352P	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.S359P|PSG6_uc002ovi.2_Missense_Mutation_p.S353P|PSG6_uc010xwk.1_Missense_Mutation_p.S192P|PSG11_uc002ovk.1_Missense_Mutation_p.S351P|PSG6_uc002ove.1_Missense_Mutation_p.S142P|PSG6_uc002ovf.1_Missense_Mutation_p.S259P|PSG6_uc002ovg.1_Missense_Mutation_p.S352P	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	352	Ig-like C2-type 3.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				GCAAAGCAGGACAAGTCGAGG	0.458													6	309	---	---	---	---	PASS
TEAD2	8463	broad.mit.edu	37	19	49852034	49852034	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49852034G>A	uc002pnj.2	-	8	752	c.661C>T	c.(661-663)CGG>TGG	p.R221W	TEAD2_uc002png.2_Missense_Mutation_p.R224W|TEAD2_uc002pnh.2_Missense_Mutation_p.R225W|TEAD2_uc002pni.2_Missense_Mutation_p.R224W|TEAD2_uc010yao.1_Missense_Mutation_p.R93W|TEAD2_uc010emw.2_Missense_Mutation_p.R224W	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	221	Transcriptional activation (Potential).				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		CCCAGGCCCCGAGCCTGCCAG	0.587													13	25	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51361427	51361427	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51361427T>C	uc002pts.1	+	3	390	c.349T>C	c.(349-351)TCC>CCC	p.S117P	KLK3_uc010ycj.1_Missense_Mutation_p.S117P|KLK3_uc002ptr.1_Missense_Mutation_p.S74P|KLK3_uc010eof.1_RNA	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3	117	Peptidase S1.				negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		AGGTGATGACTCCAGCCACGA	0.597													6	69	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55377325	55377325	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55377325C>T	uc002qhl.3	+	7	1129	c.1066C>T	c.(1066-1068)CTC>TTC	p.L356F	KIR3DL2_uc010esh.2_Missense_Mutation_p.L339F|KIR3DL2_uc002qho.3_Missense_Mutation_p.L356F			P43629	KI3L1_HUMAN	SubName: Full=KIR3DS1;	356	Helical; (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		catcctcctcctcttctttct	0.423													5	639	---	---	---	---	PASS
EBF4	57593	broad.mit.edu	37	20	2686324	2686324	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2686324G>A	uc002wgt.3	+	3	495	c.227G>A	c.(226-228)GGG>GAG	p.G76E	EBF4_uc002wgs.3_RNA	NM_001110514	NP_001103984	Q9BQW3	COE4_HUMAN	early B-cell factor 4	80					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding				0						GACCGGCAGGGGCAGCCCGTG	0.617													5	90	---	---	---	---	PASS
RASSF2	9770	broad.mit.edu	37	20	4776560	4776560	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4776560C>T	uc002wld.2	-	4	242	c.188G>A	c.(187-189)CGC>CAC	p.R63H	RASSF2_uc002wlc.2_5'Flank|RASSF2_uc002wle.2_RNA|RASSF2_uc002wlf.2_Missense_Mutation_p.R63H	NM_170774	NP_739580	P50749	RASF2_HUMAN	Ras association domain family 2	63					cell cycle|signal transduction	nucleus	protein binding			ovary(3)|lung(2)|large_intestine(1)	6						AATGGGCCGGCGCAGGCCCCA	0.597													18	56	---	---	---	---	PASS
GDF5	8200	broad.mit.edu	37	20	34021789	34021789	+	Missense_Mutation	SNP	C	T	T	rs121909347		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34021789C>T	uc002xck.1	-	2	1743	c.1424G>A	c.(1423-1425)AGC>AAC	p.S475N	GDF5_uc010gfc.1_Missense_Mutation_p.S475N|uc002xcj.2_Missense_Mutation_p.A67V|GDF5_uc010zvc.1_Missense_Mutation_p.S475N	NM_000557	NP_000548	P43026	GDF5_HUMAN	growth differentiation factor 5 preproprotein	475			S -> N (in SYNS2).		cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GAAGAGGATGCTGATGGGACT	0.577													25	53	---	---	---	---	PASS
TOP1	7150	broad.mit.edu	37	20	39744972	39744972	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39744972G>A	uc002xjl.2	+	17	2008	c.1762G>A	c.(1762-1764)GTA>ATA	p.V588I	uc002xjn.1_Intron	NM_003286	NP_003277	P11387	TOP1_HUMAN	DNA topoisomerase I	588					DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)	GACAGCCAAGGTATTCCGTAC	0.478			T	NUP98	AML*								38	89	---	---	---	---	PASS
SNX21	90203	broad.mit.edu	37	20	44469233	44469233	+	Intron	SNP	C	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44469233C>A	uc002xpv.1	+						SNX21_uc002xps.1_Intron|SNX21_uc002xpt.1_Intron|SNX21_uc002xpu.1_Intron|SNX21_uc002xpw.1_Intron|SNX21_uc002xpx.2_Intron|SNX21_uc010zxd.1_Intron|SNX21_uc002xpy.1_Intron|SNX21_uc002xpz.1_5'UTR	NM_033421	NP_219489	Q969T3	SNX21_HUMAN	sorting nexin 21 isoform a						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding			breast(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)				AGGGAACGGGCCCGTGGACAA	0.657													10	41	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29121106	29121106	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29121106C>T	uc003adu.1	-	4	523	c.451G>A	c.(451-453)GGT>AGT	p.G151S	CHEK2_uc003ads.1_Intron|CHEK2_uc010gvh.1_Intron|CHEK2_uc010gvi.1_Missense_Mutation_p.G151S|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.G194S|CHEK2_uc003adv.1_Missense_Mutation_p.G151S|CHEK2_uc003adw.1_Missense_Mutation_p.G151S|CHEK2_uc003adx.1_5'UTR|CHEK2_uc003ady.1_Missense_Mutation_p.G151S|CHEK2_uc003adz.1_Intron	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	151	FHA.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						TTTTTAGGACCCACTTCCTAA	0.363			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				7	274	---	---	---	---	PASS
RBX1	9978	broad.mit.edu	37	22	41368620	41368620	+	3'UTR	SNP	G	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41368620G>T	uc003azk.2	+	5						NM_014248	NP_055063	P62877	RBX1_HUMAN	ring-box 1						DNA repair|interspecies interaction between organisms|protein neddylation|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	Cul3-RING ubiquitin ligase complex|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytosol|nucleus|SCF ubiquitin ligase complex	NEDD8 ligase activity|protein binding|zinc ion binding			skin(1)	1						TGCTGTTTCTGTAGCCATATT	0.348													23	222	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41742095	41742095	+	Silent	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41742095G>A	uc003azw.2	+	14	1764	c.1548G>A	c.(1546-1548)CGG>CGA	p.R516R	ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	532					interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						CCGAGGAGCGGAAGGGCACCC	0.597													10	37	---	---	---	---	PASS
PACSIN2	11252	broad.mit.edu	37	22	43287181	43287181	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43287181C>G	uc010gzg.2	-	4	447	c.225G>C	c.(223-225)CAG>CAC	p.Q75H	PACSIN2_uc003bdg.3_Missense_Mutation_p.Q75H|PACSIN2_uc003bde.3_Missense_Mutation_p.Q75H|PACSIN2_uc003bdf.3_Missense_Mutation_p.Q75H	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in	75	FCH.				actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				CGGTCCCGTACTGGGGCCCTG	0.617													8	22	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45790578	45790578	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45790578T>C	uc003bgc.2	-	8	1376	c.1324A>G	c.(1324-1326)ACA>GCA	p.T442A	SMC1B_uc003bgd.2_Missense_Mutation_p.T442A|SMC1B_uc003bge.1_Missense_Mutation_p.T225A	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	442	Potential.				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CATGTCTTTGTATACTCCTCT	0.194													7	756	---	---	---	---	PASS
MID1	4281	broad.mit.edu	37	X	10450652	10450652	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10450652T>C	uc004cte.3	-	5	1072	c.881A>G	c.(880-882)AAA>AGA	p.K294R	MID1_uc004ctd.3_Missense_Mutation_p.K5R|MID1_uc004ctg.3_Missense_Mutation_p.K294R|MID1_uc004cth.3_Missense_Mutation_p.K256R|MID1_uc004ctk.3_Missense_Mutation_p.K294R|MID1_uc004cti.3_Missense_Mutation_p.K294R|MID1_uc004ctj.3_Missense_Mutation_p.K294R|MID1_uc011mie.1_RNA|MID1_uc004ctm.1_Missense_Mutation_p.K345R|MID1_uc004ctn.1_Missense_Mutation_p.K294R|MID1_uc004cto.1_Missense_Mutation_p.K256R|MID1_uc010ndw.1_Missense_Mutation_p.K5R|MID1_uc004cts.1_Missense_Mutation_p.K61R|MID1_uc004ctt.2_Missense_Mutation_p.K345R|MID1_uc004ctu.2_Missense_Mutation_p.K294R|MID1_uc004ctv.2_Missense_Mutation_p.K307R|MID1_uc004ctw.2_Missense_Mutation_p.K256R|MID1_uc010ndy.1_Missense_Mutation_p.K258R|MID1_uc004ctc.3_Missense_Mutation_p.K61R|MID1_uc004ctp.1_Intron|MID1_uc004ctq.1_Missense_Mutation_p.K61R|MID1_uc004ctr.1_Missense_Mutation_p.K61R|MID1_uc010ndu.1_Missense_Mutation_p.K61R|MID1_uc010ndv.1_Missense_Mutation_p.K5R|MID1_uc010ndx.1_RNA	NM_033290	NP_150632	O15344	TRI18_HUMAN	midline 1	294					microtubule cytoskeleton organization|pattern specification process|positive regulation of stress-activated MAPK cascade	cytoplasm|microtubule|microtubule associated complex|spindle	ligase activity|ubiquitin protein ligase binding|zinc ion binding			ovary(2)|pancreas(1)	3						CTGAGCCAGTTTGCGAAGCCT	0.483													4	82	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50556989	50556989	+	Silent	SNP	G	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50556989G>A	uc004dpe.2	-	1	56	c.30C>T	c.(28-30)TAC>TAT	p.Y10Y	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	10	PDZ.				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GCACAGGGACGTACTGGAAGG	0.662													8	7	---	---	---	---	PASS
DIAPH2	1730	broad.mit.edu	37	X	96328034	96328034	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96328034G>T	uc004efu.3	+	18	2541	c.2145G>T	c.(2143-2145)CAG>CAT	p.Q715H	DIAPH2_uc004eft.3_Missense_Mutation_p.Q715H	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	715	FH2.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						AAACAGCTCAGAATCTGTGTA	0.363													7	221	---	---	---	---	PASS
UTY	7404	broad.mit.edu	37	Y	15417383	15417383	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15417383G>T	uc004fsx.1	-	22	4175	c.3170C>A	c.(3169-3171)GCG>GAG	p.A1057E	UTY_uc004fsw.1_Missense_Mutation_p.A720E|UTY_uc010nwx.1_Missense_Mutation_p.A114E|UTY_uc004fsy.2_Missense_Mutation_p.A1057E	NM_007125	NP_009056	O14607	UTY_HUMAN	tetratricopeptide repeat protein isoform 3	1057	JmjC.				chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CACCACACGCGCAAAAGCAGG	0.418													6	112	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13701	13701	+	RNA	SNP	A	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13701A>G	uc004cox.3	+	1		c.1365A>G			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		AACCCCATTAAACGCCTGGCA	0.468													45	8	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3410185	3410186	+	Intron	INS	-	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3410185_3410186insC	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GCTGACTCCAGCCCCCCCAGGG	0.649													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4584611	4584612	+	IGR	INS	-	CT	CT	rs142390347	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4584611_4584612insCT								LOC284661 (99867 upstream) : AJAP1 (130493 downstream)																							CCACCCTCACAGTCAACATTCT	0.426													4	2	---	---	---	---	
ACOT7	11332	broad.mit.edu	37	1	6343060	6343060	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6343060delC	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		TTGGGAGTCACAGGCCAAAAA	0.552													4	2	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7622260	7622260	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7622260delT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTCCGGCCCCTCCCAAATCTG	0.527													4	2	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8616316	8616316	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8616316delA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTAAATTATCAAAAAAAAAAA	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	9002656	9002656	+	IGR	DEL	G	-	-	rs35444012		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9002656delG								ENO1 (63876 upstream) : CA6 (3266 downstream)																							GGGCCTTGTCGGGGGGGCAGT	0.537													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	12604808	12604808	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12604808delA								VPS13D (32712 upstream) : DHRS3 (23132 downstream)																							atccactatcaaaaaaacttt	0.000													4	2	---	---	---	---	
FBXO42	54455	broad.mit.edu	37	1	16607968	16607968	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16607968delT	uc001ayg.2	-						FBXO42_uc001ayf.2_Intron	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42											upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		tctttttttgttttttttttt	0.169													4	2	---	---	---	---	
NECAP2	55707	broad.mit.edu	37	1	16770024	16770024	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16770024delT	uc001ayo.2	+						NECAP2_uc001ayp.3_Intron|NECAP2_uc010ocd.1_Intron|NECAP2_uc001ayq.2_Intron	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		acagaaaatgtttgccaactc	0.234													17	9	---	---	---	---	
ARHGEF10L	55160	broad.mit.edu	37	1	17893870	17893870	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17893870delT	uc001ban.2	+						ARHGEF10L_uc009vpe.1_Intron	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		TTGAGCAGAAttttttttttg	0.249													4	2	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21475324	21475324	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21475324delA	uc001bef.2	-						EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		tcaaaaaaagaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26704843	26704843	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26704843delT								ZNF683 (5577 upstream) : LIN28A (32426 downstream)																							CCCATATCCATTGCCACCTCC	0.532													4	2	---	---	---	---	
RSPO1	284654	broad.mit.edu	37	1	38078196	38078197	+	3'UTR	INS	-	TA	TA	rs10437321		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38078196_38078197insTA	uc001cbl.1	-	8					RSPO1_uc001cbm.1_3'UTR|RSPO1_uc009vvf.1_3'UTR|RSPO1_uc009vvg.1_3'UTR	NM_001038633	NP_001033722	Q2MKA7	RSPO1_HUMAN	R-spondin1 precursor						positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				gtgtgtgtatgtgtgtgtgtgg	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	40485524	40485524	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40485524delT								MFSD2A (49897 upstream) : CAP1 (20731 downstream)																							CACAGTACTATTTTTTTTTTA	0.274													4	2	---	---	---	---	
PPT1	5538	broad.mit.edu	37	1	40539203	40539204	+	3'UTR	INS	-	TGAT	TGAT	rs146273528	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40539203_40539204insTGAT	uc001cfb.2	-	9					PPT1_uc010ojf.1_3'UTR|PPT1_uc010ojg.1_3'UTR|PPT1_uc009vwa.2_RNA	NM_000310	NP_000301	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1 isoform 1						brain development|cofactor metabolic process|cofactor transport|DNA fragmentation involved in apoptotic nuclear change|lysosomal lumen acidification|membrane raft organization|negative regulation of cell growth|negative regulation of neuron apoptosis|neuron development|pinocytosis|positive regulation of pinocytosis|positive regulation of receptor-mediated endocytosis|protein depalmitoylation|protein transport|receptor-mediated endocytosis|regulation of synapse structure and activity|sphingolipid catabolic process|visual perception	axon|cytosol|Golgi apparatus|lysosome|membrane fraction|membrane raft|nucleus|synaptic vesicle	palmitoyl-(protein) hydrolase activity|palmitoyl-CoA hydrolase activity			ovary(1)	1	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGATGATAAGATGATAGCACAG	0.436													4	2	---	---	---	---	
ZNF684	127396	broad.mit.edu	37	1	40999378	40999378	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40999378delA	uc001cft.1	+							NM_152373	NP_689586	Q5T5D7	ZN684_HUMAN	zinc finger protein 684						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			ATCCATAAGTAaatcttgtac	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41404776	41404777	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41404776_41404777insT								CITED4 (76758 upstream) : CTPS (40230 downstream)																							TTTTCTATTAAtttttttttga	0.144													4	2	---	---	---	---	
ST3GAL3	6487	broad.mit.edu	37	1	44329384	44329384	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44329384delC	uc001ckc.2	+						ST3GAL3_uc009vwu.1_Intron|ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270	Q11203	SIAT6_HUMAN	sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				TCCTGGGAGACCCCACAGAGG	0.567													4	2	---	---	---	---	
ZSWIM5	57643	broad.mit.edu	37	1	45592814	45592817	+	Intron	DEL	ATAT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45592814_45592817delATAT	uc001cnd.2	-							NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					gaagtcaacgatatataaaaagaa	0.000													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57685983	57685983	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57685983delA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						GCTCTGAGCTAAAATCATTCA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	60451483	60451483	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60451483delC								CYP2J2 (59060 upstream) : C1orf87 (3341 downstream)																							TTCTCTTTGGCCACAAGGGAG	0.224													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62207654	62207656	+	5'Flank	DEL	AAT	-	-	rs71810079		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62207654_62207656delAAT	uc001dab.2	+						INADL_uc009waf.1_5'Flank|INADL_uc001daa.2_5'Flank	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						ATGAGAAGAAAATAATGACTCCC	0.374													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	64878266	64878267	+	IGR	DEL	CT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64878266_64878267delCT								UBE2U (168239 upstream) : CACHD1 (58209 downstream)																							ctacttcatgctctctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	65571244	65571245	+	IGR	INS	-	A	A	rs80322965		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65571244_65571245insA								MIR101-1 (47053 upstream) : AK3L1 (41987 downstream)																							TCCTTTAATTGAAAAAACTTGT	0.332													4	2	---	---	---	---	
SGIP1	84251	broad.mit.edu	37	1	67198420	67198420	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67198420delT	uc001dcr.2	+						SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Intron|SGIP1_uc001dcu.2_Intron	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting						positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						ATTTTCTCTCTTTTTTTTTTA	0.209													4	2	---	---	---	---	
GNG12	55970	broad.mit.edu	37	1	68279381	68279382	+	Intron	INS	-	C	C	rs145893306	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68279381_68279382insC	uc001dea.1	-							NM_018841	NP_061329	Q9UBI6	GBG12_HUMAN	G-protein gamma-12 subunit precursor						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0						AATAAAAAAAAATGAACCTCAA	0.317													0	6	---	---	---	---	
HHLA3	11147	broad.mit.edu	37	1	70829373	70829373	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70829373delA	uc001dfa.2	+						HHLA3_uc010oqp.1_Intron|HHLA3_uc001dfb.2_Intron|HHLA3_uc001dfc.2_Intron	NM_001036645	NP_001031722	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3 isoform 2								protein binding				0						GCAGAGCTCTAAAATGGAACT	0.219													4	2	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	76016256	76016256	+	Intron	DEL	A	-	-	rs111371849		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76016256delA	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						ttaccttaataaaaaaaaaag	0.000													4	3	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	76656982	76656982	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76656982delA	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						cgtggattctaaaaaaaaaaa	0.090													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	82618696	82618696	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82618696delA								LPHN2 (160590 upstream) : None (None downstream)																							AGAGAAAGAGAAAAAAAAAAT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	82952681	82952682	+	IGR	INS	-	GA	GA	rs143703968	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82952681_82952682insGA								LPHN2 (494575 upstream) : None (None downstream)																							TAAGAGAAGGGGGGGGGAAAGT	0.347													1	5	---	---	---	---	
DNASE2B	58511	broad.mit.edu	37	1	84880011	84880011	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84880011delA	uc001djt.1	+						DNASE2B_uc001dju.1_Intron|DNASE2B_uc009wch.1_Intron	NM_021233	NP_067056	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta isoform 1 precursor						DNA metabolic process	lysosome	deoxyribonuclease II activity				0				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		CATAGTaatgatgataataac	0.204								Direct_reversal_of_damage					3	5	---	---	---	---	
LPAR3	23566	broad.mit.edu	37	1	85316422	85316422	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85316422delC	uc001dkl.2	-						LPAR3_uc009wcj.1_Intron	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3						G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						TACCACAGATCCCCCCGGCTC	0.517													4	2	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	85982555	85982555	+	Intron	DEL	C	-	-	rs2183332		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85982555delC	uc001dlc.2	-							NM_001134445	NP_001127917	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	TTAGTTTTTTCTGGTTAAAAA	0.159													4	2	---	---	---	---	
FAM102B	284611	broad.mit.edu	37	1	109167054	109167055	+	Intron	INS	-	A	A	rs34112326		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109167054_109167055insA	uc010ouy.1	+							NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611											large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		CTTGTTATGTTAAAAAAAAAAA	0.356													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116041604	116041604	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116041604delC								NGF (160747 upstream) : VANGL1 (142970 downstream)																							CCCAAAATATCCTTGCTCAAT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116478906	116478906	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116478906delA								NHLH2 (95159 upstream) : SLC22A15 (40213 downstream)																							CAACACTCCTAAACACAATTC	0.338													4	2	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120560007	120560008	+	Intron	INS	-	A	A	rs138352700	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120560007_120560008insA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		cctctgttcttataaccctgag	0.035			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143423347	143423348	+	IGR	INS	-	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143423347_143423348insG								None (None upstream) : LOC100286793 (224291 downstream)																							gcagagaaaaagggaccttctt	0.000													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145058924	145058924	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145058924delC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TTTGGAGGCACCTGCTCACTC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148873688	148873689	+	5'Flank	INS	-	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148873688_148873689insG	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																		TTAAAAATCAATATACATTTTT	0.262													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149689669	149689670	+	IGR	DEL	CC	-	-	rs146375699		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149689669_149689670delCC								HIST2H2BF (290440 upstream) : FCGR1A (64580 downstream)																							tttaaaatagccacacacacac	0.000													4	2	---	---	---	---	
OTUD7B	56957	broad.mit.edu	37	1	149922309	149922309	+	Intron	DEL	T	-	-	rs111618537		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149922309delT	uc001etn.2	-							NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TCTACCTCCGTTTTCACAGAT	0.393													4	3	---	---	---	---	
SLC25A44	9673	broad.mit.edu	37	1	156179712	156179712	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156179712delT	uc001fnp.2	+						SLC25A44_uc010phc.1_Intron|SLC25A44_uc009wrr.2_Intron|SLC25A44_uc010phd.1_Intron|SLC25A44_uc010phe.1_Intron	NM_014655	NP_055470	Q96H78	S2544_HUMAN	solute carrier family 25, member 44						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1	Hepatocellular(266;0.158)					tttatgaatattttttttttc	0.055													4	3	---	---	---	---	
IQGAP3	128239	broad.mit.edu	37	1	156532119	156532120	+	Intron	INS	-	C	C	rs138515696	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156532119_156532120insC	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGTCCAACTGCCCCCCCGGCA	0.569													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157391253	157391254	+	IGR	INS	-	T	T	rs112247473		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157391253_157391254insT								ETV3 (282870 upstream) : FCRL5 (91914 downstream)																							attggtataacttttttTTTTT	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159413567	159413567	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159413567delT	uc001fts.3	-											Homo sapiens, clone IMAGE:3917623, mRNA.																		TCCCCAAGGCTTTTCCAAGAG	0.448													4	2	---	---	---	---	
ATF6	22926	broad.mit.edu	37	1	161770802	161770802	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161770802delT	uc001gbr.2	+						ATF6_uc001gbq.1_Intron	NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			ttcattgtcattattatagat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165350585	165350586	+	IGR	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165350585_165350586delAC								LMX1A (25110 upstream) : RXRG (19765 downstream)																							acatacacatacacacacacac	0.188													4	2	---	---	---	---	
DCAF6	55827	broad.mit.edu	37	1	168014595	168014598	+	Intron	DEL	AAAG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168014595_168014598delAAAG	uc001gew.2	+						DCAF6_uc001gev.2_Intron|DCAF6_uc001gex.2_Intron|DCAF6_uc010plk.1_Intron|DCAF6_uc001gey.2_Intron|DCAF6_uc001gez.2_Intron	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b						positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ATATAAACTTAAAGAAACTTTACA	0.304													4	3	---	---	---	---	
C1orf112	55732	broad.mit.edu	37	1	169732397	169732400	+	Intron	DEL	TCTT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169732397_169732400delTCTT	uc001ggj.2	+									Q9NSG2	CA112_HUMAN	Homo sapiens cDNA FLJ10706 fis, clone NT2RP3000852.												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GACCGGCATCTCTTTCTCATATGT	0.446													4	2	---	---	---	---	
C1orf112	55732	broad.mit.edu	37	1	169756890	169756890	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169756890delT	uc001ggj.2	+									Q9NSG2	CA112_HUMAN	Homo sapiens cDNA FLJ10706 fis, clone NT2RP3000852.												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTTTATTCCATTTTGCCATGC	0.289													4	2	---	---	---	---	
