Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
LRP8	7804	broad.mit.edu	37	1	53741419	53741419	+	Missense_Mutation	SNP	C	T	T	rs149347479		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53741419C>T	uc001cvi.1	-	6	1032	c.890G>A	c.(889-891)GGC>GAC	p.G297D	LRP8_uc001cvh.1_5'UTR|LRP8_uc001cvk.1_Intron|LRP8_uc001cvj.1_Missense_Mutation_p.G297D|LRP8_uc001cvl.1_Missense_Mutation_p.G168D	NM_004631	NP_004622	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein	297	Extracellular (Potential).				cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity				0						ACGGCAGGTGCCCAGTGCTGC	0.592													14	21	---	---	---	---	PASS
PTGFR	5737	broad.mit.edu	37	1	78958841	78958841	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78958841C>G	uc001din.2	+	2	679	c.413C>G	c.(412-414)ACA>AGA	p.T138R	PTGFR_uc001dim.2_Missense_Mutation_p.T138R	NM_000959	NP_000950	P43088	PF2R_HUMAN	prostaglandin F receptor isoform a precursor	138	Cytoplasmic (Potential).				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity			ovary(3)|breast(2)|skin(1)	6				Colorectal(170;0.248)	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)	ATTGGAGTCACAAAACCAATA	0.408													41	144	---	---	---	---	PASS
UBE2Q1	55585	broad.mit.edu	37	1	154522941	154522941	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154522941C>T	uc001fff.1	-	13	1333	c.1242G>A	c.(1240-1242)TGG>TGA	p.W414*		NM_017582	NP_060052	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q	414							ATP binding|protein binding|ubiquitin-protein ligase activity				0	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGGGTGTGTACCAGCCTGCAA	0.537													64	161	---	---	---	---	PASS
LY9	4063	broad.mit.edu	37	1	160769615	160769615	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160769615C>G	uc001fwu.2	+	2	247	c.197C>G	c.(196-198)CCC>CGC	p.P66R	LY9_uc001fwt.2_Missense_Mutation_p.P66R|LY9_uc010pjs.1_Missense_Mutation_p.P66R|LY9_uc001fwv.2_Missense_Mutation_p.P66R|LY9_uc001fww.2_Missense_Mutation_p.P66R|LY9_uc001fwx.2_Missense_Mutation_p.P66R|LY9_uc001fwy.1_5'UTR	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	66	Extracellular (Potential).|Ig-like V-type 1.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GTGACTCTCCCCCTAAACATC	0.498													40	68	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201009799	201009799	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201009799A>T	uc001gvv.2	-	42	5404	c.5177T>A	c.(5176-5178)CTG>CAG	p.L1726Q		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1726	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CCTCTGGGTCAGCAGTCCCTT	0.617													23	57	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227227835	227227835	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227227835C>A	uc001hqr.2	-	23	4034	c.3091G>T	c.(3091-3093)GAA>TAA	p.E1031*	CDC42BPA_uc001hqq.2_Nonsense_Mutation_p.E330*|CDC42BPA_uc001hqs.2_Nonsense_Mutation_p.E950*|CDC42BPA_uc009xes.2_Nonsense_Mutation_p.E1003*|CDC42BPA_uc010pvs.1_Nonsense_Mutation_p.E1011*|CDC42BPA_uc001hqp.2_Nonsense_Mutation_p.E187*|CDC42BPA_uc001hqu.1_Nonsense_Mutation_p.E238*	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	1044	Phorbol-ester/DAG-type.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				TTCTTACCTTCACATGAACAG	0.338													24	92	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236924371	236924371	+	Silent	SNP	C	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236924371C>A	uc001hyf.2	+	20	2628	c.2424C>A	c.(2422-2424)ACC>ACA	p.T808T	ACTN2_uc001hyg.2_Silent_p.T600T|ACTN2_uc009xgi.1_Silent_p.T808T|ACTN2_uc010pxu.1_Silent_p.T497T|ACTN2_uc001hyh.2_Silent_p.T496T	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	808	2; possibly ancestral.|EF-hand 2.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GGCAAGGCACCGTCACCTTCC	0.542													43	107	---	---	---	---	PASS
RSAD2	91543	broad.mit.edu	37	2	7023597	7023597	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7023597C>T	uc002qyp.1	+	2	578	c.442C>T	c.(442-444)CGG>TGG	p.R148W		NM_080657	NP_542388	Q8WXG1	RSAD2_HUMAN	radical S-adenosyl methionine domain containing	148					defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		AGTAGAGTTGCGGCTGCCCAG	0.512													20	54	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128927889	128927889	+	Silent	SNP	G	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128927889G>T	uc002tps.2	+	27	3127	c.2949G>T	c.(2947-2949)GGG>GGT	p.G983G	UGGT1_uc010fme.1_Silent_p.G858G|UGGT1_uc002tpr.2_Silent_p.G959G	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	983					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						CGAAGGAAGGGGAGACATACT	0.443													19	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179454614	179454614	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179454614T>A	uc010zfg.1	-	253	54358	c.54134A>T	c.(54133-54135)CAG>CTG	p.Q18045L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q11740L|TTN_uc010zfi.1_Missense_Mutation_p.Q11673L|TTN_uc010zfj.1_Missense_Mutation_p.Q11548L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18972							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGCCTTTCTGGTTTGGTTT	0.373													49	96	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209169642	209169642	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209169642C>A	uc002vcz.2	+	12	1699	c.1541C>A	c.(1540-1542)TCT>TAT	p.S514Y	PIKFYVE_uc010fun.1_Missense_Mutation_p.S195Y|PIKFYVE_uc002vcy.1_Intron|PIKFYVE_uc002vcv.2_Missense_Mutation_p.S417Y|PIKFYVE_uc002vcw.2_Missense_Mutation_p.S514Y|PIKFYVE_uc002vcx.2_Missense_Mutation_p.S428Y	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	514					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TCAGCCGCTTCTATCAGCCTG	0.517													35	68	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183734	10183734	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183734C>A	uc003bvc.2	+	1	416	c.203C>A	c.(202-204)TCG>TAG	p.S68*	VHL_uc003bvd.2_Nonsense_Mutation_p.S68*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	68			Missing (in VHLD; type I).|S -> W (in pheochromocytoma and VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.S68*(12)|p.S68P(2)|p.N67fs*59(1)|p.S68S(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.S68L(1)|p.S68T(1)|p.N67fs*64(1)|p.N67fs*63(1)|p.P61fs*61(1)|p.R69fs*63(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TCGGTGAACTCGCGCGAGCCC	0.716		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	4	---	---	---	---	PASS
