Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ATAD3A	55210	broad.mit.edu	37	1	1469606	1469606	+	3'UTR	SNP	C	T	T	rs35611435	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1469606C>T	uc001afz.1	+	16					ATAD3A_uc001aga.1_3'UTR|ATAD3A_uc001agb.1_3'UTR|ATAD3A_uc001agc.1_RNA	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A								ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		TGCGGGTCGGCCGTTCTGCCC	0.652													4	12	---	---	---	---	PASS
NOL9	79707	broad.mit.edu	37	1	6592628	6592628	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6592628G>T	uc001ans.2	-	8	1449	c.1430C>A	c.(1429-1431)GCT>GAT	p.A477D	NOL9_uc010nzs.1_RNA	NM_024654	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	477					maturation of 5.8S rRNA	nucleolus	ATP binding|polynucleotide 5'-hydroxyl-kinase activity|RNA binding			skin(1)	1	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		AAATTCCAAAGCATCTGCAAA	0.413													59	170	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17085712	17085712	+	Intron	SNP	C	T	T	rs3863803	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085712C>T	uc010ock.1	-						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						CCCCGGCCCTCCGGTTCCAGG	0.706													10	29	---	---	---	---	PASS
ZBTB8OS	339487	broad.mit.edu	37	1	33087387	33087387	+	3'UTR	SNP	T	C	C			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33087387T>C	uc001bvp.2	-	7					ZBTB8OS_uc001bvo.1_Intron|ZBTB8OS_uc001bvq.2_3'UTR	NM_178547	NP_848642	Q8IWT0	ARCH_HUMAN	zinc finger and BTB domain containing 8 opposite												0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTGTAGAATTTAATTCATAGT	0.313													8	38	---	---	---	---	PASS
GJA5	2702	broad.mit.edu	37	1	147230622	147230622	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147230622C>T	uc001eps.1	-	2	866	c.725G>A	c.(724-726)CGG>CAG	p.R242Q	GJA5_uc001ept.1_Missense_Mutation_p.R242Q	NM_181703	NP_859054	P36382	CXA5_HUMAN	connexin 40	242	Cytoplasmic (Potential).				angiogenesis|cell-cell junction assembly|muscle contraction	integral to membrane				ovary(1)	1	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			CATGTGCTGCCGCGGTTTGAC	0.572													24	50	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152084627	152084627	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152084627C>G	uc001ezp.2	-	2	1066	c.1066G>C	c.(1066-1068)GAG>CAG	p.E356Q	TCHH_uc009wne.1_Missense_Mutation_p.E356Q	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	356	1-4.|5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ctctcctcctcctgctcgcgc	0.000													2	1	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157767975	157767975	+	Missense_Mutation	SNP	G	T	T	rs150869330		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157767975G>T	uc001frg.2	-	8	1203	c.1090C>A	c.(1090-1092)CAG>AAG	p.Q364K	FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Missense_Mutation_p.Q364K|FCRL1_uc001fri.2_Missense_Mutation_p.Q325K|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	364	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGCTGTAGCTGCCCTGGGGTA	0.498													13	32	---	---	---	---	PASS
WDR26	80232	broad.mit.edu	37	1	224599175	224599175	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224599175G>T	uc001hop.3	-	7	1037	c.671C>A	c.(670-672)GCA>GAA	p.A224E	WDR26_uc001hoq.3_Missense_Mutation_p.A208E|WDR26_uc010pvh.1_5'UTR	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a	371	WD 1.					cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		TGATCCTGTTGCTAGTTTAGT	0.368													31	110	---	---	---	---	PASS
RGPD3	653489	broad.mit.edu	37	2	107049575	107049575	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107049575C>T	uc010ywi.1	-	16	2429	c.2372G>A	c.(2371-2373)AGT>AAT	p.S791N		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	791					intracellular transport		binding			ovary(1)	1						GTAACTTTTACTTGGTGATAG	0.303													28	167	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121742131	121742131	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121742131G>T	uc010flp.2	+	11	1798	c.1768G>T	c.(1768-1770)GGC>TGC	p.G590C	GLI2_uc002tmq.1_Missense_Mutation_p.G262C|GLI2_uc002tmr.1_Missense_Mutation_p.G245C|GLI2_uc002tmt.3_Missense_Mutation_p.G262C|GLI2_uc002tmu.3_Missense_Mutation_p.G245C|GLI2_uc002tmw.1_Missense_Mutation_p.G573C	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	590					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				AACGGTCCACGGCCCAGATGC	0.597													48	144	---	---	---	---	PASS
CPB1	1360	broad.mit.edu	37	3	148552315	148552315	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148552315C>T	uc003ewl.2	+	3	201	c.178C>T	c.(178-180)CAA>TAA	p.Q60*		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	60					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTCTGTCACACAAATCAAACC	0.368													10	141	---	---	---	---	PASS
CC2D2A	57545	broad.mit.edu	37	4	15511767	15511767	+	Silent	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15511767G>A	uc010idv.2	+	8	689	c.444G>A	c.(442-444)GGG>GGA	p.G148G	CC2D2A_uc003gnx.2_Silent_p.G99G|CC2D2A_uc003gnu.2_Silent_p.G148G|CC2D2A_uc003gnv.2_Silent_p.G148G	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	148					cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						TATAGCCAGGGAAAGAGGTAG	0.408													15	36	---	---	---	---	PASS
SLC7A11	23657	broad.mit.edu	37	4	139100476	139100476	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139100476G>T	uc011chb.1	-	11	1619	c.1339C>A	c.(1339-1341)CCA>ACA	p.P447T		NM_014331	NP_055146	Q9UPY5	XCT_HUMAN	solute carrier family 7, (cationic amino acid	447	Extracellular (Potential).				blood coagulation|cellular nitrogen compound metabolic process|leukocyte migration|response to toxin	integral to membrane|plasma membrane	cystine:glutamate antiporter activity|protein binding			skin(1)	1	all_hematologic(180;0.166)				L-Cystine(DB00138)|L-Glutamic Acid(DB00142)|Sulfasalazine(DB00795)	GTACTAAATGGGTCCGAATAG	0.443													45	134	---	---	---	---	PASS
SLC27A6	28965	broad.mit.edu	37	5	128302249	128302249	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128302249G>T	uc003kuy.2	+	2	815	c.419G>T	c.(418-420)CGC>CTC	p.R140L	SLC27A6_uc003kuz.2_Missense_Mutation_p.R140L	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	140					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		ACCAACATTCGCTCCAACTCC	0.597													6	55	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	129070698	129070698	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129070698G>T	uc003kvb.1	+	22	3368	c.3368G>T	c.(3367-3369)GGA>GTA	p.G1123V	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1123	TSP type-1 5.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GGAAGACATGGAAATGAATGT	0.408													52	121	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	156074477	156074477	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156074477C>T	uc003lwd.3	+	6	979	c.503C>T	c.(502-504)GCG>GTG	p.A168V	SGCD_uc003lwb.2_Missense_Mutation_p.A169V|SGCD_uc003lwc.3_Missense_Mutation_p.A169V	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	168	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTTACAGGAGCGGAGGGCACA	0.433													4	20	---	---	---	---	PASS