SLC9A11	284525	broad.mit.edu	37	1	173478583	173478584	+	Intron	INS	-	A	A	rs35439430		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173478583_173478584insA	uc001giz.2	-						SLC9A11_uc009wwe.2_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11						sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						gcctctgtctcaaaaaaaaaaa	0.079													4	2	---	---	---	---	
PAPPA2	60676	broad.mit.edu	37	1	176577829	176577829	+	Intron	DEL	T	-	-	rs12122085	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176577829delT	uc001gkz.2	+						PAPPA2_uc001gky.1_Intron|PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ttgtaagccctttttttattc	0.000													4	2	---	---	---	---	
PAPPA2	60676	broad.mit.edu	37	1	176741561	176741561	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176741561delA	uc001gkz.2	+						PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						AAAGGGACAGAAAAAAATATC	0.408													4	2	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	185992421	185992421	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185992421delT	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAACCTAGGGTTTTTTTTTTT	0.269													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	191049526	191049526	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191049526delA								FAM5C (602767 upstream) : None (None downstream)																							AAAGAGTAGCAAAAAAACAAA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	192167073	192167073	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192167073delA								RGS18 (12130 upstream) : RGS21 (119049 downstream)																							GCAAAATAAgaaaaaaatact	0.209													4	2	---	---	---	---	
DENND1B	163486	broad.mit.edu	37	1	197688015	197688016	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197688015_197688016insA	uc001guf.3	-						DENND1B_uc010ppe.1_Intron|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Intron	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						attggcaagggaagccactgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203927290	203927290	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203927290delA								SNRPE (87012 upstream) : C1orf157 (74285 downstream)																							caacatggtgaaacctcgtct	0.000													4	2	---	---	---	---	
TMCC2	9911	broad.mit.edu	37	1	205206164	205206164	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205206164delT	uc001hbz.1	+						TMCC2_uc010prf.1_Intron	NM_014858	NP_055673	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2							integral to membrane	protein binding			pancreas(1)	1	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			ATGAGTTGAGTTTTTTTTTTA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209222453	209222453	+	IGR	DEL	T	-	-	rs67437582		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209222453delT								PLXNA2 (804788 upstream) : LOC642587 (379715 downstream)																							gTCATAGTCATTATAGACACA	0.249													1	5	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	211277969	211277970	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211277969_211277970insA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CAGAGGAGGGGGAAAAAAACAT	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213119213	213119213	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213119213delT								FLVCR1 (49016 upstream) : VASH2 (4674 downstream)																							ttacccaaaattttaccatta	0.095													4	2	---	---	---	---	
BPNT1	10380	broad.mit.edu	37	1	220234875	220234876	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220234875_220234876insA	uc001hma.2	-						BPNT1_uc010pug.1_Intron|BPNT1_uc010puh.1_Intron|BPNT1_uc001hmb.3_Intron	NM_006085	NP_006076	O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|nervous system development|xenobiotic metabolic process	cytosol	3'(2'),5'-bisphosphate nucleotidase activity			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0558)		gactccgtctcaaaaaaaaaaa	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222221900	222221900	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222221900delT								DUSP10 (306439 upstream) : HHIPL2 (473702 downstream)																							GTGAAGGTTATTTTTTTTTTC	0.338													4	2	---	---	---	---	
CDC42BPA	8476	broad.mit.edu	37	1	227504442	227504442	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227504442delT	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				TTAAAATCTCTTACTGTTGAC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230024661	230024661	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230024661delG								URB2 (228715 upstream) : GALNT2 (168875 downstream)																							ctatgggtctgggctccctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	233818950	233818950	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233818950delT								KCNK1 (10692 upstream) : SLC35F3 (221729 downstream)																							AGAAAAACAATTTTTTTTTGG	0.343													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237955699	237955700	+	Intron	DEL	GT	-	-	rs112375793		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237955699_237955700delGT	uc001hyl.1	+						RYR2_uc010pyb.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			gtgtgtgtgcgtgtgtgtgtgt	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	238652783	238652783	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238652783delG								LOC339535 (3466 upstream) : CHRM3 (897082 downstream)																							GTATGTGTTTGGGGCAGGGTA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240196388	240196389	+	IGR	INS	-	A	A	rs144004028	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240196388_240196389insA								CHRM3 (123673 upstream) : FMN2 (58796 downstream)																							aaggaatccttaaaatcaaata	0.000													4	3	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240286806	240286806	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240286806delA	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GTTTGTACACaaaaaaaaaaa	0.343													6	3	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241190525	241190526	+	Intron	INS	-	A	A	rs146896003		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241190525_241190526insA	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			aagaaaagaagaaaaaaaaaaA	0.035													4	2	---	---	---	---	
EXO1	9156	broad.mit.edu	37	1	242023590	242023591	+	Intron	INS	-	T	T	rs147466857	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242023590_242023591insT	uc001hzh.2	+						EXO1_uc001hzi.2_Intron|EXO1_uc001hzj.2_Intron|EXO1_uc009xgq.2_Intron	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b						meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			ATATAACTGTATTTTTTTATCC	0.277								Direct_reversal_of_damage|Editing_and_processing_nucleases					7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	3766013	3766013	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3766013delT								ALLC (15755 upstream) : None (None downstream)																							TCTCCTTATATTTTTTAGCAG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8543988	8543988	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8543988delT								LOC339788 (427011 upstream) : ID2 (275352 downstream)																							AGGGACTGCATTTTTTTTTTC	0.478													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10623600	10623601	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10623600_10623601insT								ODC1 (35147 upstream) : NOL10 (87293 downstream)																							TGGGAGTGGTATTTTTTTTTCT	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12916749	12916752	+	IGR	DEL	TTGT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12916749_12916752delTTGT								TRIB2 (33893 upstream) : None (None downstream)																							AGGACTATGCttgtttgttttagg	0.230													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	15973814	15973814	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15973814delA								DDX1 (202590 upstream) : MYCNOS (106206 downstream)																							gggactagcTAAAGTTGATTG	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18024547	18024547	+	IGR	DEL	G	-	-	rs67542262		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18024547delG								MSGN1 (26181 upstream) : KCNS3 (34567 downstream)																							AGAAAGGGATGGGAAACTCTG	0.423													3	4	---	---	---	---	
KCNS3	3790	broad.mit.edu	37	2	18057008	18057008	+	5'Flank	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18057008delA	uc002rcv.2	+						KCNS3_uc002rcw.2_5'Flank	NM_002252	NP_002243	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel						energy reserve metabolic process|regulation of insulin secretion	Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTAGCTGAGGAGGCACTGCTG	0.478													4	2	---	---	---	---	
DNMT3A	1788	broad.mit.edu	37	2	25489233	25489233	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25489233delC	uc002rgc.2	-						DNMT3A_uc002rgd.2_Intron|DNMT3A_uc010eyi.2_Intron	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAACTGCTTCCCATACAGTT	0.259			Mis|F|N|S		AML								4	2	---	---	---	---	
ALK	238	broad.mit.edu	37	2	30004818	30004818	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30004818delC	uc002rmy.2	-							NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	GCTTCAAAAGCCCAGGAGTCA	0.458			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				4	2	---	---	---	---	
TMEM178	130733	broad.mit.edu	37	2	39890274	39890274	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39890274delT	uc002rrt.2	+						TMEM178_uc010fam.1_5'Flank	NM_152390	NP_689603	Q8NBL3	TM178_HUMAN	transmembrane protein 178 precursor							integral to membrane					0		all_hematologic(82;0.248)				ttctcttttatttttttacta	0.000													4	2	---	---	---	---	
PKDCC	91461	broad.mit.edu	37	2	42272743	42272744	+	5'Flank	INS	-	TG	TG			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42272743_42272744insTG	uc002rsg.2	+							NM_138370	NP_612379	Q504Y2	PKDCC_HUMAN	protein kinase-like protein SgK493						cell differentiation|embryonic digestive tract development|lung alveolus development|negative regulation of Golgi to plasma membrane protein transport|ossification|palate development|positive regulation of bone mineralization|positive regulation of chondrocyte differentiation|protein transport	Golgi apparatus	ATP binding|protein kinase activity			breast(1)	1						CTCCGTGGACCTGTGTGTGTTG	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	46466407	46466407	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46466407delG								PRKCE (51279 upstream) : EPAS1 (58156 downstream)																							tggtggtgatgatggtgatga	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	49665846	49665846	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49665846delT								FSHR (284216 upstream) : NRXN1 (479798 downstream)																							gaattcactatttttttttct	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52800116	52800116	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52800116delC								None (None upstream) : None (None downstream)																							CTATCTGCCACCCCCAGCCCG	0.597													4	2	---	---	---	---	
SMEK2	57223	broad.mit.edu	37	2	55795739	55795741	+	Intron	DEL	AAC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55795739_55795741delAAC	uc002rzc.2	-						SMEK2_uc002rzb.2_Intron|SMEK2_uc002rzd.2_Intron|SMEK2_uc002ryz.2_Intron|SMEK2_uc002rza.2_Intron	NM_001122964	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 isoform 1							microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			agccagaacTaacaacaacaaca	0.187													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58624371	58624372	+	IGR	INS	-	T	T	rs113120735		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58624371_58624372insT								FANCL (155856 upstream) : None (None downstream)																							TGTTTCTCTAATTTTTTTTTTC	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60224523	60224523	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60224523delA								None (None upstream) : BCL11A (453780 downstream)																							GCGATGTAGTAAATTCAAATT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60536671	60536671	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60536671delA								None (None upstream) : BCL11A (141632 downstream)																							TCAAGGAAGGAAAAAAAAAAA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73524770	73524770	+	IGR	DEL	T	-	-	rs77845457		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73524770delT								EGR4 (3941 upstream) : ALMS1 (88116 downstream)																							ccactccCTCTTTTTTTTTTC	0.264													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	77840588	77840588	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77840588delA								LRRTM4 (91086 upstream) : SNAR-H (341445 downstream)																							gggattatgtaaaaaaaaaac	0.000													3	3	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79828630	79828631	+	Intron	DEL	GA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79828630_79828631delGA	uc010yse.1	+						CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						tccatagcctgagagagagagt	0.074													4	2	---	---	---	---	
TCF7L1	83439	broad.mit.edu	37	2	85489011	85489011	+	Intron	DEL	G	-	-	rs2366264	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85489011delG	uc002soy.2	+							NM_031283	NP_112573	Q9HCS4	TF7L1_HUMAN	HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3						CTCTTTTTTTGTTGTAAGACA	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85619857	85619857	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85619857delG								ELMOD3 (984 upstream) : CAPG (2014 downstream)																							CCTCCAGTCTGGTCCTCAGCT	0.527													4	2	---	---	---	---	
KCNIP3	30818	broad.mit.edu	37	2	96015245	96015245	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96015245delC	uc002sup.2	+						KCNIP3_uc002suq.2_Intron	NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1						apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)		TGCCCTGGGTCCCCCATCAGT	0.517													4	2	---	---	---	---	
TBC1D8	11138	broad.mit.edu	37	2	101742225	101742225	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101742225delA	uc010fiv.2	-						TBC1D8_uc010yvw.1_Intron	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8						blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						TGTATTGTTTAAAAACCATTA	0.393													4	2	---	---	---	---	
LOC150568	150568	broad.mit.edu	37	2	105128744	105128744	+	RNA	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105128744delA	uc002tch.2	+	4		c.1034delA				NR_015399				Homo sapiens cDNA FLJ30528 fis, clone BRAWH2001037.												0						TTTGgaaaagaaaaaaaaaag	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106311647	106311647	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106311647delT								FHL2 (256417 upstream) : NCK2 (49707 downstream)																							gtttttggggtttttttttga	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106840882	106840882	+	IGR	DEL	C	-	-	rs7572904		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106840882delC								UXS1 (30087 upstream) : PLGLA (161887 downstream)																							ggctatatctctttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108157387	108157387	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108157387delT								ST6GAL2 (653824 upstream) : LOC729121 (282133 downstream)																							cttgacctccttccaattcct	0.000													4	2	---	---	---	---	
ACOXL	55289	broad.mit.edu	37	2	111866417	111866417	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111866417delT	uc010yxk.1	+						uc002tgs.1_Intron	NM_001142807	NP_001136279	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 1						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						tctaactttattataagagct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114320683	114320684	+	5'Flank	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114320683_114320684insT	uc002tjy.1	+											DQ598479																		AACTGGATTGATTTTTTTTTTT	0.401													8	5	---	---	---	---	
DPP10	57628	broad.mit.edu	37	2	115273386	115273386	+	Intron	DEL	T	-	-	rs68185254		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115273386delT	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						CATATCAACCTTTTTTTTTTT	0.269													4	2	---	---	---	---	
PCDP1	200373	broad.mit.edu	37	2	120321289	120321289	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120321289delA	uc002tmb.2	+						PCDP1_uc010yyq.1_Intron	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1							cilium	calmodulin binding				0	Colorectal(110;0.196)					actcatgGTGAAAAGAAGACT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121824670	121824670	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121824670delG								GLI2 (74442 upstream) : TFCP2L1 (149496 downstream)																							ATGTCTTGTTGGCTAGCAGGA	0.468													4	2	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125465053	125465053	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125465053delA	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTATCTAAATAAATCCAGAGT	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127012646	127012646	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127012646delA								None (None upstream) : GYPC (401038 downstream)																							tcactactttaaaaaaaaaag	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127511209	127511209	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127511209delC								GYPC (56964 upstream) : BIN1 (294398 downstream)																							GAACCAGGCTCCATAACGCCC	0.572													4	2	---	---	---	---	
HS6ST1	9394	broad.mit.edu	37	2	129023184	129023185	+	3'UTR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129023184_129023185insT	uc002tpt.3	-	2						NM_004807	NP_004798	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1						heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity			pancreas(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		TTCTTCAACACTTTTTTTTAAG	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132226066	132226066	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132226066delC								LOC401010 (23599 upstream) : TUBA3D (7600 downstream)																							aatcgatcagcccacctcagc	0.060													4	2	---	---	---	---	
MBD5	55777	broad.mit.edu	37	2	149118936	149118936	+	Intron	DEL	A	-	-	rs71832379		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149118936delA	uc002twm.3	+							NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		caaacaaaacaaaaaaaaaaa	0.164													4	2	---	---	---	---	
EPC2	26122	broad.mit.edu	37	2	149542802	149542803	+	Intron	DEL	AG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149542802_149542803delAG	uc010zbt.1	+							NM_015630	NP_056445	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)		gagtagtagtagagagagagag	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	158191121	158191121	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158191121delT								ERMN (6975 upstream) : CYTIP (80010 downstream)																							CAACATGTTGTTTTTCAGAGG	0.398													4	2	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	159954483	159954483	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159954483delT	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						Gaaataaatcttttttttttt	0.284													11	5	---	---	---	---	
PSMD14	10213	broad.mit.edu	37	2	162203488	162203488	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162203488delT	uc002ubu.2	+							NM_005805	NP_005796	O00487	PSDE_HUMAN	proteasome 26S subunit, non-ATPase 14						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity			breast(1)	1						tttgcagctattttttctgtg	0.000													4	2	---	---	---	---	
STK39	27347	broad.mit.edu	37	2	169038780	169038780	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169038780delA	uc002uea.2	-							NM_013233	NP_037365	Q9UEW8	STK39_HUMAN	serine threonine kinase 39 (STE20/SPS1 homolog,						response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2						TCTGGAGGAGAAAAAAAAAAC	0.343													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	173065160	173065160	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173065160delC								DLX2 (97682 upstream) : ITGA6 (226922 downstream)																							ATTTACCCATCCCTTCTTCAT	0.289													4	2	---	---	---	---	
ATF2	1386	broad.mit.edu	37	2	175972073	175972073	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175972073delG	uc002ujl.2	-						ATF2_uc010fqv.2_Intron|ATF2_uc002ujv.2_Intron|ATF2_uc002ujm.2_Intron|ATF2_uc002ujn.2_Intron|ATF2_uc002ujo.2_Intron|ATF2_uc002ujp.2_Intron|ATF2_uc002ujq.2_Intron|ATF2_uc002ujr.2_Intron|ATF2_uc010fqu.2_Intron|ATF2_uc002ujs.2_Intron|ATF2_uc002ujt.2_Intron|ATF2_uc002uju.2_Intron|ATF2_uc002ujw.1_Intron|ATF2_uc002ujx.1_Intron	NM_001880	NP_001871	P15336	ATF2_HUMAN	activating transcription factor 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(1)|breast(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.125)			gtaaacctttgggtaaaggtt	0.000													4	2	---	---	---	---	
PTH2R	5746	broad.mit.edu	37	2	209272476	209272476	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209272476delT	uc002vdb.2	+						PTH2R_uc010zjb.1_Intron	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		TCATACGCACTTTTTTTTTTG	0.403													4	2	---	---	---	---	
PTH2R	5746	broad.mit.edu	37	2	209464924	209464924	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209464924delT	uc010fuo.1	+									P49190	PTH2R_HUMAN	Homo sapiens cDNA FLJ60238 complete cds, highly similar to Parathyroid hormone receptor precursor.							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		cctggaaacatttttttccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	211832786	211832786	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211832786delT								CPS1 (288957 upstream) : ERBB4 (407656 downstream)																							TGTCTATGGCTTTTTTTTCCC	0.348													4	2	---	---	---	---	
WDFY1	57590	broad.mit.edu	37	2	224749909	224749909	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224749909delG	uc002vnq.2	-							NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1							cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		AATTGTGTGTGGGGGGGGGTC	0.144													4	2	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225847516	225847517	+	Intron	DEL	TT	-	-	rs144909470		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225847516_225847517delTT	uc010fwz.1	-						DOCK10_uc002vod.1_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GTGAAAATGATTTTTTTTTTTA	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229715826	229715826	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229715826delA								SPHKAP (669465 upstream) : PID1 (172864 downstream)																							taatcaggttaaaatgaggcc	0.000													4	2	---	---	---	---	
ARMC9	80210	broad.mit.edu	37	2	232164170	232164171	+	Intron	DEL	AG	-	-	rs78705326	byFrequency	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232164170_232164171delAG	uc002vrq.3	+						ARMC9_uc002vrp.3_Intron|ARMC9_uc002vrr.1_Intron	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9								binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		AGGCTCCtcaagagagagaagt	0.233													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236964513	236964514	+	Intron	DEL	GG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236964513_236964514delGG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						CTTCATGACTGGATGGTCCTCA	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	3509353	3509353	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3509353delT								CRBN (287963 upstream) : SUMF1 (313683 downstream)																							ACACTGGCACTTTTTTGTGGT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	8011503	8011504	+	Intron	DEL	TC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8011503_8011504delTC	uc003bqo.1	-											Homo sapiens cDNA FLJ42867 fis, clone BRHIP2021289.																		caacactgtttctctctctctc	0.030													4	2	---	---	---	---	
CIDEC	63924	broad.mit.edu	37	3	9996961	9996961	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9996961delA	uc003bto.2	-						PRRT3_uc003bul.2_5'Flank|PRRT3_uc003buk.2_5'Flank|PRRT3_uc003bum.2_5'Flank			Q96AQ7	CIDEC_HUMAN	Homo sapiens unknown mRNA.						apoptosis|induction of apoptosis	cytosol|focal adhesion|nucleus				central_nervous_system(1)	1	Medulloblastoma(99;0.227)					TCGCGTTTCTAAACCACCAAC	0.552													4	2	---	---	---	---	
FGD5	152273	broad.mit.edu	37	3	14871508	14871508	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14871508delG	uc003bzc.2	+						FGD5_uc011avk.1_Intron	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						AATGCTCGGTGGGAATGTGAC	0.458													4	2	---	---	---	---	
RFTN1	23180	broad.mit.edu	37	3	16365613	16365613	+	Intron	DEL	T	-	-	rs9815339	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16365613delT	uc003cay.2	-						RFTN1_uc010hes.2_Intron|OXNAD1_uc003cax.2_Intron|OXNAD1_uc011awb.1_Intron	NM_015150	NP_055965	Q14699	RFTN1_HUMAN	raft-linking protein							plasma membrane				ovary(3)|central_nervous_system(1)	4						AAGATCACTGTTTTTTTTTTC	0.294													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	34889393	34889394	+	IGR	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34889393_34889394insA								PDCD6IP (978199 upstream) : ARPP21 (791687 downstream)																							CAGGATGATATAAAAAAAAAAT	0.248													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54437225	54437225	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54437225delA	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		tgcaaaaaataaaaaaaagta	0.000													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54731402	54731402	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54731402delC	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		ttaacaagcacccaaggtgac	0.199													4	2	---	---	---	---	
ERC2	26059	broad.mit.edu	37	3	55724359	55724359	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55724359delA	uc003dhr.1	-						ERC2_uc003dhq.1_Intron	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TCAGTTATAGAAAAAAAGAGA	0.458													4	2	---	---	---	---	
CNTN3	5067	broad.mit.edu	37	3	74453048	74453048	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74453048delT	uc003dpm.1	-							NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor						cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTTTTTTTTATTTTTTTGAAT	0.378													4	2	---	---	---	---	
ABI3BP	25890	broad.mit.edu	37	3	100700088	100700088	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100700088delA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003dup.3_Intron	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						CTTTTGCCTTAAAAAAAAAAA	0.388													8	4	---	---	---	---	
