Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VAMP3	9341	broad.mit.edu	37	1	7831384	7831384	+	5'UTR	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7831384C>A	uc001aol.2	+	1						NM_004781	NP_004772	Q15836	VAMP3_HUMAN	vesicle-associated membrane protein 3						cellular membrane fusion|positive regulation of receptor recycling|protein complex assembly|protein transport|retrograde transport, endosome to Golgi|substrate adhesion-dependent cell spreading|vesicle docking involved in exocytosis	cell junction|clathrin-coated vesicle|integral to membrane|recycling endosome|synapse|synaptosome	protein binding				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;6.33e-69)|GBM - Glioblastoma multiforme(8;2.07e-34)|Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.38e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000805)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		GCCTCCGGTCCCAACTTCGCT	0.413													4	21	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8420609	8420609	+	Silent	SNP	T	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8420609T>G	uc001ape.2	-	19	3768	c.2958A>C	c.(2956-2958)CCA>CCC	p.P986P	RERE_uc001apf.2_Silent_p.P986P|RERE_uc010nzx.1_Silent_p.P718P|RERE_uc001apd.2_Silent_p.P432P	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	986	Pro-rich.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTTGCAGGGGTGGGGGGTGAG	0.706													6	60	---	---	---	---	PASS
SPSB1	80176	broad.mit.edu	37	1	9416147	9416147	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9416147T>C	uc010oae.1	+	2	536	c.197T>C	c.(196-198)TTT>TCT	p.F66S	SPSB1_uc001apv.2_Missense_Mutation_p.F66S	NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box	66	B30.2/SPRY.				intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		CTCAATGTCTTTGTGAAGGAG	0.577													46	199	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10166557	10166557	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10166557G>A	uc001aqs.3	+	7	1825	c.1112G>A	c.(1111-1113)AGG>AAG	p.R371K	UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	371					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TCCAGACAGAGGCCCAGCAGC	0.657													44	116	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16199600	16199600	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16199600C>T	uc001axk.1	+	2	577	c.373C>T	c.(373-375)CGA>TGA	p.R125*	SPEN_uc010obp.1_5'Flank	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	125	Arg-rich.|By similarity.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACTTCATGCACGAGAAGGACG	0.463													17	94	---	---	---	---	PASS
USP48	84196	broad.mit.edu	37	1	22032286	22032286	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22032286G>A	uc001bfb.2	-	19	2556	c.2318C>T	c.(2317-2319)GCT>GTT	p.A773V	USP48_uc001bfa.2_Missense_Mutation_p.A311V|USP48_uc010odq.1_Missense_Mutation_p.A785V|USP48_uc009vqc.2_Missense_Mutation_p.A707V|USP48_uc001bfc.2_Missense_Mutation_p.A773V|USP48_uc001bfd.1_5'Flank	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a	773	DUSP 3.				ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ACACAAAAGAGCACTGTTCCC	0.418													16	54	---	---	---	---	PASS
DCDC2B	149069	broad.mit.edu	37	1	32678141	32678141	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32678141C>G	uc001bun.2	+	5	578	c.578C>G	c.(577-579)ACT>AGT	p.T193S		NM_001099434	NP_001092904	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	193	Doublecortin 2.				intracellular signal transduction						0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GAGCTGGTAACTGGCCATTAC	0.587													16	67	---	---	---	---	PASS
SYDE2	84144	broad.mit.edu	37	1	85624346	85624346	+	3'UTR	SNP	A	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85624346A>C	uc009wcm.2	-	7						NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2						activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		AGAGTAAAAAAATGAAAACAT	0.229													2	5	---	---	---	---	PASS
DENND2D	79961	broad.mit.edu	37	1	111734927	111734927	+	Silent	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111734927C>T	uc001eak.1	-	8	1007	c.807G>A	c.(805-807)CAG>CAA	p.Q269Q	DENND2D_uc001eal.1_Silent_p.Q266Q	NM_024901	NP_079177	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	269	DENN.									ovary(1)	1		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CATGGATGCACTGAGACAAGG	0.622													11	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803302	142803302	+	Intron	SNP	C	A	A	rs79529551		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803302C>A	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																		acaacaacaacaaACAGGATG	0.224													3	11	---	---	---	---	PASS