C6orf47	57827	broad.mit.edu	37	6	31627292	31627292	+	Silent	SNP	A	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31627292A>G	uc003nvm.1	-	1	1258	c.433T>C	c.(433-435)TTG>CTG	p.L145L		NM_021184	NP_067007	O95873	CF047_HUMAN	G4 protein	145										ovary(1)	1						GGTTTCTCCAATGGGGCTCCT	0.627													37	109	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98547298	98547298	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98547298G>T	uc003upp.2	+	36	5157	c.4948G>T	c.(4948-4950)GTG>TTG	p.V1650L	TRRAP_uc011kis.1_Missense_Mutation_p.V1632L|TRRAP_uc003upr.2_Missense_Mutation_p.V1349L	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	1650					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AAGCATTATAGTGAAAAACGA	0.527													15	44	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123594289	123594289	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123594289C>T	uc003vld.2	+	4	1067	c.665C>T	c.(664-666)CCG>CTG	p.P222L	SPAM1_uc003vle.2_Missense_Mutation_p.P222L|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.P222L|SPAM1_uc010lku.2_Missense_Mutation_p.P222L	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	222					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	TATCTTTTTCCGGATTGTTAC	0.363													57	170	---	---	---	---	PASS
MEGF9	1955	broad.mit.edu	37	9	123476115	123476115	+	Silent	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123476115G>A	uc004bkj.1	-	1	498	c.498C>T	c.(496-498)ACC>ACT	p.T166T	MEGF9_uc011lyb.1_Silent_p.T166T|MEGF9_uc004bkk.3_Silent_p.T166T	NM_001080497	NP_001073966	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	174	Extracellular (Potential).|Pro-rich.					integral to membrane	calcium ion binding				0						GGAGATCGGGGGTCGGGGTCC	0.731													6	16	---	---	---	---	PASS
CREM	1390	broad.mit.edu	37	10	35495906	35495906	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35495906G>A	uc001iyb.2	+	7	844	c.682G>A	c.(682-684)GGA>AGA	p.G228R	CREM_uc001ixy.2_Missense_Mutation_p.G24R|CREM_uc001ixz.2_Missense_Mutation_p.G24R|CREM_uc001iya.2_Missense_Mutation_p.G177R|CREM_uc001iyc.2_Missense_Mutation_p.G149R|CREM_uc001iyd.2_Missense_Mutation_p.G228R|CREM_uc001iye.2_Missense_Mutation_p.G165R|CREM_uc001iyf.2_Missense_Mutation_p.G198R|CREM_uc001iyg.2_Missense_Mutation_p.G135R|CREM_uc001iyh.2_Missense_Mutation_p.G173R|CREM_uc001iyi.2_Missense_Mutation_p.G110R|CREM_uc001iyj.2_Missense_Mutation_p.G107R|CREM_uc001iyk.2_Missense_Mutation_p.G107R|CREM_uc001iyl.2_Missense_Mutation_p.G49R|CREM_uc001iym.2_Missense_Mutation_p.G49R|CREM_uc001iyn.2_Missense_Mutation_p.G37R|CREM_uc001iyo.2_Missense_Mutation_p.G37R|CREM_uc001iyp.2_Missense_Mutation_p.G31R|CREM_uc001iyq.2_Missense_Mutation_p.G41R|CREM_uc001iyr.2_Missense_Mutation_p.G41R|CREM_uc001iys.2_Missense_Mutation_p.G24R|CREM_uc001iyt.2_Missense_Mutation_p.G24R	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a	289					cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGCATCGCCCGGAAGTTTGCA	0.527													80	152	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49420020	49420020	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49420020C>G	uc001jgi.2	-	13	1695	c.1588G>C	c.(1588-1590)GAT>CAT	p.D530H	FRMPD2_uc001jgh.2_Missense_Mutation_p.D498H|FRMPD2_uc001jgj.2_Missense_Mutation_p.D508H	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	530	FERM.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		AGCTCAGCATCCTCTCCCCAC	0.557													11	27	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49420021	49420021	+	Silent	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49420021C>T	uc001jgi.2	-	13	1694	c.1587G>A	c.(1585-1587)GAG>GAA	p.E529E	FRMPD2_uc001jgh.2_Silent_p.E497E|FRMPD2_uc001jgj.2_Silent_p.E507E	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	529	FERM.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		GCTCAGCATCCTCTCCCCACA	0.557													11	28	---	---	---	---	PASS
DHDPSL	112817	broad.mit.edu	37	10	99359589	99359589	+	Intron	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99359589C>T	uc001kny.2	+						DHDPSL_uc001knx.2_3'UTR|DHDPSL_uc001knz.2_Intron|PI4K2A_uc010qoy.1_Intron	NM_138413	NP_612422	Q86XE5	HOGA1_HUMAN	DHDPS-like protein isoform 1						glyoxylate catabolic process	mitochondrion	4-hydroxy-2-oxoglutarate aldolase activity				0						GCAGCAGCTCCGGGGCTGGGG	0.577													18	49	---	---	---	---	PASS
OR51E1	143503	broad.mit.edu	37	11	4674482	4674482	+	Silent	SNP	T	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4674482T>G	uc001lzi.3	+	2	870	c.726T>G	c.(724-726)ACT>ACG	p.T242T		NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATTTGGCACTTGCGTCTCTC	0.502													40	91	---	---	---	---	PASS
HPS5	11234	broad.mit.edu	37	11	18301346	18301346	+	3'UTR	SNP	C	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18301346C>A	uc001mod.1	-	23					HPS5_uc001moe.1_3'UTR|HPS5_uc001mof.1_3'UTR	NM_181507	NP_852608	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5 isoform a							cytosol				ovary(1)|pancreas(1)|skin(1)	3						GTCTTTCCTTCAATAACAAAT	0.463									Hermansky-Pudlak_syndrome				8	18	---	---	---	---	PASS
CNTF	1270	broad.mit.edu	37	11	58391797	58391797	+	Silent	SNP	C	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58391797C>G	uc001nna.3	+	2	485	c.405C>G	c.(403-405)CCC>CCG	p.P135P	ZFP91-CNTF_uc010rkm.1_RNA	NM_000614	NP_000605	P26441	CNTF_HUMAN	ciliary neurotrophic factor	135					ciliary neurotrophic factor-mediated signaling pathway|growth|negative regulation of neuron apoptosis|positive regulation of tyrosine phosphorylation of Stat3 protein		ciliary neurotrophic factor receptor binding|growth factor activity|interleukin-6 receptor binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				ACAAGATCCCCCGCAATGAGG	0.478													9	119	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85428602	85428602	+	Intron	SNP	A	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85428602A>G	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc001pav.2_5'Flank|SYTL2_uc010rte.1_Intron|SYTL2_uc001pax.2_Intron|SYTL2_uc001paz.2_Intron|SYTL2_uc001pba.2_Intron|SYTL2_uc001pay.2_Intron|SYTL2_uc001paw.2_Intron|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Intron|SYTL2_uc001pbb.2_Intron|SYTL2_uc001pbc.2_Intron|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TTGAGAATAAATACCATTTTA	0.388													54	137	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117352764	117352764	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117352764C>A	uc001prh.1	-	12	2655	c.2653G>T	c.(2653-2655)GGG>TGG	p.G885W		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	825	Extracellular (Potential).|Ig-like C2-type 9.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ACTGTGTCCCCCTTCTCCCAG	0.627													24	74	---	---	---	---	PASS