CD47	961	broad.mit.edu	37	3	107769566	107769566	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107769566delA	uc003dwt.1	-						CD47_uc003dwu.1_Intron|CD47_uc003dwv.1_Intron|CD47_uc003dww.1_Intron	NM_001777	NP_001768	Q08722	CD47_HUMAN	CD47 antigen isoform 1 precursor						blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			TCCTACAGTCAAAAAAAAAAG	0.229													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	108841090	108841090	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108841090delC								MORC1 (4097 upstream) : C3orf66 (55922 downstream)																							tttgttgtctccagttaccta	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110492080	110492081	+	IGR	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110492080_110492081insA								None (None upstream) : PVRL3 (298784 downstream)																							TAAGCAAAGATAAAAAAAATCA	0.292													4	2	---	---	---	---	
LSAMP	4045	broad.mit.edu	37	3	116163562	116163563	+	Intron	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116163562_116163563delAC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron|LSAMP_uc010hqq.1_RNA	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TAAAACAGGGacacacacacac	0.317													6	4	---	---	---	---	
COL6A4P2	646300	broad.mit.edu	37	3	129938755	129938756	+	Intron	DEL	AG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129938755_129938756delAG	uc011blf.1	+							NR_027898				Homo sapiens collagen VI alpha 4 pseudogene 2 (COL6A4P2), non-coding RNA.												0						cagttaaggaagagagaggggg	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	144578475	144578475	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144578475delT								C3orf58 (867266 upstream) : None (None downstream)																							TAGACACAAATTTTTTTTAAA	0.403													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155456060	155456060	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155456060delC								PLCH1 (34063 upstream) : C3orf33 (24341 downstream)																							GCATTTTCTTCTAGCCTGGAG	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172123727	172123727	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172123727delT								FNDC3B (5237 upstream) : GHSR (39224 downstream)																							TGCACATACATTTTTTTTTTC	0.383													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174020646	174020646	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174020646delG								NLGN1 (19530 upstream) : NAALADL2 (556465 downstream)																							aaaaaaaaaaGGCCATCAGTT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	176405345	176405346	+	IGR	DEL	CT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176405345_176405346delCT								NAALADL2 (881919 upstream) : TBL1XR1 (333197 downstream)																							CCATCACACACTCTCTCTCAGG	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177422949	177422949	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177422949delT								TBL1XR1 (507901 upstream) : KCNMB2 (831275 downstream)																							CTAGGTTGCATTTTTTTTTCC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177635412	177635412	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177635412delA								TBL1XR1 (720364 upstream) : KCNMB2 (618812 downstream)																							gcacccactcagatcatggag	0.000													4	2	---	---	---	---	
C3orf65	646600	broad.mit.edu	37	3	185435215	185435215	+	3'UTR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185435215delA	uc003fpr.2	+	2					IGF2BP2_uc010hyi.2_Intron|IGF2BP2_uc010hyj.2_Intron|IGF2BP2_uc010hyk.2_Intron|IGF2BP2_uc010hyl.2_Intron|IGF2BP2_uc003fpo.2_Intron|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Intron|C3orf65_uc003fps.3_Intron	NR_027317				RecName: Full=Putative uncharacterized protein C3orf65;												0	all_cancers(143;1.5e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CTGTCCAAGCAAAAAAAAACC	0.433													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188198918	188198918	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188198918delT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		tctcttaaacttttagtctga	0.000			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
CLDN1	9076	broad.mit.edu	37	3	190040681	190040681	+	5'Flank	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190040681delC	uc003fsh.2	-							NM_021101	NP_066924	O95832	CLD1_HUMAN	claudin 1						calcium-independent cell-cell adhesion|interspecies interaction between organisms	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity			lung(1)	1	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		CCCCTTCTTTCCTCTCTCTGC	0.483											OREG0015986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190565562	190565562	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190565562delA								IL1RAP (189719 upstream) : LOC647309 (4964 downstream)																							taatggggggaagggTTAGGA	0.204													4	2	---	---	---	---	
ATP13A5	344905	broad.mit.edu	37	3	193039761	193039762	+	Intron	DEL	TG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193039761_193039762delTG	uc011bsq.1	-							NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		ACATTGATTTTGTGTGTGTGTG	0.337													5	4	---	---	---	---	
WHSC1	7468	broad.mit.edu	37	4	1964105	1964105	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1964105delG	uc003gdz.3	+						WHSC1_uc003geb.3_Intron|WHSC1_uc003gec.3_Intron|WHSC1_uc003ged.3_Intron|WHSC1_uc003gee.3_Intron|WHSC1_uc003gef.3_Intron|WHSC1_uc003gei.3_Intron|WHSC1_uc011bvh.1_Intron|WHSC1_uc010icf.2_Intron	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		tgggggcagtgggaaaaattt	0.000			T	IGH@	MM								4	2	---	---	---	---	
ADD1	118	broad.mit.edu	37	4	2896576	2896576	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2896576delA	uc003gfr.2	+						ADD1_uc003gfn.2_Intron|ADD1_uc010ico.1_Intron|ADD1_uc003gfo.2_Intron|ADD1_uc003gfp.2_Intron|ADD1_uc003gfq.2_Intron|ADD1_uc003gfs.2_Intron|ADD1_uc003gft.3_Intron|ADD1_uc003gfu.2_Intron	NM_001119	NP_001110	P35611	ADDA_HUMAN	adducin 1 (alpha) isoform a						actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGTTGAATATAAAAAAAAAGG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3917767	3917767	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3917767delT								ADRA2C (147516 upstream) : LOC348926 (25903 downstream)																							ATGGGGCTACTTTTTTTTGGA	0.443													4	2	---	---	---	---	
STX18	53407	broad.mit.edu	37	4	4421575	4421576	+	3'UTR	INS	-	G	G	rs138817667	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4421575_4421576insG	uc003gic.2	-	11						NM_016930	NP_058626	Q9P2W9	STX18_HUMAN	syntaxin 18						ER to Golgi vesicle-mediated transport|intracellular protein transport	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	SNAP receptor activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)		AGCTGCTAAATGGCTGAACACC	0.500													4	5	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7367976	7367977	+	Intron	DEL	CT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7367976_7367977delCT	uc003gkb.3	+							NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ccttcccttcctCTCTCTCTCT	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13526279	13526279	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13526279delA								RAB28 (40290 upstream) : NKX3-2 (16175 downstream)																							cacgagtttcaaattcagggt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	19052232	19052232	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19052232delT								None (None upstream) : None (None downstream)																							attatctctattttactgatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28480300	28480300	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28480300delA								None (None upstream) : None (None downstream)																							GCCCGAAAGGAAAAAAAAATA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29646376	29646376	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29646376delA								None (None upstream) : None (None downstream)																							TTCTACCCTCAAAAAAAAATG	0.204													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	34473646	34473646	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34473646delA								None (None upstream) : None (None downstream)																							GAACATTTGCAAAAGGAATAG	0.343													4	2	---	---	---	---	
CEP135	9662	broad.mit.edu	37	4	56821422	56821422	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56821422delA	uc003hbi.2	+						CEP135_uc003hbh.1_Intron|CEP135_uc010igz.1_Intron	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4						centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					AGGCTAGGTCAAGACAGATTA	0.378													4	2	---	---	---	---	
IGFBP7	3490	broad.mit.edu	37	4	57914959	57914959	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57914959delA	uc003hcn.2	-						IGFBP7_uc011cag.1_Intron	NM_001553	NP_001544	Q16270	IBP7_HUMAN	insulin-like growth factor binding protein 7						cell adhesion|negative regulation of cell proliferation|regulation of cell growth	extracellular space	insulin-like growth factor binding			lung(2)|central_nervous_system(1)	3	Glioma(25;0.08)|all_neural(26;0.181)				Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GTTACTATTTAAAAAAAAGAG	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	58042389	58042389	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58042389delA	uc003hco.2	+											Homo sapiens, clone IMAGE:5722917, mRNA.																		TGAGAACTTTAAAAAATTGTG	0.328													4	2	---	---	---	---	
LOC550112	550112	broad.mit.edu	37	4	68653863	68653863	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68653863delA	uc003hdl.3	+											Homo sapiens chromosome 4 cDNA.												0						TCTCTCTCTCAAAAAAAAAAA	0.169													4	2	---	---	---	---	
STBD1	8987	broad.mit.edu	37	4	77226227	77226228	+	5'Flank	DEL	GA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77226227_77226228delGA	uc003hka.2	+						STBD1_uc003hjy.2_Intron|STBD1_uc011cbv.1_Intron|STBD1_uc011cbw.1_Intron	NM_003943	NP_003934	O95210	STBD1_HUMAN	starch binding domain 1						carbohydrate metabolic process|muscle contraction	integral to plasma membrane|membrane fraction	carbohydrate binding|catalytic activity|protein binding			ovary(1)	1			Lung(101;0.196)			taaaggggatgagagagagagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	85199599	85199602	+	Intron	DEL	ATTC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85199599_85199602delATTC	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																		CAGTTCACATattcattcattcat	0.265													4	2	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96105673	96105674	+	Intron	INS	-	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96105673_96105674insC	uc003htp.1	-							NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CATGTGATTTTCCCCCAGGTAT	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	98243542	98243542	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98243542delC								None (None upstream) : C4orf37 (236492 downstream)																							aactccacctccAGATTACAT	0.104													4	2	---	---	---	---	
TSPAN5	10098	broad.mit.edu	37	4	99566367	99566368	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99566367_99566368insA	uc003hub.2	-						TSPAN5_uc011cdz.1_Intron	NM_005723	NP_005714	P62079	TSN5_HUMAN	transmembrane 4 superfamily member 9							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		tccattataacaaaagaaaaga	0.000													4	2	---	---	---	---	
GSTCD	79807	broad.mit.edu	37	4	106638369	106638369	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106638369delT	uc003hxz.3	+						GSTCD_uc003hxx.2_Intron|GSTCD_uc003hxy.3_Intron|GSTCD_uc011cfb.1_Intron|GSTCD_uc010ils.1_Intron	NM_001031720	NP_001026890	Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain							cytoplasm	rRNA methyltransferase activity			breast(1)|central_nervous_system(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		ACCAGCACTGTCAAAACTTCT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	108265763	108265763	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108265763delA								DKK2 (60917 upstream) : PAPSS1 (269060 downstream)																							gccagtttagaaaacactgac	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112611812	112611812	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112611812delG								MIR297 (830009 upstream) : C4orf32 (454741 downstream)																							ggaacgcagtggatggagagc	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	122435648	122435648	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122435648delT								QRFPR (133467 upstream) : ANXA5 (153505 downstream)																							ctgaggacccttaaataagct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	127654613	127654613	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127654613delA								None (None upstream) : INTU (899507 downstream)																							GTGAGAACTCAAATTAAGCTG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	130034927	130034928	+	IGR	INS	-	AA	AA	rs145683372	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130034927_130034928insAA								C4orf33 (1085 upstream) : None (None downstream)																							TTTGCCACAGGAAAAAAAACAT	0.342													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	130960990	130960991	+	IGR	DEL	TC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130960990_130960991delTC								C4orf33 (927148 upstream) : None (None downstream)																							tctctgtatgtctctctcaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	147113568	147113568	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147113568delC								LSM6 (2356 upstream) : SLC10A7 (61569 downstream)																							CCTTGCTGTTCCCCACAGCCC	0.463													4	3	---	---	---	---	
NR3C2	4306	broad.mit.edu	37	4	149328197	149328197	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149328197delA	uc003ilj.3	-						NR3C2_uc003ilk.3_Intron|NR3C2_uc010iph.2_Intron	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	gcactgcgctaaatgtatctg	0.090													4	2	---	---	---	---	
KIAA0922	23240	broad.mit.edu	37	4	154463551	154463552	+	Intron	INS	-	GTT	GTT	rs141082901	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154463551_154463552insGTT	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				GCAAGGGCCACGTTGCAGAGAG	0.480													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	159645987	159645987	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159645987delA								PPID (1435 upstream) : FNIP2 (44195 downstream)																							GTTAAAAAAGAAAAAAAAAAA	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	170802762	170802762	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170802762delT								C4orf27 (123669 upstream) : MFAP3L (104988 downstream)																							gcctgaggactttatgaaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	171104836	171104837	+	IGR	INS	-	TG	TG	rs149279397	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171104836_171104837insTG								AADAT (93464 upstream) : None (None downstream)																							TGAGACTAgtatgtgtgtgtgt	0.307													4	2	---	---	---	---	
GPM6A	2823	broad.mit.edu	37	4	176755796	176755796	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176755796delA	uc003iug.2	-						GPM6A_uc003iuh.2_Intron	NM_005277	NP_005268	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 1							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CCAAGAATTTAAAAAAAAAAC	0.328													4	2	---	---	---	---	
ODZ3	55714	broad.mit.edu	37	4	183522021	183522022	+	Intron	INS	-	AT	AT	rs141344153	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183522021_183522022insAT	uc003ivd.1	+							NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		TGTGTATATACATATATATATA	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	183934269	183934269	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183934269delG								DCTD (95639 upstream) : FAM92A3 (24549 downstream)																							GCCCCCACAAGCCCCTGTCCT	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	188156473	188156473	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188156473delA								FAT1 (508623 upstream) : ZFP42 (760452 downstream)																							GCTTGTTGTTAAAAAAAAACC	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189745021	189745022	+	IGR	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189745021_189745022delAC								TRIML1 (676372 upstream) : None (None downstream)																							atacacagggacacacacacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190004214	190004214	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190004214delA								TRIML1 (935565 upstream) : FRG1 (857760 downstream)																							AAGCCACTACAAATACCATTT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190527298	190527298	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190527298delG								None (None upstream) : FRG1 (334676 downstream)																							caaggcttctggccctggctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190626764	190626764	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190626764delT								None (None upstream) : FRG1 (235210 downstream)																							TACTGTGGTGTTTTGGAGGCT	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	859964	859964	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:859964delG								ZDHHC11 (8863 upstream) : BRD9 (3887 downstream)																							CGTGTCGGTTGGGGGGGGTCC	0.607													4	2	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1103774	1103775	+	Intron	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1103774_1103775delAC	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	atacacgtgtacacacacacat	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3389855	3389855	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3389855delG								C5orf38 (634343 upstream) : IRX1 (206313 downstream)																							GCTCCCAAGTGGGAATGCAGT	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4303311	4303311	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4303311delA								IRX1 (701795 upstream) : LOC340094 (731161 downstream)																							TTCAACATTTAAAAAAAAACA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6132295	6132296	+	IGR	INS	-	A	A	rs149847820	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6132295_6132296insA								KIAA0947 (641958 upstream) : FLJ33360 (178258 downstream)																							AGAAATGATGGAAAAAAAAATA	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6393260	6393261	+	IGR	DEL	CT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6393260_6393261delCT								MED10 (14621 upstream) : UBE2QL1 (55475 downstream)																							ttccccctccctctctctctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8242466	8242466	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8242466delT								MTRR (341233 upstream) : SEMA5A (792672 downstream)																							GGTTTTTGTCTTTTTTTTTGA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26788017	26788017	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26788017delT								None (None upstream) : CDH9 (92692 downstream)																							TCACAGGGGATTTAGAGATTA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30053162	30053163	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30053162_30053163insT								None (None upstream) : None (None downstream)																							TGCTGCTGTTGTTTTTTTTCGC	0.233													4	2	---	---	---	---	
CDH6	1004	broad.mit.edu	37	5	31216790	31216791	+	Intron	INS	-	A	A	rs145972555		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31216790_31216791insA	uc003jhe.1	+						CDH6_uc003jhc.1_Intron|CDH6_uc003jhd.1_Intron	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						GCCCTGCCACCAAAAAAAAAAA	0.074													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34303405	34303405	+	IGR	DEL	A	-	-	rs71924911		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34303405delA								C1QTNF3 (260088 upstream) : RAI14 (353028 downstream)																							TTAAGGAAAGAAAAAAAAAAC	0.318													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35820673	35820673	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35820673delC								SPEF2 (5961 upstream) : IL7R (36318 downstream)																							ACTTCTATCTCCCCAGTGGAC	0.458													4	2	---	---	---	---	
OSMR	9180	broad.mit.edu	37	5	38868843	38868843	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38868843delT	uc003jln.1	+						OSMR_uc003jlm.1_Intron	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor						cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					ataaatgctcttttcatgtca	0.000													2	4	---	---	---	---	
GHR	2690	broad.mit.edu	37	5	42632500	42632500	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42632500delG	uc003jmt.2	+						GHR_uc011cpq.1_Intron	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CAGTAGCTCTGGAGAGACACA	0.443													4	2	---	---	---	---	
CCDC152	100129792	broad.mit.edu	37	5	42800579	42800579	+	3'UTR	DEL	A	-	-	rs71793261		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42800579delA	uc003jmx.3	+	9					CCDC152_uc011cpr.1_3'UTR|SEPP1_uc011cps.1_RNA|SEPP1_uc011cpt.1_RNA|SEPP1_uc011cpu.1_RNA|SEPP1_uc011cpv.1_RNA|SEPP1_uc003jna.2_RNA	NM_001134848	NP_001128320	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152												0						CTGGAAAAAGAAAAAAAAAGA	0.303													4	2	---	---	---	---	
C5orf34	375444	broad.mit.edu	37	5	43494273	43494273	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43494273delA	uc003jnz.1	-							NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444											breast(1)	1	Lung NSC(6;2.07e-05)					AAAGAAGTATAAAAATTTTAA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	52839013	52839013	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52839013delT								FST (57111 upstream) : NDUFS4 (17452 downstream)																							tctctctCTGTTTTTTTTTTT	0.159													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	58176087	58176087	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58176087delC								RAB3C (28682 upstream) : PDE4D (88779 downstream)																							TTACAACTGGCCACTGCCTCC	0.473													4	2	---	---	---	---	
OCLN	4950	broad.mit.edu	37	5	68804795	68804795	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68804795delT	uc003jwu.2	+						OCLN_uc003jwv.3_Intron	NM_002538	NP_002529			occludin												0		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		gcagaatgggttgtggctaga	0.050													4	2	---	---	---	---	
POLK	51426	broad.mit.edu	37	5	74839252	74839252	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74839252delG	uc003kdw.2	+						POLK_uc003kdx.2_Intron|POLK_uc003kdy.2_Intron|POLK_uc003kdz.2_Intron	NM_016218	NP_057302	Q9UBT6	POLK_HUMAN	DNA-directed DNA polymerase kappa						DNA replication|nucleotide-excision repair, DNA gap filling	nucleus	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|kidney(2)	4		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		gtttggatgtgggtgtatgag	0.045								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	2	---	---	---	---	
LHFPL2	10184	broad.mit.edu	37	5	77903369	77903369	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77903369delT	uc003kfo.2	-							NM_005779	NP_005770	Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2							integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		CCTAAATGTCTTTTTTGTGCA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78447974	78447974	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78447974delC								BHMT (19862 upstream) : JMY (83980 downstream)																							ctactccttgccagcagttcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78857768	78857768	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78857768delT								HOMER1 (48068 upstream) : PAPD4 (50475 downstream)																							AGCCTTTCCCTTTTTTTTTGG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78898967	78898967	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78898967delT								HOMER1 (89267 upstream) : PAPD4 (9276 downstream)																							tcaGTACTGCTTTCTTTCTTA	0.249													4	2	---	---	---	---	
TMEM167A	153339	broad.mit.edu	37	5	82372898	82372898	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82372898delT	uc003khx.3	-						XRCC4_uc003kia.1_5'Flank|XRCC4_uc003kib.2_5'Flank|XRCC4_uc003kid.2_5'Flank|XRCC4_uc003kic.2_5'Flank|XRCC4_uc003kie.2_5'Flank	NM_174909	NP_777569	Q8TBQ9	KISHA_HUMAN	transmembrane protein 167A precursor							Golgi membrane|integral to membrane					0						CACCAACGCATTTTTTTTTCC	0.478													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	88297271	88297271	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88297271delA								MEF2C (97402 upstream) : None (None downstream)																							TTACATTTCTAATAAAGCTGA	0.363													4	2	---	---	---	---	
TTC37	9652	broad.mit.edu	37	5	94873252	94873252	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94873252delT	uc003klb.2	-						TTC37_uc010jbf.1_Intron	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37								binding			ovary(3)|pancreas(1)	4						atcttcaacctttaaaaagca	0.000													4	2	---	---	---	---	
CAST	831	broad.mit.edu	37	5	96057355	96057355	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96057355delG	uc003klz.1	+						CAST_uc003klt.2_Intron|CAST_uc003klu.2_Intron|CAST_uc003klv.2_Intron|CAST_uc003klw.2_Intron|CAST_uc003klx.2_Intron|CAST_uc003kly.2_Intron|CAST_uc011cuo.1_Intron|CAST_uc011cup.1_Intron|CAST_uc011cuq.1_Intron|CAST_uc011cur.1_Intron|CAST_uc011cus.1_Intron|CAST_uc003kma.1_Intron|CAST_uc011cut.1_Intron|CAST_uc003kmb.2_Intron|CAST_uc003kmc.2_Intron|CAST_uc003kmd.2_Intron|CAST_uc003kme.2_Intron|CAST_uc003kmf.2_Intron	NM_001042443	NP_001035908	P20810	ICAL_HUMAN	calpastatin isoform i								calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding			central_nervous_system(3)|ovary(1)|kidney(1)	5		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		TGGAATCCCTGGGTTCTAAAA	0.413													4	2	---	---	---	---	
NUDT12	83594	broad.mit.edu	37	5	102901452	102901452	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102901452delT	uc003koi.2	-						NUDT12_uc011cvb.1_5'Flank|NUDT12_uc010jbq.1_5'Flank	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12							nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		caccaaagagttagccaagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103151723	103151727	+	IGR	DEL	TTTTC	-	-	rs72117681		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103151723_103151727delTTTTC								NUDT12 (253233 upstream) : None (None downstream)																							aatcctgtcGttttcttttcttttc	0.005													2	4	---	---	---	---	
FBXL17	64839	broad.mit.edu	37	5	107690239	107690240	+	Intron	INS	-	AG	AG			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107690239_107690240insAG	uc011cvc.1	-						FBXL17_uc003kon.3_Intron	NM_001163315	NP_001156787	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		ataccaagaaaagagagagaga	0.000													4	2	---	---	---	---	
