Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CLSPN	63967	broad.mit.edu	37	1	36230187	36230187	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36230187T>A	uc001bzi.2	-	3	342	c.262A>T	c.(262-264)AAT>TAT	p.N88Y	CLSPN_uc009vux.2_Missense_Mutation_p.N88Y	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	88					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTCTCTTTATTTTCCTCCTCG	0.373													53	177	---	---	---	---	PASS
COL8A2	1296	broad.mit.edu	37	1	36563266	36563266	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36563266C>A	uc001bzv.1	-	2	2023	c.2016G>T	c.(2014-2016)CAG>CAT	p.Q672H	COL8A2_uc001bzw.1_Missense_Mutation_p.Q607H	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	672	C1q.|Nonhelical region (NC1).				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCACCCAGACCTGGTCGTTGG	0.602													5	105	---	---	---	---	PASS
TSPAN1	10103	broad.mit.edu	37	1	46646810	46646810	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46646810A>G	uc001cpd.2	+	3	495	c.31A>G	c.(31-33)ATG>GTG	p.M11V	TSPAN1_uc009vyd.1_Missense_Mutation_p.M11V	NM_005727	NP_005718	O60635	TSN1_HUMAN	tetraspan 1	11	Cytoplasmic (Potential).					integral to membrane|lysosomal membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				TAAGACCATGATGATCCTCTT	0.522													11	52	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55566554	55566554	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55566554C>T	uc001cyg.3	-	41	4749	c.4749G>A	c.(4747-4749)ATG>ATA	p.M1583I		NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24	1743					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						GCTTGCTTTCCATTAAATGTC	0.368													35	75	---	---	---	---	PASS
ABCD3	5825	broad.mit.edu	37	1	94953300	94953300	+	Silent	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94953300T>C	uc001dqn.3	+	12	1120	c.1018T>C	c.(1018-1020)TTG>CTG	p.L340L	ABCD3_uc010oto.1_Silent_p.L364L|ABCD3_uc010otp.1_Silent_p.L267L|ABCD3_uc009wdr.2_Intron|ABCD3_uc001dqo.3_Silent_p.L28L	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3	340	ABC transmembrane type-1.				peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TTTCTTAGATTTGTCTCATCC	0.358													53	176	---	---	---	---	PASS
ISG20L2	81875	broad.mit.edu	37	1	156697247	156697247	+	Silent	SNP	C	T	T	rs61742814		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156697247C>T	uc001fps.1	-	1	459	c.198G>A	c.(196-198)ACG>ACA	p.T66T	ISG20L2_uc001fpt.1_Silent_p.T66T|C1orf66_uc001fpu.2_5'Flank|C1orf66_uc001fpv.2_5'Flank	NM_030980	NP_112242	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene	66					ribosome biogenesis	nucleolus	exonuclease activity|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCCATCGACCGTAGGAGTTT	0.512													45	133	---	---	---	---	PASS
CD247	919	broad.mit.edu	37	1	167487734	167487734	+	5'UTR	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167487734G>T	uc001gei.3	-	1					CD247_uc001gej.3_5'UTR|CD247_uc001gek.2_5'UTR	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)			AGGCTGGGAGGCAGAGGCTGA	0.592													8	82	---	---	---	---	PASS
BRP44	25874	broad.mit.edu	37	1	167887490	167887490	+	3'UTR	SNP	A	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167887490A>T	uc001ges.2	-	5					BRP44_uc001get.2_3'UTR|BRP44_uc001geu.2_3'UTR	NM_015415	NP_056230	O95563	BR44_HUMAN	brain protein 44							mitochondrion					0	all_hematologic(923;0.215)			KIRC - Kidney renal clear cell carcinoma(1967;0.247)		TGCTTTATCAATAACCAAATA	0.348													18	51	---	---	---	---	PASS
ELK4	2005	broad.mit.edu	37	1	205589605	205589605	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205589605T>C	uc001hcy.1	-	3	1819	c.569A>G	c.(568-570)AAA>AGA	p.K190R	ELK4_uc001hcz.2_Missense_Mutation_p.K190R	NM_001973	NP_001964	P28324	ELK4_HUMAN	ELK4 protein isoform a	190						cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity				0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CGTGACAAATTTGATGACAGA	0.433			T	SLC45A3	prostate								6	114	---	---	---	---	PASS
ZNF692	55657	broad.mit.edu	37	1	249151932	249151932	+	Intron	SNP	A	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249151932A>C	uc001ifc.1	-						ZNF692_uc001iez.1_5'Flank|ZNF692_uc001ifa.1_5'Flank|ZNF692_uc001ifb.1_5'UTR|ZNF692_uc001ifd.1_Intron|ZNF692_uc001ife.1_Intron|ZNF692_uc001iff.1_Intron|ZNF692_uc010pzr.1_Intron	NM_017865	NP_060335	Q9BU19	ZN692_HUMAN	zinc finger protein 692 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CCCTTCCCAAACTTACTCAGG	0.577													6	28	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21225774	21225774	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21225774C>T	uc002red.2	-	29	12648	c.12520G>A	c.(12520-12522)GGC>AGC	p.G4174S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	4174					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CGTACCAAGCCATCAAACACG	0.463													38	118	---	---	---	---	PASS
SNRNP27	11017	broad.mit.edu	37	2	70122234	70122234	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70122234C>T	uc002sfw.2	+	2	70	c.43C>T	c.(43-45)CGT>TGT	p.R15C	SNRNP27_uc002sfv.2_RNA|SNRNP27_uc002sfx.2_Missense_Mutation_p.R15C	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa	15	Arg-rich.				mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						AGAACGTAGGCGTTCCCGGTC	0.532													6	358	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109384150	109384150	+	Silent	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109384150A>G	uc002tem.3	+	20	7281	c.7155A>G	c.(7153-7155)AGA>AGG	p.R2385R		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2385	RanBD1 3.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						CCAATCACAGAATAACTCCAG	0.363													199	551	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179185050	179185050	+	Intron	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179185050C>T	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_5'UTR	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TAAAGAGCTACAGTGAAATAT	0.418													42	116	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179413534	179413534	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179413534C>A	uc010zfg.1	-	288	85339	c.85115G>T	c.(85114-85116)GGG>GTG	p.G28372V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G22067V|TTN_uc010zfi.1_Missense_Mutation_p.G22000V|TTN_uc010zfj.1_Missense_Mutation_p.G21875V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29299							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATACTGGCCCCAGCTCTAAC	0.473													4	106	---	---	---	---	PASS
SCG2	7857	broad.mit.edu	37	2	224463043	224463043	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224463043C>A	uc002vnm.2	-	2	1091	c.958G>T	c.(958-960)GCT>TCT	p.A320S		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	320					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		CTTCCTGCAGCATTTACTAAC	0.433													96	339	---	---	---	---	PASS
C3orf20	84077	broad.mit.edu	37	3	14744669	14744669	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14744669C>T	uc003byy.2	+	6	1182	c.778C>T	c.(778-780)CCG>TCG	p.P260S	C3orf20_uc003byz.2_Missense_Mutation_p.P138S|C3orf20_uc003bza.2_Missense_Mutation_p.P138S|C3orf20_uc003byx.1_Missense_Mutation_p.P260S	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	260						cytoplasm|integral to membrane				ovary(3)|skin(1)	4						TGTCAGCATGCCGCCCCTGCA	0.458													5	255	---	---	---	---	PASS
TGFBR2	7048	broad.mit.edu	37	3	30713909	30713909	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30713909G>C	uc003ceo.2	+	4	1616	c.1234G>C	c.(1234-1236)GAC>CAC	p.D412H	TGFBR2_uc003cen.2_Missense_Mutation_p.D437H	NM_003242	NP_003233	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II	412	Protein kinase.|Cytoplasmic (Potential).				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						GTCTGTGGATGACCTGGCTAA	0.532													4	329	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52668655	52668655	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52668655G>A	uc003des.2	-	11	1276	c.1264C>T	c.(1264-1266)CAG>TAG	p.Q422*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.Q422*|PBRM1_uc003der.2_Nonsense_Mutation_p.Q390*|PBRM1_uc003det.2_Nonsense_Mutation_p.Q422*|PBRM1_uc003deu.2_Nonsense_Mutation_p.Q422*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.Q422*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.Q422*|PBRM1_uc003dey.2_Nonsense_Mutation_p.Q422*|PBRM1_uc003dez.1_Nonsense_Mutation_p.Q422*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.Q320*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	422	Bromo 3.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTAATTTGCTGGTAATAATCA	0.363			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								51	164	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53844188	53844188	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53844188C>A	uc003dgv.3	+	47	6218	c.6055C>A	c.(6055-6057)CTG>ATG	p.L2019M	CACNA1D_uc003dgu.3_Missense_Mutation_p.L2039M|CACNA1D_uc003dgy.3_Missense_Mutation_p.L1995M|CACNA1D_uc003dgw.3_Missense_Mutation_p.L1686M|CACNA1D_uc011bes.1_RNA	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	2019	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	CCTGCCGTCCCTGCACCGCAG	0.627													15	67	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130454821	130454821	+	Silent	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130454821T>C	uc003enj.2	-	3	1340	c.759A>G	c.(757-759)ACA>ACG	p.T253T		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	253	Protein kinase.				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						GTACACCTTCTGTAAAAAGCT	0.318													64	161	---	---	---	---	PASS