FGF23	8074	broad.mit.edu	37	12	4479729	4479729	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4479729C>T	uc001qmq.1	-	3	682	c.536G>A	c.(535-537)CGG>CAG	p.R179Q		NM_020638	NP_065689	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23 precursor	179		Cleavage; by proprotein convertases.	R -> Q (in ADHR; C-terminal processing is abolished; reduced proteolysis by PHEX; resistant to cleavage by furin).		cell differentiation|insulin receptor signaling pathway|negative regulation of bone mineralization|negative regulation of hormone secretion|negative regulation of osteoblast differentiation|positive regulation of vitamin D 24-hydroxylase activity|regulation of phosphate transport|vitamin D catabolic process	extracellular space	growth factor activity			ovary(2)|breast(1)|skin(1)	4			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			CTCGGCGCTCCGGGTGTGCCG	0.682													5	79	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94642074	94642074	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94642074A>C	uc001tdc.2	+	14	2913	c.2664A>C	c.(2662-2664)CAA>CAC	p.Q888H		NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	888	Extracellular (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						AAAATGGGCAATTAAATTGCA	0.333													42	87	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106820975	106820975	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106820975C>T	uc001tlp.2	+	13	1324	c.1102C>T	c.(1102-1104)CTT>TTT	p.L368F	POLR3B_uc001tlq.2_Missense_Mutation_p.L310F	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	368					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TTTTTTTTAGCTTTTATCTCT	0.274													5	27	---	---	---	---	PASS
HTR2A	3356	broad.mit.edu	37	13	47470003	47470003	+	Silent	SNP	T	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47470003T>A	uc001vbq.2	-	1	173	c.39A>T	c.(37-39)TCA>TCT	p.S13S	HTR2A_uc001vbr.2_Intron|HTR2A_uc010acr.2_Silent_p.S13S	NM_000621	NP_000612	P28223	5HT2A_HUMAN	5-hydroxytryptamine receptor 2A isoform 1	13	Extracellular (By similarity).				ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	AGTTCGTAGTTGAGCTCAAAG	0.398													13	144	---	---	---	---	PASS
SLC7A8	23428	broad.mit.edu	37	14	23608686	23608686	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23608686A>G	uc001wiz.2	-	6	1585	c.859T>C	c.(859-861)TAT>CAT	p.Y287H	SLC7A8_uc001wix.2_Missense_Mutation_p.Y84H|SLC7A8_uc010tnk.1_Missense_Mutation_p.Y63H|SLC7A8_uc010tnl.1_Missense_Mutation_p.Y182H|SLC7A8_uc001wiy.2_Intron|SLC7A8_uc010akj.2_Intron	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid	287	Helical; (Potential).				blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GCAGTGACATAAGCGACATTG	0.527													63	167	---	---	---	---	PASS
DHRS4	10901	broad.mit.edu	37	14	24475265	24475265	+	3'UTR	SNP	T	C	C			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24475265T>C	uc001wlc.3	+	8					DHRS4L2_uc001wld.3_3'UTR|DHRS4L2_uc001wle.3_3'UTR|DHRS4L2_uc001wlg.3_RNA|DHRS4L2_uc001wlh.3_RNA|DHRS4L2_uc001wli.3_3'UTR|DHRS4L2_uc010alb.2_3'UTR	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	GTGCTGTTCCTGCATTCACCC	0.592													3	2	---	---	---	---	PASS
SERPINA1	5265	broad.mit.edu	37	14	94844895	94844895	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94844895G>T	uc001ycx.3	-	5	1409	c.1148C>A	c.(1147-1149)TCT>TAT	p.S383Y	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Missense_Mutation_p.S383Y|SERPINA1_uc010aux.2_Missense_Mutation_p.S383Y|SERPINA1_uc001ycy.3_Missense_Mutation_p.S383Y|SERPINA1_uc010auy.2_Missense_Mutation_p.S383Y|SERPINA1_uc001ycz.3_Missense_Mutation_p.S383Y|SERPINA1_uc010auz.2_Missense_Mutation_p.S383Y|SERPINA1_uc010ava.2_Missense_Mutation_p.S383Y|SERPINA1_uc001ydb.3_Missense_Mutation_p.S383Y|SERPINA1_uc010avb.2_Missense_Mutation_p.S383Y|SERPINA1_uc001ydc.3_Missense_Mutation_p.S383Y	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	383	RCL.	Reactive bond.			acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)	GGGGGGGATAGACATGGGTAT	0.507									Alpha-1-Antitrypsin_Deficiency				21	55	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29346935	29346935	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346935C>T	uc001zck.2	+	3	1055	c.848C>T	c.(847-849)TCG>TTG	p.S283L	APBA2_uc010azj.2_Missense_Mutation_p.S283L|APBA2_uc010uat.1_Missense_Mutation_p.S283L|APBA2_uc001zcl.2_Missense_Mutation_p.S283L|APBA2_uc010uas.1_Missense_Mutation_p.S283L	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	283					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AGGCCCAAGTCGCTGAACCTC	0.672													11	21	---	---	---	---	PASS
TM6SF1	53346	broad.mit.edu	37	15	83805262	83805262	+	Silent	SNP	T	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83805262T>A	uc002bjp.2	+	10	1060	c.951T>A	c.(949-951)CTT>CTA	p.L317L	TM6SF1_uc010bmq.2_Silent_p.L286L|TM6SF1_uc002bjq.2_3'UTR|TM6SF1_uc010bmr.2_RNA|TM6SF1_uc002bjr.2_Silent_p.L169L	NM_023003	NP_075379	Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1 isoform 1	317						integral to membrane				ovary(1)	1						GTGCATCTCTTCATGCTAGAA	0.378													55	134	---	---	---	---	PASS
MFGE8	4240	broad.mit.edu	37	15	89449935	89449935	+	Silent	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89449935G>A	uc002bng.3	-	4	575	c.462C>T	c.(460-462)TAC>TAT	p.Y154Y	MFGE8_uc002bnf.3_Silent_p.Y42Y|MFGE8_uc002bnh.3_Silent_p.Y154Y|MFGE8_uc010bnn.2_Silent_p.Y146Y|MFGE8_uc010upq.1_Silent_p.Y110Y|MFGE8_uc010upr.1_Silent_p.Y154Y|MFGE8_uc010bno.2_Silent_p.Y110Y	NM_005928	NP_005919	Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein isoform a	154	F5/8 type C 1.				angiogenesis|cell adhesion|interspecies interaction between organisms|single fertilization					ovary(1)	1	Lung NSC(78;0.0392)|all_lung(78;0.077)					AGGCCTTCAGGTACTCATGAC	0.537													28	75	---	---	---	---	PASS
RHOT2	89941	broad.mit.edu	37	16	722787	722787	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:722787G>A	uc002cip.2	+	17	1556	c.1489G>A	c.(1489-1491)GAC>AAC	p.D497N	RHOT2_uc002ciq.2_Missense_Mutation_p.D390N|RHOT2_uc010bqy.2_Missense_Mutation_p.D276N|RHBDL1_uc002cir.1_5'Flank|RHBDL1_uc010uun.1_5'Flank	NM_138769	NP_620124	Q8IXI1	MIRO2_HUMAN	ras homolog gene family, member T2	497	Miro 2.|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			pancreas(1)	1		Hepatocellular(780;0.0218)				TGATGGCAGTGACCCAAAGTC	0.627													12	106	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21151927	21151927	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21151927A>C	uc010vbe.1	-	5	626	c.626T>G	c.(625-627)CTC>CGC	p.L209R	DNAH3_uc002die.2_Missense_Mutation_p.L180R	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	209	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CATGACATCGAGCTGCTGTTC	0.483													45	186	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	29110458	29110458	+	Intron	SNP	T	C	C	rs151074589	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29110458T>C	uc010vct.1	-						RRN3P2_uc002dsf.3_RNA|RRN3P2_uc002dsg.3_RNA|RRN3P2_uc010vdn.1_RNA					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GAATTTTGAGTGGATAGTGAT	0.328													8	68	---	---	---	---	PASS
SLC12A4	6560	broad.mit.edu	37	16	67980916	67980916	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67980916T>G	uc002euz.2	-	17	2306	c.2165A>C	c.(2164-2166)AAG>ACG	p.K722T	LCAT_uc002euy.1_5'Flank|SLC12A4_uc010ceu.2_Missense_Mutation_p.K716T|SLC12A4_uc010vkh.1_Missense_Mutation_p.K691T|SLC12A4_uc010vki.1_Missense_Mutation_p.K722T|SLC12A4_uc010vkj.1_Missense_Mutation_p.K724T|SLC12A4_uc002eva.2_Missense_Mutation_p.K722T|SLC12A4_uc010cev.1_RNA|SLC12A4_uc002evb.2_RNA	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	722					cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGTCAGGCCCTTGCCAGCCTT	0.632													8	33	---	---	---	---	PASS