PJA2	9867	broad.mit.edu	37	5	108746835	108746835	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108746835delT	uc003kos.3	-							NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		CTGAGACTAATTTTTTTTTGC	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	112956046	112956047	+	IGR	DEL	CT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112956046_112956047delCT								YTHDC2 (25067 upstream) : KCNN2 (741969 downstream)																							ctgttgcttcctctctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	119290103	119290104	+	IGR	DEL	TG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119290103_119290104delTG								FAM170A (318587 upstream) : PRR16 (509915 downstream)																							Agtgtgtgtttgtgtgtgtgtg	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	125963880	125963881	+	IGR	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125963880_125963881insA								PHAX (2800 upstream) : C5orf48 (3533 downstream)																							TGACATTGGCTAGGGCCTTTGC	0.510													4	4	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130995270	130995270	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130995270delC	uc003kvp.1	-						FNIP1_uc003kvs.1_Intron|FNIP1_uc003kvt.1_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TCCCGGCCAGCCACGTCCAGA	0.572													4	2	---	---	---	---	
SAR1B	51128	broad.mit.edu	37	5	133970142	133970142	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133970142delT	uc003kzq.2	-						SAR1B_uc003kzr.2_5'Flank	NM_001033503	NP_001028675	Q9Y6B6	SAR1B_HUMAN	SAR1a gene homolog 2						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi cisterna membrane	GTP binding|GTPase activity|metal ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATAGTCAGCAttttttttttt	0.035													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134740981	134740981	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134740981delA								H2AFY (5404 upstream) : C5orf20 (38924 downstream)																							gatctcatttaaacttcgtta	0.000													4	2	---	---	---	---	
SPOCK1	6695	broad.mit.edu	37	5	136659410	136659410	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136659410delA	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			catgtatgggaaaaaaaatac	0.000													4	2	---	---	---	---	
PURA	5813	broad.mit.edu	37	5	139494774	139494775	+	3'UTR	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139494774_139494775delAC	uc003lfa.2	+	1						NM_005859	NP_005850	Q00577	PURA_HUMAN	purine-rich element binding protein A						DNA unwinding involved in replication|DNA-dependent DNA replication initiation	DNA replication factor A complex	double-stranded telomeric DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|single-stranded DNA binding|transcription factor binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			acacatgcatacacacacacac	0.243													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141887755	141887755	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141887755delC								SPRY4 (183135 upstream) : FGF1 (83989 downstream)																							TGGCTCTCAACCCCCCACATC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	151941456	151941456	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151941456delA								NMUR2 (156616 upstream) : GRIA1 (927719 downstream)																							gctggtgatTAACAGGCTCTT	0.264													4	2	---	---	---	---	
UBLCP1	134510	broad.mit.edu	37	5	158697815	158697815	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158697815delA	uc003lxq.2	+							NM_145049	NP_659486	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase							nucleus	phosphoprotein phosphatase activity			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			acagataagcaaaaaaaaaag	0.119													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159206229	159206231	+	IGR	DEL	AAA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159206229_159206231delAAA								LOC285627 (312945 upstream) : ADRA1B (137509 downstream)																							actccatctcaaaaaaaaaaaga	0.113													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161800815	161800815	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161800815delT								GABRG2 (218271 upstream) : None (None downstream)																							TTTGAATCCATTCTCTAGGGA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163674835	163674836	+	IGR	DEL	TG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163674835_163674836delTG								MAT2B (728502 upstream) : None (None downstream)																							actttgcagatgaggagaccat	0.149													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166758936	166758936	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166758936delA	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		AAAATGCAGTAAAAAAATCAA	0.343													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166838887	166838888	+	Intron	INS	-	TGAA	TGAA	rs76679123		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166838887_166838888insTGAA	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TTTGTGTTGACTGACTGCTGAT	0.312													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167431523	167431524	+	Intron	DEL	CA	-	-	rs4976567		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167431523_167431524delCA	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CGCGCGCGCGcacacacacaca	0.446													4	2	---	---	---	---	
WWC1	23286	broad.mit.edu	37	5	167845758	167845758	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167845758delG	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron|WWC1_uc003lzw.2_Intron	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		AGGTAAAAATGGTGAGCGCCA	0.483													4	2	---	---	---	---	
STC2	8614	broad.mit.edu	37	5	172743119	172743119	+	3'UTR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172743119delT	uc003mco.1	-	4					STC2_uc003mcn.1_3'UTR	NM_003714	NP_003705	O76061	STC2_HUMAN	stanniocalcin 2 precursor						cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ATGCATATGCTTTTTGACCCA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173981599	173981600	+	IGR	INS	-	GAT	GAT	rs146099964	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173981599_173981600insGAT								HMP19 (445418 upstream) : MSX2 (169975 downstream)																							CCCACCAGACAGATGAGAGAGT	0.356													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174824116	174824116	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174824116delA								MSX2 (666215 upstream) : DRD1 (43560 downstream)																							TTCTGGTGGGAAAAAAAAGTG	0.498													4	2	---	---	---	---	
TSPAN17	26262	broad.mit.edu	37	5	176082910	176082912	+	Intron	DEL	AAC	-	-	rs6897431	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176082910_176082912delAAC	uc003met.2	+						TSPAN17_uc003mes.3_Intron|TSPAN17_uc003meu.2_Intron|TSPAN17_uc003mev.2_Intron|TSPAN17_uc003mew.2_Intron	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a							integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			tcaaaaaaaaaacaaaaGCACAT	0.281													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177362810	177362812	+	IGR	DEL	CCT	-	-	rs113173559		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177362810_177362812delCCT								LOC728554 (51543 upstream) : PROP1 (56424 downstream)																							taccttctgacctccttgaccag	0.000													3	3	---	---	---	---	
AACSL	729522	broad.mit.edu	37	5	178192987	178192987	+	RNA	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178192987delA	uc011dgk.1	-	7		c.1050delT			AACSL_uc011dgl.1_RNA|AACSL_uc003mjk.2_RNA	NR_024035				Homo sapiens acetoacetyl-CoA synthetase-like, mRNA (cDNA clone IMAGE:3945810), partial cds.												0						TGGGAACAATAAATCTAGCAG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2384331	2384331	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2384331delA								GMDS (138485 upstream) : C6orf195 (238641 downstream)																							AGGTGAAGTTAAAAAAAAAAA	0.308													3	4	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5338325	5338326	+	Intron	DEL	AG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5338325_5338326delAG	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	ATATTGAGAAAGAGAAACATAG	0.243													3	3	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5617761	5617761	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5617761delT	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	aaaaacctggttttttagctc	0.020													4	2	---	---	---	---	
FARS2	10667	broad.mit.edu	37	6	5766196	5766196	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5766196delA	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	CAAAATCTTTAAAAAAAATCA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	5848121	5848121	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5848121delC								FARS2 (76305 upstream) : NRN1 (150114 downstream)																							CCCTCACCAGCCAGACTTTCC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8579877	8579878	+	Intron	INS	-	G	G	rs148267701	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8579877_8579878insG	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																		CTAGACAATTTGGAACAAGGCG	0.465													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14670875	14670875	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14670875delT								CD83 (533729 upstream) : JARID2 (574859 downstream)																							ATCATTAGGATTTTTTTTTAC	0.433													4	2	---	---	---	---	
JARID2	3720	broad.mit.edu	37	6	15421127	15421127	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15421127delG	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron|JARID2_uc011diw.1_Intron	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				cactattcctggtgcttttac	0.000													4	2	---	---	---	---	
NUP153	9972	broad.mit.edu	37	6	17702281	17702281	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17702281delG	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GTTTGCCCATGGACTCAAGTT	0.493													4	2	---	---	---	---	
FLJ22536	401237	broad.mit.edu	37	6	21988123	21988123	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21988123delG	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0						tcaattgtgtggacagagatc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	23803476	23803476	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23803476delA								None (None upstream) : NRSN1 (322938 downstream)																							GAGATGAAATAATAAGTAATT	0.348													4	2	---	---	---	---	
HIST1H2BE	8344	broad.mit.edu	37	6	26181648	26181648	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26181648delT	uc003ngt.2	+							NM_003523	NP_003514	P62807	H2B1C_HUMAN	histone cluster 1, H2be						defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0						CCATCAGAGGTTTTTTTTTTC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	27293740	27293740	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27293740delA								FKSG83 (1 upstream) : ZNF204P (31862 downstream)																							accctgtctgaaaaaaaaaaa	0.080													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32526464	32526464	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32526464delG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						ccactctgctgggggagctta	0.010													4	2	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42317015	42317015	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42317015delT	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGAAGCTGTCTTTTTTTTTTT	0.358													4	2	---	---	---	---	
PLA2G7	7941	broad.mit.edu	37	6	46682474	46682474	+	Intron	DEL	T	-	-	rs71984523		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46682474delT	uc010jzf.2	-						PLA2G7_uc010jzg.1_Intron|PLA2G7_uc011dwd.1_Intron|PLA2G7_uc011dwe.1_Intron	NM_005084	NP_005075	Q13093	PAFA_HUMAN	phospholipase A2, group VII						inflammatory response|lipid catabolic process	extracellular space	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding				0			Lung(136;0.192)			GAACTGTAAGttttttttttt	0.174													4	2	---	---	---	---	
FAM83B	222584	broad.mit.edu	37	6	54759577	54759578	+	Intron	DEL	TT	-	-	rs145864529		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54759577_54759578delTT	uc003pck.2	+							NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584											ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					GTCAGAAAACTTAGAAGCAGGG	0.134													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57131520	57131520	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57131520delA								RAB23 (44419 upstream) : PRIM2 (50902 downstream)																							TTTGTAGTGTAAAAATAGTCT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57536210	57536210	+	IGR	DEL	C	-	-	rs112147444		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57536210delC								PRIM2 (22835 upstream) : GUSBL2 (709949 downstream)																							cttgagatcaccccccaaaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	67675418	67675418	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67675418delT								None (None upstream) : None (None downstream)																							TTCAACTAGATTTTTTTTTTC	0.343													4	2	---	---	---	---	
ANKRD6	22881	broad.mit.edu	37	6	90321741	90321741	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90321741delT	uc003pni.3	+						ANKRD6_uc003pne.3_Intron|ANKRD6_uc003pnf.3_Intron|ANKRD6_uc011dzy.1_Intron|ANKRD6_uc010kcd.2_Intron|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|ANKRD6_uc003pnh.3_Intron	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6								protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		aaaggctggcttttagttagt	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95970012	95970013	+	IGR	INS	-	AA	AA	rs144483913	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95970012_95970013insAA								None (None upstream) : MANEA (55400 downstream)																							tatctgtttttaaaaatcttca	0.000													3	4	---	---	---	---	
C6orf168	84553	broad.mit.edu	37	6	99773967	99773967	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99773967delG	uc003ppj.3	-						C6orf168_uc003ppi.3_Intron	NM_032511	NP_115900	Q5TGI0	CF168_HUMAN	hypothetical protein LOC84553											ovary(2)|central_nervous_system(1)	3		all_cancers(76;1.63e-06)|Acute lymphoblastic leukemia(125;5.12e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00898)|Colorectal(196;0.0699)|Lung NSC(302;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.073)		GCGCCGGCAAGGGCACAATCA	0.408													4	2	---	---	---	---	
ASCC3	10973	broad.mit.edu	37	6	101315536	101315536	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101315536delA	uc003pqk.2	-						ASCC3_uc011eai.1_Intron|ASCC3_uc003pql.2_Intron|ASCC3_uc010kcv.2_Intron|ASCC3_uc003pqm.2_Intron	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GGAGCTGAACAAAAAAAAAAT	0.318													4	3	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	102310146	102310147	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102310146_102310147insT	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	attcccaagaatttttaactta	0.054													4	2	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123759471	123759471	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123759471delT	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|uc003pzm.1_5'Flank	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		GAAACAGAACTTTTTTTTTTT	0.279													9	5	---	---	---	---	
RNF146	81847	broad.mit.edu	37	6	127599103	127599103	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127599103delG	uc003qav.2	+						RNF146_uc003qat.2_Intron|RNF146_uc003qau.2_Intron	NM_030963	NP_112225	Q9NTX7	RN146_HUMAN	ring finger protein 146						positive regulation of canonical Wnt receptor signaling pathway|protein autoubiquitination|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol	poly-ADP-D-ribose binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(1)	1				GBM - Glioblastoma multiforme(226;0.0407)|all cancers(137;0.2)		cttgtatttaggggccacata	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130987035	130987036	+	IGR	DEL	TG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130987035_130987036delTG								TMEM200A (222827 upstream) : LOC285733 (161288 downstream)																							TTTTTGGTTTtgtgtgtgtgtg	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	142465322	142465323	+	IGR	INS	-	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142465322_142465323insG								NMBR (55386 upstream) : VTA1 (3087 downstream)																							tatttctacttgggggggatgc	0.084													4	2	---	---	---	---	
STXBP5	134957	broad.mit.edu	37	6	147647905	147647905	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147647905delA	uc003qlz.2	+						STXBP5_uc010khz.1_Intron|STXBP5_uc003qlx.2_Intron|STXBP5_uc003qly.2_Intron|STXBP5_uc003qma.2_Intron	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b						exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TTCCTAATAGAAGGGAATGTC	0.393													4	2	---	---	---	---	
SASH1	23328	broad.mit.edu	37	6	148771610	148771611	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148771610_148771611insT	uc003qme.1	+							NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1								protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TTCAAGTCCTATTTGAAGGACT	0.441													4	2	---	---	---	---	
PLEKHG1	57480	broad.mit.edu	37	6	151132409	151132409	+	Intron	DEL	G	-	-	rs34705005		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151132409delG	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron|PLEKHG1_uc011eem.1_Intron|PLEKHG1_uc003qnz.2_Intron	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GATAGGGAATGtttttttttt	0.204													4	2	---	---	---	---	
FBXO5	26271	broad.mit.edu	37	6	153292021	153292021	+	3'UTR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153292021delT	uc003qpg.2	-	5					FBXO5_uc003qph.2_3'UTR	NM_012177	NP_036309	Q9UKT4	FBX5_HUMAN	F-box only protein 5 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding				0		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		ATTGAATCAATTTTTTTTTAC	0.254													4	2	---	---	---	---	
CNKSR3	154043	broad.mit.edu	37	6	154811870	154811871	+	Intron	INS	-	A	A	rs142186766	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154811870_154811871insA	uc003qpy.2	-							NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3						negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		cagtggctgacaatgtcaaaat	0.035													4	2	---	---	---	---	
EZR	7430	broad.mit.edu	37	6	159224228	159224229	+	Intron	INS	-	TT	TT	rs149922686	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159224228_159224229insTT	uc003qrt.3	-						EZR_uc011efs.1_Intron|EZR_uc003qru.3_Intron|uc003qrv.1_5'Flank	NM_003379	NP_003370	P15311	EZRI_HUMAN	ezrin						actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TTCCTAGTAACTGACTTTTCAC	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159934499	159934499	+	IGR	DEL	G	-	-	rs113741268		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159934499delG								FNDC1 (241360 upstream) : SOD2 (165652 downstream)																							GCTCCTTTTTGGACATCGTAC	0.428													3	4	---	---	---	---	
SLC22A1	6580	broad.mit.edu	37	6	160554761	160554762	+	Intron	DEL	CG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160554761_160554762delCG	uc003qtc.2	+						SLC22A1_uc003qtd.2_Intron	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a							basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TTGATGGGTCCGGGGCCCCAGA	0.644													4	2	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162976667	162976668	+	Intron	INS	-	A	A	rs141959044	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162976667_162976668insA	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GAAAAAAATACAAAAAAAAAAT	0.252													4	3	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	169004404	169004405	+	Intron	DEL	AC	-	-	rs146630696		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169004404_169004405delAC	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		aaaaaaaaaaaccagtaatcca	0.000													3	3	---	---	---	---	
FAM20C	56975	broad.mit.edu	37	7	288947	288947	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:288947delC	uc003sip.2	+						FAM20C_uc011jvn.1_Intron	NM_020223	NP_064608	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C							extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		ACCCGGAGTGCCAGCCCACGG	0.562													4	2	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	692835	692835	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:692835delG	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		ctacacaagtggggagccagg	0.030													4	2	---	---	---	---	
ELFN1	392617	broad.mit.edu	37	7	1753748	1753748	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1753748delC	uc010ksg.2	+							NM_001128636	NP_001122108			extracellular leucine-rich repeat and												0						GGCTCAGTGACCAGGTCAGCT	0.592													4	2	---	---	---	---	
LOC389458	389458	broad.mit.edu	37	7	5083856	5083856	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5083856delT	uc003snr.2	+						RBAK_uc010kss.1_5'Flank|RBAK_uc003sns.1_5'Flank					Synthetic construct DNA, clone: pF1KB3788, Homo sapiens RBAK gene for RB-associated KRAB repressor, complete cds, without stop codon, in Flexi system.												0						ttctgacaccttttaagatcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	5123496	5123496	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5123496delT								LOC389458 (10643 upstream) : WIPI2 (106339 downstream)																							CAATGAGGACtttttttttga	0.229													4	2	---	---	---	---	
VWDE	221806	broad.mit.edu	37	7	12444182	12444182	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12444182delT	uc003ssj.2	-						VWDE_uc011jxl.1_5'Flank|VWDE_uc011jxm.1_5'Flank	NM_001135924	NP_001129396	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains							extracellular region					0						CCCAACCTCGTttttgttttg	0.269													4	2	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14419025	14419025	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14419025delT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	AATTATGGAGTTTTTTTTTTT	0.353													2	4	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21804843	21804844	+	Intron	INS	-	TG	TG	rs145919459	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21804843_21804844insTG	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						AGCAGTGTTTCTGTGTCCAGTG	0.381									Kartagener_syndrome				10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	26540094	26540094	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26540094delT								LOC441204 (1500 upstream) : KIAA0087 (32646 downstream)																							tgaagtctagtttacctattt	0.000													4	2	---	---	---	---	
HOXA1	3198	broad.mit.edu	37	7	27136807	27136808	+	5'Flank	DEL	AG	-	-	rs79198317	byFrequency	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27136807_27136808delAG	uc003syd.2	-						HOXA1_uc003sye.2_5'Flank|uc003syg.2_Intron	NM_153620	NP_705873	P49639	HXA1_HUMAN	homeobox A1 isoform b							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						GAATGTTAGAAGAGAGAGAGAG	0.574													4	2	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	28078894	28078895	+	Intron	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28078894_28078895delAC	uc003szn.2	-							NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						gtgcatacaaacacacacacac	0.124			T	SUZ12	endometrial stromal tumours								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	28895404	28895405	+	IGR	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28895404_28895405delAC								CREB5 (29895 upstream) : TRIL (97571 downstream)																							tctccctctGACACACACACAC	0.381													4	2	---	---	---	---	
C7orf16	10842	broad.mit.edu	37	7	31728053	31728053	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31728053delA	uc003tcl.2	+						C7orf16_uc011kaf.1_Intron	NM_006658	NP_006649	O96001	GSUB_HUMAN	G-substrate isoform 1						behavior|central nervous system development|intracellular protein kinase cascade|protein phosphorylation	soluble fraction				ovary(2)|central_nervous_system(1)	3			GBM - Glioblastoma multiforme(11;0.216)			GAGAAAAGACAAAAAATCCAG	0.418													4	2	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	31861646	31861646	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31861646delG	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TGGTGCTGGTGGCAACTTCAG	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35544483	35544483	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35544483delC								TBX20 (251241 upstream) : HERPUD2 (127789 downstream)																							TTGTAGGATTCCCCAGGTAGC	0.478													4	2	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36692686	36692686	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36692686delT	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						tcctcacaactttttataaat	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	37547381	37547381	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37547381delT								ELMO1 (58851 upstream) : GPR141 (232615 downstream)																							ataatatccatttcaaagagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	37749578	37749578	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37749578delA	uc003tfl.2	+											Homo sapiens, clone IMAGE:3881224, mRNA.																		CGCCCGCAGTAAGCATTCTCT	0.448													4	2	---	---	---	---	
TXNDC3	51314	broad.mit.edu	37	7	37916284	37916284	+	Intron	DEL	T	-	-	rs11334674		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37916284delT	uc003tfn.2	+							NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						TTCTTGGATATAATAGGGAGA	0.249									Kartagener_syndrome				8	4	---	---	---	---	
UBE2D4	51619	broad.mit.edu	37	7	43989956	43989957	+	Intron	DEL	GA	-	-	rs76093392		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43989956_43989957delGA	uc003tja.1	+						POLR2J4_uc003tjc.2_Intron|UBE2D4_uc003tjb.1_Intron	NM_015983	NP_057067	Q9Y2X8	UB2D4_HUMAN	ubiquitin-conjugating enzyme E2D 4 (putative)						protein K11-linked ubiquitination|protein K27-linked ubiquitination|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0						GAAGGGGAATGAGAACCAGGAT	0.554													5	8	---	---	---	---	
DDX56	54606	broad.mit.edu	37	7	44607049	44607050	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44607049_44607050insA	uc003tlg.2	-						DDX56_uc003tle.2_Intron|DDX56_uc003tlf.2_Intron|DDX56_uc003tlh.2_Intron|DDX56_uc010kyg.2_Intron	NM_019082	NP_061955	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 56						rRNA processing	nucleolus	ATP binding|ATP-dependent RNA helicase activity|identical protein binding|RNA binding			upper_aerodigestive_tract(1)	1						TACTCATTACCAAAAACACCTC	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47629547	47629548	+	IGR	DEL	CT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47629547_47629548delCT								TNS3 (7805 upstream) : C7orf65 (65294 downstream)																							ccttcctcccctctctctctcc	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	48822459	48822459	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48822459delA								ABCA13 (135368 upstream) : CDC14C (141698 downstream)																							AGAAGCAAGGAAAAAAAGAGA	0.383													4	2	---	---	---	---	