OXSM	54995	broad.mit.edu	37	3	25832713	25832713	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25832713G>C	uc003cdn.2	+	2	309	c.202G>C	c.(202-204)GGA>CGA	p.G68R	NGLY1_uc011awo.1_5'Flank|OXSM_uc011awp.1_5'UTR|OXSM_uc010hfh.2_Missense_Mutation_p.G68R	NM_017897	NP_060367	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial isoform 1	68					acyl-CoA metabolic process|medium-chain fatty acid biosynthetic process|short-chain fatty acid biosynthetic process	mitochondrion	3-oxoacyl-[acyl-carrier-protein] synthase activity			ovary(1)|breast(1)	2						TCGTCTTATCGGAGGAGAGAG	0.463													60	87	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52620685	52620685	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52620685G>C	uc003des.2	-	20	3155	c.3143C>G	c.(3142-3144)CCA>CGA	p.P1048R	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.P1048R|PBRM1_uc003der.2_Missense_Mutation_p.P1016R|PBRM1_uc003det.2_Missense_Mutation_p.P1063R|PBRM1_uc003deu.2_Missense_Mutation_p.P1063R|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.P1048R|PBRM1_uc010hmk.1_Missense_Mutation_p.P1023R|PBRM1_uc003dey.2_Missense_Mutation_p.P1023R|PBRM1_uc003dez.1_Missense_Mutation_p.P1047R|PBRM1_uc003dfb.1_Missense_Mutation_p.P960R|PBRM1_uc003dfa.1_Missense_Mutation_p.P394R	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1048	BAH 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GAAGTTTTCTGGGCATAACTT	0.363			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								30	50	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130289957	130289957	+	Silent	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130289957C>T	uc010htl.2	+	6	2728	c.2697C>T	c.(2695-2697)TTC>TTT	p.F899F		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	899	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						ACCACATGTTCACTGAAGCCC	0.537													9	26	---	---	---	---	PASS
NCEH1	57552	broad.mit.edu	37	3	172365895	172365895	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172365895T>A	uc011bpx.1	-	2	382	c.244A>T	c.(244-246)ATC>TTC	p.I82F	NCEH1_uc003fig.2_Missense_Mutation_p.I82F|NCEH1_uc011bpw.1_5'UTR|NCEH1_uc011bpy.1_Intron	NM_001146276	NP_001139748	Q6PIU2	NCEH1_HUMAN	arylacetamide deacetylase-like 1 isoform a	50	Lumenal (Potential).				lipid catabolic process	endoplasmic reticulum|integral to membrane|microsome	carboxylesterase activity				0						AGGTAGTGGATCAGGTTACTC	0.512													23	54	---	---	---	---	PASS
TEC	7006	broad.mit.edu	37	4	48147523	48147523	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48147523C>A	uc003gxz.2	-	13	1246	c.1155G>T	c.(1153-1155)AGG>AGT	p.R385S		NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase	385	Protein kinase.				intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						ATTTGCCAAGCCTCACCACTC	0.458													72	132	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114277953	114277953	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114277953C>T	uc003ibe.3	+	38	8279	c.8179C>T	c.(8179-8181)CAG>TAG	p.Q2727*	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Nonsense_Mutation_p.Q29*|ANK2_uc011cgb.1_Nonsense_Mutation_p.Q2742*	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2694					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGAAGATACTCAGGAAGAGCC	0.423													36	97	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155253991	155253991	+	Silent	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155253991C>T	uc003inw.2	-	9	1872	c.1872G>A	c.(1870-1872)TCG>TCA	p.S624S	DCHS2_uc003inx.2_Silent_p.S1123S	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	624	Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGGGTTCCAGCGAGTACCTAA	0.527													16	28	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553991	140553991	+	Silent	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553991G>A	uc003lit.2	+	1	1749	c.1575G>A	c.(1573-1575)CAG>CAA	p.Q525Q		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	525	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGCCCTGCAGGCGTTCGAGT	0.706													31	75	---	---	---	---	PASS
GRK6	2870	broad.mit.edu	37	5	176860405	176860405	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176860405T>A	uc011dfz.1	+	7	751	c.591T>A	c.(589-591)TTT>TTA	p.F197L	GRK6_uc003mgp.2_Missense_Mutation_p.F197L|GRK6_uc003mgq.2_Missense_Mutation_p.F197L|GRK6_uc003mgs.1_Missense_Mutation_p.F167L	NM_002082	NP_002073	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6 isoform B	197	Protein kinase.|ATP.				regulation of G-protein coupled receptor protein signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)|stomach(1)|breast(1)	3	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGGTGGCTTTGGGGAGGTGA	0.617													18	61	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7231266	7231266	+	Silent	SNP	T	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7231266T>A	uc003mxc.2	+	10	3324	c.2934T>A	c.(2932-2934)TCT>TCA	p.S978S	RREB1_uc003mxb.2_Silent_p.S978S|RREB1_uc010jnx.2_Silent_p.S978S	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	978	Pro-rich.				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CCGGCCCTTCTCTTCCTGTAA	0.682													16	24	---	---	---	---	PASS
CYP3A7	1551	broad.mit.edu	37	7	99313483	99313483	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99313483C>A	uc003uru.2	-	7	673	c.568G>T	c.(568-570)GGA>TGA	p.G190*	ZNF498_uc003urn.2_Intron|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	NM_000765	NP_000756	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A,	190					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)	1	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)					ATGCTCACTCCAAATGATGTG	0.423													54	145	---	---	---	---	PASS
SPAM1	6677	broad.mit.edu	37	7	123593857	123593857	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123593857G>A	uc003vld.2	+	4	635	c.233G>A	c.(232-234)AGC>AAC	p.S78N	SPAM1_uc003vle.2_Missense_Mutation_p.S78N|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.S78N|SPAM1_uc010lku.2_Missense_Mutation_p.S78N	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	78					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	TTCATAGGAAGCCCCCGAATA	0.428													27	61	---	---	---	---	PASS
C8orf42	157695	broad.mit.edu	37	8	442623	442623	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:442623G>A	uc003wpd.2	-	3	908	c.334C>T	c.(334-336)CCA>TCA	p.P112S	C8orf42_uc011kwg.1_Missense_Mutation_p.P112S	NM_175075	NP_778250	Q86YL5	CH042_HUMAN	hypothetical protein LOC157695	112											0		Ovarian(12;0.0481)|Colorectal(14;0.0815)|Hepatocellular(245;0.0968)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;5.16e-14)|OV - Ovarian serous cystadenocarcinoma(5;7.35e-07)|BRCA - Breast invasive adenocarcinoma(11;4.17e-06)|COAD - Colon adenocarcinoma(149;0.0255)		GCAAGTTTTGGAGGCTCCCAA	0.478													26	58	---	---	---	---	PASS