EFCAB5	374786	broad.mit.edu	37	17	28405489	28405489	+	Silent	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28405489G>A	uc002het.2	+	15	3186	c.2994G>A	c.(2992-2994)CCG>CCA	p.P998P	EFCAB5_uc010cse.2_Silent_p.P753P|EFCAB5_uc010csf.2_Intron	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a	998							calcium ion binding			ovary(1)|skin(1)	2						CCCTAGAGCCGGTGTATAGTG	0.483													19	52	---	---	---	---	PASS
KRT35	3886	broad.mit.edu	37	17	39635602	39635602	+	Silent	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39635602C>T	uc002hws.2	-	3	751	c.708G>A	c.(706-708)GAG>GAA	p.E236E		NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35	236	Rod.|Coil 1B.				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				tgctcacctccTCATGGTTCT	0.294													30	81	---	---	---	---	PASS
HOXB13	10481	broad.mit.edu	37	17	46805884	46805884	+	Silent	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46805884C>T	uc002ioa.2	-	1	228	c.72G>A	c.(70-72)GGG>GGA	p.G24G		NM_006361	NP_006352	Q92826	HXB13_HUMAN	homeobox B13	24					angiogenesis|epidermis development|response to wounding		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCAGATTCCGCCCCCCTCCCG	0.657													10	35	---	---	---	---	PASS
TRIM25	7706	broad.mit.edu	37	17	54985850	54985850	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54985850T>G	uc002iut.2	-	2	732	c.672A>C	c.(670-672)AGA>AGC	p.R224S	TRIM25_uc010dcj.2_Missense_Mutation_p.R16S	NM_005082	NP_005073	Q14258	TRI25_HUMAN	tripartite motif-containing 25	224	Interaction with influenza A virus NS1.|Potential.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|response to virus	cell junction|cytosol|nucleus	sequence-specific DNA binding transcription factor activity|ubiquitin-protein ligase activity|zinc ion binding			lung(1)|breast(1)|skin(1)	3	Breast(9;6.15e-08)					GCTGCCTGTTTCTCACATCAT	0.592													35	99	---	---	---	---	PASS
MPO	4353	broad.mit.edu	37	17	56350261	56350261	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56350261A>G	uc002ivu.1	-	10	1817	c.1640T>C	c.(1639-1641)CTC>CCC	p.L547P		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	547					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	GAGGCCCCGGAGGATGGGGTC	0.567													57	186	---	---	---	---	PASS
POLG2	11232	broad.mit.edu	37	17	62474074	62474074	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62474074A>T	uc002jei.2	-	8	1407	c.1324T>A	c.(1324-1326)TTG>ATG	p.L442M		NM_007215	NP_009146	Q9UHN1	DPOG2_HUMAN	DNA polymerase subunit gamma-2, mitochondrial	442					DNA repair|DNA-dependent DNA replication|glycyl-tRNA aminoacylation	mitochondrial chromosome	ATP binding|DNA-directed DNA polymerase activity|glycine-tRNA ligase activity|identical protein binding|single-stranded DNA binding			central_nervous_system(1)	1	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			TCAGTAACCAAAACTGTGAAG	0.333													30	122	---	---	---	---	PASS
SMURF2	64750	broad.mit.edu	37	17	62541851	62541851	+	3'UTR	SNP	A	G	G	rs59188589		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62541851A>G	uc002jep.1	-	19					SMURF2_uc002jeq.1_3'UTR|SMURF2_uc002jer.1_3'UTR	NM_022739	NP_073576	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2						BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity			skin(3)|lung(1)	4	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			AAAAAAAAAAAGGGGGGGGGG	0.393													3	1	---	---	---	---	PASS
FASN	2194	broad.mit.edu	37	17	80046746	80046746	+	Silent	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80046746G>A	uc002kdu.2	-	15	2428	c.2311C>T	c.(2311-2313)CTG>TTG	p.L771L	FASN_uc002kdw.1_5'UTR	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	771	Acyl and malonyl transferases (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	CCACGCTTCAGGACAGCCTGG	0.672													12	26	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10071471	10071471	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10071471G>T	uc002mmq.1	-	66	5033	c.4947C>A	c.(4945-4947)TAC>TAA	p.Y1649*		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1649	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TCTGGCAGGAGTAGGTGAAGT	0.592													24	64	---	---	---	---	PASS
ECSIT	51295	broad.mit.edu	37	19	11618640	11618640	+	Silent	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11618640G>A	uc002msb.2	-	6	956	c.822C>T	c.(820-822)GCC>GCT	p.A274A	ZNF653_uc002mrz.1_5'Flank|ECSIT_uc002msa.1_RNA|ECSIT_uc010dyc.1_Intron|ECSIT_uc010dyd.2_Intron|ECSIT_uc010xma.1_Silent_p.A60A	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate	274					innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						GGGCCAGGGCGGCCTGCTGAT	0.637													13	39	---	---	---	---	PASS
DMKN	93099	broad.mit.edu	37	19	36003602	36003602	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36003602C>A	uc002nzm.3	-	2	700	c.517G>T	c.(517-519)GTC>TTC	p.V173F	DMKN_uc002nzj.2_5'Flank|DMKN_uc002nzk.3_5'Flank|DMKN_uc002nzl.3_5'Flank|DMKN_uc002nzo.3_Missense_Mutation_p.V173F|DMKN_uc002nzn.3_Missense_Mutation_p.V173F|DMKN_uc002nzw.2_5'Flank|DMKN_uc002nzr.2_5'Flank|DMKN_uc002nzp.2_5'Flank|DMKN_uc002nzq.2_5'Flank|DMKN_uc002nzt.2_5'Flank|DMKN_uc002nzs.2_5'Flank|DMKN_uc002nzu.2_5'Flank|DMKN_uc002nzv.2_5'Flank|DMKN_uc010xsv.1_5'Flank|DMKN_uc010xsw.1_5'Flank|DMKN_uc002nzx.3_5'Flank|DMKN_uc002nzy.3_5'Flank|DMKN_uc002nzz.2_5'Flank|DMKN_uc002oac.3_Missense_Mutation_p.V173F|DMKN_uc010eeb.2_Missense_Mutation_p.V173F|DMKN_uc002oaa.3_Missense_Mutation_p.V173F|DMKN_uc002oab.3_Missense_Mutation_p.V173F	NM_033317	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine isoform 2 precursor	173	Gly-rich.					extracellular region				large_intestine(1)|ovary(1)|skin(1)	3	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TATCCGTGGACCCACGGAGTC	0.597													6	81	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25010806	25010806	+	Silent	SNP	G	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25010806G>A	uc003aan.1	+	6	715	c.228G>A	c.(226-228)GGG>GGA	p.G76G	GGT1_uc003aas.1_Silent_p.G76G|GGT1_uc003aat.1_Silent_p.G76G|GGT1_uc003aau.1_Silent_p.G76G|GGT1_uc003aav.1_Silent_p.G76G|GGT1_uc003aaw.1_Silent_p.G76G|GGT1_uc003aax.1_Silent_p.G76G	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	76	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	TGTGTGTGGGGCTCATGAATG	0.617													31	62	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53612105	53612105	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53612105C>A	uc004dsp.2	-	40	5270	c.4868G>T	c.(4867-4869)CGC>CTC	p.R1623L	HUWE1_uc004dsn.2_Missense_Mutation_p.R448L	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	1623	WWE.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						ACGCCCAGAGCGATCATCAAA	0.428													46	52	---	---	---	---	PASS
MSN	4478	broad.mit.edu	37	X	64959702	64959702	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64959702C>T	uc004dwf.2	+	13	1879	c.1681C>T	c.(1681-1683)CAG>TAG	p.Q561*		NM_002444	NP_002435	P26038	MOES_HUMAN	moesin	561					leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton		MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						GACCCTGCGCCAGATCCGGCA	0.552			T	ALK	ALCL								13	84	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108636245	108636245	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108636245C>A	uc004eod.3	-	13	2740	c.2464G>T	c.(2464-2466)GAT>TAT	p.D822Y	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	822	Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						AGCATAGAATCAATAATATTG	0.358													20	150	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	19314274	19314277	+	IGR	DEL	GAAA	-	-	rs72498264		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19314274_19314277delGAAA								IFFO2 (31448 upstream) : UBR4 (84327 downstream)																							aggaaggaaggaaagaaggaagga	0.191													4	2	---	---	---	---	