PCCB	5096	broad.mit.edu	37	3	136035796	136035796	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136035796G>A	uc003eqy.1	+	10	1031	c.980G>A	c.(979-981)CGT>CAT	p.R327H	PCCB_uc003eqz.1_Missense_Mutation_p.R327H|PCCB_uc011bmc.1_Missense_Mutation_p.R347H|PCCB_uc011bmd.1_Missense_Mutation_p.R244H	NM_000532	NP_000523	P05166	PCCB_HUMAN	propionyl Coenzyme A carboxylase, beta	327	Acyl-CoA binding (Potential).|Carboxyltransferase.				fatty acid beta-oxidation	mitochondrial matrix	ATP binding|propionyl-CoA carboxylase activity				0					Biotin(DB00121)|L-Valine(DB00161)	GTTGATGAGCGTGAATTTTTT	0.368													4	228	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169548374	169548374	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169548374A>G	uc003fgb.2	+	3	1289	c.1289A>G	c.(1288-1290)CAC>CGC	p.H430R		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	430	LRR 18.										0						GATTGCCGGCACAATTTGCTT	0.443													3	61	---	---	---	---	PASS
ADD1	118	broad.mit.edu	37	4	2930084	2930084	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2930084C>A	uc003gfr.2	+	15	2236	c.2048C>A	c.(2047-2049)CCA>CAA	p.P683Q	ADD1_uc003gfn.2_RNA|ADD1_uc003gfo.2_3'UTR|ADD1_uc003gfp.2_3'UTR|ADD1_uc003gfq.2_Missense_Mutation_p.P714Q|ADD1_uc003gfs.2_3'UTR	NM_001119	NP_001110	P35611	ADDA_HUMAN	adducin 1 (alpha) isoform a	683					actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GAGCCAGCCCCAGACCCAGCC	0.682													5	95	---	---	---	---	PASS
TBC1D19	55296	broad.mit.edu	37	4	26741524	26741524	+	Silent	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26741524T>C	uc003gsf.3	+	17	1426	c.1156T>C	c.(1156-1158)TTG>CTG	p.L386L	TBC1D19_uc010iew.2_Silent_p.L386L|TBC1D19_uc011bxu.1_Silent_p.L321L	NM_018317	NP_060787	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	386	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)				ACCTTCCAAATTGTATCAGAT	0.303													89	258	---	---	---	---	PASS
DCTD	1635	broad.mit.edu	37	4	183836682	183836682	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183836682C>T	uc003ivf.2	-	2	214	c.40G>A	c.(40-42)GAA>AAA	p.E14K	DCTD_uc003ivg.2_Missense_Mutation_p.E25K|DCTD_uc010irw.2_5'UTR|DCTD_uc003ivh.2_5'UTR	NM_001921	NP_001912	P32321	DCTD_HUMAN	dCMP deaminase isoform b	14					nucleotide biosynthetic process|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide metabolic process	cytosol	dCMP deaminase activity|zinc ion binding				0		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)		TCTGGCCATTCCAAATAGTCG	0.403													69	193	---	---	---	---	PASS
PRR16	51334	broad.mit.edu	37	5	120021872	120021872	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120021872G>T	uc003ksq.2	+	2	546	c.383G>T	c.(382-384)AGG>ATG	p.R128M	PRR16_uc003ksp.2_Missense_Mutation_p.R105M|PRR16_uc003ksr.2_Missense_Mutation_p.R58M	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	128	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CCTCCTCCAAGGTTGACACCT	0.517													42	151	---	---	---	---	PASS
CD74	972	broad.mit.edu	37	5	149792311	149792311	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149792311A>T	uc003lsc.2	-	1	13	c.2T>A	c.(1-3)ATG>AAG	p.M1K	CD74_uc003lse.2_Missense_Mutation_p.M1K|CD74_uc003lsd.2_Missense_Mutation_p.M1K|CD74_uc003lsf.1_Missense_Mutation_p.M1K	NM_001025159	NP_001020330	P04233	HG2A_HUMAN	CD74 antigen isoform a	1	Cytoplasmic (Potential).				antigen processing and presentation of endogenous antigen|cell proliferation|immunoglobulin mediated immune response|intracellular protein transport|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of peptide secretion|positive regulation of B cell proliferation|positive regulation of chemokine (C-X-C motif) ligand 2 production|positive regulation of cytokine-mediated signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of macrophage cytokine production|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|prostaglandin biosynthetic process|protein complex assembly|regulation of macrophage activation	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|lysosome|receptor complex	beta-amyloid binding|cytokine receptor activity|identical protein binding|MHC class II protein binding			breast(1)	1		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTCCTGTGCATCTGGGACCC	0.577			T	ROS1	NSCLC								100	338	---	---	---	---	PASS
RNF145	153830	broad.mit.edu	37	5	158603687	158603687	+	Silent	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158603687A>G	uc003lxp.2	-	5	887	c.574T>C	c.(574-576)TTG>CTG	p.L192L	RNF145_uc011ddy.1_Silent_p.L206L|RNF145_uc003lxo.1_Silent_p.L220L|RNF145_uc011ddz.1_Silent_p.L209L|RNF145_uc010jiq.1_Silent_p.L222L|RNF145_uc011dea.1_Silent_p.L208L	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	192						integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAAGGTACCAAAAGATTAGAC	0.343													24	91	---	---	---	---	PASS
UIMC1	51720	broad.mit.edu	37	5	176332369	176332369	+	Silent	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176332369A>G	uc011dfp.1	-	15	2241	c.2074T>C	c.(2074-2076)TTA>CTA	p.L692L	UIMC1_uc003mfc.1_Silent_p.L569L|UIMC1_uc003mfd.1_Silent_p.L322L	NM_016290	NP_057374	Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	692					double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGTCCACTAAGCAATCTGTG	0.463													32	170	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7231393	7231393	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7231393T>A	uc003mxc.2	+	10	3451	c.3061T>A	c.(3061-3063)TCA>ACA	p.S1021T	RREB1_uc003mxb.2_Missense_Mutation_p.S1021T|RREB1_uc010jnx.2_Missense_Mutation_p.S1021T	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	1021	Pro-rich.				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				AATCTACTCCTCAGCCCTGGT	0.687													18	73	---	---	---	---	PASS
UBD	10537	broad.mit.edu	37	6	29524035	29524035	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29524035C>G	uc003nmo.2	-	2	344	c.120G>C	c.(118-120)AAG>AAC	p.K40N	GABBR1_uc003nmp.3_3'UTR	NM_006398	NP_006389	O15205	UBD_HUMAN	ubiquitin D	40	Ubiquitin 1.				aggresome assembly|myeloid dendritic cell differentiation|negative regulation of mitotic prometaphase|positive regulation of apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein ubiquitination|response to interferon-gamma|response to tumor necrosis factor|ubiquitin-dependent protein catabolic process	aggresome|cytoplasm|nucleus	proteasome binding				0						GAACCTTGGTCTTAGACCGGA	0.473													3	101	---	---	---	---	PASS
HLA-J	3137	broad.mit.edu	37	6	29977409	29977409	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29977409T>C	uc003rtl.3	+	5	790	c.428T>C	c.(427-429)ATC>ACC	p.I143T	HLA-G_uc011dmb.1_3'UTR|NCRNA00171_uc011dme.1_Intron|HLA-J_uc003nou.3_RNA|HLA-J_uc003nov.3_RNA					Homo sapiens major histocompatibility complex, class I, J (pseudogene), mRNA (cDNA clone IMAGE:4694038).												0						TGCAAAGGCATCTGAATGTGT	0.512													4	55	---	---	---	---	PASS
PHF3	23469	broad.mit.edu	37	6	64410277	64410277	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64410277C>T	uc003pep.1	+	8	3046	c.3020C>T	c.(3019-3021)CCT>CTT	p.P1007L	PHF3_uc010kah.1_Missense_Mutation_p.P821L|PHF3_uc003pen.2_Missense_Mutation_p.P919L|PHF3_uc011dxs.1_Missense_Mutation_p.P276L	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1007	TFIIS central.				multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GAAGTAACTCCTGATCATCTT	0.343													3	136	---	---	---	---	PASS
MOXD1	26002	broad.mit.edu	37	6	132643865	132643865	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132643865T>C	uc003qdf.2	-	8	1357	c.1258A>G	c.(1258-1260)AAT>GAT	p.N420D	MOXD1_uc003qde.2_Missense_Mutation_p.N352D	NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	420	Lumenal (Potential).				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		TCCTGGAAATTGAAGTCAAAA	0.383													42	144	---	---	---	---	PASS
SEPT7	989	broad.mit.edu	37	7	35930362	35930362	+	Silent	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35930362T>C	uc010kxc.2	+	10	1150	c.957T>C	c.(955-957)TAT>TAC	p.Y319Y	SEPT7_uc011kat.1_Silent_p.Y318Y|SEPT7_uc011kau.1_Silent_p.Y283Y|SEPT7_uc011kav.1_Silent_p.Y266Y|SEPT7_uc003tey.2_Silent_p.Y167Y	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1	319					cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						CTGTGACTTATAATGGAGTTG	0.323													4	77	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	65223026	65223026	+	Intron	SNP	C	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65223026C>G	uc003tud.1	-						CCT6P1_uc003tug.2_RNA|CCT6P1_uc003tuh.2_RNA|CCT6P1_uc003tui.2_RNA|uc003tuk.1_5'Flank					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		CTCATAAAAGCTGAAAGAAAA	0.279													4	31	---	---	---	---	PASS