ZNF479	90827	broad.mit.edu	37	7	57208429	57208430	+	5'Flank	INS	-	TG	TG	rs142768217	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57208429_57208430insTG	uc010kzo.2	-							NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			attgctgtttctgtgagctggg	0.059													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57402728	57402729	+	IGR	DEL	TG	-	-	rs34226953		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57402728_57402729delTG								ZNF479 (195157 upstream) : ZNF716 (107154 downstream)																							tgtgtgtgtttgtgtgtgtgtg	0.188													4	2	---	---	---	---	
KCTD7	154881	broad.mit.edu	37	7	66106882	66106882	+	3'UTR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66106882delA	uc003tve.2	+	4					RABGEF1_uc003tvf.2_Intron	NM_153033	NP_694578	Q96MP8	KCTD7_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)	3						AGAACAGAAGAAGGGTTGGGT	0.448													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71502142	71502142	+	Intron	DEL	T	-	-	rs35583201		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71502142delT	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				CTTTTCATAAttttttttttt	0.015													3	3	---	---	---	---	
RSBN1L	222194	broad.mit.edu	37	7	77330043	77330044	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77330043_77330044insT	uc010ldt.1	+						RSBN1L_uc003ugm.2_Intron	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like							nucleus				ovary(1)	1						ttcatgtctcatttttttcatt	0.000													4	2	---	---	---	---	
RUNDC3B	154661	broad.mit.edu	37	7	87425977	87425977	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87425977delA	uc003ujb.2	+						RUNDC3B_uc011khd.1_Intron|RUNDC3B_uc011khe.1_Intron|RUNDC3B_uc003ujc.2_Intron|RUNDC3B_uc003ujd.2_Intron	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a											skin(1)	1	Esophageal squamous(14;0.00164)					tcaatgtgctaaaagaaaaaa	0.005													4	2	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90637105	90637105	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90637105delA	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						AGGAGGGAGGAAAAAAAAAAC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	95385507	95385508	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95385507_95385508insT								PDK4 (159582 upstream) : DYNC1I1 (16310 downstream)																							GAAACAGAGAATTAAAAAAAAA	0.287													4	2	---	---	---	---	
SMURF1	57154	broad.mit.edu	37	7	98640278	98640279	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98640278_98640279insA	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			ACAGTCAAGCCAAAAAAAAGGC	0.307													4	2	---	---	---	---	
ACTL6B	51412	broad.mit.edu	37	7	100247969	100247970	+	Intron	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100247969_100247970delAC	uc003uvy.2	-						ACTL6B_uc003uvx.1_5'Flank|ACTL6B_uc003uvz.2_Intron	NM_016188	NP_057272	O94805	ACL6B_HUMAN	actin-like 6B						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex|SWI/SNF complex	ATP binding|protein binding|structural constituent of cytoskeleton			ovary(1)	1	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					atacactcaaacacacacacat	0.025													4	2	---	---	---	---	
SERPINE1	5054	broad.mit.edu	37	7	100770210	100770211	+	5'Flank	DEL	CA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100770210_100770211delCA	uc003uxt.2	+						SERPINE1_uc011kkj.1_5'Flank|SERPINE1_uc003uxs.2_5'Flank	NM_000602	NP_000593	P05121	PAI1_HUMAN	plasminogen activator inhibitor-1 isoform 1						angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)				Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)	cacagagcagcacacacacaca	0.460													4	2	---	---	---	---	
RASA4	10156	broad.mit.edu	37	7	102334997	102334997	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102334997delA	uc011kld.1	-									O43374	RASL2_HUMAN	Homo sapiens mRNA for KIAA0538 protein, partial cds.						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						GTAGGAATGGAAAACACAAAT	0.308													4	2	---	---	---	---	
DNAJC2	27000	broad.mit.edu	37	7	102982636	102982636	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102982636delA	uc003vbo.2	-						DNAJC2_uc003vbn.2_5'Flank|DNAJC2_uc010lix.2_Intron|DNAJC2_uc003vbp.2_Intron|DNAJC2_uc003vbq.1_Intron|DNAJC2_uc003vbr.1_Intron	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2						'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1						CTGACAAAACAAAAAAAACTC	0.323													4	2	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105294317	105294317	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105294317delC	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						ggtgtgccctcccccattctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108633768	108633768	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108633768delT								C7orf66 (109131 upstream) : EIF3IP1 (965516 downstream)																							CGAATTTACGTTTTTTTTTTA	0.398													4	2	---	---	---	---	
MET	4233	broad.mit.edu	37	7	116398287	116398288	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116398287_116398288insT	uc003vij.2	+						MET_uc010lkh.2_Intron|MET_uc011kng.1_Intron|MET_uc011knh.1_Intron|MET_uc011kni.1_Intron|MET_uc011knj.1_Intron	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor						axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TACTTTAAAGGTTTTTTTTTCA	0.361			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	126967538	126967538	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126967538delA								GRM8 (74391 upstream) : ZNF800 (42816 downstream)																							TCCTAGAATTAAAAAAAAAAA	0.343													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128730939	128730940	+	IGR	INS	-	TCAC	TCAC	rs111905346		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128730939_128730940insTCAC								TPI1P2 (33646 upstream) : LOC407835 (35385 downstream)																							TTGAAGAGAAGTGGGCTGCAGC	0.347													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	154849571	154849571	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154849571delA								LOC202781 (52159 upstream) : HTR5A (12975 downstream)																							TATCCCCTCTAAAGTGAAAGG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	525986	525986	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:525986delA								C8orf42 (30655 upstream) : ERICH1 (38763 downstream)																							ACGCTGATGTAAACCCGGGAA	0.557													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4654717	4654717	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4654717delC	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTGACTGAAGCCCACACAGTA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6825398	6825399	+	IGR	DEL	AG	-	-	rs150807729		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6825398_6825399delAG								DEFA4 (29612 upstream) : DEFA1B (9772 downstream)																							CTTTTCAATTAGAGTCTGAAGC	0.416													3	3	---	---	---	---	
DOK2	9046	broad.mit.edu	37	8	21672943	21672943	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21672943delA	uc003wzx.1	-							NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		tgatttgcccaaggtcgcata	0.129													4	2	---	---	---	---	
XPO7	23039	broad.mit.edu	37	8	21810283	21810283	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21810283delC	uc003xaa.3	+						XPO7_uc010lti.2_Intron|XPO7_uc010ltj.1_Intron	NM_015024	NP_055839	Q9UIA9	XPO7_HUMAN	exportin 7 isoform b						mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		CATTCTGTTGCCCTGTCAGGT	0.413													4	2	---	---	---	---	
ADAM28	10863	broad.mit.edu	37	8	24209108	24209109	+	Intron	DEL	CA	-	-	rs76956970	byFrequency	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24209108_24209109delCA	uc003xdy.2	+						ADAM28_uc011laa.1_Intron|ADAM28_uc010lua.2_Intron	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1						proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		ctccctctctcacacacacaca	0.193													4	2	---	---	---	---	
PTK2B	2185	broad.mit.edu	37	8	27183004	27183004	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27183004delG	uc003xfn.1	+						PTK2B_uc003xfo.1_Intron|PTK2B_uc003xfp.1_5'Flank|PTK2B_uc003xfq.1_5'Flank	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a						apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)		TTAAGGAAGTGGGGAGGAGAG	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33587093	33587093	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33587093delA								DUSP26 (129654 upstream) : None (None downstream)																							gaaagaaaggaaaaaaatgta	0.015													4	2	---	---	---	---	
GPR124	25960	broad.mit.edu	37	8	37656347	37656348	+	Intron	DEL	GT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37656347_37656348delGT	uc003xkj.2	+						GPR124_uc003xki.2_Intron|GPR124_uc010lvy.2_Intron	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor						central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CCCGGCCCGGGTGTGTGTGTGC	0.653													4	2	---	---	---	---	
PLEKHA2	59339	broad.mit.edu	37	8	38775830	38775831	+	Intron	DEL	CA	-	-	rs72636200	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38775830_38775831delCA	uc003xmi.3	+						PLEKHA2_uc011lce.1_Intron	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A						positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			acacacacaccacacacacact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47356875	47356876	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47356875_47356876insT								None (None upstream) : BEYLA (395632 downstream)																							aggcctgaagatttagagccag	0.000													4	2	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48745246	48745246	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48745246delA	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				tgagatatctaagcactagga	0.000								NHEJ					4	2	---	---	---	---	
PLAG1	5324	broad.mit.edu	37	8	57107169	57107170	+	Intron	DEL	TG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57107169_57107170delTG	uc003xsr.3	-						PLAG1_uc010lyi.2_Intron|PLAG1_uc010lyj.2_Intron	NM_002655	NP_002646	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding		CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			tatgtgtgtttgtgtgtgtgtg	0.327			T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57237712	57237712	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57237712delT								SDR16C5 (4471 upstream) : PENK (115801 downstream)																							CTCTAACAAATTTTTTTTCCC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58444673	58444674	+	IGR	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58444673_58444674insA								C8orf71 (247385 upstream) : FAM110B (462439 downstream)																							AAGAATCCTGTAAAAAATGAGT	0.243													4	2	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59556830	59556830	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59556830delC	uc003xtt.2	-						NSMAF_uc011lee.1_Intron|NSMAF_uc003xtu.2_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				aatggtaaaacccacaggcta	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64554765	64554766	+	IGR	DEL	AC	-	-	rs35748058		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64554765_64554766delAC								YTHDF3 (429420 upstream) : MIR124-2 (736940 downstream)																							TAGTCAGCAAacacacacacac	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	67188462	67188462	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67188462delA								CRH (97764 upstream) : RRS1 (152801 downstream)																							TCAGAAAGGCAAAAAAAGCAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	75777892	75777893	+	Intron	INS	-	A	A	rs2732012	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75777892_75777893insA	uc003yak.1	-											Homo sapiens cDNA FLJ14180 fis, clone NT2RP2003799.																		ATAATCATGAGTTTTTttttcc	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	88993639	88993639	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88993639delA								DCAF4L2 (107343 upstream) : MMP16 (55823 downstream)																							gctactttataatattagaga	0.000													4	2	---	---	---	---	
ESRP1	54845	broad.mit.edu	37	8	95671965	95671966	+	Intron	DEL	TA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95671965_95671966delTA	uc003ygq.3	+						ESRP1_uc003ygr.3_Intron|ESRP1_uc003ygs.3_Intron|ESRP1_uc003ygt.3_Intron|ESRP1_uc003ygu.3_Intron|ESRP1_uc003ygv.2_Intron|ESRP1_uc003ygw.2_Intron	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						agcaaaacattatagggtgtta	0.000													4	2	---	---	---	---	
C8orf38	137682	broad.mit.edu	37	8	95970241	95970242	+	5'UTR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95970241_95970242insT	uc003yhi.2	+	1					C8orf38_uc003yhe.1_RNA|C8orf38_uc003yhf.2_5'UTR	NM_152416	NP_689629	Q330K2	CH038_HUMAN	hypothetical protein LOC137682 precursor						biosynthetic process	mitochondrion	transferase activity				0	Breast(36;3.32e-06)					ttcggcctttctgacatggtgc	0.005													4	2	---	---	---	---	
GDF6	392255	broad.mit.edu	37	8	97172667	97172668	+	Frame_Shift_Ins	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97172667_97172668insA	uc003yhp.2	-	1	353_354	c.253_254insT	c.(253-255)CCGfs	p.P85fs		NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN	growth differentiation factor 6 precursor	85					activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(1)|breast(1)|pancreas(1)	3	Breast(36;2.67e-05)					CCTGCCTGGCGGCTCCTGCGCC	0.688													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103544243	103544243	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103544243delT								UBR5 (119748 upstream) : ODF1 (19605 downstream)																							aaacgtgtggtttttttttct	0.050													4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106646245	106646245	+	Intron	DEL	A	-	-	rs72224898		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106646245delA	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ATCATTTAGGAAAAAAAAAAA	0.348													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	112475652	112475652	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112475652delT								None (None upstream) : CSMD3 (759509 downstream)																							AAAACAGGAATTTTTTTTTCT	0.234													4	2	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	114329332	114329332	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114329332delA	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron|CSMD3_uc003ynx.3_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GAAGAGGTTTAAAAAAAATCA	0.279										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			4	2	---	---	---	---	
ENPP2	5168	broad.mit.edu	37	8	120598168	120598169	+	Intron	DEL	AC	-	-	rs142862962		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120598168_120598169delAC	uc003yot.1	-						ENPP2_uc011lic.1_5'Flank|ENPP2_uc003yor.1_Intron|ENPP2_uc003yos.1_Intron|ENPP2_uc010mdd.1_Intron	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein						cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GATGAAAGAGacacacacacac	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126861419	126861420	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126861419_126861420insT								TRIB1 (410777 upstream) : FAM84B (703267 downstream)																							CTTTGAGCAGGtttttttttgt	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126989318	126989318	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126989318delA								TRIB1 (538676 upstream) : FAM84B (575369 downstream)																							AGTGTATGTCAAATATCTGCT	0.303													4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139617583	139617583	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139617583delA	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			tgagggctggacaaGCACCCC	0.259										HNSCC(7;0.00092)			4	2	---	---	---	---	
HEATR7A	727957	broad.mit.edu	37	8	145273380	145273380	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145273380delT	uc003zbk.3	+						HEATR7A_uc011lla.1_Intron|HEATR7A_uc010mft.2_Intron	NM_032450	NP_115826	Q8NDA8	HTR7A_HUMAN	HEAT repeat containing 7A isoform 1								binding				0						GCCCTTGAGATTTTTTTTCAC	0.438													4	2	---	---	---	---	
CNTLN	54875	broad.mit.edu	37	9	17308889	17308890	+	Intron	INS	-	T	T	rs144083775	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17308889_17308890insT	uc003zmz.2	+						CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		taaattagttattttttGTGTT	0.178													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69808651	69808651	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69808651delA								LOC100133920 (143702 upstream) : FOXD4L5 (367058 downstream)																							TGTCAGTGCCAAATGTTTACT	0.378													4	2	---	---	---	---	
NAA35	60560	broad.mit.edu	37	9	88560192	88560193	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88560192_88560193insA	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						TTCTTGGAACTAAAAAAAAATT	0.366													4	2	---	---	---	---	
DAPK1	1612	broad.mit.edu	37	9	90185018	90185018	+	Intron	DEL	T	-	-	rs34663541		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90185018delT	uc004apc.2	+						DAPK1_uc004ape.2_Intron|DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						TCACTTTCTATTTTTTTTTAA	0.308									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				4	2	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92294378	92294379	+	Intron	INS	-	CT	CT			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92294378_92294379insCT	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						aactctctctcctctctctctc	0.000													4	2	---	---	---	---	
SPTLC1	10558	broad.mit.edu	37	9	94840151	94840151	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94840151delT	uc004arl.1	-						SPTLC1_uc011ltv.1_Intron|SPTLC1_uc004arm.1_Intron	NM_006415	NP_006406	O15269	SPTC1_HUMAN	serine palmitoyltransferase subunit 1 isoform a							integral to membrane|SPOTS complex	protein binding|pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			ovary(1)|breast(1)	2					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	agttcttttcttttatactta	0.000													4	2	---	---	---	---	
SLC44A1	23446	broad.mit.edu	37	9	108056732	108056733	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108056732_108056733insT	uc004bcn.2	+						SLC44A1_uc010mtk.1_Intron	NM_080546	NP_536856	Q8WWI5	CTL1_HUMAN	CDW92 antigen							integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)	gttggtagttgttttttttttc	0.000													5	3	---	---	---	---	
KCNT1	57582	broad.mit.edu	37	9	138673598	138673598	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138673598delA	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron|KCNT1_uc004cgo.1_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CTCCGGAAGGAAAAAGGGAGG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11961516	11961516	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11961516delT								C10orf47 (47242 upstream) : UPF2 (506 downstream)																							TGTAGGCTACTTTTTTTTTCA	0.433													4	3	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14640735	14640735	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14640735delT	uc001ina.1	-						FAM107B_uc010qbu.1_Intron|FAM107B_uc001imy.1_Intron|FAM107B_uc001imz.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						GTAAAGAACATTTTTTGAAAG	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	15806669	15806669	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15806669delA								ITGA8 (44899 upstream) : FAM188A (13506 downstream)																							taagtagaggaaaaaaaagaa	0.104													4	2	---	---	---	---	
ST8SIA6	338596	broad.mit.edu	37	10	17438305	17438306	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17438305_17438306insA	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron|uc001ipe.2_Intron|uc001ipf.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						aggagtgctggaaaaaaaatca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	18396511	18396512	+	IGR	INS	-	T	T	rs144154951	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18396511_18396512insT								SLC39A12 (64290 upstream) : CACNB2 (33094 downstream)																							acccaaatctctatttccagcc	0.000													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24110034	24110035	+	Intron	DEL	GT	-	-	rs72199137		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24110034_24110035delGT	uc001irs.2	+							NM_001098500	NP_001091970	Q5T5P2	SKT_HUMAN	sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						gtgtgtgtgcgtgtgtgtgtgt	0.287													4	2	---	---	---	---	
LOC100133308	100133308	broad.mit.edu	37	10	45647622	45647623	+	Intron	INS	-	TTG	TTG	rs150301001	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45647622_45647623insTTG	uc009xmq.1	-						uc001jca.3_Intron|uc001jcb.1_5'Flank|uc009xmr.1_5'Flank	NR_024472				Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						CCTTGCAGCTTttgttgttgtt	0.337													4	7	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	56651734	56651734	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56651734delA	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ATCAAAGAATAAAGGAGGCAG	0.408										HNSCC(58;0.16)			4	2	---	---	---	---	
BICC1	80114	broad.mit.edu	37	10	60478030	60478030	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60478030delT	uc001jki.1	+							NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						aggtggcaccttctatgtctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	63220867	63220867	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63220867delA	uc001jlr.2	+											Homo sapiens, clone IMAGE:5222445, mRNA.																		CCATCATAGTAATAGGATAGG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	66751156	66751156	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66751156delA								ANXA2P3 (164522 upstream) : CTNNA3 (928569 downstream)																							CAAGTCCCCTAAAATGCATTA	0.373													4	2	---	---	---	---	
RUFY2	55680	broad.mit.edu	37	10	70168999	70168999	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70168999delT	uc001job.2	-						RUFY2_uc001jnz.1_5'Flank|RUFY2_uc001joc.2_5'Flank|RUFY2_uc010qiw.1_5'Flank|RUFY2_uc001jod.1_5'Flank|RUFY2_uc009xpv.1_5'Flank|RUFY2_uc001joe.1_5'Flank	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1						tgttcccttcttttttttttt	0.000													3	3	---	---	---	---	
DDX50	79009	broad.mit.edu	37	10	70697646	70697646	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70697646delT	uc001jou.2	+						DDX50_uc010qjc.1_Intron	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						ccggcctgtattttttttcta	0.000													4	2	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75875456	75875456	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75875456delG	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					AGGCTTTTCCGGGGCATGAGG	0.453													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78671593	78671594	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78671593_78671594insA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	TTGTGAATCAGAAAATGTAAAC	0.436													4	2	---	---	---	---	
LOC219347	219347	broad.mit.edu	37	10	81808001	81808001	+	RNA	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81808001delT	uc001kbk.2	-	6		c.1936delA			LOC219347_uc001kbi.3_RNA|LOC219347_uc009xsk.2_RNA|LOC219347_uc009xsl.2_RNA|LOC219347_uc009xsm.2_RNA|LOC219347_uc001kbj.3_RNA					Homo sapiens cDNA FLJ11611 fis, clone HEMBA1003987.												0						TGCAGAGCCCTTTTCCTCAGG	0.537													4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87971465	87971466	+	Intron	DEL	AA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87971465_87971466delAA	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	ttccctggttaaaaaaaaaaaa	0.099										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
NEURL	9148	broad.mit.edu	37	10	105310507	105310508	+	Intron	INS	-	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105310507_105310508insC	uc001kxh.2	+							NM_004210	NP_004201	O76050	NEU1A_HUMAN	neuralized-like						nervous system development	perinuclear region of cytoplasm	zinc ion binding				0				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CGTTGCCCTTTCCtggatggag	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115742903	115742903	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115742903delC								NHLRC2 (74451 upstream) : ADRB1 (60903 downstream)																							ACAGGCAGCTCCACTTGCTGG	0.493													4	2	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	132974689	132974690	+	Intron	DEL	AT	-	-	rs76829431		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132974689_132974690delAT	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		ACCAAGACACATGTACACACAG	0.139													4	2	---	---	---	---	
CD81	975	broad.mit.edu	37	11	2412346	2412348	+	Intron	DEL	AGG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2412346_2412348delAGG	uc001lwf.1	+						CD81_uc001lwg.1_Intron	NM_004356	NP_004347	P60033	CD81_HUMAN	CD81 antigen						activation of MAPK activity|cell proliferation|phosphatidylinositol biosynthetic process|positive regulation of 1-phosphatidylinositol 4-kinase activity|positive regulation of cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization|regulation of immune response|virion attachment, binding of host cell surface receptor	integral to plasma membrane	protein binding				0		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		gggcaaggccaggaggaggagga	0.448													4	2	---	---	---	---	
RHOG	391	broad.mit.edu	37	11	3864469	3864469	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3864469delT	uc001lyu.2	-							NM_001665	NP_001656	P84095	RHOG_HUMAN	ras homolog gene family, member G precursor						actin cytoskeleton organization|activation of Rac GTPase activity|axon guidance|cell chemotaxis|platelet activation|positive regulation of cell proliferation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of transcription, DNA-dependent|Rac protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding				0		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0349)|LUSC - Lung squamous cell carcinoma(625;0.194)		CCTGTAGCCCTTCAGACAAAC	0.517													4	2	---	---	---	---	
NLRP14	338323	broad.mit.edu	37	11	7071695	7071696	+	Intron	INS	-	T	T	rs141291059	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7071695_7071696insT	uc001mfb.1	+							NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14						cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TAAGAAAGATCTTATTTTTCAA	0.351													4	4	---	---	---	---	