WDR47	22911	broad.mit.edu	37	1	109560373	109560373	+	Intron	DEL	T	-	-	rs33990918		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109560373delT	uc001dwj.2	-						WDR47_uc001dwl.2_Intron|WDR47_uc001dwi.2_Intron|WDR47_uc001dwk.2_Intron|WDR47_uc010ovf.1_5'Flank	NM_001142551	NP_001136023	O94967	WDR47_HUMAN	WD repeat domain 47 isoform 3											ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		TTTTTCATAAttttttttttt	0.129													5	4	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145559918	145559919	+	Intron	INS	-	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145559918_145559919insA	uc001emp.3	+						ANKRD35_uc010oyx.1_Intron|ANKRD35_uc001eob.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		aactccgtctcaaaaaaaaaaa	0.203													4	2	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153800932	153800939	+	Intron	DEL	ACACACAC	-	-	rs71677766		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800932_153800939delACACACAC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCTcacacatacacacacacacacacac	0.236													9	4	---	---	---	---	
WDR26	80232	broad.mit.edu	37	1	224599407	224599407	+	Intron	DEL	T	-	-	rs67168562		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224599407delT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc010pvh.1_5'Flank	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		TTTGTAAATCttttttttttt	0.114													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234492401	234492402	+	IGR	INS	-	TT	TT	rs61287975		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234492401_234492402insTT								SLC35F3 (32139 upstream) : C1orf31 (16873 downstream)																							ATTTGCATATCTTTTTTTTTTT	0.421													5	3	---	---	---	---	
LGALS8	3964	broad.mit.edu	37	1	236702555	236702556	+	Intron	INS	-	G	G	rs149106643	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236702555_236702556insG	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CCTAAATGTGAGGTATggcacc	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18053425	18053428	+	IGR	DEL	TTCC	-	-	rs78965234		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18053425_18053428delTTCC								MSGN1 (55059 upstream) : KCNS3 (5686 downstream)																							tttctttcttttccttccttcctt	0.098													2	5	---	---	---	---	
SPAST	6683	broad.mit.edu	37	2	32340026	32340027	+	Intron	INS	-	T	T	rs67016851		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32340026_32340027insT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ATAAAGTTAAAttttttttttt	0.114													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241580301	241580304	+	IGR	DEL	TCCC	-	-	rs111676100		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241580301_241580304delTCCC								GPR35 (9626 upstream) : AQP12B (35532 downstream)																							cctccttccttccctgacctacct	0.000													4	2	---	---	---	---	
IL17RB	55540	broad.mit.edu	37	3	53883546	53883547	+	Intron	INS	-	A	A	rs149695132	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53883546_53883547insA	uc003dha.2	+							NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor						defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		ctacaaaaaacatttttttaat	0.208													5	3	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131436727	131436728	+	Intron	DEL	TT	-	-	rs112269419		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131436727_131436728delTT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						cttttctttctttctttctttc	0.035													8	4	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183695546	183695546	+	Intron	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183695546delT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GTCAATTACAttttttttttt	0.219													4	2	---	---	---	---	
C1QTNF7	114905	broad.mit.edu	37	4	15351897	15351898	+	Intron	INS	-	GAAG	GAAG	rs142488726	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15351897_15351898insGAAG	uc003gno.2	+							NM_001135170	NP_001128642	Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7							collagen					0						gagggaggaaagaaggaaggaa	0.005													3	3	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79430319	79430319	+	Intron	DEL	G	-	-	rs34380083		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79430319delG	uc003hlb.2	+						FRAS1_uc003hlc.1_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CATAAGAAAaggttatatgct	0.159													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97710727	97710728	+	IGR	INS	-	TTCC	TTCC	rs145116079	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97710727_97710728insTTCC								PDHA2 (948103 upstream) : C4orf37 (769306 downstream)																							ccctccctcctttccttccttc	0.139													4	4	---	---	---	---	
EGF	1950	broad.mit.edu	37	4	110925372	110925373	+	Intron	DEL	AC	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110925372_110925373delAC	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	GGGcatacatacacacacacac	0.193													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	122504388	122504389	+	IGR	INS	-	AAGGAAGG	AAGGAAGG			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122504388_122504389insAAGGAAGG								QRFPR (202207 upstream) : ANXA5 (84764 downstream)																							gaggaggaggaaaggaaggaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	146376237	146376240	+	IGR	DEL	AGAA	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146376237_146376240delAGAA								OTUD4 (275405 upstream) : SMAD1 (26711 downstream)																							AAAGAGAGAGAGAAAGAGAAaagg	0.093													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3276446	3276446	+	IGR	DEL	G	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3276446delG								C5orf38 (520934 upstream) : IRX1 (319722 downstream)																							ggaggaaggagggaggggagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35431551	35431552	+	IGR	INS	-	TGCCACTGCCAC	TGCCACTGCCAC	rs150396528	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35431551_35431552insTGCCACTGCCAC								PRLR (200757 upstream) : SPEF2 (186437 downstream)																							agaagAAAAAGTGCCACTGCCA	0.233													5	3	---	---	---	---	
FAM151B	167555	broad.mit.edu	37	5	79794833	79794833	+	Intron	DEL	A	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79794833delA	uc003kgv.1	+						FAM151B_uc010jal.1_Intron	NM_205548	NP_991111	Q6UXP7	F151B_HUMAN	hypothetical protein LOC167555												0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		TGGCAGATGGAAAAAAAAAAA	0.408													5	3	---	---	---	---	
SPINK5	11005	broad.mit.edu	37	5	147445109	147445114	+	Intron	DEL	CACACA	-	-	rs3036741		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147445109_147445114delCACACA	uc003lox.2	+						SPINK5_uc010jgq.1_Intron|SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTCTCTCTcacacacacacacaca	0.252													2	4	---	---	---	---	