CDK6	1021	broad.mit.edu	37	7	92252376	92252376	+	Silent	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92252376A>G	uc011khw.1	-	6	1084	c.672T>C	c.(670-672)GAT>GAC	p.D224D	CDK6_uc010lez.2_Silent_p.D224D	NM_001259	NP_001250	Q00534	CDK6_HUMAN	cyclin-dependent kinase 6	224	Protein kinase.				cell dedifferentiation|cell division|G1 phase of mitotic cell cycle|gliogenesis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|negative regulation of osteoblast differentiation|positive regulation of cell-matrix adhesion|positive regulation of fibroblast proliferation|regulation of erythrocyte differentiation|regulation of gene expression|response to virus	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleus|ruffle	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			central_nervous_system(1)|skin(1)	2	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GTTGATCAACATCTGAACTTC	0.299			T	MLLT10	ALL								9	52	---	---	---	---	PASS
FOXP2	93986	broad.mit.edu	37	7	114282567	114282567	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114282567C>T	uc003vhb.2	+	7	1252	c.878C>T	c.(877-879)ACT>ATT	p.T293I	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.T318I|FOXP2_uc003vha.2_Missense_Mutation_p.T201I|FOXP2_uc011kmu.1_Missense_Mutation_p.T310I|FOXP2_uc011kmv.1_Missense_Mutation_p.T292I|FOXP2_uc010ljz.1_Missense_Mutation_p.T201I|FOXP2_uc003vgx.2_Missense_Mutation_p.T293I|FOXP2_uc003vhd.2_Missense_Mutation_p.T293I|FOXP2_uc003vhc.2_Missense_Mutation_p.T318I	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	293				DLTTNNSSSTTSSNT -> EEFPVQGPAAVCAGL (in Ref. 10; AAB91439).	camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						GACCTCACTACTAACAATTCC	0.443													102	156	---	---	---	---	PASS
C7orf34	135927	broad.mit.edu	37	7	142637748	142637748	+	3'UTR	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142637748C>A	uc003wca.2	+	2						NM_178829	NP_849151	Q96L11	CG034_HUMAN	hypothetical protein LOC135927							extracellular region					0	Melanoma(164;0.059)					CTCTGATCACCATCACTGTAT	0.552													3	37	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38899622	38899622	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38899622T>A	uc003xmr.2	+	12	1366	c.1288T>A	c.(1288-1290)TGT>AGT	p.C430S	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	430	Extracellular (Potential).|Disintegrin.				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			AGAGTGTGACTGTGGTACTCC	0.413													31	126	---	---	---	---	PASS
DCAF13	25879	broad.mit.edu	37	8	104438314	104438314	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104438314A>G	uc003yln.2	+	4	1142	c.865A>G	c.(865-867)AAA>GAA	p.K289E	DCAF13_uc003ylm.1_Missense_Mutation_p.K22E|DCAF13_uc003ylo.2_5'UTR	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	137	WD 2.				rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						GAAGCAGTGGAAAATGGATGG	0.348													20	77	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79320488	79320488	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79320488G>T	uc010mpk.2	-	8	6826	c.6702C>A	c.(6700-6702)AGC>AGA	p.S2234R	PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	2234					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TTACAAAAATGCTAGTTGCCA	0.443													4	130	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104312897	104312897	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104312897C>T	uc004bbn.2	+	10	1192	c.1102C>T	c.(1102-1104)CGG>TGG	p.R368W		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	368	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GGTGGAATTGCGGAGTGCAGT	0.313													5	356	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88203105	88203105	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88203105C>T	uc001kdo.2	-	17	3780	c.3338G>A	c.(3337-3339)GGC>GAC	p.G1113D	WAPAL_uc009xsv.2_Missense_Mutation_p.G372D|WAPAL_uc001kdn.2_Missense_Mutation_p.G1150D|WAPAL_uc009xsw.2_Missense_Mutation_p.G1107D	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	1113	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						CATGTGTTTGCCGGCATGCTG	0.403													4	198	---	---	---	---	PASS
C10orf2	56652	broad.mit.edu	37	10	102749574	102749574	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102749574C>T	uc001ksf.2	+	2	2092	c.1417C>T	c.(1417-1419)CAC>TAC	p.H473Y	MRPL43_uc001kry.1_5'Flank|MRPL43_uc010qpu.1_5'Flank|MRPL43_uc001krz.1_5'Flank|MRPL43_uc001ksa.1_5'Flank|MRPL43_uc001ksb.1_5'Flank|MRPL43_uc001ksd.1_5'Flank|MRPL43_uc001ksc.2_5'Flank|MRPL43_uc001kse.2_5'Flank|C10orf2_uc001ksg.2_Missense_Mutation_p.H473Y|C10orf2_uc001ksi.2_Missense_Mutation_p.H19Y|C10orf2_uc010qpv.1_Missense_Mutation_p.H19Y|C10orf2_uc001ksh.2_RNA	NM_021830	NP_068602	Q96RR1	PEO1_HUMAN	twinkle isoform A	473	SF4 helicase.				cell death|mitochondrial DNA replication|protein hexamerization|protein homooligomerization|transcription from mitochondrial promoter	mitochondrial nucleoid	5'-3' DNA helicase activity|ATP binding|protease binding|single-stranded DNA binding			ovary(1)	1		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAAATATGATCACTGGGCTGA	0.532													60	206	---	---	---	---	PASS
PLA2G16	11145	broad.mit.edu	37	11	63357820	63357820	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63357820C>T	uc001nxh.2	-	3	562	c.139G>A	c.(139-141)GCA>ACA	p.A47T	PLA2G16_uc001nxi.2_Missense_Mutation_p.A59T|PLA2G16_uc009you.1_Missense_Mutation_p.A47T	NM_007069	NP_009000	P53816	PAG16_HUMAN	HRAS-like suppressor 3	47					lipid catabolic process	integral to membrane|perinuclear region of cytoplasm	hydrolase activity|protein binding			ovary(1)	1						ACACTGGCTGCACCAGCTCCT	0.582													11	56	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117265695	117265695	+	Silent	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117265695C>T	uc001prc.2	+	22	2967	c.2820C>T	c.(2818-2820)GCC>GCT	p.A940A	CEP164_uc001prb.2_Silent_p.A943A|CEP164_uc010rxk.1_Silent_p.A914A|CEP164_uc001prf.2_Intron|CEP164_uc009yzp.1_RNA|CEP164_uc001prg.1_Silent_p.A373A	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	940	Glu-rich.				cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		ATGTCAAGGCCAGATTGGCTC	0.512													88	218	---	---	---	---	PASS
SLC6A12	6539	broad.mit.edu	37	12	318976	318976	+	Silent	SNP	G	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:318976G>C	uc001qhz.2	-	4	720	c.177C>G	c.(175-177)GTC>GTG	p.V59V	SLC6A12_uc001qia.2_Silent_p.V59V|SLC6A12_uc001qib.2_Silent_p.V59V|SLC6A12_uc009zdh.1_Silent_p.V59V|SLC6A12_uc009zdi.1_Intron	NM_003044	NP_003035	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter	59	Helical; Name=1; (Potential).				cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GAAACCTCCAGACATTGCCCA	0.562													44	178	---	---	---	---	PASS
CLEC7A	64581	broad.mit.edu	37	12	10277799	10277799	+	Intron	SNP	G	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10277799G>A	uc001qxg.2	-						CLEC7A_uc001qxe.3_Intron|CLEC7A_uc001qxf.2_Intron|CLEC7A_uc001qxh.2_Intron|CLEC7A_uc001qxi.2_Intron|CLEC7A_uc001qxj.2_Intron|CLEC7A_uc009zhg.1_Intron|CLEC7A_uc001qxk.1_Intron|CLEC7A_uc001qxl.1_Intron|CLEC7A_uc010sgy.1_3'UTR|CLEC7A_uc001qxm.1_3'UTR	NM_197947	NP_922938	Q9BXN2	CLC7A_HUMAN	dendritic cell-associated C-type lectin 1						carbohydrate mediated signaling|defense response to protozoan|inflammatory response|innate immune response|phagocytosis, recognition|T cell activation	cytoplasm|integral to membrane	metal ion binding|MHC protein binding|sugar binding			central_nervous_system(1)	1						aaaaaaaaaaGACTTCATTTT	0.184													4	28	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13906661	13906661	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13906661C>A	uc001rbt.2	-	3	779	c.600G>T	c.(598-600)GAG>GAT	p.E200D		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	200	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GGAGGACCTCCTCTAGCTCCC	0.468													4	213	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49722800	49722800	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49722800C>T	uc001rtx.3	+	9	1149	c.982C>T	c.(982-984)CGG>TGG	p.R328W	TROAP_uc009zlh.2_Missense_Mutation_p.R328W|TROAP_uc001rty.2_Missense_Mutation_p.R36W	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	328					cell adhesion	cytoplasm				ovary(1)	1						ACCCTTTGGACGGGCTCAGCG	0.622													4	134	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20660248	20660248	+	3'UTR	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20660248C>A	uc001umr.2	+	26					ZMYM2_uc001ums.2_3'UTR|ZMYM2_uc001umt.2_3'UTR|ZMYM2_uc001umv.2_3'UTR|ZMYM2_uc001umw.2_3'UTR	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198						regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TTTACTCCTTCTGTTTTGAGT	0.363													3	20	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25008976	25008976	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25008976G>T	uc001upl.2	-	31	4409	c.4303C>A	c.(4303-4305)CCC>ACC	p.P1435T		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1435					cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TGAAGCTGGGGAGAATCCAGC	0.512													10	46	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78217740	78217740	+	Silent	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78217740A>G	uc001xuf.2	-	3	279	c.252T>C	c.(250-252)AAT>AAC	p.N84N	SNW1_uc010tvm.1_Silent_p.N9N|SNW1_uc010asu.2_Intron|SNW1_uc010tvn.1_Silent_p.N84N	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	84					negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TGGCCAGCGCATTCGACATTT	0.423													34	95	---	---	---	---	PASS