SLC7A2	6542	broad.mit.edu	37	8	17412117	17412117	+	Silent	SNP	G	A	A	rs1134978		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17412117G>A	uc011kyc.1	+	7	1273	c.1104G>A	c.(1102-1104)GCG>GCA	p.A368A	SLC7A2_uc011kyd.1_Intron|SLC7A2_uc011kye.1_Silent_p.A408A|SLC7A2_uc011kyf.1_Silent_p.A368A	NM_001008539	NP_001008539	P52569	CTR2_HUMAN	solute carrier family 7, member 2 isoform 2	368	Cytoplasmic (Potential).				cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	ATGCTATGGCGGAGGATGGGT	0.413													81	206	---	---	---	---	PASS
CHMP7	91782	broad.mit.edu	37	8	23118090	23118090	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23118090A>C	uc003xdc.2	+	11	1988	c.1340A>C	c.(1339-1341)GAA>GCA	p.E447A	CHMP7_uc003xdd.2_Missense_Mutation_p.E337A|CHMP7_uc003xde.2_Missense_Mutation_p.N285H	NM_152272	NP_689485	Q8WUX9	CHMP7_HUMAN	CHMP family, member 7	447					cellular membrane organization|late endosome to vacuole transport	cytosol|ESCRT III complex	protein transporter activity				0		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		AGGCAATTGGAACCGACTCTA	0.423													61	109	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113212507	113212507	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113212507T>C	uc010mtz.2	-	24	4272	c.3935A>G	c.(3934-3936)CAG>CGG	p.Q1312R	SVEP1_uc010mua.1_Missense_Mutation_p.Q1312R	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	1312	EGF-like 4; calcium-binding (Potential).				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						TGGGTTTGACTGGCATTCATT	0.458													50	58	---	---	---	---	PASS
ZNF438	220929	broad.mit.edu	37	10	31134199	31134199	+	Silent	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31134199C>T	uc010qdz.1	-	8	2613	c.2178G>A	c.(2176-2178)CTG>CTA	p.L726L	ZNF438_uc001ivn.2_Silent_p.L677L|ZNF438_uc010qdy.1_Silent_p.L716L|ZNF438_uc001ivo.3_Silent_p.L290L|ZNF438_uc009xlg.2_Silent_p.L726L|ZNF438_uc001ivp.3_Silent_p.L716L|ZNF438_uc010qea.1_Silent_p.L726L|ZNF438_uc010qeb.1_Silent_p.L726L	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	726					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)				GCTGCCTTTTCAGTCTTGGAC	0.547													67	95	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61815520	61815520	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61815520A>T	uc001jky.2	-	42	13153	c.12961T>A	c.(12961-12963)TGT>AGT	p.C4321S	ANK3_uc001jkw.2_Missense_Mutation_p.C945S|ANK3_uc009xpa.2_Missense_Mutation_p.C945S|ANK3_uc001jkx.2_Missense_Mutation_p.C989S|ANK3_uc010qih.1_Missense_Mutation_p.C1812S|ANK3_uc001jkz.3_Missense_Mutation_p.C1805S|ANK3_uc001jkv.2_Missense_Mutation_p.C344S	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	4321					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						ACAGGCACACAGGGTTTAGTC	0.463													134	334	---	---	---	---	PASS
DLG5	9231	broad.mit.edu	37	10	79553777	79553777	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79553777C>G	uc001jzk.2	-	31	5715	c.5645G>C	c.(5644-5646)AGG>ACG	p.R1882T	DLG5_uc001jzi.2_Missense_Mutation_p.R637T|DLG5_uc001jzj.2_Missense_Mutation_p.R1297T	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	1882	Guanylate kinase-like.				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGTGAAGTACCTGCTGTACTC	0.577													59	134	---	---	---	---	PASS
FANCF	2188	broad.mit.edu	37	11	22646844	22646844	+	Silent	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22646844C>T	uc001mql.1	-	1	544	c.513G>A	c.(511-513)CTG>CTA	p.L171L		NM_022725	NP_073562	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	171					DNA repair	nucleoplasm	protein binding			skin(1)	1						GCAGACGCTCCAGCAGCAGCT	0.612			N|F			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	56	164	---	---	---	---	PASS
CHRM4	1132	broad.mit.edu	37	11	46407571	46407571	+	Silent	SNP	C	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46407571C>A	uc001nct.1	-	1	537	c.537G>T	c.(535-537)ACG>ACT	p.T179T		NM_000741	NP_000732	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	179	Extracellular (By similarity).				cell proliferation	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity				0				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)|Tropicamide(DB00809)	TGTCGGGCACCGTCCGCTTAC	0.582													3	19	---	---	---	---	PASS
MTA2	9219	broad.mit.edu	37	11	62366080	62366080	+	Silent	SNP	C	G	G			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62366080C>G	uc001ntq.1	-	4	603	c.222G>C	c.(220-222)GGG>GGC	p.G74G	MTA2_uc010rlx.1_5'UTR	NM_004739	NP_004730	O94776	MTA2_HUMAN	metastasis-associated protein 2	74	BAH.				chromatin assembly or disassembly	NuRD complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						GCTCAGACACCCCTGGCTGCT	0.483													58	161	---	---	---	---	PASS
TPCN2	219931	broad.mit.edu	37	11	68853399	68853399	+	Splice_Site	SNP	G	A	A	rs145113932		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68853399G>A	uc001oos.2	+	22	2119	c.2003_splice	c.e22+1	p.P668_splice	TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_Splice_Site	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ACTCAGGCCCGTGAGTCCTCG	0.637													3	21	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92087535	92087535	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92087535G>A	uc001pdj.3	+	1	2274	c.2257G>A	c.(2257-2259)GCC>ACC	p.A753T		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	753	Extracellular (Potential).|Cadherin 7.				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGCCTATGATGCCGACTCTGG	0.403										TCGA Ovarian(4;0.039)			100	177	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95694240	95694240	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95694240C>T	uc001tdz.2	+	12	2236	c.2131C>T	c.(2131-2133)CCT>TCT	p.P711S	VEZT_uc009ztb.1_RNA|VEZT_uc009ztc.1_Missense_Mutation_p.P76S|VEZT_uc001tdy.2_RNA	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	711						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						GACCACTGCCCCTCCAACTCC	0.507													16	44	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42440166	42440166	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42440166C>T	uc001uyj.2	-	11	1289	c.1219G>A	c.(1219-1221)GCC>ACC	p.A407T	KIAA0564_uc001uyk.2_Missense_Mutation_p.A407T	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	407						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		CTGGTCCCGGCTGGCACCTAT	0.303													26	61	---	---	---	---	PASS