FLAD1	80308	broad.mit.edu	37	1	154965555	154965555	+	3'UTR	SNP	A	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154965555A>G	uc001fgf.1	+	7					FLAD1_uc001fge.1_3'UTR|FLAD1_uc001fgg.1_3'UTR|FLAD1_uc001fgh.1_3'UTR|LENEP_uc001fgi.2_5'Flank	NM_025207	NP_079483	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase isoform						FAD biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|FMN adenylyltransferase activity			ovary(2)|skin(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GTCCTAGGGTATAACCTGGCA	0.557													6	42	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183072788	183072788	+	Intron	SNP	C	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183072788C>G	uc001gpy.3	+						LAMC1_uc001gpx.2_Silent_p.A248A	NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor						axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACAGGTTGGCCTGAAGCCAGC	0.517													11	49	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200562851	200562851	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200562851C>T	uc010ppk.1	-	15	3035	c.2596G>A	c.(2596-2598)GAA>AAA	p.E866K	KIF14_uc010ppj.1_Missense_Mutation_p.E375K	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	866	FHA.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						GTCTTTGCTTCCCCAACTGGG	0.294													50	208	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200959172	200959172	+	Splice_Site	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200959172C>T	uc001gvs.1	-	21	3348	c.3031_splice	c.e21-1	p.E1011_splice	KIF21B_uc001gvr.1_Splice_Site_p.E1011_splice|KIF21B_uc009wzl.1_Splice_Site_p.E1011_splice|KIF21B_uc010ppn.1_Splice_Site_p.E1011_splice	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						CCAGCTCCTCCTAGGACCGGG	0.647													19	66	---	---	---	---	PASS
TRAF5	7188	broad.mit.edu	37	1	211545849	211545849	+	Silent	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211545849G>A	uc001hih.2	+	11	1539	c.1479G>A	c.(1477-1479)AAG>AAA	p.K493K	TRAF5_uc001hii.2_Silent_p.K493K|TRAF5_uc010psx.1_Silent_p.K504K|TRAF5_uc010psy.1_Silent_p.K387K|TRAF5_uc001hij.2_Silent_p.K493K	NM_004619	NP_004610	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	493	MATH.				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(2)|ovary(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		GTGGCAAAAAGAACATTATGG	0.507													20	85	---	---	---	---	PASS
ARHGAP25	9938	broad.mit.edu	37	2	69045086	69045086	+	Silent	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69045086C>A	uc002seu.2	+	8	1324	c.960C>A	c.(958-960)CTC>CTA	p.L320L	ARHGAP25_uc010fdg.2_Silent_p.L321L|ARHGAP25_uc010yql.1_Silent_p.L281L|ARHGAP25_uc002sev.2_Silent_p.L314L|ARHGAP25_uc002sew.2_Silent_p.L313L|ARHGAP25_uc002sex.2_Silent_p.L314L|ARHGAP25_uc010fdh.1_RNA|ARHGAP25_uc002sey.2_Silent_p.L47L	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	320	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						GTGTGAATCTCATCAGGTCGA	0.453													13	79	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86325787	86325787	+	Silent	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86325787G>A	uc002sqs.2	-	3	758	c.379C>T	c.(379-381)CTG>TTG	p.L127L	POLR1A_uc002sqv.2_Silent_p.L127L	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	127					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						CCGACTTCCAGAACCCTCAGC	0.532													68	264	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152551064	152551064	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152551064G>T	uc010fnx.2	-	19	1945	c.1754C>A	c.(1753-1755)GCC>GAC	p.A585D	NEB_uc010fny.1_Missense_Mutation_p.A139D	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	585	Nebulin 14.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTTGGCTTTGGCTGCCAGCAG	0.488													8	29	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201450857	201450857	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201450857T>G	uc002uvx.2	+	1	127	c.26T>G	c.(25-27)TTC>TGC	p.F9C		NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	9	2Fe-2S ferredoxin-type.				inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GAGCTGCTCTTCTACGTGAAC	0.716													3	4	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211441087	211441087	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211441087C>G	uc002vee.3	+	3	386	c.254C>G	c.(253-255)ACT>AGT	p.T85S	CPS1_uc010fur.2_Missense_Mutation_p.T91S	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	85	Anthranilate phosphoribosyltransferase homolog.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		GAAGCTATTACTGACCCTGCC	0.408													68	233	---	---	---	---	PASS