DENND5A	23258	broad.mit.edu	37	11	9271819	9271819	+	Intron	DEL	A	-	-	rs11390887		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9271819delA	uc001mhl.2	-						DENND5A_uc010rbw.1_Intron|DENND5A_uc010rbx.1_Intron	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1											liver(1)	1						AACTGTCACCAAAAAAAAAAA	0.363													1	5	---	---	---	---	
INSC	387755	broad.mit.edu	37	11	15197823	15197823	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15197823delT	uc001mly.2	+						INSC_uc001mlz.2_Intron|INSC_uc001mma.2_Intron|INSC_uc010rcs.1_Intron|INSC_uc001mmb.2_Intron|INSC_uc001mmc.2_Intron	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						gtgctaggtgtttttttttta	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	17629072	17629072	+	Intron	DEL	G	-	-	rs71484776	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17629072delG	uc001mnh.1	+											SubName: Full=Putative uncharacterized protein OTOG;																		tctctaaagtgggggtaataa	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	18832055	18832055	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18832055delG								PTPN5 (18666 upstream) : MRGPRX1 (123306 downstream)																							gataattaatggactgttctc	0.000													4	2	---	---	---	---	
ZDHHC13	54503	broad.mit.edu	37	11	19197719	19197720	+	3'UTR	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19197719_19197720insA	uc001mpi.2	+	17					ZDHHC13_uc001mpj.2_3'UTR	NM_019028	NP_061901	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC domain containing 13 isoform						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|palmitoyltransferase activity|signal transducer activity|zinc ion binding				0						GGCAGACATCTAAAAAAAAAAC	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	24074609	24074609	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24074609delA								None (None upstream) : LUZP2 (443947 downstream)																							atgctctaagaaaaaaggaag	0.005													4	2	---	---	---	---	
ANO3	63982	broad.mit.edu	37	11	26376151	26376151	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26376151delT	uc001mqt.3	+						ANO3_uc010rdr.1_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						tttagctctattttttttctg	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27844349	27844349	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27844349delG								BDNF (100744 upstream) : KIF18A (197814 downstream)																							CCAATGACCTGGCCTATATTC	0.423													4	2	---	---	---	---	
EIF3M	10480	broad.mit.edu	37	11	32614238	32614238	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32614238delC	uc001mtu.2	+						EIF3M_uc010ref.1_Intron	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					TCTAAAACTACCATCTCTAGT	0.403													4	2	---	---	---	---	
SLC1A2	6506	broad.mit.edu	37	11	35282111	35282111	+	3'UTR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35282111delG	uc001mwd.2	-	11					SLC1A2_uc001mwe.2_3'UTR	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2						D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	CATGTCCCCTGGGAAAAGAGC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	35856431	35856431	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35856431delT								TRIM44 (25501 upstream) : LDLRAD3 (109181 downstream)																							accttccccctgctcactgct	0.000													4	2	---	---	---	---	
LDLRAD3	143458	broad.mit.edu	37	11	36229233	36229233	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36229233delA	uc001mwk.1	+						LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron|LDLRAD3_uc010rfa.1_Intron	NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain							integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				ATCATGTCTCAAAAAAAAAAG	0.348													5	3	---	---	---	---	
PRR5L	79899	broad.mit.edu	37	11	36453712	36453713	+	Intron	DEL	TG	-	-	rs143366358		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36453712_36453713delTG	uc001mwo.3	+						PRR5L_uc001mwp.2_Intron|PRR5L_uc009ykk.2_Intron|PRR5L_uc010rfc.1_Intron	NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a											ovary(1)	1						GGtttttttttgttttgttttt	0.361													4	2	---	---	---	---	
LOC440040	440040	broad.mit.edu	37	11	49827358	49827359	+	Intron	INS	-	TT	TT	rs142261479	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49827358_49827359insTT	uc010rhy.1	+						LOC440040_uc009ymb.2_Intron	NR_027044				SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;												0						CCTCAGAGTTGTTTTCTGTAAA	0.351													5	3	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63517928	63517928	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63517928delT	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						CTCTAAAttcttttttttttt	0.184													4	2	---	---	---	---	
PLCB3	5331	broad.mit.edu	37	11	64034268	64034268	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64034268delC	uc001nzb.2	+						PLCB3_uc009ypg.1_Intron|PLCB3_uc009yph.1_Intron|PLCB3_uc009ypi.2_Intron	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3						intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						GGAGCCTTCGCCCACCTGACt	0.318													4	2	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72385332	72385367	+	5'UTR	DEL	ACCCCCAGCAGGCACAGGGACCAAGAGCAGTGGGCT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72385332_72385367delACCCCCAGCAGGCACAGGGACCAAGAGCAGTGGGCT	uc010rrc.1	-	1					PDE2A_uc010rrd.1_5'UTR|PDE2A_uc001osq.2_RNA	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	AGGGCAGGGCACCCCCAGCAGGCACAGGGACCAAGAGCAGTGGGCTGCCCCCTACT	0.686													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	81819521	81819521	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81819521delT	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																		actctgtgtctttatgtacac	0.000													4	2	---	---	---	---	
ANKRD42	338699	broad.mit.edu	37	11	82919017	82919017	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82919017delC	uc001ozz.1	+						ANKRD42_uc009yvi.1_Intron|ANKRD42_uc010rsv.1_Intron|ANKRD42_uc001paa.2_Intron|ANKRD42_uc001pab.1_Intron	NM_182603	NP_872409	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42											skin(1)	1						GAGAGTTTTTCCCCCCCTCCT	0.289													4	2	---	---	---	---	
FAT3	120114	broad.mit.edu	37	11	92584856	92584856	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92584856delT	uc001pdj.3	+						FAT3_uc001pdi.3_Intron	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCCTTCATGCTTACTGTGGTA	0.473										TCGA Ovarian(4;0.039)			4	2	---	---	---	---	
ARHGAP42	143872	broad.mit.edu	37	11	100569413	100569413	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100569413delA	uc001pge.2	+							NM_152432	NP_689645	A6NI28	RHG42_HUMAN	Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0						aactccgtttaaaaaaaaGGG	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	105068343	105068343	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105068343delT								CARD18 (58537 upstream) : GRIA4 (412457 downstream)																							ACAGACCTCCTACATAATTCA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	107767173	107767173	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107767173delA								SLC35F2 (37259 upstream) : RAB39 (32104 downstream)																							aaaaaaaaggaaaaaaaaaga	0.040													4	2	---	---	---	---	
DLAT	1737	broad.mit.edu	37	11	111916412	111916412	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111916412delA	uc001pmo.2	+						DLAT_uc009yyk.1_Intron|DLAT_uc010rwr.1_Intron	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor						glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)	actccatctcaaaaaaaaaaa	0.159													3	3	---	---	---	---	
C11orf34	349633	broad.mit.edu	37	11	112125844	112125847	+	Intron	DEL	GTGA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112125844_112125847delGTGA	uc009yyp.2	-						PTS_uc009yyo.2_Intron	NM_001145024	NP_001138496	Q6UQ28	PLET1_HUMAN	hypothetical protein LOC349633 precursor							integral to membrane					0						gtgtatgtgtgtgaggtgtgtggg	0.044													4	2	---	---	---	---	
TMPRSS4	56649	broad.mit.edu	37	11	117974865	117974866	+	Intron	DEL	GA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117974865_117974866delGA	uc010rxo.1	+						TMPRSS4_uc010rxp.1_Intron|TMPRSS4_uc010rxq.1_Intron|TMPRSS4_uc010rxr.1_Intron|TMPRSS4_uc010rxs.1_Intron|TMPRSS4_uc009yzu.2_Intron|TMPRSS4_uc010rxt.1_Intron	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		GGGCAGGGCTGAGTGACTTTCT	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	118570687	118570688	+	IGR	INS	-	G	G	rs61385183		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118570687_118570688insG								TREH (20306 upstream) : DDX6 (47785 downstream)																							TGATGAAAAAATCTCCATTTCA	0.233													4	2	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120313451	120313451	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120313451delT	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TTGTTATGGGTAAATAGCACC	0.139			T	MLL	AML								4	2	---	---	---	---	
SORL1	6653	broad.mit.edu	37	11	121348571	121348574	+	Intron	DEL	TGCT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121348571_121348574delTGCT	uc001pxx.2	+							NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class						cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		accctgtctctgctaaaaatacaa	0.000													5	3	---	---	---	---	
LOC399959	399959	broad.mit.edu	37	11	122148055	122148055	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122148055delT	uc009zbb.1	-											Homo sapiens cDNA FLJ34394 fis, clone HCHON2000676.												0						GACCCCCGCCTCCAGTAATAT	0.428													4	2	---	---	---	---	
ZBTB44	29068	broad.mit.edu	37	11	130153707	130153707	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130153707delA	uc001qga.2	-						ZBTB44_uc001qgb.3_Intron|ZBTB44_uc001qfx.2_Intron|ZBTB44_uc001qgc.1_Intron	NM_014155	NP_054874	Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		ctaaaaatacaaaaaaaaatt	0.000													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131711438	131711438	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131711438delT	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ataagtcacatttttttttaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6395344	6395344	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6395344delA								CD9 (47917 upstream) : PLEKHG6 (24258 downstream)																							aggaagaaggaaaaatgtaaa	0.000													4	2	---	---	---	---	
CLEC2A	387836	broad.mit.edu	37	12	10065707	10065708	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10065707_10065708insT	uc009zhb.2	-							NM_001130711	NP_001124183	Q6UVW9	CLC2A_HUMAN	C-type lectin domain family 2, member A						natural killer cell mediated cytotoxicity	integral to membrane|plasma membrane	protein homodimerization activity|receptor activity|sugar binding				0						GGGAGATTGCATTTTTTTTTTC	0.272													4	2	---	---	---	---	
MGST1	4257	broad.mit.edu	37	12	16498251	16498251	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16498251delT	uc001rdf.2	+						MGST1_uc001rdg.2_5'Flank|MGST1_uc009zih.1_5'Flank|MGST1_uc001rdh.2_5'Flank	NM_145792	NP_665735	P10620	MGST1_HUMAN	microsomal glutathione S-transferase 1						protein homotrimerization|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane	glutathione transferase activity				0		Hepatocellular(102;0.121)			Glutathione(DB00143)	ATCAATGACCTTTTAAACTGT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	25527323	25527326	+	IGR	DEL	TTGT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25527323_25527326delTTGT								KRAS (123460 upstream) : IFLTD1 (101690 downstream)																							GTTGTTGTCGTTGtttgtttgttt	0.069													3	4	---	---	---	---	
CPNE8	144402	broad.mit.edu	37	12	39118428	39118428	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39118428delT	uc001rls.1	-							NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII											pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				GCCCCTAGGATAATCTACAAG	0.373													1	6	---	---	---	---	
PRICKLE1	144165	broad.mit.edu	37	12	42872204	42872204	+	Intron	DEL	G	-	-	rs1669922	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42872204delG	uc010skv.1	-						PRICKLE1_uc001rnl.2_Intron|PRICKLE1_uc010skw.1_Intron|PRICKLE1_uc001rnm.2_Intron|PRICKLE1_uc009zka.2_Intron	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		GAAGGAGAAAGAAAAGCAAAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	52266697	52266697	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52266697delT								FIGNL2 (50489 upstream) : ANKRD33 (15096 downstream)																							atgtaagaggttatCTACTGG	0.169													4	2	---	---	---	---	
KRT83	3889	broad.mit.edu	37	12	52713951	52713951	+	Intron	DEL	T	-	-	rs5798207		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52713951delT	uc001saf.2	-							NM_002282	NP_002273	P78385	KRT83_HUMAN	keratin 83						epidermis development	keratin filament	structural molecule activity			skin(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AAATTCCACATTTTTTTTTCC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54878489	54878489	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54878489delT								GTSF1 (11103 upstream) : NCKAP1L (13006 downstream)																							AAACCATTGGTTTTTTTTTTT	0.318													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59329963	59329963	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59329963delA								LRIG3 (15701 upstream) : SLC16A7 (659885 downstream)																							aatcaagcagaaaaaaatcaa	0.000													4	2	---	---	---	---	
LEMD3	23592	broad.mit.edu	37	12	65605008	65605008	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65605008delA	uc001ssl.1	+						LEMD3_uc009zqo.1_Intron	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3						negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		ACTTTACTGTAAAAGACTACT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	66006669	66006669	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66006669delC								MSRB3 (145989 upstream) : RPSAP52 (145134 downstream)																							AGTTTCTCGTCCCCATCAAAC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	85154045	85154045	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85154045delT								None (None upstream) : SLC6A15 (99224 downstream)																							ctttaccagattaccatgctg	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	89441327	89441327	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89441327delC								KITLG (467089 upstream) : DUSP6 (300512 downstream)																							AGCTGAGCTTCCCCCAGGTCC	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	92790295	92790296	+	IGR	INS	-	AG	AG			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92790295_92790296insAG								BTG1 (250622 upstream) : CLLU1OS (23574 downstream)																							GAAACAGAGAAAGAGAGAGAAA	0.297													4	2	---	---	---	---	
USP44	84101	broad.mit.edu	37	12	95911790	95911790	+	3'UTR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95911790delA	uc001teg.2	-	6					USP44_uc001teh.2_3'UTR|USP44_uc009zte.2_3'UTR	NM_001042403	NP_001035862	Q9H0E7	UBP44_HUMAN	ubiquitin thiolesterase 44						anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)|breast(1)|central_nervous_system(1)	3						TATACTTTGTAAAAAAAAAAA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	108170730	108170730	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108170730delG								ASCL4 (310 upstream) : WSCD2 (352781 downstream)																							TTTGGTTTGTGGGGGAAGAAG	0.403													4	2	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111980859	111980859	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111980859delT	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsm.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						AACTATTCTGTTTAGCTTTCC	0.338													4	2	---	---	---	---	
MED13L	23389	broad.mit.edu	37	12	116422401	116422401	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116422401delA	uc001tvw.2	-							NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TAGGCTCTCTAAAAAAAAAAA	0.388													4	2	---	---	---	---	
FBXW8	26259	broad.mit.edu	37	12	117424585	117424585	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117424585delT	uc001twg.1	+						FBXW8_uc001twf.1_Intron|FBXW8_uc009zwp.1_Intron	NM_153348	NP_699179	Q8N3Y1	FBXW8_HUMAN	F-box and WD repeat domain containing 8 isoform								protein binding			ovary(2)|pancreas(1)	3	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)		GACTGGAAGCTTTTTGAACTA	0.468													4	2	---	---	---	---	
CCDC64	92558	broad.mit.edu	37	12	120428185	120428185	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120428185delC	uc001txl.1	+						CCDC64_uc001txk.2_Intron|CCDC64_uc009zwv.1_Intron	NM_207311	NP_997194	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64						Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAACCACTCACCCCCACTTCG	0.607													4	2	---	---	---	---	
RNF10	9921	broad.mit.edu	37	12	121011158	121011158	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121011158delT	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ccatatccccttttttttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127509197	127509197	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127509197delT	uc001uho.2	-											Homo sapiens cDNA clone IMAGE:4829480.																		GTTGGACGGGTGGacatgtct	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132995527	132995527	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132995527delG								GALNT9 (89622 upstream) : FBRSL1 (71630 downstream)																							tacccgcagtggtttgctgca	0.219													4	2	---	---	---	---	
ZMYM2	7750	broad.mit.edu	37	13	20645239	20645239	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20645239delT	uc001umr.2	+						ZMYM2_uc001ums.2_Intron|ZMYM2_uc001umt.2_Intron|ZMYM2_uc001umv.2_Intron|ZMYM2_uc001umw.2_Intron	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198						regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AGTCTTCTGGtttttttttga	0.199													4	2	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32712381	32712381	+	Intron	DEL	T	-	-	rs71919851		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32712381delT	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GTTCATTAAATTTTTTTTCTA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	34551162	34551162	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34551162delA								RFC3 (10468 upstream) : NBEA (965294 downstream)																							aaaaattcacaataccaatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	38899177	38899178	+	IGR	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38899177_38899178insA								TRPC4 (455238 upstream) : UFM1 (24764 downstream)																							cagcgttccacaaaaaaaaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	42599978	42599978	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42599978delT								KIAA0564 (64757 upstream) : DGKH (14194 downstream)																							TTTTTTAGTATTTTTTTTTTC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	42607567	42607567	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42607567delT								KIAA0564 (72346 upstream) : DGKH (6605 downstream)																							cagcattagattctcatagga	0.000													4	2	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	49034099	49034100	+	Intron	INS	-	T	T	rs66680468		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49034099_49034100insT	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ttctttctttctttctctcttt	0.050		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			4	2	---	---	---	---	
FNDC3A	22862	broad.mit.edu	37	13	49712704	49712705	+	Intron	INS	-	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49712704_49712705insG	uc001vcm.2	+						FNDC3A_uc001vcl.1_Intron|FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron|FNDC3A_uc001vcp.1_Intron|FNDC3A_uc001vcq.2_Intron	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		AAGATAGAAATAAAAACTAAAG	0.277													4	3	---	---	---	---	
DLEU1	10301	broad.mit.edu	37	13	50961258	50961259	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50961258_50961259insT	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vek.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001ven.1_Intron|uc001veo.1_Intron|uc001vep.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0						TGAAGTTTTGATTTTTCCAATC	0.450													4	2	---	---	---	---	
NEK5	341676	broad.mit.edu	37	13	52646649	52646650	+	Intron	INS	-	G	G	rs138252998	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52646649_52646650insG	uc001vge.2	-							NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5								ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		AAAGAGTGGCAGTTAAAACTTT	0.421													4	2	---	---	---	---	
RBM26	64062	broad.mit.edu	37	13	79894530	79894533	+	3'UTR	DEL	TTTC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79894530_79894533delTTTC	uc001vkz.2	-	22					RBM26_uc001vky.2_3'UTR|RBM26_uc001vla.2_3'UTR|RBM26_uc010tia.1_3'UTR|RBM26_uc001vkx.2_3'UTR	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26						mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		ATTGCATATGTTTCTAGTGTGATG	0.289													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	87674330	87674331	+	IGR	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87674330_87674331insA								None (None upstream) : SLITRK5 (650539 downstream)																							CCGCAAAAATTAAAAAAAAAGT	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	91825404	91825404	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91825404delG								LOC144776 (246553 upstream) : MIR17HG (174670 downstream)																							TCTAAATCTTGGGGCTTAGAT	0.438													4	2	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	94075306	94075307	+	Intron	INS	-	T	T	rs1323992		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94075306_94075307insT	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				ggtcacaccccaccagctcccc	0.109													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	95963600	95963600	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95963600delC								ABCC4 (9913 upstream) : CLDN10 (122253 downstream)																							AGAAAGTCAgccccccaacat	0.020													4	2	---	---	---	---	
SLC15A1	6564	broad.mit.edu	37	13	99361222	99361222	+	Intron	DEL	T	-	-	rs71774276		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99361222delT	uc001vno.2	-							NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide						digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	GCATATTTACttttttttttt	0.204													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	104299130	104299131	+	IGR	INS	-	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104299130_104299131insG								SLC10A2 (579934 upstream) : None (None downstream)																							gcttatcggcaggtcaattctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	111463498	111463498	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111463498delT								ING1 (90078 upstream) : C13orf29 (52836 downstream)																							GGACTGGGGGTGCATCCCCAC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112037216	112037216	+	IGR	DEL	T	-	-	rs67478018		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112037216delT								C13orf16 (40623 upstream) : SOX1 (684697 downstream)																							tatctgcatgtgtgtgtgtgt	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112849976	112849976	+	IGR	DEL	C	-	-	rs72384356		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112849976delC								SOX1 (123956 upstream) : C13orf28 (180693 downstream)																							cttccttcctctttcccttcc	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112882682	112882682	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112882682delT								SOX1 (156662 upstream) : C13orf28 (147987 downstream)																							gaattgctgcttttttttctt	0.000													4	2	---	---	---	---	
TFDP1	7027	broad.mit.edu	37	13	114256937	114256938	+	Intron	INS	-	CTTTT	CTTTT			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114256937_114256938insCTTTT	uc001vtw.2	+						TFDP1_uc010tkd.1_Intron|TFDP1_uc010tke.1_Intron|TFDP1_uc001vty.3_Intron|TFDP1_uc010agx.2_Intron	NM_007111	NP_009042	Q14186	TFDP1_HUMAN	transcription factor Dp-1						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			lung(4)|ovary(2)|skin(1)	7	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			AGCTCTGCTTACTTTTGAAATT	0.342										TSP Lung(29;0.18)			4	2	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114754134	114754134	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114754134delA	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ctgtccatccatccatcactc	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114907306	114907307	+	IGR	DEL	CA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114907306_114907307delCA								RASA3 (9211 upstream) : CDC16 (93055 downstream)																							tgcacatgctcacacacatcct	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19112336	19112337	+	IGR	INS	-	C	C	rs143668329	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19112336_19112337insC								None (None upstream) : OR11H12 (265257 downstream)																							TTAAAATTGGGAAAGTATTTTC	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19610970	19610971	+	Intron	INS	-	CTTT	CTTT			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19610970_19610971insCTTT	uc001vvi.2	+											Homo sapiens prostate-specific P775P mRNA sequence.																		ctctcgcctgcctttctttctt	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38281841	38281841	+	Intron	DEL	C	-	-	rs60265164	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38281841delC	uc001wug.2	+						uc001wuh.2_Intron|uc001wui.2_Intron|uc001wuj.2_Intron					Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		AGATAAACAGCCAATACATTT	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	42476644	42476644	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42476644delT								LRFN5 (102894 upstream) : None (None downstream)																							GCCTCTACTGTTTTTGGAGAT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86337053	86337054	+	IGR	DEL	CA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86337053_86337054delCA								FLRT2 (242784 upstream) : None (None downstream)																							cacacacatgcacacacacaca	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	94349389	94349389	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94349389delA								PRIMA1 (94623 upstream) : C14orf86 (21687 downstream)																							tctcacttctaactgaaagaa	0.169													4	2	---	---	---	---	