SLC8A3	6547	broad.mit.edu	37	14	70634851	70634851	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70634851G>A	uc001xly.2	-	2	1043	c.289C>T	c.(289-291)CGC>TGC	p.R97C	SLC8A3_uc001xlw.2_Missense_Mutation_p.R97C|SLC8A3_uc001xlx.2_Missense_Mutation_p.R97C|SLC8A3_uc001xlz.2_Missense_Mutation_p.R97C|SLC8A3_uc010ara.2_RNA	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium	97	Cytoplasmic (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GCCATGAAGCGGTCAGCAATG	0.488													24	46	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105418040	105418040	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105418040G>A	uc010axc.1	-	7	3868	c.3748C>T	c.(3748-3750)CAG>TAG	p.Q1250*	AHNAK2_uc001ypx.2_Nonsense_Mutation_p.Q1150*	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1250						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTAGGCATCTGCACCTTGGGC	0.622													67	162	---	---	---	---	PASS
RAD51	5888	broad.mit.edu	37	15	41011016	41011016	+	Missense_Mutation	SNP	G	A	A	rs121917739	byFrequency	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41011016G>A	uc001zmi.3	+	6	748	c.449G>A	c.(448-450)CGG>CAG	p.R150Q	RAD51_uc010bbw.2_Missense_Mutation_p.R150Q|RAD51_uc010bbx.2_Missense_Mutation_p.R151Q|RAD51_uc001zmk.3_Intron|RAD51_uc001zml.3_Missense_Mutation_p.R151Q|RAD51_uc001zmn.1_Missense_Mutation_p.R67Q	NM_002875	NP_002866	Q06609	RAD51_HUMAN	RAD51 homolog protein isoform 1	150			R -> Q (in BC; familial).		DNA recombinase assembly|DNA unwinding involved in replication|mitotic recombination|positive regulation of DNA ligation|protein homooligomerization|reciprocal meiotic recombination	mitochondrial matrix|nucleus|perinuclear region of cytoplasm|PML body	ATP binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|protein C-terminus binding|single-stranded DNA binding|single-stranded DNA-dependent ATPase activity				0		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		CCCATTGACCGGGGTGGAGGT	0.453								Homologous_recombination					42	98	---	---	---	---	PASS
PLA2G4D	283748	broad.mit.edu	37	15	42363002	42363002	+	Silent	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42363002G>A	uc001zox.2	-	18	2051	c.1956C>T	c.(1954-1956)ATC>ATT	p.I652I		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	652	PLA2c.				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)|skin(1)	2		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		AGCTGGTGTTGATGAAGTAGG	0.632													3	13	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43821933	43821933	+	Silent	SNP	T	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43821933T>A	uc001zrt.2	+	5	8588	c.8121T>A	c.(8119-8121)GCT>GCA	p.A2707A		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2707						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GCAAGACTGCTGACCTTGACT	0.572													40	101	---	---	---	---	PASS
NMRAL1	57407	broad.mit.edu	37	16	4519369	4519369	+	Silent	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4519369C>T	uc002cwm.2	-	3	294	c.138G>A	c.(136-138)GAG>GAA	p.E46E	NMRAL1_uc002cwn.2_Silent_p.E46E|NMRAL1_uc002cwo.2_Silent_p.E46E|NMRAL1_uc002cwp.2_Silent_p.E82E	NM_020677	NP_065728	Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	46						nucleus|perinuclear region of cytoplasm	binding			kidney(1)	1						GCAGCCTCAGCTCCTTTGCTG	0.582													174	227	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16108476	16108476	+	Silent	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16108476C>T	uc010bvi.2	+	4	655	c.480C>T	c.(478-480)GCC>GCT	p.A160A	ABCC1_uc010bvj.2_Silent_p.A160A|ABCC1_uc010bvk.2_Silent_p.A160A|ABCC1_uc010bvl.2_Silent_p.A160A|ABCC1_uc010bvm.2_Silent_p.A160A|ABCC1_uc002del.3_Silent_p.A44A|ABCC1_uc010bvn.2_Silent_p.A23A	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	160	Extracellular.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TTATGACAGCCTTAAAAGAGG	0.522													39	138	---	---	---	---	PASS
NUTF2	10204	broad.mit.edu	37	16	67904600	67904600	+	Intron	SNP	G	C	C			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67904600G>C	uc002eup.2	+						NUTF2_uc002euq.3_RNA|EDC4_uc002eur.2_5'Flank|EDC4_uc010cer.2_5'Flank|EDC4_uc010vkg.1_5'Flank	NM_005796	NP_005787	P61970	NTF2_HUMAN	nuclear transport factor 2						protein transport	cytosol|nuclear pore	protein binding|transporter activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		AGGACAGTAGGGCCTGATCCT	0.443													5	23	---	---	---	---	PASS
KIAA0182	23199	broad.mit.edu	37	16	85696485	85696485	+	Intron	SNP	G	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85696485G>T	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_5'UTR|KIAA0182_uc010cho.2_5'Flank	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						GTGCCAGCAGGCCTGGCCTGA	0.562													7	9	---	---	---	---	PASS
GALNS	2588	broad.mit.edu	37	16	88893182	88893182	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88893182G>A	uc002fly.3	-	10	1156	c.1067C>T	c.(1066-1068)ACG>ATG	p.T356M	GALNS_uc010cid.2_Missense_Mutation_p.T362M|GALNS_uc002flz.3_Missense_Mutation_p.T39M	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	356						lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	GCTGGGCGGCGTCAGGCCCGC	0.657													3	12	---	---	---	---	PASS
C17orf57	124989	broad.mit.edu	37	17	45503313	45503313	+	Intron	SNP	A	C	C			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45503313A>C	uc002iln.2	+						C17orf57_uc002ilm.2_Intron|LOC100272146_uc010wks.1_RNA	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989								calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						AGAGAGAGCGAGCACAATGTA	0.353													19	59	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22804557	22804557	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22804557C>T	uc002kvk.2	-	4	3572	c.3325G>A	c.(3325-3327)GTC>ATC	p.V1109I	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.V1109I|ZNF521_uc002kvl.2_Missense_Mutation_p.V889I	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	1109					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CCGGGAGGGACGTTAATGCCT	0.547			T	PAX5	ALL								22	59	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59221899	59221899	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59221899G>A	uc010dps.1	+	11	2389	c.2377G>A	c.(2377-2379)GCG>ACG	p.A793T	CDH20_uc002lif.2_Missense_Mutation_p.A787T	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	793	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				GCTCTACGGGGCGTCGGAGGG	0.692													7	5	---	---	---	---	PASS