RPS2	6187	broad.mit.edu	37	16	2012906	2012906	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2012906A>T	uc002cnn.2	-	4	568	c.380T>A	c.(379-381)TTT>TAT	p.F127Y	RPS2_uc010bsa.1_RNA|RPS2_uc002cnl.2_Intron|RPS2_uc002cnm.2_Intron|RPS2_uc002cno.2_Missense_Mutation_p.F127Y|SNORA10_uc002cnp.1_5'Flank|SNHG9_uc002cnr.2_5'Flank|SNORA78_uc002cns.1_5'Flank	NM_002952	NP_002943	P15880	RS2_HUMAN	ribosomal protein S2	127	S5 DRBM.				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleoplasm	fibroblast growth factor 1 binding|fibroblast growth factor 3 binding|RNA binding|structural constituent of ribosome				0						GATAGCAACAAATGCCTGCGA	0.607													33	95	---	---	---	---	PASS
LOC653786	653786	broad.mit.edu	37	16	22563729	22563729	+	5'UTR	SNP	G	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22563729G>C	uc002dlh.3	+	2						NR_003676				RecName: Full=Otoancorin; Flags: Precursor;												0						TCTGCAAGCAGCTTCCAAGAT	0.428													44	169	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48201440	48201440	+	Silent	SNP	G	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48201440G>A	uc002eff.1	-	28	4373	c.4023C>T	c.(4021-4023)AAC>AAT	p.N1341N	ABCC11_uc002efg.1_Silent_p.N1341N|ABCC11_uc002efh.1_Silent_p.N1303N|ABCC11_uc010cbg.1_RNA	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	1341	ABC transporter 2.|Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				TGTGGTCACAGTTCAGCACAG	0.587									Cerumen_Type				3	115	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268158	70268158	+	RNA	SNP	A	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268158A>C	uc010cfp.1	-	3		c.257T>G								Homo sapiens cDNA, FLJ98908.																		TTCTTCATTAAAACAGCTACT	0.333													3	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	74411881	74411881	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74411881C>T	uc010vmt.1	+	1	11	c.10C>T	c.(10-12)CGC>TGC	p.R4C						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		CATGCGGCTGCGCTTTTGGCT	0.642													3	23	---	---	---	---	PASS
MPHOSPH6	10200	broad.mit.edu	37	16	82182151	82182151	+	3'UTR	SNP	A	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82182151A>G	uc002fgw.2	-	5						NM_005792	NP_005783	Q99547	MPH6_HUMAN	M-phase phosphoprotein 6						M phase of mitotic cell cycle|maturation of 5.8S rRNA	cytoplasm|nucleolus	protein binding|RNA binding				0						AATGAATACCAAGAAGCAAAG	0.328													3	8	---	---	---	---	PASS
ZFP3	124961	broad.mit.edu	37	17	4995604	4995604	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4995604A>C	uc002gaq.2	+	2	930	c.805A>C	c.(805-807)ATT>CTT	p.I269L		NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3	269	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCACAGCTTATTCAGCATCA	0.393													33	118	---	---	---	---	PASS
DULLARD	23399	broad.mit.edu	37	17	7147450	7147450	+	3'UTR	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7147450G>T	uc002gfd.2	-	8					GABARAP_uc002gfb.2_5'Flank|DULLARD_uc002gfe.2_3'UTR|DULLARD_uc002gff.2_3'UTR|DULLARD_uc002gfc.2_RNA	NM_001143775	NP_001137247	O95476	CNEP1_HUMAN	dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0						GGCATCCCAAGGGCTCGCCCT	0.642													3	24	---	---	---	---	PASS
CD300LG	146894	broad.mit.edu	37	17	41931245	41931245	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41931245G>T	uc002iem.2	+	4	593	c.552G>T	c.(550-552)TTG>TTT	p.L184F	CD300LG_uc002iel.1_Intron|CD300LG_uc010czk.2_Missense_Mutation_p.L184F|CD300LG_uc010wil.1_Missense_Mutation_p.L150F|CD300LG_uc010czl.2_Intron	NM_145273	NP_660316	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g precursor	184	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|multivesicular body membrane	receptor activity				0		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCCCTCCATTGCCAGGGACTT	0.622													36	93	---	---	---	---	PASS
CD300LG	146894	broad.mit.edu	37	17	41931246	41931246	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41931246C>A	uc002iem.2	+	4	594	c.553C>A	c.(553-555)CCA>ACA	p.P185T	CD300LG_uc002iel.1_Intron|CD300LG_uc010czk.2_Missense_Mutation_p.P185T|CD300LG_uc010wil.1_Missense_Mutation_p.P151T|CD300LG_uc010czl.2_Intron	NM_145273	NP_660316	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g precursor	185	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|multivesicular body membrane	receptor activity				0		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCCTCCATTGCCAGGGACTTC	0.617													34	96	---	---	---	---	PASS
MPP2	4355	broad.mit.edu	37	17	41955101	41955101	+	3'UTR	SNP	T	G	G			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41955101T>G	uc010wip.1	-	13					MPP2_uc002ien.1_3'UTR|MPP2_uc010wim.1_3'UTR|MPP2_uc002ieo.1_3'UTR|MPP2_uc010win.1_3'UTR|MPP2_uc010wio.1_3'UTR	NM_005374	NP_005365	Q14168	MPP2_HUMAN	palmitoylated membrane protein 2						signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity				0		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		TGGCAGGGGGTCACAGGTCAG	0.582													8	49	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75205361	75205361	+	Intron	SNP	G	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75205361G>A	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron|SEC14L1_uc010wti.1_Intron|SEC14L1_uc010wtj.1_Intron|SEC14L1_uc002jtr.2_5'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						TGGCCGGTGTGTCTGGGTTTC	0.517													9	26	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75205364	75205364	+	Intron	SNP	T	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75205364T>A	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron|SEC14L1_uc010wti.1_Intron|SEC14L1_uc010wtj.1_Intron|SEC14L1_uc002jtr.2_5'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						CCGGTGTGTCTGGGTTTCGTG	0.522													10	27	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76528621	76528621	+	IGR	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76528621G>T								DNAH17 (59765 upstream) : CYTH1 (141510 downstream)																							CATCTGTCCAGGTGTCCAAGT	0.562													4	36	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6983136	6983136	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6983136C>A	uc002knm.2	-	40	5852	c.5758G>T	c.(5758-5760)GCC>TCC	p.A1920S	LAMA1_uc010wzj.1_Missense_Mutation_p.A1396S	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1920	Domain II and I.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCATCTCTGGCCAGTTCCTCC	0.498													19	81	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1054594	1054594	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1054594G>T	uc002lqw.3	+	28	3983	c.3752G>T	c.(3751-3753)GGC>GTC	p.G1251V	ABCA7_uc010dsb.1_Missense_Mutation_p.G1113V|ABCA7_uc002lqy.2_5'Flank	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1251	Helical; (Potential).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTTTGTGGGCCTGGCCCTC	0.632													8	118	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940373	22940373	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940373T>C	uc010xrh.1	-	5	2065	c.2065A>G	c.(2065-2067)AAG>GAG	p.K689E		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGAATTATCTTATGTTTTCTA	0.343													3	164	---	---	---	---	PASS
CATSPERG	57828	broad.mit.edu	37	19	38853135	38853135	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38853135C>A	uc002oih.3	+	19	2364	c.2277C>A	c.(2275-2277)TTC>TTA	p.F759L	CATSPERG_uc002oig.3_Missense_Mutation_p.F719L|CATSPERG_uc002oif.3_Missense_Mutation_p.F399L|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	759	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						AGCGCATTTTCCTGGACAAGG	0.607													30	117	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40432973	40432973	+	Silent	SNP	G	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40432973G>A	uc002omp.3	-	2	1304	c.1296C>T	c.(1294-1296)TGC>TGT	p.C432C		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	432	IgGFc-binding.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TACTCCGGCCGCAATCAGCAG	0.582													4	96	---	---	---	---	PASS