DDX24	57062	broad.mit.edu	37	14	94526303	94526304	+	Intron	DEL	AA	-	-	rs36013055		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94526303_94526304delAA	uc001ycj.2	-						DDX24_uc010twq.1_Intron|DDX24_uc010twr.1_Intron	NM_020414	NP_065147	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24						RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|skin(1)	4		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		AATGCTGTGCAAAAAAAAAAAA	0.396													4	2	---	---	---	---	
IFI27L1	122509	broad.mit.edu	37	14	94550271	94550271	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94550271delA	uc001ycl.2	+						DDX24_uc001ycj.2_5'Flank|DDX24_uc010twq.1_5'Flank|DDX24_uc010twr.1_5'Flank|IFI27L1_uc001yck.2_Intron	NM_206949	NP_996832	Q96BM0	I27L1_HUMAN	interferon, alpha-inducible protein 27-like 1							integral to membrane					0						catcatctttaaaaaaagaaa	0.149													4	2	---	---	---	---	
SETD3	84193	broad.mit.edu	37	14	99876317	99876318	+	Intron	INS	-	G	G			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99876317_99876318insG	uc001ygc.2	-						SETD3_uc001ygd.2_3'UTR	NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a						peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				taatgggaggcgggggggtgaa	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20006720	20006720	+	IGR	DEL	G	-	-	rs61999500		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20006720delG								None (None upstream) : GOLGA6L6 (730374 downstream)																							attctacgaagagagtgtttc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20541315	20541315	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20541315delG								None (None upstream) : GOLGA6L6 (195779 downstream)																							tgaacagtgtggaggccatta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	25689470	25689470	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25689470delC								UBE3A (5342 upstream) : ATP10A (234392 downstream)																							aggcagGCTTCCCCCCGCCCC	0.075													4	3	---	---	---	---	
FAM189A1	23359	broad.mit.edu	37	15	29719093	29719093	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29719093delG	uc010azk.1	-							NM_015307	NP_056122	O60320	F1891_HUMAN	hypothetical protein LOC23359							integral to membrane					0						CCCAAAGCTTGGGGCAGTGCA	0.423													4	2	---	---	---	---	
AVEN	57099	broad.mit.edu	37	15	34245060	34245060	+	Intron	DEL	A	-	-	rs79147441		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34245060delA	uc001zhj.2	-							NM_020371	NP_065104	Q9NQS1	AVEN_HUMAN	cell death regulator aven						anti-apoptosis|apoptosis	endomembrane system|intracellular|membrane|membrane fraction	protein binding			kidney(1)	1		all_lung(180;1.78e-08)		all cancers(64;1.66e-15)|GBM - Glioblastoma multiforme(113;1.42e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0359)		GGCTAAAGAGAAAAAAAAAAA	0.328													3	3	---	---	---	---	
CYP19A1	1588	broad.mit.edu	37	15	51544125	51544125	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51544125delG	uc001zyz.3	-						CYP19A1_uc001zza.3_Intron|CYP19A1_uc001zzb.2_Intron|CYP19A1_uc010bey.1_Intron|CYP19A1_uc001zze.1_Intron|uc001zzf.1_5'Flank	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19						estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	tataaaatgagggggttgagc	0.358													4	2	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53967142	53967142	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53967142delA	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		CAATTGAAAGAAAAAAAAAGG	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60200885	60200885	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60200885delT								BNIP2 (219243 upstream) : FOXB1 (95536 downstream)																							GTGTGTGTGCTTTTTTTTTTT	0.323													4	2	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	61014807	61014807	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61014807delC	uc002agx.2	-							NM_134261	NP_599023	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						GACATCATGTCCACCTGCTCT	0.537													4	2	---	---	---	---	
SNX22	79856	broad.mit.edu	37	15	64440916	64440916	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64440916delT	uc002anc.1	+						SNX22_uc002amz.1_5'Flank|SNX22_uc002ana.1_5'Flank|SNX22_uc002anb.1_5'Flank	NM_024798	NP_079074	Q96L94	SNX22_HUMAN	sorting nexin 22						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0						GTTTTTCTTCTTTTGTACCTG	0.388													4	2	---	---	---	---	
IGDCC3	9543	broad.mit.edu	37	15	65638802	65638802	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65638802delT	uc002aos.2	-							NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule											ovary(3)	3						GACTCAGCtcttttttttttt	0.249													4	3	---	---	---	---	
AAGAB	79719	broad.mit.edu	37	15	67538203	67538204	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67538203_67538204insA	uc002aqk.3	-						AAGAB_uc002aql.2_Intron|AAGAB_uc010uju.1_Intron	NM_024666	NP_078942	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin-binding protein p34						protein transport	cytoplasm					0						ACAACCCCAGGAAAATTCAGAC	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	72446903	72446903	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72446903delC								SENP8 (13600 upstream) : GRAMD2 (5245 downstream)																							TTCTTTGAGGCCCACGCATGC	0.468													4	2	---	---	---	---	
EFTUD1	79631	broad.mit.edu	37	15	82473094	82473094	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82473094delT	uc002bgt.1	-						EFTUD1_uc002bgu.1_Intron	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain						mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1						tttttctttcttttttttttt	0.159													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	99143653	99143654	+	IGR	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99143653_99143654delAC								FAM169B (86042 upstream) : IGF1R (49107 downstream)																							ATGCGCATGTacacacacacat	0.188													4	2	---	---	---	---	
MEF2A	4205	broad.mit.edu	37	15	100120194	100120194	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100120194delT	uc002bve.2	+						MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Intron|MEF2A_uc002bvg.2_Intron	NM_001130926	NP_001124398	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 2						apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			tatgtggccctttaaatcaag	0.000													4	2	---	---	---	---	
TARSL2	123283	broad.mit.edu	37	15	102224572	102224572	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102224572delA	uc002bxm.2	-						TARSL2_uc002bxl.2_Intron|TARSL2_uc010usi.1_Intron	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2						threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCACCAGGTTAAAAAAAAAAT	0.254													4	2	---	---	---	---	
ABCA3	21	broad.mit.edu	37	16	2360429	2360432	+	Intron	DEL	AAAC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2360429_2360432delAAAC	uc002cpy.1	-						ABCA3_uc010bsk.1_Intron|ABCA3_uc010bsl.1_Intron	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3						response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				acaaacaaaaaaacaaacaaacaa	0.000													1	5	---	---	---	---	
LOC100128788	100128788	broad.mit.edu	37	16	2787095	2787095	+	RNA	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2787095delT	uc002crh.1	-	6		c.1353delA			LOC100128788_uc002cri.1_RNA|LOC100128788_uc010uwg.1_RNA	NR_027274				Homo sapiens cDNA FLJ31501 fis, clone NT2NE2005537.												0						AATTTTTGTGTTTTTTTTTAA	0.443													4	2	---	---	---	---	
ZNF597	146434	broad.mit.edu	37	16	3487751	3487752	+	Intron	INS	-	GG	GG			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3487751_3487752insGG	uc002cvd.2	-							NM_152457	NP_689670	Q96LX8	ZN597_HUMAN	zinc finger protein 597						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTAAGGAGAGAATAGCTATAAC	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3958951	3958951	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3958951delC								CREBBP (28830 upstream) : ADCY9 (53702 downstream)																							GGTCTGGCCTCCCCCAGACCC	0.458													4	2	---	---	---	---	
DNAJA3	9093	broad.mit.edu	37	16	4481227	4481228	+	Intron	DEL	GA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4481227_4481228delGA	uc002cwk.2	+						DNAJA3_uc002cwl.2_Intron|DNAJA3_uc010uxk.1_Intron	NM_005147	NP_005138	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3						activation of caspase activity|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of cell proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein kinase activity|neuromuscular junction development|positive regulation of apoptosis|positive regulation of protein ubiquitination|protein folding|protein folding|protein stabilization|response to heat|response to interferon-gamma	cytosol|mitochondrial matrix|mitochondrial nucleoid|nucleus	ATP binding|heat shock protein binding|interferon-gamma receptor binding|metal ion binding|NF-kappaB binding|protein kinase binding			ovary(2)|breast(2)	4						AATGAGTGGTGAGAGAGAGGCT	0.500													4	2	---	---	---	---	
ABAT	18	broad.mit.edu	37	16	8861834	8861834	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8861834delA	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	cacccagccTAAAATTTGTGA	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9175242	9175242	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9175242delC								USP7 (117901 upstream) : C16orf72 (10295 downstream)																							cagaagccctccccagaggtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10930411	10930411	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10930411delA								FAM18A (17790 upstream) : CIITA (40644 downstream)																							TGAatcatgcaaaaaatgggt	0.104													4	2	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18821302	18821302	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18821302delA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron|SMG1_uc010bwa.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						ACGGTTTCTTAAAAAAAAAAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	20136789	20136790	+	IGR	DEL	GT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20136789_20136790delGT								GPR139 (51689 upstream) : GP2 (185022 downstream)																							CCAAATGCTGGTGACTCAAAAA	0.248													4	2	---	---	---	---	
TNRC6A	27327	broad.mit.edu	37	16	24814297	24814297	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24814297delT	uc002dmm.2	+						TNRC6A_uc010bxs.2_Intron|TNRC6A_uc002dmn.2_Intron|TNRC6A_uc002dmo.2_Intron|TNRC6A_uc002dmp.2_5'Flank|TNRC6A_uc002dmq.2_5'Flank	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		GAGAAGATCATTTTTTATTGC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32501375	32501376	+	IGR	INS	-	T	T	rs148589092	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32501375_32501376insT								HERC2P4 (337501 upstream) : TP53TG3B (183465 downstream)																							ttgtaacactgtttttttgtcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33919395	33919395	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33919395delG								None (None upstream) : MIR1826 (46113 downstream)																							ttatcactttgtagattctac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33982745	33982746	+	IGR	DEL	AG	-	-	rs144014292		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33982745_33982746delAG								MIR1826 (17153 upstream) : UBE2MP1 (421056 downstream)																							cagcttggatagagtctttttg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49235739	49235739	+	IGR	DEL	C	-	-	rs34711939		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49235739delC								N4BP1 (591619 upstream) : CBLN1 (76472 downstream)																							CTTTTTAACTCCCCCTCCAGG	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49885963	49885963	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49885963delA								ZNF423 (25045 upstream) : TMEM188 (173226 downstream)																							CTGAATCGAGAAACCTGTAAC	0.388													4	2	---	---	---	---	
FTO	79068	broad.mit.edu	37	16	54050554	54050554	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54050554delC	uc002ehr.2	+						FTO_uc010vha.1_Intron|FTO_uc010cbz.2_Intron|FTO_uc002ehs.2_Intron	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CTGTCCCTTGCCCCGAAAGTA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	62958446	62958446	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62958446delA								CDH8 (888410 upstream) : None (None downstream)																							TTCTCACGAGAAAAAAAATCT	0.353													4	2	---	---	---	---	
WWP2	11060	broad.mit.edu	37	16	69930998	69930998	+	Intron	DEL	T	-	-	rs11343848		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69930998delT	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						TCTCCCCGTCttttttttttt	0.214													4	2	---	---	---	---	
FUK	197258	broad.mit.edu	37	16	70501069	70501069	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70501069delC	uc002eyy.2	+						FUK_uc010vmb.1_3'UTR|FUK_uc010cft.2_Intron|FUK_uc002eyz.2_Intron	NM_145059	NP_659496	Q8N0W3	FUK_HUMAN	fucokinase							cytoplasm	ATP binding|fucokinase activity			ovary(1)	1		Ovarian(137;0.0694)				agcagccctgccccttctgtc	0.368													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73856416	73856416	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73856416delT								HTA (728746 upstream) : PSMD7 (474265 downstream)																							CTGCTTTTGCTTTTTTTTTTT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74822567	74822567	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74822567delG								FA2H (13846 upstream) : WDR59 (84904 downstream)																							gggtgacagagggagactcca	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	76828309	76828309	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76828309delT								CNTNAP4 (235174 upstream) : MON1B (396527 downstream)																							tgttactttgttttttttttt	0.000													4	4	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78889285	78889285	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78889285delA	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TGCGGGGAGGAAAAAAAAACA	0.348													4	2	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81155069	81155069	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81155069delA	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						actccatctcaaaaaaaaaaa	0.239													7	4	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81245100	81245100	+	Intron	DEL	A	-	-	rs35111351		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81245100delA	uc002fgh.1	-						PKD1L2_uc002fgj.2_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CTCCACCATCACGGTTCATAC	0.552													2	5	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81729320	81729321	+	Intron	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81729320_81729321delAC	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron|CMIP_uc002fgr.1_Intron|CMIP_uc010vnr.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						TTCCTCCcatacacacacacac	0.233													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82663075	82663075	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82663075delA	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		TGTGCCATAGAAAAAAGTGGG	0.408													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	82765779	82765779	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82765779delC	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ctgcacgcttccccaggtaga	0.055													4	2	---	---	---	---	
MYBBP1A	10514	broad.mit.edu	37	17	4443453	4443453	+	Intron	DEL	C	-	-	rs66511920		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4443453delC	uc002fyb.3	-						MYBBP1A_uc002fxz.3_Intron|MYBBP1A_uc002fya.3_Intron|MYBBP1A_uc010vsa.1_Intron	NM_014520	NP_055335	Q9BQG0	MBB1A_HUMAN	MYB binding protein 1a isoform 2						nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2						TCCTGCGAGGCTCCTGCGAGG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6622971	6622971	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6622971delG								SLC13A5 (6231 upstream) : XAF1 (35823 downstream)																							GGGAAATGGTGGGGGGGGGCT	0.408													4	2	---	---	---	---	
MYH10	4628	broad.mit.edu	37	17	8397862	8397862	+	Intron	DEL	T	-	-	rs75074367		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8397862delT	uc002gll.2	-						MYH10_uc002glm.2_Intron|MYH10_uc010cnx.2_Intron	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle						actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						CTGTCTGAGATTTTTTTTTTT	0.289													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	11096055	11096055	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11096055delA								PIRT (354637 upstream) : SHISA6 (48685 downstream)																							TAAGTGATCCAAAATAGAAGA	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16267079	16267080	+	IGR	INS	-	G	G	rs141112366	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16267079_16267080insG								CENPV (10267 upstream) : UBB (17287 downstream)																							TAAGTTCCTATGGGGGGGGCGG	0.401											OREG0024201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
NOS2	4843	broad.mit.edu	37	17	26163651	26163652	+	Intron	DEL	AA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26163651_26163652delAA	uc010crh.1	-							NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	atcaaattttaaaaaggaaatg	0.000													4	2	---	---	---	---	
SGK494	124923	broad.mit.edu	37	17	26934997	26935000	+	3'UTR	DEL	TTAT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26934997_26935000delTTAT	uc002hbr.1	-	10					SGK494_uc010waq.1_Intron|SGK494_uc010war.1_Intron	NM_144610	NP_653211			uncharacterized serine/threonine-protein kinase												0						ATACATTGCCttatttatttatat	0.147													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31775926	31775926	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31775926delA	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GAACCTagtcaaaagaacaca	0.055													4	2	---	---	---	---	
FBXL20	84961	broad.mit.edu	37	17	37495846	37495847	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37495846_37495847insA	uc010wed.1	-						FBXL20_uc002hrt.2_Intron|FBXL20_uc010cvu.2_Intron	NM_032875	NP_116264	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20							cytoplasm				ovary(1)	1			LUAD - Lung adenocarcinoma(14;0.146)			aatcctgggccaaaaaaagaat	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43087555	43087555	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43087555delC								C1QL1 (41911 upstream) : DCAKD (13151 downstream)																							TTGAAATCCTCCACTGAATGG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44486655	44486655	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44486655delT								ARL17A (47492 upstream) : LRRC37A2 (103421 downstream)																							TACAGTCttcttttttttttt	0.134													6	3	---	---	---	---	
MYCBPAP	84073	broad.mit.edu	37	17	48587312	48587312	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48587312delA	uc010wmr.1	+						MYCBPAP_uc002iqx.2_Intron|MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			ggcagacaagaaaaaaaagga	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48769616	48769619	+	IGR	DEL	AAAG	-	-	rs67164083		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48769616_48769619delAAAG								ABCC3 (554 upstream) : ANKRD40 (933 downstream)																							GCAAGCCAACAAAGAGTTTCTTTT	0.510													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51609994	51609994	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51609994delT								None (None upstream) : KIF2B (290245 downstream)																							tcttgccccATTTTTTTTAAT	0.169													2	4	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59073659	59073659	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59073659delA	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			agagtattgcaaaaaatcagg	0.000													4	2	---	---	---	---	
MXRA7	439921	broad.mit.edu	37	17	74697416	74697416	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74697416delT	uc002jsk.1	-						MXRA7_uc002jsl.2_Intron|MXRA7_uc002jsm.2_Intron	NM_001008528	NP_001008528	P84157	MXRA7_HUMAN	transmembrane anchor protein 1 isoform 1							integral to membrane					0						ATGTCTGGGCTTTTGGTCTGA	0.602													4	2	---	---	---	---	
PDE6G	5148	broad.mit.edu	37	17	79620833	79620834	+	Intron	DEL	TT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79620833_79620834delTT	uc002kay.3	-						PDE6G_uc002kaz.3_Intron	NM_002602	NP_002593	P18545	CNRG_HUMAN	phosphodiesterase 6G						platelet activation|visual perception	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|enzyme inhibitor activity				0	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CTACTCTGGgtttttttttgtt	0.302													4	2	---	---	---	---	
TYMS	7298	broad.mit.edu	37	18	669367	669367	+	Intron	DEL	T	-	-	rs143773032		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:669367delT	uc010dka.1	+						TYMS_uc010dkb.1_Intron|TYMS_uc010dkc.1_Intron	NM_001071	NP_001062	P04818	TYSY_HUMAN	thymidylate synthase						DNA repair|DNA replication|phosphatidylinositol-mediated signaling|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to organophosphorus	cytosol	thymidylate synthase activity				0					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Pemetrexed(DB00642)|Raltitrexed(DB00293)|Trifluridine(DB00432)	gcCCAGAGGAttttttttttt	0.025													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	5133768	5133768	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5133768delA								DLGAP1 (678502 upstream) : LOC642597 (9904 downstream)																							AGACCAGACTAAAAGGGACCC	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	6441525	6441525	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6441525delA								L3MBTL4 (26615 upstream) : ARHGAP28 (346968 downstream)																							CTTCTTTGGCAAAAAGGTTTT	0.408													4	2	---	---	---	---	
RAB31	11031	broad.mit.edu	37	18	9706445	9706445	+	5'Flank	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9706445delG	uc002kog.2	+							NM_006868	NP_006859	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1						CAAATAGACTGGGGCGATTCT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14155112	14155113	+	IGR	INS	-	A	A	rs138270849	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14155112_14155113insA								ZNF519 (22683 upstream) : LOC284233 (182309 downstream)																							ATTATTTGTACAAAAAAAAATG	0.292													2	4	---	---	---	---	
POTEC	388468	broad.mit.edu	37	18	14535288	14535288	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14535288delT	uc010dln.2	-						POTEC_uc010xaj.1_Intron	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2											skin(3)	3						Ttttggatgattttttttttc	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15223131	15223131	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15223131delT								ANKRD30B (370394 upstream) : LOC644669 (90424 downstream)																							CTACATAGTGTTTCCTGTCTA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15225876	15225877	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15225876_15225877insT								ANKRD30B (373139 upstream) : LOC644669 (87678 downstream)																							GCTGATTATTCTTTTTTTTTTC	0.307													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	18786143	18786143	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18786143delT								ROCK1 (94331 upstream) : GREB1L (36060 downstream)																							CAGTATAAACttttttttttt	0.204													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	19230441	19230441	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19230441delA								SNRPD1 (20233 upstream) : ABHD3 (417 downstream)																							tcactttcctaaaaggggaga	0.015													4	2	---	---	---	---	
OSBPL1A	114876	broad.mit.edu	37	18	21929706	21929707	+	Intron	DEL	AC	-	-	rs144586672	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21929706_21929707delAC	uc002kve.2	-							NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					aaaaaaaaaaacaacaacagtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	23032849	23032849	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23032849delG								ZNF521 (100635 upstream) : SS18 (563370 downstream)																							ccaaaaaagtgGTCAAAATTA	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	26076953	26076953	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26076953delT								CDH2 (319508 upstream) : None (None downstream)																							TCGCATGCAATTTATGTCAAT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	28443559	28443560	+	IGR	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28443559_28443560delAC								MIR302F (564633 upstream) : DSC3 (126493 downstream)																							atacatacatacacacacacac	0.262													4	2	---	---	---	---	
B4GALT6	9331	broad.mit.edu	37	18	29253903	29253904	+	Intron	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29253903_29253904delAC	uc002kwz.3	-						B4GALT6_uc010dma.2_Intron|B4GALT6_uc010dmb.2_Intron	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	beta-1,4-galactosyltransferase 6						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding				0			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			acacacacagacacacacacac	0.050													5	3	---	---	---	---	
KIAA1012	22878	broad.mit.edu	37	18	29429921	29429921	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29429921delT	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0						ACCCTAAATCttttttttttt	0.159													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	33407932	33407932	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33407932delT								GALNT1 (116135 upstream) : MIR187 (76849 downstream)																							TAAAGACTCCTTTCAGCCTCA	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36062726	36062726	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36062726delA								CELF4 (916726 upstream) : LOC647946 (724162 downstream)																							CCTATCAGGGAAAAAAGTTTG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	38638658	38638658	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38638658delT								None (None upstream) : KC6 (421580 downstream)																							TCCTCTAGGGTTTTTTTTTTC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	38658141	38658143	+	IGR	DEL	TTC	-	-	rs72337349		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38658141_38658143delTTC								None (None upstream) : KC6 (402095 downstream)																							CATGCAGTCTTTCTTCTTCTTCT	0.251													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	40965889	40965889	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40965889delC								SYT4 (108274 upstream) : None (None downstream)																							AAAGATATCTCCACACTGAAT	0.318													4	2	---	---	---	---	