PRMT1	3276	broad.mit.edu	37	19	50185319	50185319	+	Silent	SNP	C	T	T	rs143554083		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50185319C>T	uc010enf.1	+	4	387	c.345C>T	c.(343-345)ATC>ATT	p.I115I	PRMT1_uc002ppc.1_RNA|PRMT1_uc002ppd.2_Silent_p.I91I|PRMT1_uc002ppe.2_Silent_p.I97I|PRMT1_uc002ppf.2_RNA|PRMT1_uc002ppg.2_Silent_p.I62I|PRMT1_uc010yba.1_RNA	NM_001536	NP_001527	Q8WUW5	Q8WUW5_HUMAN	HMT1 hnRNP methyltransferase-like 2 isoform 1	96						cytoplasm	protein methyltransferase activity			ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)		GCAAGGTCATCGGGGTGAGTC	0.667													22	22	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135405173	135405173	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135405173A>G	uc004ezu.1	+	5	598	c.307A>G	c.(307-309)AGA>GGA	p.R103G	GPR112_uc010nsb.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	103	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					AATACTATACAGATTGGGAAA	0.433													12	154	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7023	7023	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7023G>A	uc011mfh.1	+	1	1170	c.122G>A	c.(121-123)TGT>TAT	p.C41Y	uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		CGTACTACGTTGTAGCTCACT	0.458													3	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	20952662	20952665	+	IGR	DEL	AAGA	-	-	rs72050492	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20952662_20952665delAAGA								CDA (7264 upstream) : PINK1 (7283 downstream)																							ggaaggaaggaagaaaggaaggga	0.010													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	76412548	76412549	+	IGR	INS	-	CTTC	CTTC	rs56952079		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76412548_76412549insCTTC								ASB17 (14432 upstream) : ST6GALNAC3 (127840 downstream)																							agctgatttatcttccttcctt	0.000													4	2	---	---	---	---	
TMEM183A	92703	broad.mit.edu	37	1	202991831	202991831	+	Intron	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202991831delA	uc001gyu.1	+						TMEM183A_uc001gyv.1_Intron|TMEM183A_uc001gyw.1_Intron|TMEM183A_uc001gyx.1_Intron|TMEM183A_uc001gyy.2_5'Flank	NM_001079809	NP_001073277	Q8IXX5	T183A_HUMAN	transmembrane protein 183B							integral to membrane					0			BRCA - Breast invasive adenocarcinoma(75;0.18)			gtcctttctcaaaaaaaaaaa	0.144													3	4	---	---	---	---	
CNTN2	6900	broad.mit.edu	37	1	205036040	205036041	+	Intron	INS	-	G	G	rs151113569	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205036040_205036041insG	uc001hbr.2	+						CNTN2_uc001hbq.1_Intron|CNTN2_uc001hbs.2_Intron	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CACACAGCATTGCAGAGGCACC	0.317													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90473889	90473890	+	IGR	DEL	GT	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90473889_90473890delGT								None (None upstream) : None (None downstream)																							gtgtgtgtacgtgtgtgtgtgt	0.292													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131590958	131590960	+	Intron	DEL	AAG	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131590958_131590960delAAG	uc002trx.1	-											Homo sapiens cDNA FLJ33681 fis, clone BRAWH2002549.																		gaaggaaagaaagaaagaaaaga	0.049													5	3	---	---	---	---	
TNFAIP6	7130	broad.mit.edu	37	2	152214427	152214427	+	Intron	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152214427delT	uc002txk.2	+							NM_007115	NP_009046	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6						cell adhesion|cell-cell signaling|inflammatory response|signal transduction		hyaluronic acid binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		ATACATACGCTTTTTTTTTTT	0.279													5	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225661961	225661961	+	Intron	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225661961delT	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATCCCTCTCCTTTTTTTTTTT	0.333													4	2	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230634174	230634174	+	Intron	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230634174delA	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACCTCTTTCCaaaaaaaaaaa	0.333													4	2	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242433012	242433013	+	Intron	INS	-	T	T	rs113589065		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242433012_242433013insT	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GCAATGCtttgttttttttttt	0.243													5	3	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184587435	184587436	+	Intron	DEL	AC	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184587435_184587436delAC	uc003fpb.1	+						VPS8_uc010hyd.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GTATTAAAAAacacacacacac	0.168													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195664074	195664075	+	IGR	INS	-	G	G			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195664074_195664075insG								TNK2 (25258 upstream) : SDHAP1 (22717 downstream)																							CCAAGAGACCCGCGGAGGGAGG	0.658													9	5	---	---	---	---	
FAM114A1	92689	broad.mit.edu	37	4	38879585	38879586	+	Intron	INS	-	A	A	rs34317975		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38879585_38879586insA	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron|FAM114A1_uc011byg.1_Intron	NM_138389	NP_612398	Q8IWE2	NXP20_HUMAN	hypothetical protein LOC92689							cytoplasm				ovary(1)	1						aactccgtctcaaaaaaaaaaa	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	42386066	42386069	+	IGR	DEL	CCTT	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42386066_42386069delCCTT								BEND4 (231171 upstream) : SHISA3 (13787 downstream)																							tccttccttcccttccttccttcc	0.078													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	177944807	177944807	+	IGR	DEL	G	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177944807delG								VEGFC (230912 upstream) : NEIL3 (286184 downstream)																							aggaaagaaagaaagagaaag	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55028949	55028960	+	IGR	DEL	TCCTTCCTTCCT	-	-	rs7380931		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55028949_55028960delTCCTTCCTTCCT								SLC38A9 (20395 upstream) : DDX4 (4885 downstream)																							ttctctttcctccttccttccttccttccttc	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	87232818	87232821	+	IGR	DEL	CTTC	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87232818_87232821delCTTC								CCNH (523982 upstream) : TMEM161B (258203 downstream)																							ccttccttttcttccttctttctt	0.000													4	2	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134140864	134140864	+	Intron	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134140864delT	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAGAACTGTAttttttttttt	0.204													4	2	---	---	---	---	