PSG7	5676	broad.mit.edu	37	19	43441318	43441318	+	5'UTR	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43441318C>T	uc002ovl.3	-	1					PSG3_uc002ouf.2_5'Flank|PSG11_uc002ouw.2_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_5'UTR	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7						female pregnancy	extracellular region					0		Prostate(69;0.00682)				GCTGTCCTTCCTCCTTCTGCA	0.602													10	63	---	---	---	---	PASS
ZNF611	81856	broad.mit.edu	37	19	53209367	53209367	+	Missense_Mutation	SNP	C	A	A	rs144132013	byFrequency	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53209367C>A	uc002pzz.2	-	7	1258	c.941G>T	c.(940-942)CGT>CTT	p.R314L	ZNF611_uc010eqc.2_Missense_Mutation_p.R244L|ZNF611_uc010ydo.1_Missense_Mutation_p.R244L|ZNF611_uc010ydr.1_Missense_Mutation_p.R245L|ZNF611_uc010ydp.1_Missense_Mutation_p.R314L|ZNF611_uc010ydq.1_Missense_Mutation_p.R314L|ZNF611_uc002qaa.3_Missense_Mutation_p.R244L	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a	314					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		ACAATTGTAACGTTTTACTCC	0.398													72	202	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53854397	53854397	+	Missense_Mutation	SNP	G	C	C	rs10415799	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53854397G>C	uc010ydv.1	+	4	586	c.469G>C	c.(469-471)GAA>CAA	p.E157Q	ZNF845_uc010ydw.1_Missense_Mutation_p.E157Q	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	157					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTTTCAGACCGAAGGGAAAAT	0.408													4	308	---	---	---	---	PASS
PAX1	5075	broad.mit.edu	37	20	21689243	21689243	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21689243G>A	uc002wsj.2	+	3	1018	c.964G>A	c.(964-966)GAC>AAC	p.D322N	PAX1_uc010zsl.1_Missense_Mutation_p.D322N|PAX1_uc010zsm.1_Missense_Mutation_p.D298N	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	322					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2						CAAGATGGAAGACTGGGCCGG	0.602													56	173	---	---	---	---	PASS
NFS1	9054	broad.mit.edu	37	20	34262500	34262500	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34262500T>C	uc002xdw.1	-	9	1052	c.988A>G	c.(988-990)ATA>GTA	p.I330V	CPNE1_uc002xdn.1_5'Flank|CPNE1_uc002xdo.1_5'Flank|CPNE1_uc002xdp.1_RNA|NFS1_uc002xdt.1_Missense_Mutation_p.I270V|NFS1_uc002xdu.1_Missense_Mutation_p.I270V|NFS1_uc002xdv.1_RNA|NFS1_uc010zvk.1_Missense_Mutation_p.I128V|NFS1_uc010zvl.1_Missense_Mutation_p.I279V	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor	330					cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	ATATTCTGTATCAGCCGCTCT	0.453													6	111	---	---	---	---	PASS
NFATC2	4773	broad.mit.edu	37	20	50140605	50140605	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50140605C>T	uc002xwd.2	-	2	395	c.175G>A	c.(175-177)GCA>ACA	p.A59T	NFATC2_uc002xwc.2_Missense_Mutation_p.A59T|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Missense_Mutation_p.A39T|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Missense_Mutation_p.A39T	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	59					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					TCGGGGTATGCGGGTCCGGAG	0.592													5	150	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47545531	47545531	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47545531G>T	uc002zia.1	+	25	2051	c.1969G>T	c.(1969-1971)GGG>TGG	p.G657W	COL6A2_uc002zhy.1_Missense_Mutation_p.G657W|COL6A2_uc002zhz.1_Missense_Mutation_p.G657W|COL6A2_uc002zib.1_Missense_Mutation_p.G63W|COL6A2_uc002zic.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	657	VWFA 2.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GTCCGAGACAGGTCAGCGGGG	0.642													3	41	---	---	---	---	PASS
CXorf21	80231	broad.mit.edu	37	X	30578381	30578381	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30578381T>C	uc004dcg.1	-	3	368	c.92A>G	c.(91-93)AAG>AGG	p.K31R		NM_025159	NP_079435	Q9HAI6	CX021_HUMAN	hypothetical protein LOC80231	31										ovary(1)	1						CTCCTCTTCCTTTTCCCCAGC	0.458													56	66	---	---	---	---	PASS
MBNL3	55796	broad.mit.edu	37	X	131516239	131516239	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131516239G>T	uc004ewv.3	-	7	1099	c.1020C>A	c.(1018-1020)AGC>AGA	p.S340R	uc004ewr.1_Intron|MBNL3_uc004eww.2_Missense_Mutation_p.S244R|MBNL3_uc004ews.2_Missense_Mutation_p.S244R|MBNL3_uc004ewt.2_Missense_Mutation_p.S290R|MBNL3_uc011muz.1_Missense_Mutation_p.S244R|MBNL3_uc004ewu.3_Missense_Mutation_p.S305R|MBNL3_uc004ewx.1_Missense_Mutation_p.S278R	NM_018388	NP_060858	Q9NUK0	MBNL3_HUMAN	muscleblind-like 3 isoform G	340					mRNA processing|multicellular organismal development|regulation of RNA splicing|RNA splicing	Golgi apparatus|nucleus	nucleic acid binding|zinc ion binding				0	Acute lymphoblastic leukemia(192;0.000127)					CGAACGGAACGCTGGTGGCAG	0.468													4	162	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7337516	7337517	+	Intron	INS	-	GTGT	GTGT	rs35672144		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7337516_7337517insGTGT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TCCAAGCAATGgtgtgtgtgtg	0.282													4	2	---	---	---	---	
ARHGEF19	128272	broad.mit.edu	37	1	16528470	16528483	+	Intron	DEL	CCTACCCTAGGGAC	-	-	rs58225172		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16528470_16528483delCCTACCCTAGGGAC	uc001ayc.1	-						ARHGEF19_uc009voo.1_Intron|ARHGEF19_uc001ayb.1_Intron	NM_153213	NP_694945	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19						regulation of actin cytoskeleton organization	intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		AGGACCCAGGCCTACCCTAGGGACCCATGTCTGC	0.621													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	107056139	107056140	+	IGR	INS	-	TG	TG	rs113802351		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107056139_107056140insTG								None (None upstream) : PRMT6 (543127 downstream)																							tgcagagttcatgtgtgtgtgt	0.000													4	2	---	---	---	---	
CSDE1	7812	broad.mit.edu	37	1	115276154	115276154	+	Intron	DEL	A	-	-	rs10718423		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115276154delA	uc001efk.2	-						CSDE1_uc001efi.2_Intron|CSDE1_uc001efj.2_Intron|CSDE1_uc001efl.2_Intron|CSDE1_uc001efm.2_Intron|CSDE1_uc009wgv.2_Intron|CSDE1_uc001efn.2_Intron	NM_001007553	NP_001007554	O75534	CSDE1_HUMAN	upstream of NRAS isoform 1						male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding			ovary(1)	1	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		acaaaaaaagaaaaaaaaaaa	0.129													4	4	---	---	---	---	
NBPF15	284565	broad.mit.edu	37	1	148562353	148562353	+	Intron	DEL	T	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148562353delT	uc001esc.2	+						NBPF15_uc001esb.1_Intron	NM_173638	NP_775909	Q8N660	NBPFF_HUMAN	hypothetical protein LOC284565							cytoplasm					0	all_hematologic(923;0.032)					ATttccttccttccttccttc	0.224													4	2	---	---	---	---	
F5	2153	broad.mit.edu	37	1	169518873	169518873	+	Intron	DEL	A	-	-	rs67616247		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169518873delA	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TAGACAAGACAAAAAAAAAAA	0.289													3	4	---	---	---	---	
DPYSL5	56896	broad.mit.edu	37	2	27170942	27170943	+	3'UTR	DEL	CA	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27170942_27170943delCA	uc002rhu.3	+	13					DPYSL5_uc002rhv.3_3'UTR	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCTGCCACcacacacacaca	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90048090	90048091	+	Intron	DEL	CA	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90048090_90048091delCA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		cacacacactcacacacacaca	0.238													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122630817	122630818	+	IGR	INS	-	TTCT	TTCT	rs150416494	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122630817_122630818insTTCT								TSN (105391 upstream) : None (None downstream)																							tcctgccttTGttcttcttcct	0.084													3	5	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	125394228	125394231	+	Intron	DEL	TGTC	-	-	rs10199562		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125394228_125394231delTGTC	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		tgtgtgtgtgtgtctgtgtgtgtc	0.225													4	2	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161282846	161282847	+	Intron	INS	-	AAGG	AAGG	rs138498508	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161282846_161282847insAAGG	uc002ubo.2	-						RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron|RBMS1_uc010fox.2_Intron	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						ggaaggaaggaaaggaaggaag	0.099													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164689758	164689759	+	IGR	DEL	AC	-	-	rs35969616		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164689758_164689759delAC								FIGN (97245 upstream) : GRB14 (659574 downstream)																							TAGTGCCTAAacacacacacac	0.292													4	2	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169712116	169712116	+	Intron	DEL	A	-	-	rs75498213		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169712116delA	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron|NOSTRIN_uc002uek.2_5'Flank	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						TTGTGTGAACaaaaaaaaaaa	0.249													4	2	---	---	---	---	