MYLK4	340156	broad.mit.edu	37	6	2679263	2679263	+	Intron	DEL	C	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2679263delC	uc003mty.3	-						MYLK4_uc003mtx.3_Intron	NM_001012418	NP_001012418	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4								ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				TAATTTTTGGCTTTTAGGTTG	0.224													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3222231	3222232	+	5'Flank	INS	-	CACT	CACT			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3222231_3222232insCACT	uc011dhu.1	+											Synthetic construct Homo sapiens gateway clone IMAGE:100018300 3' read TUBB2A mRNA.																		accaccaccacactaccaccac	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18670993	18671000	+	Intron	DEL	CTTTCCTC	-	-	rs56110917	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18670993_18671000delCTTTCCTC	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																		ttccttccttctttcctcccttcctccc	0.183													9	5	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149186	44149187	+	Intron	INS	-	CA	CA	rs150427721	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149186_44149187insCA	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CACACCACACTcacacacacac	0.262													5	3	---	---	---	---	
MEP1A	4224	broad.mit.edu	37	6	46765669	46765672	+	Intron	DEL	TTCC	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46765669_46765672delTTCC	uc010jzh.1	+						MEP1A_uc011dwg.1_Intron|MEP1A_uc011dwh.1_Intron|MEP1A_uc011dwi.1_Intron	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor						digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			ccttccttctttccttccttcctt	0.000													5	5	---	---	---	---	
THEMIS	387357	broad.mit.edu	37	6	128031311	128031312	+	Intron	INS	-	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128031311_128031312insA	uc003qbi.2	-						THEMIS_uc010kfa.2_Intron|THEMIS_uc011ebt.1_Intron|THEMIS_uc010kfb.2_Intron	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform						negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						GCAAAATAAAGAAAAAAAAAAA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	132839949	132839949	+	IGR	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132839949delT								STX7 (5612 upstream) : TAAR9 (19478 downstream)																							TTTACAGGTATTTTTTTTACA	0.373													4	2	---	---	---	---	
CCDC28A	25901	broad.mit.edu	37	6	139109706	139109717	+	Intron	DEL	TTTTTTTTTTTT	-	-	rs7349837	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139109706_139109717delTTTTTTTTTTTT	uc003qie.2	+							NM_015439	NP_056254	Q8IWP9	CC28A_HUMAN	coiled-coil domain containing 28A												0				OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)		ttttcttttctttttttttttttttttttttt	0.132													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	157077773	157077778	+	IGR	DEL	GAGAAG	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157077773_157077778delGAGAAG								MIR1202 (809760 upstream) : ARID1B (21308 downstream)																							gagagagaaagagaaggagaaggaga	0.019													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659644	57659644	+	IGR	DEL	G	-	-	rs111399871		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659644delG								ZNF716 (126379 upstream) : None (None downstream)																							CATGTTTTTTGTGTTTTTCTT	0.353													3	5	---	---	---	---	
SMURF1	57154	broad.mit.edu	37	7	98654616	98654616	+	Intron	DEL	A	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98654616delA	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			aaaaaaaaccaaaaaaaaaaa	0.179													6	4	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105302530	105302534	+	Intron	DEL	TTTCT	-	-	rs846939		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105302530_105302534delTTTCT	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						tccttccttctttcttttcttttct	0.054													4	2	---	---	---	---	
AKR1B15	441282	broad.mit.edu	37	7	134260925	134260926	+	Intron	INS	-	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134260925_134260926insT	uc011kpr.1	+						AKR1B15_uc011kps.1_Intron	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15								oxidoreductase activity			ovary(1)	1						GTGAACCAGGCTTGCAAAATGC	0.485													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	67328399	67328402	+	IGR	DEL	GAAG	-	-	rs150500788		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67328399_67328402delGAAG								CRH (237701 upstream) : RRS1 (12861 downstream)																							aggaaggaaagaaggaaggaagga	0.000													5	3	---	---	---	---	
COPS5	10987	broad.mit.edu	37	8	67961711	67961711	+	Intron	DEL	A	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67961711delA	uc003xxe.2	-						COPS5_uc003xxd.2_Intron|COPS5_uc003xxf.2_Intron|COPS5_uc010lyu.1_Intron	NM_006837	NP_006828	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5						cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			aaagaaaaagaaaaaaaaaaa	0.179													4	2	---	---	---	---	
IL7	3574	broad.mit.edu	37	8	79652031	79652032	+	Intron	INS	-	A	A	rs143357204		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79652031_79652032insA	uc003ybg.2	-						IL7_uc003ybe.2_Intron|IL7_uc011lfm.1_Intron|IL7_uc003ybh.2_Intron|IL7_uc003ybi.3_Intron	NM_000880	NP_000871	P13232	IL7_HUMAN	interleukin 7 precursor						bone resorption|cell-cell signaling|humoral immune response|organ morphogenesis|positive regulation of B cell proliferation|positive regulation of T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-7 receptor binding				0						AATGGTGAAACAAAAAAAACTT	0.248													4	2	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14803313	14803314	+	Intron	INS	-	TCCCCTCCCC	TCCCCTCCCC	rs141611687	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14803313_14803314insTCCCCTCCCC	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		tctttttcttttcccctcccct	0.020													2	4	---	---	---	---	
GBA2	57704	broad.mit.edu	37	9	35749654	35749654	+	5'Flank	DEL	C	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35749654delC	uc003zxw.2	-						GBA2_uc011lpb.1_5'Flank|GBA2_uc011lpc.1_5'Flank|GBA2_uc011lpd.1_Intron|RGP1_uc011lpe.1_Intron|RGP1_uc011lpf.1_Intron	NM_020944	NP_065995	Q9HCG7	GBA2_HUMAN	bile acid beta-glucosidase						bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity			ovary(3)|skin(1)	4	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCCCTGTCCTCAGCCCTCAGC	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	126875683	126875683	+	IGR	DEL	G	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126875683delG								LHX2 (80241 upstream) : NEK6 (144203 downstream)																							GGGATGTCTTGGGGGAGGGAT	0.383													4	2	---	---	---	---	
C10orf82	143379	broad.mit.edu	37	10	118424915	118424916	+	Intron	INS	-	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118424915_118424916insA	uc001lcr.2	-						C10orf82_uc001lcs.1_3'UTR	NM_144661	NP_653262	Q8WW14	CJ082_HUMAN	hypothetical protein LOC143379												0				all cancers(201;0.0143)		gactccgtctcaaaaaaaaaaa	0.129													6	3	---	---	---	---	