PCDHGA10	56106	broad.mit.edu	37	5	140852548	140852548	+	Intron	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140852548delA	uc003lkl.1	+						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			agtgaaactcaaaaaaaaaaa	0.050													4	3	---	---	---	---	
HMMR	3161	broad.mit.edu	37	5	162887151	162887151	+	5'Flank	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162887151delT	uc003lzf.2	+						NUDCD2_uc003lze.2_5'Flank|HMMR_uc003lzh.2_5'Flank|HMMR_uc003lzg.2_5'Flank|HMMR_uc011dem.1_5'Flank	NM_012484	NP_036616	O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor isoform b							cell surface|cytoplasm	hyaluronic acid binding				0	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)		TCCGCTCGGGTCACTGCGCAT	0.652													23	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174357094	174357097	+	IGR	DEL	CTTT	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174357094_174357097delCTTT								MSX2 (199193 upstream) : DRD1 (510579 downstream)																							tcttttcttcctttctttcttttc	0.098													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15710434	15710437	+	IGR	DEL	CTTT	-	-	rs12191708		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15710434_15710437delCTTT								DTNBP1 (47163 upstream) : MYLIP (418880 downstream)																							tccttccttcctttcttcctttct	0.088													16	7	---	---	---	---	
MRS2	57380	broad.mit.edu	37	6	24416484	24416484	+	Intron	DEL	T	-	-	rs35657958		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24416484delT	uc003neb.2	+						MRS2_uc003nea.2_Intron|MRS2_uc011djl.1_Intron|MRS2_uc011djm.1_Intron|MRS2_uc011djn.1_Intron|MRS2_uc003nec.2_Intron	NM_020662	NP_065713	Q9HD23	MRS2_HUMAN	MRS2-like, magnesium homeostasis factor						ion transport	integral to membrane|mitochondrial inner membrane					0						AATACTCAACttttttttttt	0.139													4	3	---	---	---	---	
GPX6	257202	broad.mit.edu	37	6	28474483	28474484	+	Intron	INS	-	AC	AC	rs56155284		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28474483_28474484insAC	uc011dlj.1	-						GPX6_uc010jrg.1_Intron	NM_182701	NP_874360	P59796	GPX6_HUMAN	glutathione peroxidase 6 precursor						response to oxidative stress	extracellular region	glutathione peroxidase activity			ovary(3)|pancreas(1)|skin(1)	5					Glutathione(DB00143)	TTTTTTTTTAAacacacacaca	0.342													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1458978	1458980	+	IGR	DEL	CTC	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1458978_1458980delCTC								UNCX (182366 upstream) : MICALL2 (15016 downstream)																							ATAACCCCGTctcctcctcctcc	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65888988	65888988	+	IGR	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65888988delT								NCRNA00174 (23593 upstream) : LOC493754 (104458 downstream)																							tttttttttcttttttttttt	0.264													5	3	---	---	---	---	
PDAP1	11333	broad.mit.edu	37	7	98994127	98994127	+	3'UTR	DEL	C	-	-	rs113663373		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98994127delC	uc003uqe.2	-	6						NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1						cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	CTCCCCCAGTCCCCCCCCCCA	0.542													3	3	---	---	---	---	
FAM3C	10447	broad.mit.edu	37	7	121023197	121023197	+	Intron	DEL	A	-	-	rs35702337		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121023197delA	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					CATTGGCATTAAAAAAAAAAA	0.209													4	2	---	---	---	---	
CHRM2	1129	broad.mit.edu	37	7	136685314	136685315	+	Intron	INS	-	GAAGGAAA	GAAGGAAA	rs137979175	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136685314_136685315insGAAGGAAA	uc003vtf.1	+						CHRM2_uc003vtg.1_Intron|CHRM2_uc003vtj.1_Intron|CHRM2_uc003vtk.1_Intron|CHRM2_uc003vtl.1_Intron|CHRM2_uc003vtm.1_Intron|CHRM2_uc003vti.1_Intron|CHRM2_uc003vto.1_Intron|CHRM2_uc003vtn.1_Intron|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2						activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	aaggaaggaaggaaggaaggaa	0.119													4	2	---	---	---	---	
TTC26	79989	broad.mit.edu	37	7	138857969	138857969	+	Intron	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138857969delA	uc003vus.2	+						TTC26_uc011kqn.1_Intron|TTC26_uc011kqo.1_Intron|TTC26_uc011kqp.1_Intron|TTC26_uc003vut.2_Intron|TTC26_uc011kqq.1_Intron	NM_024926	NP_079202	A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26 isoform 1								binding			ovary(1)	1						GTACAAAGTCACCtttttttt	0.214													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103487951	103487951	+	IGR	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103487951delT								UBR5 (63456 upstream) : ODF1 (75897 downstream)																							ccttccttccttTTTTTTTTT	0.065													2	5	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20787095	20787098	+	Intron	DEL	AAAT	-	-	rs62557557	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20787095_20787098delAAAT	uc003zog.1	+							NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		acaaacaaacaaataaacaaacaa	0.368													4	2	---	---	---	---	
HIATL2	84278	broad.mit.edu	37	9	99734982	99734982	+	Intron	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99734982delA	uc004aws.2	-						HIATL2_uc004awr.1_Intron	NR_002894				RecName: Full=Hippocampus abundant transcript-like protein 2;												0						ACCACAATGGaaaaaaaaaaa	0.358													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11696232	11696233	+	IGR	INS	-	AGGAAGGAAGGA	AGGAAGGAAGGA			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11696232_11696233insAGGAAGGAAGGA								USP6NL (42553 upstream) : ECHDC3 (88123 downstream)																							AGGaggaggagaggaaggaagg	0.035													5	3	---	---	---	---	
KIAA1462	57608	broad.mit.edu	37	10	30362576	30362577	+	Intron	INS	-	TCCT	TCCT			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362576_30362577insTCCT	uc001iuz.2	-									Q9P266	K1462_HUMAN	RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4						TAGCAAGATTGtccttccttcc	0.158													6	4	---	---	---	---	
AGAP5	729092	broad.mit.edu	37	10	75486922	75486923	+	Intron	INS	-	A	A	rs11387949		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75486922_75486923insA	uc001juu.3	-						BMS1P4_uc001juv.3_Intron|BMS1P4_uc010qkm.1_Intron	NM_001144000	NP_001137472	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						GCTAACTTAGTAAAGTATAAGA	0.386													7	4	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88820205	88820205	+	Intron	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88820205delT	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TGTTTGCTTGTTTTTTTTTTT	0.209													4	2	---	---	---	---	