PECR	55825	broad.mit.edu	37	2	216939217	216939224	+	Intron	DEL	AAGGAAGG	-	-	rs72274918		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216939217_216939224delAAGGAAGG	uc002vft.2	-						PECR_uc010zjq.1_Intron|PECR_uc002vfu.1_Intron	NM_018441	NP_060911	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase						fatty acid biosynthetic process|regulation of apoptosis	peroxisome	binding|trans-2-enoyl-CoA reductase (NADPH) activity				0		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	gaaagaaaaaaaggaaggaaggaaggaa	0.082													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	225572690	225572701	+	IGR	DEL	TCCCTCCCTCCC	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225572690_225572701delTCCCTCCCTCCC								CUL3 (122580 upstream) : DOCK10 (57106 downstream)																							cctcccttcttccctccctccctccctccctc	0.014													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	43304181	43304182	+	IGR	INS	-	AGGG	AGGG	rs139493780	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43304181_43304182insAGGG								C3orf39 (156616 upstream) : SNRK (23822 downstream)																							ggaaggagggaagggagggagg	0.035													3	3	---	---	---	---	
C3orf63	23272	broad.mit.edu	37	3	56675209	56675215	+	Intron	DEL	TTGTAAC	-	-	rs3215018		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56675209_56675215delTTGTAAC	uc003did.3	-						C3orf63_uc003dic.3_Intron|C3orf63_uc003die.3_Intron	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b											ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		ATTTATCTCTTTGTAACAAGGAATAAC	0.324													9	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	138137839	138137840	+	IGR	DEL	AC	-	-	rs35441129		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138137839_138137840delAC								MRAS (13463 upstream) : ESYT3 (15575 downstream)																							ATGCAGATGTacacacacacac	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	102292058	102292061	+	IGR	DEL	TTCC	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102292058_102292061delTTCC								PPP3CA (23430 upstream) : BANK1 (49057 downstream)																							gctttcttgtttccttccttcctt	0.029													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112576764	112576775	+	IGR	DEL	TGTGTGTGTGTG	-	-	rs60293925		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112576764_112576775delTGTGTGTGTGTG								MIR297 (794961 upstream) : C4orf32 (489778 downstream)																							CACACATATAtgtgtgtgtgtgtgtgtgtgtg	0.127													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	137400625	137400626	+	IGR	INS	-	CCTTCCTT	CCTTCCTT			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137400625_137400626insCCTTCCTT								None (None upstream) : None (None downstream)																							AGAGCAAAGACccttccttcct	0.168													3	3	---	---	---	---	
GLRA3	8001	broad.mit.edu	37	4	175709742	175709743	+	Intron	DEL	AA	-	-	rs71595436		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175709742_175709743delAA	uc003ity.1	-						GLRA3_uc003itz.1_Intron	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	TTAGAGAAGTaaaaaaaaaaaa	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	180827854	180827854	+	IGR	DEL	T	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180827854delT								None (None upstream) : None (None downstream)																							ttttctttTAttttttttgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1192301	1192302	+	IGR	INS	-	A	A	rs149505685	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1192301_1192302insA								SLC12A7 (80129 upstream) : SLC6A19 (9408 downstream)																							ggctgaggagtgggggagatgt	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4702312	4702313	+	IGR	DEL	TG	-	-	rs148699592		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4702312_4702313delTG								None (None upstream) : LOC340094 (332159 downstream)																							TGAGCATGCCtgtgtgtgtgtg	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28780357	28780358	+	IGR	INS	-	TCT	TCT			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28780357_28780358insTCT								None (None upstream) : None (None downstream)																							tctttcctttcttttttctttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116276423	116276424	+	IGR	INS	-	AC	AC	rs149971151	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116276423_116276424insAC								SEMA6A (365872 upstream) : None (None downstream)																							CACCTCTGTGTacacacacaca	0.272													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	125987648	125987655	+	IGR	DEL	AAGGAAGG	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125987648_125987655delAAGGAAGG								C5orf48 (15674 upstream) : LMNB1 (125178 downstream)																							aaagaaaggaaaggaaggaaggaaggaa	0.000													4	4	---	---	---	---	
IRF1	3659	broad.mit.edu	37	5	131823862	131823863	+	Intron	INS	-	TG	TG	rs149828053	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131823862_131823863insTG	uc003kxa.2	-						IRF1_uc003kxd.2_Intron|IRF1_uc003kxb.2_Intron|IRF1_uc010jdt.1_Intron	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1						blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		CTGGCTTGGACACCCATCTTGA	0.540													6	4	---	---	---	---	
AFF4	27125	broad.mit.edu	37	5	132280658	132280659	+	Intron	INS	-	A	A	rs142291614	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132280658_132280659insA	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron|AFF4_uc003kyf.3_Intron	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTTTTTAATTAAAAAAACAAA	0.213													2	5	---	---	---	---	
NPM1	4869	broad.mit.edu	37	5	170819591	170819591	+	Intron	DEL	T	-	-	rs112063950		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170819591delT	uc011dex.1	+						NPM1_uc003mbh.2_Intron|NPM1_uc003mbi.2_Intron|NPM1_uc003mbj.2_Intron	NM_002520	NP_002511	P06748	NPM_HUMAN	nucleophosmin 1 isoform 1						anti-apoptosis|cell aging|CenH3-containing nucleosome assembly at centromere|centrosome cycle|DNA repair|interspecies interaction between organisms|intracellular protein transport|negative regulation of cell proliferation|negative regulation of centrosome duplication|nucleocytoplasmic transport|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|regulation of endodeoxyribonuclease activity|regulation of endoribonuclease activity|ribosome assembly|signal transduction	nucleolus|nucleoplasm|ribonucleoprotein complex|spindle pole centrosome	histone binding|NF-kappaB binding|protein binding|protein heterodimerization activity|protein homodimerization activity|ribosomal large subunit binding|ribosomal small subunit binding|RNA binding|Tat protein binding|transcription coactivator activity|unfolded protein binding		NPM1/ALK(632)	haematopoietic_and_lymphoid_tissue(3109)|skin(1)	3110	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCATGTGCTCttttttttttt	0.294			T|F 	ALK|RARA|MLF1	NHL|APL|AML								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	38675419	38675420	+	IGR	INS	-	GGAGGGAA	GGAGGGAA			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38675419_38675420insGGAGGGAA								GLO1 (4467 upstream) : DNAH8 (8918 downstream)																							gagggagggagggaaggaagga	0.000													4	2	---	---	---	---	
KIAA1009	22832	broad.mit.edu	37	6	84863037	84863040	+	Intron	DEL	TGAG	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84863037_84863040delTGAG	uc010kbp.2	-						KIAA1009_uc003pkj.3_Intron|KIAA1009_uc003pki.3_Intron	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein						cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TTCTGTTTCTTGAGTGAGTCAAAT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92145913	92145914	+	IGR	DEL	TG	-	-	rs10602833		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92145913_92145914delTG								MAP3K7 (849006 upstream) : None (None downstream)																							ccctggctattgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	157770816	157770817	+	IGR	DEL	GT	-	-	rs144106037	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157770816_157770817delGT								C6orf35 (26023 upstream) : ZDHHC14 (31740 downstream)																							gtgtgtgtgcgtgtgtgtgtgt	0.000													2	4	---	---	---	---	
ISPD	729920	broad.mit.edu	37	7	16248899	16248899	+	Intron	DEL	T	-	-	rs34795937		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16248899delT	uc010ktx.2	-						ISPD_uc010kty.2_Intron|uc003stf.2_5'Flank	NM_001101426	NP_001094896	A4D126	ISPD_HUMAN	notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1						TCTAAGTGTCttttttttttt	0.214										Multiple Myeloma(15;0.18)			5	3	---	---	---	---	