SLC14A2	8170	broad.mit.edu	37	18	43171023	43171023	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43171023delA	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						ATCCCACCCCAACACACAGAC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45073269	45073269	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45073269delG	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																		AGGGGCAACTGGGGAGACTAA	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45294102	45294102	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45294102delA								IER3IP1 (591357 upstream) : SMAD2 (65365 downstream)																							agatgcatgcaaagaggcaaa	0.000													3	3	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	49872723	49872723	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49872723delT	uc002lfe.1	+							NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGTTAATTCCTTATCTTATAT	0.318													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	49895611	49895611	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49895611delT	uc002lfe.1	+							NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCTTTGTGGGTTTTTTTTCTT	0.328													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50535936	50535936	+	Intron	DEL	T	-	-	rs112501372		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50535936delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GTTAGGTGACTTTTTTTTTAG	0.358													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50915165	50915165	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50915165delT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TTAAAGTTCAttttttttgag	0.129													4	2	---	---	---	---	
PHLPP1	23239	broad.mit.edu	37	18	60524164	60524165	+	Intron	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60524164_60524165insT	uc002lis.2	+							NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein						apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						ttctcaagctgttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	61133844	61133845	+	IGR	INS	-	C	C			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61133844_61133845insC								VPS4B (44092 upstream) : SERPINB5 (10299 downstream)																							cagagtgggaaccagccagtct	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	66251078	66251078	+	IGR	DEL	A	-	-	rs11306455		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66251078delA								None (None upstream) : TMX3 (89849 downstream)																							TTACCATCACAAAAAAAGCAC	0.388													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	71603212	71603212	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71603212delC								None (None upstream) : FBXO15 (137376 downstream)																							TCGGAGTAAGCCCCAAACCCC	0.468													4	2	---	---	---	---	
ZNF516	9658	broad.mit.edu	37	18	74187759	74187760	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74187759_74187760insA	uc002lme.2	-									Q92618	ZN516_HUMAN	Synthetic construct DNA, clone: pF1KSDA0222, Homo sapiens ZNF516 gene for zinc finger protein 516, complete cds, without stop codon, in Flexi system.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		TACGCAAAATTAAAAAAAAATT	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75134590	75134590	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75134590delT								GALR1 (152496 upstream) : None (None downstream)																							CATTGATCACTTTTTTTTTTC	0.393													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6346322	6346322	+	IGR	DEL	A	-	-	rs75770675		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6346322delA								ACER1 (12682 upstream) : CLPP (15141 downstream)																							TCCTTCCTCCAAAAAAAAGTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7639909	7639909	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7639909delT								PNPLA6 (13257 upstream) : KIAA1543 (20879 downstream)																							acccggccacttttttttttt	0.000													4	2	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10085284	10085284	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10085284delA	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TCAAAGTGTTAAACAGTGAGT	0.139													4	2	---	---	---	---	
CNN1	1264	broad.mit.edu	37	19	11660002	11660003	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11660002_11660003insA	uc002msc.1	+						CNN1_uc010xmb.1_Intron|CNN1_uc010xmc.1_Intron	NM_001299	NP_001290	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle						actomyosin structure organization|regulation of smooth muscle contraction	cytoskeleton	actin binding|calmodulin binding				0						gactccgtctcaaaaaaaaata	0.173													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	11954644	11954644	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11954644delG								ZNF440 (8628 upstream) : ZNF439 (4935 downstream)																							tagtgagcaagggccctgagc	0.000													4	2	---	---	---	---	
MED26	9441	broad.mit.edu	37	19	16686550	16686550	+	3'UTR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16686550delT	uc002nen.1	-	3					MED26_uc002nee.2_Intron	NM_004831	NP_004822	O95402	MED26_HUMAN	mediator complex subunit 26						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|RNA polymerase II transcription cofactor activity|transcription coactivator activity			ovary(2)	2						GGACTAACGCTTTTTATAGCT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	18169240	18169240	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18169240delT								ARRDC2 (44335 upstream) : IL12RB1 (1131 downstream)																							GGTCTCATCCTTTTTTTGCCA	0.577											OREG0025356	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21393865	21393865	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21393865delC								ZNF431 (25060 upstream) : ZNF708 (80098 downstream)																							ATCACAGTCACCACCCAGCAA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28447092	28447093	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28447092_28447093insT								LOC148189 (162244 upstream) : None (None downstream)																							AAATTATCACATTTTTTTTTCT	0.317													4	2	---	---	---	---	
ZNF567	163081	broad.mit.edu	37	19	37183032	37183032	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37183032delT	uc010xtl.1	+						ZNF567_uc002oeo.1_Intron|ZNF567_uc010xtk.1_Intron|ZNF567_uc002oep.3_Intron	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			cattcgggtctttttgtagat	0.030													4	2	---	---	---	---	
ZNF829	374899	broad.mit.edu	37	19	37383698	37383699	+	Intron	DEL	AT	-	-	rs28635726	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37383698_37383699delAT	uc002ofa.1	-						ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aaaaaaaaaaattttttttGCC	0.475													5	3	---	---	---	---	
TIMM50	92609	broad.mit.edu	37	19	39975044	39975045	+	Intron	INS	-	A	A			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39975044_39975045insA	uc002olu.1	+						TIMM50_uc002olt.1_Intron|TIMM50_uc002olv.1_5'Flank	NM_001001563	NP_001001563	Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50						mitochondrial membrane organization|protein transport|release of cytochrome c from mitochondria|transmembrane transport	integral to membrane|mitochondrial inner membrane presequence translocase complex|nuclear speck	interleukin-2 receptor binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|ribonucleoprotein binding|RNA binding			ovary(1)	1	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			tctccatctctaaaaaaaaata	0.045													4	2	---	---	---	---	
FCGBP	8857	broad.mit.edu	37	19	40383839	40383840	+	Frame_Shift_Ins	INS	-	GT	GT			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40383839_40383840insGT	uc002omp.3	-	21	9778_9779	c.9770_9771insAC	c.(9769-9771)CTCfs	p.L3257fs		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3257						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CGGATGGCAGGAGGCCACACAC	0.668													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	44978021	44978021	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44978021delT								ZNF229 (25255 upstream) : ZNF180 (1839 downstream)																							atttctagggttctcctgaat	0.184													4	2	---	---	---	---	
ZNF549	256051	broad.mit.edu	37	19	58066091	58066091	+	3'UTR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58066091delC	uc010eud.1	+	4					ZNF547_uc002qpm.3_Intron|ZNF550_uc002qpc.2_Intron|ZNF550_uc010eue.1_Intron|ZNF550_uc002qpd.2_Intron|ZNF550_uc002qpe.1_Intron			Q6P9A3	ZN549_HUMAN	Homo sapiens cDNA FLJ34917 fis, clone NT2RP7002028.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTGCTACATGCCTGGCTTTGA	0.468													4	2	---	---	---	---	
ZNF551	90233	broad.mit.edu	37	19	58197026	58197026	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58197026delT	uc002qpw.3	+						ZNF551_uc002qpv.3_Intron|ZNF776_uc002qpx.2_Intron	NM_138347	NP_612356	Q7Z340	ZN551_HUMAN	zinc finger protein 551						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AAGACTCTCCTTTGAGTGTTT	0.413													4	2	---	---	---	---	
SRXN1	140809	broad.mit.edu	37	20	637982	637982	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:637982delC	uc002web.2	-									Q9BYN0	SRXN1_HUMAN	Homo sapiens full length insert cDNA YO23H03.						response to oxidative stress	cytosol	antioxidant activity|ATP binding|DNA binding|sulfiredoxin activity			ovary(1)	1						gtgggtgctgcaaaagaatGG	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	1923589	1923591	+	IGR	DEL	TCC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1923589_1923591delTCC								SIRPA (3050 upstream) : PDYN (35812 downstream)																							CCATCACTTTTCCTCCTCCTCCA	0.320													4	2	---	---	---	---	
PTPRA	5786	broad.mit.edu	37	20	2990500	2990500	+	Intron	DEL	T	-	-	rs36013325		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2990500delT	uc010zqd.1	+						PTPRA_uc002whj.2_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron|PTPRA_uc002whn.2_Intron|PTPRA_uc002who.2_Intron	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						gatgggaacattttttttttt	0.070													1	5	---	---	---	---	
MAVS	57506	broad.mit.edu	37	20	3843259	3843260	+	Intron	INS	-	T	T	rs138993117	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3843259_3843260insT	uc002wjw.3	+						MAVS_uc002wjx.3_Intron|MAVS_uc002wjy.3_Intron	NM_020746	NP_065797	Q7Z434	MAVS_HUMAN	virus-induced signaling adapter						activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity				0						agttttccaaatttttttttta	0.119													4	2	---	---	---	---	
BMP2	650	broad.mit.edu	37	20	6751465	6751465	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6751465delA	uc002wmu.1	+							NM_001200	NP_001191	P12643	BMP2_HUMAN	bone morphogenetic protein 2 preproprotein						BMP signaling pathway involved in heart induction|bone mineralization involved in bone maturation|cardiac cell differentiation|cardiac epithelial to mesenchymal transition|cartilage development|growth|negative regulation of cell cycle|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|pathway-restricted SMAD protein phosphorylation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cartilage development|positive regulation of endothelial cell proliferation|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of phosphatase activity|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	activin receptor activity, type II|BMP receptor binding|cytokine activity|growth factor activity|phosphatase activator activity|protein heterodimerization activity|SMAD binding|transforming growth factor beta receptor binding			ovary(1)|breast(1)	2					Simvastatin(DB00641)	GGAAAAGGAGAAAAAGGGAGG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10750014	10750014	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10750014delC								JAG1 (95320 upstream) : None (None downstream)																							ATGTGTGGTTCCCATATGTGC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12858061	12858064	+	IGR	DEL	AAAT	-	-	rs144626237		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12858061_12858064delAAAT								BTBD3 (950819 upstream) : SPTLC3 (131563 downstream)																							TTGCCATGACAAATGAATGAAAAG	0.324													3	3	---	---	---	---	
PCSK2	5126	broad.mit.edu	37	20	17320151	17320152	+	Intron	INS	-	TTG	TTG	rs138751578	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17320151_17320152insTTG	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	tttggttgtttttgttgttgtt	0.005													4	2	---	---	---	---	
TMEM90B	79953	broad.mit.edu	37	20	24460611	24460612	+	Intron	DEL	CA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24460611_24460612delCA	uc002wtw.1	+							NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						caaatgcctgcacacacacaca	0.327													4	2	---	---	---	---	
NDRG3	57446	broad.mit.edu	37	20	35376249	35376249	+	5'Flank	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35376249delT	uc002xfw.2	-						NDRG3_uc002xfx.2_5'Flank|NDRG3_uc010zvq.1_5'Flank|NDRG3_uc010zvr.1_5'Flank	NM_032013	NP_114402	Q9UGV2	NDRG3_HUMAN	N-myc downstream regulated gene 3 isoform a						cell differentiation|negative regulation of cell growth|spermatogenesis	cytoplasm				ovary(1)	1		Myeloproliferative disorder(115;0.00878)				tctgtccccattttacagatg	0.129													4	2	---	---	---	---	
DSN1	79980	broad.mit.edu	37	20	35382752	35382752	+	Intron	DEL	A	-	-	rs78743674		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35382752delA	uc010gfr.2	-						DSN1_uc002xfz.2_Intron|DSN1_uc002xfy.3_Intron|DSN1_uc002xga.2_Intron|DSN1_uc010zvs.1_Intron|DSN1_uc002xgc.2_Intron|DSN1_uc002xgb.2_Intron	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,						cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				cccccagcccaaaaaaaaagt	0.164													4	2	---	---	---	---	
SRC	6714	broad.mit.edu	37	20	35988306	35988306	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35988306delT	uc002xgx.2	+						SRC_uc002xgy.2_Intron	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC						axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	GGGCCAAGCATTTTTTTTTTC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36063706	36063707	+	IGR	DEL	TG	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36063706_36063707delTG								SRC (29887 upstream) : BLCAP (82113 downstream)																							TCCTTCCTGCTGTGTGTGTGTT	0.470													4	2	---	---	---	---	
LOC388796	388796	broad.mit.edu	37	20	37050926	37050927	+	Intron	INS	-	A	A	rs139941859	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37050926_37050927insA	uc002xie.3	-						LOC388796_uc002xii.3_Intron|LOC388796_uc002xig.3_Intron|LOC388796_uc002xih.3_Intron|LOC388796_uc002xij.3_Intron|LOC388796_uc002xif.3_Intron					Homo sapiens cDNA FLJ12683 fis, clone NT2RM4002457.												0						GACAACAGTCCAAAATCCCACC	0.520													3	3	---	---	---	---	
DNTTIP1	116092	broad.mit.edu	37	20	44438130	44438130	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44438130delC	uc002xpk.2	+							NM_052951	NP_443183	Q9H147	TDIF1_HUMAN	terminal deoxynucleotidyltransferase interacting							nucleus				ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.0122)				actactttttcccactactgc	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46820406	46820407	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46820406_46820407insT								SULF2 (405046 upstream) : LOC284749 (168247 downstream)																							aattatccctgtttttttaaat	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49312403	49312404	+	IGR	INS	-	T	T			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49312403_49312404insT								FAM65C (4487 upstream) : PARD6B (35677 downstream)																							TTTTTTTGGTGTTGTTTTTTTT	0.139													4	2	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51684076	51684076	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51684076delA	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CATCAGTGCCAAAAATATACA	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	52484166	52484167	+	IGR	INS	-	C	C	rs140159898	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52484166_52484167insC								ZNF217 (273365 upstream) : SUMO1P1 (6875 downstream)																							AAGTATGCTTTTTTTTTTATCA	0.347													1	5	---	---	---	---	
RBM38	55544	broad.mit.edu	37	20	55973306	55973307	+	Intron	DEL	GT	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55973306_55973307delGT	uc010zzj.1	+						RBM38_uc010zzk.1_Intron	NM_017495	NP_059965	Q9H0Z9	RBM38_HUMAN	RNA-binding region containing protein 1 isoform						3'-UTR-mediated mRNA stabilization|cell cycle|cell cycle arrest|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mRNA processing|negative regulation of cell proliferation|regulation of RNA splicing|RNA splicing	cytosol|cytosol|nucleus|nucleus	mRNA 3'-UTR binding|mRNA binding|nucleotide binding|RNA binding				0	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			AGGTGATGGCgtgtgtgtgtgt	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57984995	57984996	+	IGR	DEL	GA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57984995_57984996delGA								EDN3 (83949 upstream) : PHACTR3 (167568 downstream)																							gcagacagaggagagagagaga	0.099													5	3	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60338345	60338347	+	Intron	DEL	GAT	-	-	rs137965362		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60338345_60338347delGAT	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGGAGCATCAGATGGCCCCCCAC	0.522													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62089485	62089485	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62089485delG	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	CCCCTGGCCTGGGGTCCCCTG	0.701													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11076555	11076557	+	Intron	DEL	TAA	-	-	rs151275384		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11076555_11076557delTAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tctaatttgttaataataatata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	16187214	16187215	+	IGR	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16187214_16187215delAC								SAMSN1 (231491 upstream) : NRIP1 (146341 downstream)																							AGCTCTGCCAacacacacacac	0.337													4	2	---	---	---	---	
PSMG1	8624	broad.mit.edu	37	21	40548158	40548158	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40548158delA	uc002yxi.2	-						PSMG1_uc002yxj.2_Intron|PSMG1_uc010gob.2_Intron	NM_003720	NP_003711	O95456	PSMG1_HUMAN	Down syndrome critical region protein 2 isoform						proteasome assembly	endoplasmic reticulum	protein binding				0		Prostate(19;8.44e-08)				TCTCCAAAGCAAAAATGAAAA	0.388													4	2	---	---	---	---	
C2CD2	25966	broad.mit.edu	37	21	43360197	43360197	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43360197delA	uc002yzw.2	-							NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1						cttgactagtaaaaaaataat	0.005													4	2	---	---	---	---	
PDXK	8566	broad.mit.edu	37	21	45157732	45157732	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45157732delG	uc002zdm.3	+						PDXK_uc010gpj.2_Intron|PDXK_uc002zdn.3_Intron|PDXK_uc002zdo.2_RNA|PDXK_uc002zdp.2_3'UTR	NM_003681	NP_003672	O00764	PDXK_HUMAN	pyridoxal kinase						cell proliferation|pyridoxal 5'-phosphate salvage	cytosol	ATP binding|lithium ion binding|magnesium ion binding|potassium ion binding|protein homodimerization activity|pyridoxal kinase activity|pyridoxal phosphate binding|sodium ion binding|zinc ion binding				0				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	atctgtaaatggaatgagttg	0.463													4	2	---	---	---	---	
MED15	51586	broad.mit.edu	37	22	20873098	20873098	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20873098delC	uc002zsp.2	+						MED15_uc002zsn.1_Intron|MED15_uc002zso.2_Intron|MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			GAACTTTTTTCCCTCACAGCT	0.294													4	2	---	---	---	---	
ZNF70	7621	broad.mit.edu	37	22	24094330	24094331	+	5'Flank	INS	-	C	C	rs145157675	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24094330_24094331insC	uc002zxs.2	-							NM_021916	NP_068735	Q9UC06	ZNF70_HUMAN	zinc finger protein 70							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						TGCCCATGACACCCCCCCCTCA	0.510													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27876538	27876538	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27876538delC								MIAT (761589 upstream) : MN1 (267728 downstream)																							AGGAGACCCTCCCCCATGCCT	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34625362	34625363	+	IGR	INS	-	CTCT	CTCT	rs146136578	by1000genomes	TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34625362_34625363insCTCT								LARGE (306778 upstream) : ISX (836766 downstream)																							TGTCTCCCTGACTCTGTTTCTC	0.361													6	5	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40724450	40724450	+	3'UTR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40724450delA	uc011aor.1	+	23					TNRC6B_uc003aym.2_3'UTR|TNRC6B_uc003ayn.3_3'UTR	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						GAGAATTTGGAAGCACCTTTA	0.363													4	2	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43602308	43602309	+	Intron	DEL	AC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43602308_43602309delAC	uc003bdt.1	-							NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				acacacccctacacacacacca	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50076150	50076150	+	IGR	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50076150delA								C22orf34 (24960 upstream) : BRD1 (90788 downstream)																							cagtttctttaatagttgtag	0.000													4	2	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2211311	2211311	+	Intron	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2211311delC	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TTTTTTTTTTCCCAGAAGGAC	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	14996198	14996198	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14996198delT								MOSPD2 (56743 upstream) : ASB9 (265913 downstream)																							GAATTGGTAGTTTTTGAAATT	0.353													4	2	---	---	---	---	
ASB9	140462	broad.mit.edu	37	X	15273107	15273107	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15273107delA	uc004cwl.2	-						ASB9_uc004cwk.2_Intron|ASB9_uc004cwm.2_Intron|ASB9_uc010ner.2_Intron|ASB9_uc004cwn.2_Intron	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform						intracellular signal transduction						0	Hepatocellular(33;0.183)					TATTGACTTTAAaaaaaaaaa	0.224													4	3	---	---	---	---	
CA5BP	340591	broad.mit.edu	37	X	15693750	15693750	+	Intron	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15693750delG	uc011mir.1	+							NR_026551				RecName: Full=Putative carbonic anhydrase 5B-like protein; AltName: Full=CA-VB-like protein;												0						AGCCTGGGTCGGGGACAGAAT	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48904087	48904087	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48904087delT								TFE3 (3097 upstream) : CCDC120 (7014 downstream)																							ACAAGTGATATCCCATGACAC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61837556	61837556	+	IGR	DEL	C	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61837556delC								None (None upstream) : SPIN4 (729552 downstream)																							ttgaaacactcttttgtagaa	0.000													6	3	---	---	---	---	
STARD8	9754	broad.mit.edu	37	X	67900673	67900673	+	Intron	DEL	A	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67900673delA	uc004dxa.2	+						STARD8_uc004dxb.2_Intron	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						TACGTGATACAAGGGCAAGAA	0.443													4	2	---	---	---	---	
NKAP	79576	broad.mit.edu	37	X	119059524	119059524	+	Intron	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119059524delT	uc004esh.2	-						NKAP_uc004esg.2_Intron	NM_024528	NP_078804	Q8N5F7	NKAP_HUMAN	NFKB activating protein						negative regulation of transcription, DNA-dependent|Notch signaling pathway|positive regulation of alpha-beta T cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|protein binding			ovary(2)	2						TGACACGTCCtttttttttgt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	134812444	134812444	+	IGR	DEL	T	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134812444delT								DDX26B (95985 upstream) : CT45A1 (34741 downstream)																							TGGTTGGCCATTTTTTTTATC	0.443													4	2	---	---	---	---	
UBL4A	8266	broad.mit.edu	37	X	153714611	153714611	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153714611delG	uc004flo.2	-	2	119	c.110delC	c.(109-111)CCAfs	p.P37fs		NM_014235	NP_055050	P11441	UBL4A_HUMAN	ubiquitin-like 4	37	Ubiquitin-like.				protein modification process|tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	small conjugating protein ligase activity				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGGCGCACTGGGACGTTCAG	0.706													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9960850	9960850	+	IGR	DEL	G	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9960850delG								TTTY22 (309996 upstream) : None (None downstream)																							TAGAGGCCCTGGGGAATATTG	0.448													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13264218	13264219	+	IGR	DEL	TC	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13264218_13264219delTC								None (None upstream) : None (None downstream)																							tcgtgtattttcttttgttatc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13541053	13541054	+	IGR	INS	-	AT	AT	rs112626071		TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13541053_13541054insAT								None (None upstream) : None (None downstream)																							TACACACACACACAGTAAATAC	0.252													11	6	---	---	---	---	
UTY	7404	broad.mit.edu	37	Y	15417437	15417438	+	Intron	INS	-	AT	AT			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15417437_15417438insAT	uc004fsx.1	-						UTY_uc004fsw.1_Intron|UTY_uc010nwx.1_Intron|UTY_uc004fsy.2_Intron	NM_007125	NP_009056	O14607	UTY_HUMAN	tetratricopeptide repeat protein isoform 3						chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						CCTGCAATAAATTAACAGATTA	0.366													40	46	---	---	---	---	
RBMY2EP	159125	broad.mit.edu	37	Y	23558557	23558558	+	Intron	DEL	CA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:23558557_23558558delCA	uc004fun.1	-							NR_001574				Homo sapiens RNA binding motif protein, Y-linked, family 2, member E pseudogene (RBMY2EP), non-coding RNA.												0						taccataattcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58845500	58845504	+	IGR	DEL	TTCCA	-	-			TCGA-B2-5633-01A-01D-1534-10	TCGA-B2-5633-10A-01D-1535-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58845500_58845504delTTCCA								None (None upstream) : None (None downstream)																							ttccattcctttccattccattcca	0.015													4	2	---	---	---	---	