IDE	3416	broad.mit.edu	37	10	94268316	94268317	+	Intron	INS	-	A	A	rs144722232		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268316_94268317insA	uc001kia.2	-							NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	atctaaaaaagaaaaaaaaAAA	0.188													8	4	---	---	---	---	
VTI1A	143187	broad.mit.edu	37	10	114574898	114574899	+	Intron	INS	-	CA	CA	rs631578	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114574898_114574899insCA	uc001kzz.2	+							NM_145206	NP_660207	Q96AJ9	VTI1A_HUMAN	SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		TTTCGCGCGCGcacacacacac	0.480													5	3	---	---	---	---	
HBG2	3048	broad.mit.edu	37	11	5559122	5559123	+	Intron	INS	-	GG	GG	rs150877031	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5559122_5559123insGG	uc001mak.1	-									P69892	HBG2_HUMAN	Homo sapiens hemoglobin gamma-G (HBG2) mRNA, partial cds.						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ttgtatttctaggtgtgtgtgt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56249435	56249438	+	IGR	DEL	AAGA	-	-	rs11382373	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56249435_56249438delAAGA								OR5M3 (11462 upstream) : OR5M8 (8473 downstream)																							ggaaggaaggaagaaagaaagaaa	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68412245	68412246	+	IGR	INS	-	G	G	rs60199346		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68412245_68412246insG								SAPS3 (29446 upstream) : GAL (39737 downstream)																							aaggaaggaaagaaggaaggaa	0.000													3	3	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31630951	31630952	+	Intron	INS	-	T	T	rs142172766	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31630951_31630952insT	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron|DENND5B_uc001rkj.2_Intron|DENND5B_uc001rkk.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						TAAAAAATGGATTTTTTTTTTA	0.322													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	65527520	65527523	+	IGR	DEL	GGAA	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65527520_65527523delGGAA								WIF1 (12404 upstream) : LEMD3 (35848 downstream)																							ATAGAGCTGTggaaggaaggaagg	0.181													4	3	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	71003525	71003526	+	Intron	DEL	TT	-	-	rs35267294		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71003525_71003526delTT	uc001swb.3	-						PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron|PTPRB_uc001swd.3_Intron|PTPRB_uc009zrr.1_Intron|PTPRB_uc001swe.2_Intron	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTCTGACCCCTTCTCGGGCCAC	0.569													6	3	---	---	---	---	
VPS29	51699	broad.mit.edu	37	12	110937446	110937446	+	Intron	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110937446delA	uc001tqy.2	-						VPS29_uc001tqw.2_5'Flank|VPS29_uc001tqx.2_Intron|VPS29_uc001tqz.2_Intron|RAD9B_uc001trc.1_5'Flank|RAD9B_uc001trf.3_5'Flank|RAD9B_uc001trg.3_5'Flank|RAD9B_uc010sya.1_5'Flank|RAD9B_uc001tre.3_5'Flank|RAD9B_uc001trd.3_5'Flank	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1						protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						aaaagaaaccaaaaaaaaaaa	0.289													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	127990353	127990356	+	IGR	DEL	TCCT	-	-	rs35920059		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127990353_127990356delTCCT								None (None upstream) : TMEM132C (908935 downstream)																							tttcctttcctccttccttccttc	0.127													4	4	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25069017	25069018	+	Intron	INS	-	TTTTTT	TTTTTT	rs139965809	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25069017_25069018insTTTTTT	uc001upl.2	-						PARP4_uc010tdc.1_Intron	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ttttctttttcttttttttttg	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	64661925	64661928	+	IGR	DEL	AGGA	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64661925_64661928delAGGA								OR7E156P (345224 upstream) : None (None downstream)																							gcaggaaggcaggaaggaaggaag	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850123	112850126	+	IGR	DEL	CTTC	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850123_112850126delCTTC								SOX1 (124103 upstream) : C13orf28 (180543 downstream)																							tccttcccctcttccttccttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	77120925	77120925	+	IGR	DEL	G	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77120925delG								ESRRB (152747 upstream) : VASH1 (107310 downstream)																							ggggaagggtggtactatctt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20563423	20563423	+	IGR	DEL	C	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20563423delC								None (None upstream) : GOLGA6L6 (173671 downstream)																							cccttcctctcccttcctctc	0.448													6	3	---	---	---	---	
NIPA1	123606	broad.mit.edu	37	15	23052358	23052363	+	Intron	DEL	GGCCAC	-	-	rs72277823		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23052358_23052363delGGCCAC	uc001yvc.2	-						NIPA1_uc001yvd.2_Intron|NIPA1_uc001yve.2_Intron	NM_144599	NP_653200	Q7RTP0	NIPA1_HUMAN	non-imprinted in Prader-Willi/Angelman syndrome						cell death	early endosome|integral to membrane|plasma membrane					0		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		AGGAATACCAGGCCACGGAGGCTCCC	0.650													4	3	---	---	---	---	
ARRDC4	91947	broad.mit.edu	37	15	98508660	98508661	+	Intron	DEL	CG	-	-	rs28380454	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98508660_98508661delCG	uc010bom.2	+						ARRDC4_uc002bui.3_Intron	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4						signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CATAGACACACGCACACACACC	0.203													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102322365	102322365	+	IGR	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102322365delA								TARSL2 (57720 upstream) : OR4F6 (23558 downstream)																							GCGTGGCCTTAATGCTCCAAG	0.562													71	35	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10532277	10532277	+	Intron	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10532277delT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						aatttttgggttttttttttt	0.000													3	5	---	---	---	---	