RPS2P32	256355	broad.mit.edu	37	7	23531029	23531030	+	3'UTR	INS	-	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23531029_23531030insA	uc011jza.1	+	1						NR_026676				Homo sapiens ribosomal protein S2 pseudogene, mRNA (cDNA clone IMAGE:4671259).												0						CTATTACTGTCAAAAAAAAAAA	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55659699	55659699	+	IGR	DEL	C	-	-	rs140374894		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55659699delC								VOPP1 (19499 upstream) : LOC442308 (53613 downstream)																							CTCAGCTGCACCCCCCCTCTT	0.587													7	4	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105377975	105377976	+	Intron	DEL	GT	-	-	rs113061707		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105377975_105377976delGT	uc003vde.2	-							NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						TAACGTCCCCgtgtgtgtgtgt	0.203													4	2	---	---	---	---	
WNT2	7472	broad.mit.edu	37	7	116932348	116932349	+	Intron	DEL	CA	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116932348_116932349delCA	uc003viz.2	-						WNT2_uc003vja.2_Intron	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family						atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CAACcacactcacacacacaca	0.287													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	147622385	147622388	+	Intron	DEL	CACA	-	-	rs72341658	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147622385_147622388delCACA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			agcgcgcgcgcacacacacacaca	0.000										HNSCC(39;0.1)			4	2	---	---	---	---	
ERI1	90459	broad.mit.edu	37	8	8874058	8874059	+	Intron	INS	-	A	A	rs55825019		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8874058_8874059insA	uc011kwu.1	+						ERI1_uc003wsk.2_Intron	NM_153332	NP_699163	Q8IV48	ERI1_HUMAN	three prime histone mRNA exonuclease 1						gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)	TTGtaataattaaaaaaaaaaa	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30181786	30181789	+	IGR	DEL	AAGA	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30181786_30181789delAAGA								DCTN6 (140727 upstream) : RBPMS (60155 downstream)																							ggaaggaaggaagaaagaaagaaa	0.083													8	4	---	---	---	---	
WHSC1L1	54904	broad.mit.edu	37	8	38156049	38156050	+	Intron	DEL	TG	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38156049_38156050delTG	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			ATACACCTACtgtgtgtgtgtg	0.297			T	NUP98	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	101900106	101900107	+	IGR	INS	-	AAAG	AAAG	rs149864597	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101900106_101900107insAAAG								PABPC1 (165791 upstream) : YWHAZ (30697 downstream)																							gaaagaaagaaaaagaaagaaa	0.010													4	2	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121705757	121705758	+	Intron	DEL	TC	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121705757_121705758delTC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			ctctcctctgtctctctctctc	0.203													4	2	---	---	---	---	
LOC642929	642929	broad.mit.edu	37	9	43143338	43143338	+	Intron	DEL	A	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43143338delA	uc004acy.3	-							NR_027472				Homo sapiens clone HLS_IMAGE_1031047 mRNA sequence.												0						gacttcgtctaaaaaaaaaaa	0.149													4	2	---	---	---	---	
ERP44	23071	broad.mit.edu	37	9	102822388	102822388	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102822388delT	uc004bam.2	-	2	332	c.124delA	c.(124-126)ATTfs	p.I42fs	ERP44_uc010msy.2_RNA|ERP44_uc010msz.2_Frame_Shift_Del_p.I42fs	NM_015051	NP_055866	Q9BS26	ERP44_HUMAN	thioredoxin domain containing 4 (endoplasmic	42	Thioredoxin.				cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0						TTACTTAAAATTTCATCTATA	0.249													31	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	117528940	117528941	+	IGR	INS	-	CCTT	CCTT	rs113822880	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117528940_117528941insCCTT								C9orf91 (120244 upstream) : TNFSF15 (22672 downstream)																							tttccttcctaccttccttcct	0.059													4	5	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126220283	126220284	+	Intron	INS	-	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126220283_126220284insT	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						ttttcttttccttttttttttt	0.213													3	3	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18122472	18122473	+	Intron	INS	-	A	A			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18122472_18122473insA	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						gactctgtctcaaaaaaaaaaa	0.079													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34220055	34220056	+	IGR	INS	-	TTCCTTCCTTCC	TTCCTTCCTTCC			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34220055_34220056insTTCCTTCCTTCC								NRP1 (596049 upstream) : PARD3 (180042 downstream)																							AGATAAGTGGAttccttccttc	0.188													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	37691032	37691035	+	IGR	DEL	CCTT	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37691032_37691035delCCTT								ANKRD30A (169537 upstream) : ZNF248 (399412 downstream)																							cctttctttcccttccttccttcc	0.000													9	6	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105186868	105186868	+	Intron	DEL	A	-	-	rs75558099		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105186868delA	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		cttgtcccagaaaaaaaaaaa	0.209													4	2	---	---	---	---	
BNIP3	664	broad.mit.edu	37	10	133795202	133795203	+	Intron	INS	-	TGGCCTCCCTC	TGGCCTCCCTC	rs142589527	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133795202_133795203insTGGCCTCCCTC	uc001lkv.1	-						BNIP3_uc010qut.1_Intron	NM_004052	NP_004043	Q12983	BNIP3_HUMAN	BCL2/adenovirus E1B 19kD-interacting protein 3						cellular response to cobalt ion|cellular response to hypoxia|cellular response to mechanical stimulus|chromatin remodeling|defense response to virus|DNA fragmentation involved in apoptotic nuclear change|induction of apoptosis|interspecies interaction between organisms|mitochondrial fragmentation involved in apoptosis|negative regulation of membrane potential|negative regulation of mitochondrial fusion|negative regulation of survival gene product expression|neuron apoptosis|positive regulation of mitochondrial fission|positive regulation of protein complex disassembly|positive regulation of release of cytochrome c from mitochondria|reactive oxygen species metabolic process|regulation of mitochondrial membrane permeability	dendrite|integral to mitochondrial outer membrane|nuclear envelope|nucleoplasm	GTPase binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|skin(1)	2		all_cancers(35;4e-11)|all_epithelial(44;5.07e-08)|Ovarian(717;2.61e-05)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Breast(234;0.023)|all_neural(114;0.0299)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)		Epithelial(32;1.59e-12)|all cancers(32;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(35;2.57e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TGGCGCCCTCTTGGCCTTCCCC	0.757													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45764950	45764965	+	IGR	DEL	AAGGAAGGAAGGAAGA	-	-	rs56170165	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45764950_45764965delAAGGAAGGAAGGAAGA								CHST1 (77778 upstream) : DKFZp779M0652 (28018 downstream)																							ggaaggaaggaaggaaggaaggaagagagagagaga	0.000													5	4	---	---	---	---	
ANKRD13D	338692	broad.mit.edu	37	11	67058823	67058824	+	Intron	DEL	AA	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67058823_67058824delAA	uc001okc.1	+						ANKRD13D_uc001okd.1_Intron|ANKRD13D_uc001oke.1_Intron	NM_207354	NP_997237	Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D											ovary(1)	1			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			agcaagtctcaaaaaaaaaaaa	0.262													7	4	---	---	---	---	
XRRA1	143570	broad.mit.edu	37	11	74631050	74631051	+	Intron	DEL	GC	-	-	rs602411	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74631050_74631051delGC	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						TTATAAAACTGCAAAAAAAAAA	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	79794352	79794353	+	IGR	INS	-	TCCT	TCCT	rs61882897		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79794352_79794353insTCCT								ODZ4 (642657 upstream) : None (None downstream)																							cccttcttctctccttccttcc	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	97782257	97782258	+	IGR	INS	-	TG	TG	rs144552383	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97782257_97782258insTG								None (None upstream) : None (None downstream)																							CTGGAGTTTAAtgtgtgtgtgt	0.144													3	3	---	---	---	---	