NAP1L4	4676	broad.mit.edu	37	11	2985356	2985356	+	Intron	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2985356delT	uc001lxc.2	-						NAP1L4_uc010qxm.1_Intron|NAP1L4_uc010qxn.1_Intron|SNORA54_uc001lxd.1_5'Flank	NM_005969	NP_005960	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4						nucleosome assembly	chromatin assembly complex|cytoplasm	unfolded protein binding			ovary(1)	1		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		TTATTTGCGCTTTTTTTTTTA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	3552650	3552651	+	IGR	INS	-	G	G	rs34642454		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3552650_3552651insG								LOC650368 (122272 upstream) : TRPC2 (85811 downstream)																							CAGCACCCCATGGGGGGGCCCT	0.376													5	5	---	---	---	---	
NAALAD2	10003	broad.mit.edu	37	11	89910846	89910846	+	Intron	DEL	C	-	-	rs34300990		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89910846delC	uc001pdf.3	+						NAALAD2_uc009yvx.2_Intron|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				gtcttgaactcctgagctcag	0.025													7	4	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131468793	131468793	+	Intron	DEL	C	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131468793delC	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ttccttccttccttccttcct	0.005													4	3	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42671922	42671925	+	Intron	DEL	AGGG	-	-	rs12322512	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42671922_42671925delAGGG	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		gaaggaaagaagggagggagggag	0.127													8	5	---	---	---	---	
ANKRD52	283373	broad.mit.edu	37	12	56638274	56638274	+	Intron	DEL	C	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56638274delC	uc001skm.3	-							NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52								protein binding			ovary(2)	2						CAGTAGCCATCCTGGCTCTCC	0.552													19	12	---	---	---	---	
CEP290	80184	broad.mit.edu	37	12	88530707	88530707	+	Intron	DEL	T	-	-	rs112841615		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88530707delT	uc001tar.2	-						CEP290_uc009zsl.1_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa						cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						GCTTAAGAACTTTTTTTTTTT	0.284													4	2	---	---	---	---	
TXNRD1	7296	broad.mit.edu	37	12	104728170	104728170	+	Intron	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104728170delT	uc010swk.1	+						TXNRD1_uc010swl.1_Intron|TXNRD1_uc010swm.1_Intron|TXNRD1_uc010swn.1_Intron|TXNRD1_uc010swo.1_Intron|TXNRD1_uc010swp.1_Intron|TXNRD1_uc010swq.1_Intron|TXNRD1_uc001tku.2_Intron|TXNRD1_uc009zun.2_Intron	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						tttgttgttgtttttttttta	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	112367333	112367334	+	IGR	INS	-	A	A			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112367333_112367334insA								MAPKAPK5 (36106 upstream) : TMEM116 (1769 downstream)																							aggaaggaaggaaggaaggaag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31374523	31374530	+	IGR	DEL	TTCCTTCC	-	-	rs66633179	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31374523_31374530delTTCCTTCC								ALOX5AP (35967 upstream) : C13orf33 (105782 downstream)																							ATTATttcctttccttccttccttcctt	0.188													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	52754632	52754632	+	IGR	DEL	G	-	-	rs35553348		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52754632delG								PTGDR (11191 upstream) : PTGER2 (26384 downstream)																							ATAAATGTTTGTTTCTAAATA	0.279													3	3	---	---	---	---	
HSPA2	3306	broad.mit.edu	37	14	65009534	65009535	+	3'UTR	INS	-	T	T	rs148978517	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65009534_65009535insT	uc001xhj.2	+	2					HSPA2_uc001xhk.3_3'UTR	NM_021979	NP_068814	P54652	HSP72_HUMAN	heat shock 70kDa protein 2						response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CTCTCTCTCTCTTTTTTTTTGT	0.411													4	2	---	---	---	---	
CPSF2	53981	broad.mit.edu	37	14	92623897	92623898	+	Intron	DEL	AT	-	-	rs143351858		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92623897_92623898delAT	uc001yah.1	+							NM_017437	NP_059133	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2						histone mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	hydrolase activity|protein binding|RNA binding			ovary(2)	2		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		ATACTATAACATGTGTATTTCT	0.134													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22467654	22467657	+	5'Flank	DEL	ACAC	-	-	rs6145496		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22467654_22467657delACAC	uc001yui.1	-											Homo sapiens clone IgA5728-2 immunoglobulin A heavy chain mRNA, partial cds.																		acagtaatggacacacacacacac	0.235													4	3	---	---	---	---	
IL4R	3566	broad.mit.edu	37	16	27367406	27367406	+	Intron	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27367406delT	uc002don.2	+						IL4R_uc002dop.3_Intron|IL4R_uc010bxy.2_Intron|IL4R_uc002doo.2_Intron	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a						immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CACttttttcttttttttttt	0.214													4	2	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74378975	74378976	+	Intron	DEL	AT	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74378975_74378976delAT	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						AACCTCTTGAAttttttttttt	0.183													4	2	---	---	---	---	
ZFPM1	161882	broad.mit.edu	37	16	88593210	88593211	+	Intron	DEL	CT	-	-	rs150280017	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88593210_88593211delCT	uc002fkv.2	+							NM_153813	NP_722520	Q8IX07	FOG1_HUMAN	zinc finger protein, multitype 1						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|transcription factor binding|zinc ion binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0478)		TGTTCCTACCCTCCCCCCCCAG	0.688													3	4	---	---	---	---	
GLOD4	51031	broad.mit.edu	37	17	673936	673936	+	Intron	DEL	T	-	-	rs72295826		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:673936delT	uc002frv.2	-						GLOD4_uc002frt.2_Intron|GLOD4_uc002fru.2_Intron|GLOD4_uc010vqc.1_Intron	NM_016080	NP_057164	Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							mitochondrion					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		cgcatctatgttttttttttt	0.000													2	4	---	---	---	---	
FBXW10	10517	broad.mit.edu	37	17	18652860	18652860	+	Intron	DEL	A	-	-	rs140182637		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18652860delA	uc002guk.2	+						FBXW10_uc002guj.2_Intron|FBXW10_uc002gul.2_Intron|FBXW10_uc010cqh.1_Intron	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10											ovary(1)	1						actccgtctcaaaaaaaaaaa	0.184													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	26795576	26795576	+	IGR	DEL	A	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26795576delA								SLC46A1 (62348 upstream) : SLC13A2 (5088 downstream)																							gcatttccttaaaaaaaaaaa	0.000													4	3	---	---	---	---	