SCNN1B	6338	broad.mit.edu	37	16	23354830	23354831	+	Intron	INS	-	GG	GG	rs10655638		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23354830_23354831insGG	uc002dln.2	+							NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	gaaggaaggaaaaggaaggaag	0.010													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55776076	55776077	+	IGR	DEL	AC	-	-	rs141799220		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55776076_55776077delAC								SLC6A2 (38378 upstream) : CES4 (18434 downstream)																							cacacacaaaacacacacacac	0.376													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81759318	81759319	+	IGR	INS	-	CTTTCTTCCTTC	CTTTCTTCCTTC	rs13330700	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81759318_81759319insCTTTCTTCCTTC								CMIP (13953 upstream) : PLCG2 (53611 downstream)																							tttctttctttcttccttcctt	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16309620	16309623	+	IGR	DEL	AGGG	-	-	rs113233361		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16309620_16309623delAGGG								UBB (23567 upstream) : TRPV2 (9265 downstream)																							gaaggaaggaagggagggagggag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18988444	18988444	+	IGR	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18988444delA								GRAP (38108 upstream) : GRAPL (42338 downstream)																							ccctgtctccaaaaaaaaaaa	0.129													4	3	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80152185	80152186	+	Intron	INS	-	TT	TT	rs140430398		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80152185_80152186insTT	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GACTCAATGACttttttttttt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	20619944	20619945	+	IGR	DEL	AG	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20619944_20619945delAG								RBBP8 (13499 upstream) : CABLES1 (94583 downstream)																							agaaagagacagagagagagag	0.000													2	4	---	---	---	---	
CYB5A	1528	broad.mit.edu	37	18	71930382	71930383	+	Intron	DEL	AA	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71930382_71930383delAA	uc002lli.2	-						CYB5A_uc002llh.2_Intron	NM_148923	NP_683725	P00167	CYB5_HUMAN	cytochrome b-5 isoform 1						electron transport chain|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane	aldo-keto reductase (NADP) activity|cytochrome-c oxidase activity|enzyme binding|heme binding				0		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)			Methoxyflurane(DB01028)	gacctgtctcaaaaaaaaaaaa	0.124													6	3	---	---	---	---	
SAFB	6294	broad.mit.edu	37	19	5668445	5668445	+	3'UTR	DEL	T	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5668445delT	uc002mcf.2	+	21					SAFB_uc002mcg.2_3'UTR|SAFB_uc002mce.3_3'UTR|SAFB_uc010xir.1_3'UTR|SAFB_uc010xis.1_3'UTR|SAFB_uc010xit.1_3'UTR|SAFB_uc010xiu.1_3'UTR	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		CGTTTTGGGGTTTTTTTTTTT	0.279													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7440158	7440158	+	IGR	DEL	A	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7440158delA								INSR (146147 upstream) : ARHGEF18 (7562 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ARRDC2	27106	broad.mit.edu	37	19	18111475	18111476	+	5'Flank	INS	-	GGAA	GGAA	rs141584055	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18111475_18111476insGGAA	uc002nhu.2	+							NM_001025604	NP_001020775	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 2											pancreas(1)	1						agaggaaggagggaaggaagga	0.223													6	4	---	---	---	---	
PRR12	57479	broad.mit.edu	37	19	50123757	50123757	+	Intron	DEL	G	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50123757delG	uc002poo.3	+							NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12								DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		ctggggaggaggggggggggc	0.249													6	3	---	---	---	---	
ZIM3	114026	broad.mit.edu	37	19	57649403	57649404	+	Intron	INS	-	A	A			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57649403_57649404insA	uc002qnz.1	-							NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		aggaaggaaagaaggaaggaag	0.000													4	2	---	---	---	---	
C21orf63	59271	broad.mit.edu	37	21	33840213	33840214	+	Intron	INS	-	AT	AT	rs142651013	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33840213_33840214insAT	uc002ypr.1	+						C21orf63_uc002ypq.1_3'UTR|C21orf63_uc002yps.1_Intron|C21orf63_uc010glw.1_Intron|C21orf63_uc002ypt.1_Intron|C21orf63_uc002ypu.1_Intron	NM_058187	NP_478067	P58658	CU063_HUMAN	hypothetical protein LOC59271 precursor							integral to membrane	sugar binding			ovary(2)|pancreas(1)	3						gaattaatagaatatatatata	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	34754550	34754551	+	IGR	INS	-	A	A	rs142256565		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34754550_34754551insA								IFNAR1 (22424 upstream) : IFNGR2 (20651 downstream)																							gaccctgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
IL17RA	23765	broad.mit.edu	37	22	17581031	17581032	+	Intron	INS	-	AAAAA	AAAAA	rs9618982		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17581031_17581032insAAAAA	uc002zly.2	+						IL17RA_uc010gqt.2_Intron	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor						fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GATCCAGGTTTaaaaaaaaaaa	0.411													4	2	---	---	---	---	
GNB1L	54584	broad.mit.edu	37	22	19808558	19808559	+	Intron	DEL	GT	-	-			TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19808558_19808559delGT	uc002zqe.1	-						GNB1L_uc002zqd.1_Intron|GNB1L_uc002zqf.1_Intron	NM_053004	NP_443730	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	internal side of plasma membrane|intracellular				breast(1)	1	Colorectal(54;0.0993)					GTAACAAAGAGTGTGTGTGTGT	0.609													5	3	---	---	---	---	
BPIL2	254240	broad.mit.edu	37	22	32853547	32853558	+	5'Flank	DEL	TCCATCCATCCA	-	-	rs71320927	by1000genomes	TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32853547_32853558delTCCATCCATCCA	uc003amn.2	-						BPIL2_uc010gwo.2_5'Flank|BPIL2_uc011amb.1_Intron|BPIL2_uc003amo.3_Intron	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						catccatccgtccatccatccatccatccatc	0.057											OREG0003513	type=REGULATORY REGION|Gene=BPIL2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	2	---	---	---	---	
FAAH2	158584	broad.mit.edu	37	X	57458220	57458220	+	Intron	DEL	G	-	-	rs6521622		TCGA-BP-4995-01A-01D-1462-08	TCGA-BP-4995-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57458220delG	uc004dvc.2	+							NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						ttgtttttttgttttttttgg	0.060										HNSCC(52;0.14)			4	2	---	---	---	---	