UBASH3B	84959	broad.mit.edu	37	11	122597057	122597058	+	Intron	INS	-	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122597057_122597058insT	uc001pyi.3	+							NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,							cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		tcttcttcttcttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110073352	110073363	+	IGR	DEL	CCATCATCACTT	-	-	rs57557025	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110073352_110073363delCCATCATCACTT								MVK (38282 upstream) : C12orf34 (78827 downstream)																							atcatcaccaccatcatcacttccattaccat	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	37474381	37474382	+	IGR	INS	-	TTCC	TTCC	rs67966909		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37474381_37474382insTTCC								MEIS2 (80881 upstream) : TMCO5A (752445 downstream)																							ctttcctttttttccttccttc	0.257													7	4	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43237806	43237806	+	Intron	DEL	T	-	-	rs11352938		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43237806delT	uc001zqq.2	-							NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AAAAGGGATATTTTCCCTTCA	0.393													5	3	---	---	---	---	
STX1B	112755	broad.mit.edu	37	16	31004014	31004015	+	3'UTR	INS	-	GGGGTGGAGGA	GGGGTGGAGGA	rs143292802	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31004014_31004015insGGGGTGGAGGA	uc010cad.2	-	10						NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B						intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						GGTCTGCCGTGGGGGTGGGGCT	0.653													3	5	---	---	---	---	
TAX1BP3	30851	broad.mit.edu	37	17	3569035	3569036	+	Intron	DEL	CC	-	-	rs11650581	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3569035_3569036delCC	uc002fwc.2	-						P2RX5_uc002fwd.2_Intron|TAX1BP3_uc002fwe.1_Intron	NM_014604	NP_055419	O14907	TX1B3_HUMAN	Tax1 binding protein 3						activation of Cdc42 GTPase activity|negative regulation of protein localization at cell surface|negative regulation of Wnt receptor signaling pathway|Rho protein signal transduction|Wnt receptor signaling pathway	cytoplasm|nucleus	protein C-terminus binding				0				COAD - Colon adenocarcinoma(5;0.0761)		TCTCTGGGCTCCaaaaaaaaaa	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7262499	7262502	+	IGR	DEL	CTTC	-	-	rs142591874		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7262499_7262502delCTTC								TMEM95 (1961 upstream) : TNK1 (21863 downstream)																							CCAtttctttcttccttccttcct	0.240													6	3	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10431364	10431365	+	Intron	INS	-	T	T	rs71365770		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10431364_10431365insT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						ttctttctttcttttttttttt	0.089													4	2	---	---	---	---	
SEZ6	124925	broad.mit.edu	37	17	27332097	27332098	+	Intron	DEL	GT	-	-	rs139624154		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27332097_27332098delGT	uc002hdp.2	-						SEZ6_uc010cry.1_Intron|SEZ6_uc002hdq.1_Intron|SEZ6_uc010crz.1_Intron	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1							integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CGGGGCAGTGgtgtgtgtgtgt	0.510													4	3	---	---	---	---	
PSMB3	5691	broad.mit.edu	37	17	36909737	36909737	+	Intron	DEL	T	-	-	rs35484180		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36909737delT	uc002hqr.2	+							NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0						CTTCCCtttcttttttttttt	0.264													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	47059507	47059508	+	IGR	INS	-	TTCC	TTCC			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47059507_47059508insTTCC								GIP (13552 upstream) : IGF2BP1 (15266 downstream)																							ttggtttatttttccttccttc	0.000													4	2	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655757	47655757	+	Intron	DEL	G	-	-	rs36092852		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655757delG	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					AAAGGACAATGGGGGGGGGGG	0.532													4	2	---	---	---	---	
NME1-NME2	654364	broad.mit.edu	37	17	49231520	49231521	+	Intron	INS	-	T	T	rs60023424	by1000genomes	TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49231520_49231521insT	uc002itk.2	+						NME1_uc010dbx.1_Intron|NME1_uc002ith.1_Intron|NME1_uc002iti.1_Intron|NME1-NME2_uc002itj.2_Intron	NM_002512	NP_002503	P22392	NDKB_HUMAN	nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			GTCTCTCTCTCTTTTTTTTTTT	0.302													3	3	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58037277	58037277	+	Intron	DEL	A	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58037277delA	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron|RNFT1_uc010wop.1_3'UTR	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			tctcaaaaagaaaaaaaaaaa	0.000													9	5	---	---	---	---	
CACNG4	27092	broad.mit.edu	37	17	65026269	65026272	+	Intron	DEL	GTGT	-	-	rs79931933		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65026269_65026272delGTGT	uc002jft.1	+							NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	voltage-dependent calcium channel gamma-4						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			AATAATAGGGgtgtgtgtgtgtgt	0.255													3	3	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3188631	3188631	+	Intron	DEL	G	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3188631delG	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						catctcaaaaggaaaaaaaaa	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	30362345	30362347	+	IGR	DEL	CTT	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30362345_30362347delCTT								KLHL14 (9371 upstream) : C18orf34 (155019 downstream)																							tctttctttccttctttctttct	0.000													5	5	---	---	---	---	
KIAA1632	57724	broad.mit.edu	37	18	43437668	43437669	+	Intron	INS	-	T	T			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43437668_43437669insT	uc002lbm.2	-							NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724						autophagy						0						ATCAGGCTCTGTTTTTTTTTTC	0.272													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	4811522	4811524	+	IGR	DEL	GAA	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4811522_4811524delGAA								FEM1A (15953 upstream) : TICAM1 (4415 downstream)																							ggaggaggaggaagaagaagaag	0.227													3	3	---	---	---	---	
DENND1C	79958	broad.mit.edu	37	19	6469043	6469043	+	Intron	DEL	T	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6469043delT	uc002mfe.2	-						DENND1C_uc002mfb.2_Intron|DENND1C_uc002mfc.2_Intron|DENND1C_uc002mfd.2_Intron|DENND1C_uc010xje.1_Intron	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						TTAGTTAGtcttttttttttt	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13709274	13709275	+	IGR	INS	-	AAGAAAGG	AAGAAAGG	rs79314340		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709274_13709275insAAGAAAGG								CACNA1A (92000 upstream) : CCDC130 (133299 downstream)																							accctgtcaaaaaggaaggaag	0.000											OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42293713	42293714	+	IGR	INS	-	AAGAAAGG	AAGAAAGG	rs71870163		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42293713_42293714insAAGAAAGG								CEACAM6 (17600 upstream) : CEACAM3 (6820 downstream)																							aggaaggaagaaaggaaggaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56112805	56112805	+	IGR	DEL	C	-	-	rs148086773		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56112805delC								CTCFL (12097 upstream) : PCK1 (23332 downstream)																							AGGTTCtcttccttccttcct	0.199													3	3	---	---	---	---	
USP18	11274	broad.mit.edu	37	22	18650485	18650485	+	Intron	DEL	G	-	-	rs28408612		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18650485delG	uc002zny.2	+							NM_017414	NP_059110	Q9UMW8	UBP18_HUMAN	ubiquitin specific protease 18						regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway|ubiquitin-dependent protein catabolic process	cytosol|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			breast(1)	1						aaaaaaaaaagaaaaaaGAGT	0.169													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20149983	20149985	+	IGR	DEL	CAT	-	-	rs13057826		TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20149983_20149985delCAT								ZDHHC8 (14454 upstream) : LOC150197 (43870 downstream)																							ccaccatcaccatcaccaccacc	0.025													6	3	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	299254	299269	+	Intron	DEL	CACCCGTCCTCCCACT	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:299254_299269delCACCCGTCCTCCCACT	uc004cpg.2	-						PPP2R3B_uc004cpf.2_Intron	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCTGCAcacacacccgtcctcccactcacccgtcct	0.380													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	39545531	39545538	+	IGR	DEL	GAAGGAAG	-	-			TCGA-BP-5170-01A-01D-1429-08	TCGA-BP-5170-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39545531_39545538delGAAGGAAG								MID1IP1 (879750 upstream) : BCOR (364963 downstream)																							aggaaggaaagaaggaaggaaggaagga	0.130													5	3	---	---	---	---	