ARL4D	379	broad.mit.edu	37	17	41476893	41476893	+	Intron	DEL	A	-	-	rs3071190		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41476893delA	uc002idt.2	+							NM_001661	NP_001652	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D						protein secretion|small GTPase mediated signal transduction	cytoplasm|nucleolus|plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)	1		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		GTTATGCCTTAAAAAAAAAAA	0.473													3	3	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626934	73626934	+	Intron	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626934delT	uc010dgl.2	-						RECQL5_uc010dgk.2_Intron|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			GGGGGGGGGGTGGTCCTTGGT	0.627								Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	3	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674482	78674483	+	Intron	INS	-	TGA	TGA			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674482_78674483insTGA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gatgatggaggtggtggtgatg	0.000													6	3	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80141902	80141911	+	Intron	DEL	CGCGCGCACA	-	-	rs72278140	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80141902_80141911delCGCGCGCACA	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron|CCDC57_uc010dik.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			TGCGCGCGCGCGCGCGcacacacacacaca	0.386													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	19658552	19658553	+	IGR	DEL	TT	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19658552_19658553delTT								MIB1 (207642 upstream) : GATA6 (90863 downstream)																							tctttctttctttctctctctt	0.000													4	2	---	---	---	---	
CDH20	28316	broad.mit.edu	37	18	59136598	59136599	+	Intron	DEL	AC	-	-	rs146696136		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59136598_59136599delAC	uc002lif.2	+							NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				GAGAATGAATacacacacacac	0.342													3	3	---	---	---	---	
ZADH2	284273	broad.mit.edu	37	18	72913186	72913186	+	3'UTR	DEL	T	-	-	rs67264905		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72913186delT	uc002llx.2	-	2					ZADH2_uc010dqv.2_3'UTR	NM_175907	NP_787103	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain							peroxisome	oxidoreductase activity|zinc ion binding				0		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		TATTAGCACATTTTTTTTTTT	0.303													4	2	---	---	---	---	
OR7G3	390883	broad.mit.edu	37	19	9237801	9237802	+	5'Flank	DEL	TC	-	-	rs144625616		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9237801_9237802delTC	uc010xkl.1	-							NM_001001958	NP_001001958	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						tctttctctttctctctctttc	0.000													4	2	---	---	---	---	
FAM187B	148109	broad.mit.edu	37	19	35719750	35719750	+	5'Flank	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35719750delT	uc002nyk.1	-							NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B							integral to membrane				ovary(2)	2						ACTGtttttcttttttttttt	0.249													3	3	---	---	---	---	
ZNF790	388536	broad.mit.edu	37	19	37309182	37309184	+	3'UTR	DEL	CTG	-	-	rs142103405		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37309182_37309184delCTG	uc002oew.2	-	5					uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GATGAATTCTctgctgctgctgc	0.261													8	4	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56755967	56755971	+	Intron	DEL	CAAGG	-	-	rs57532903		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56755967_56755971delCAAGG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttgttgtcacaagggggaggacag	0.117													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44624529	44624532	+	IGR	DEL	CTTT	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44624529_44624532delCTTT								ZNF335 (23696 upstream) : MMP9 (13015 downstream)																							CATCTGTAAACTttctttctttct	0.225													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9865569	9865570	+	IGR	INS	-	A	A	rs77497487	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9865569_9865570insA								None (None upstream) : None (None downstream)																							CTGCTGAGTTTAAATCTTCCTT	0.490													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20229948	20229949	+	IGR	INS	-	A	A	rs139419884	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20229948_20229949insA								TMPRSS15 (453978 upstream) : None (None downstream)																							aagatctgcataaaaaaacaag	0.099													6	6	---	---	---	---	
NCAM2	4685	broad.mit.edu	37	21	22782458	22782459	+	Intron	INS	-	A	A	rs112122491		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22782458_22782459insA	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		gtctcaaaaagaaaaaaaaaaa	0.099													4	2	---	---	---	---	
RWDD2B	10069	broad.mit.edu	37	21	30391672	30391674	+	5'UTR	DEL	AAA	-	-	rs66619103		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30391672_30391674delAAA	uc002yms.2	-	1					RWDD2B_uc002ymt.2_5'UTR|RWDD2B_uc002ymu.2_RNA|RWDD2B_uc002ymv.2_5'UTR	NM_016940	NP_058636	P57060	RWD2B_HUMAN	RWD domain containing 2B												0						GACCTACCGGAAAAAAAAAAAAA	0.567													3	3	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37649139	37649139	+	Intron	DEL	A	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37649139delA	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						actccatctcaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16915280	16915281	+	IGR	INS	-	TT	TT	rs148711386		TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16915280_16915281insTT								OR11H1 (465476 upstream) : CCT8L2 (156367 downstream)																							CTCCCTCACCAttttttttttt	0.129													7	4	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26413077	26413078	+	Intron	INS	-	CCTT	CCTT	rs56237338	by1000genomes	TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26413077_26413078insCCTT	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron|MYO18B_uc010gva.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ctcactcactcccttccttcct	0.015													6	4	---	---	---	---	
SOX10	6663	broad.mit.edu	37	22	38370365	38370365	+	Intron	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38370365delT	uc003aun.1	-						POLR2F_uc003aum.2_Intron|SOX10_uc003auo.1_Intron	NM_006941	NP_008872	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10							cytoplasm|nucleus	DNA binding|identical protein binding|transcription coactivator activity				0	Melanoma(58;0.045)					tttttttttgttttttttttt	0.244													6	3	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2683418	2683425	+	Intron	DEL	GGAAGGAA	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2683418_2683425delGGAAGGAA	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				agggagggagggaaggaaggaaggaagg	0.135													4	2	---	---	---	---	
CTPS2	56474	broad.mit.edu	37	X	16721146	16721146	+	Intron	DEL	T	-	-			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16721146delT	uc004cxk.2	-						CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)					CCAGAATTAAttttttttttt	0.154													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13637596	13637597	+	IGR	INS	-	T	T			TCGA-BP-4991-01A-01D-1462-08	TCGA-BP-4991-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13637596_13637597insT								None (None upstream) : None (None downstream)																							GGCATAGATACGTTTGAAGAGA	0.351													8	4	---	---	---	---	