ACSL3	2181	broad.mit.edu	37	2	223795455	223795455	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223795455G>A	uc002vni.2	+	14	2108	c.1657G>A	c.(1657-1659)GAT>AAT	p.D553N	ACSL3_uc002vnj.2_Missense_Mutation_p.D553N	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	553	Cytoplasmic (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TTTCTTTGAAGATGAAAATGG	0.388			T	ETV1	prostate								26	120	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188240	10188240	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188240T>A	uc003bvc.2	+	2	596	c.383T>A	c.(382-384)CTT>CAT	p.L128H	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	128	Involved in binding to CCT complex.		L -> F (in VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L128fs*31(5)|p.L128P(3)|p.L128fs*4(2)|p.L128R(2)|p.L128H(1)|p.L128I(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CACGATGGGCTTCTGGTTAAC	0.413		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				67	183	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36872739	36872739	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36872739C>A	uc003cgj.2	-	12	6855	c.6553G>T	c.(6553-6555)GGC>TGC	p.G2185C		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	2735					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TTCTCTGGGCCACGGGTAAAC	0.592													17	46	---	---	---	---	PASS
SNRK	54861	broad.mit.edu	37	3	43389698	43389698	+	Silent	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43389698C>T	uc003cms.3	+	7	2279	c.1947C>T	c.(1945-1947)CTC>CTT	p.L649L	SNRK_uc003cmt.3_Silent_p.L649L|SNRK_uc010hik.2_Silent_p.L649L|SNRK_uc011azr.1_Silent_p.L443L	NM_017719	NP_060189	Q9NRH2	SNRK_HUMAN	SNF related kinase	649					myeloid cell differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		GCCTCAAACTCATGAGCCTCT	0.552													21	50	---	---	---	---	PASS
KLHDC8B	200942	broad.mit.edu	37	3	49212294	49212294	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49212294G>A	uc003cwh.2	+	4	846	c.661G>A	c.(661-663)GAA>AAA	p.E221K	KLHDC8B_uc003cwi.1_Missense_Mutation_p.E94K	NM_173546	NP_775817	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	221	Kelch 5.					cytoplasm					0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CGCCATGGCTGAAGGCAGCGT	0.602													16	45	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52443892	52443892	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52443892C>T	uc003ddx.2	-	1	118	c.3G>A	c.(1-3)ATG>ATA	p.M1I	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	1					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGCCCTTATTCATCTTCCCGC	0.766			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								14	31	---	---	---	---	PASS
SHQ1	55164	broad.mit.edu	37	3	72893524	72893524	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72893524T>C	uc003dpf.2	-	2	301	c.194A>G	c.(193-195)TAT>TGT	p.Y65C	SHQ1_uc010hod.2_5'UTR	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog	65	CS.				ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		ATCTGCATCATAGGACCCTTG	0.338													3	90	---	---	---	---	PASS
C3orf17	25871	broad.mit.edu	37	3	112724334	112724334	+	3'UTR	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112724334C>A	uc003dzr.2	-	9					GTPBP8_uc011bhy.1_Intron|C3orf17_uc003dzq.2_3'UTR|C3orf17_uc011bhz.1_3'UTR|C3orf17_uc010hqh.2_3'UTR|C3orf17_uc003dzt.2_3'UTR|C3orf17_uc003dzs.2_3'UTR|C3orf17_uc010hqg.2_3'UTR|C3orf17_uc011bia.1_3'UTR|C3orf17_uc003dzu.2_3'UTR|C3orf17_uc011bib.1_3'UTR|C3orf17_uc011bic.1_3'UTR|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871							integral to membrane					0						ACTTAGAACACTGAACTAGCC	0.393													11	62	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114058081	114058081	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114058081A>G	uc003ebi.2	-	5	2177	c.1997T>C	c.(1996-1998)ATC>ACC	p.I666T	ZBTB20_uc003ebj.2_Missense_Mutation_p.I593T|ZBTB20_uc010hqp.2_Missense_Mutation_p.I593T|ZBTB20_uc003ebk.2_Missense_Mutation_p.I593T|ZBTB20_uc003ebl.2_Missense_Mutation_p.I593T|ZBTB20_uc003ebm.2_Missense_Mutation_p.I593T|ZBTB20_uc003ebn.2_Missense_Mutation_p.I593T	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	666	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CTTTTTGCAGATGTAGCACTC	0.592													62	223	---	---	---	---	PASS
CCDC48	79825	broad.mit.edu	37	3	128753037	128753037	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128753037G>T	uc011bkt.1	+	5	1314	c.1314G>T	c.(1312-1314)ATG>ATT	p.M438I		NM_024768	NP_079044	Q9HA90	CCD48_HUMAN	coiled-coil domain containing 48	438											0						AGAAGCTCATGACTTACTTTG	0.622													28	125	---	---	---	---	PASS
TLR1	7096	broad.mit.edu	37	4	38799865	38799865	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38799865G>T	uc003gtl.2	-	4	862	c.588C>A	c.(586-588)TTC>TTA	p.F196L		NM_003263	NP_003254	Q15399	TLR1_HUMAN	toll-like receptor 1 precursor	196	Extracellular (Potential).				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity			lung(2)|skin(2)|prostate(1)	5						TGTTTGTGGGGAACACAATGT	0.393													27	103	---	---	---	---	PASS
AFF1	4299	broad.mit.edu	37	4	88055842	88055842	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88055842T>G	uc003hqj.3	+	19	3914	c.3507T>G	c.(3505-3507)AAT>AAG	p.N1169K	AFF1_uc011ccz.1_Missense_Mutation_p.N1177K|AFF1_uc003hqk.3_Missense_Mutation_p.N1170K|AFF1_uc011cda.1_Missense_Mutation_p.N808K	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1169						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CGAGGAAGAATAAAGGTAAAT	0.413													7	139	---	---	---	---	PASS
AGXT2L1	64850	broad.mit.edu	37	4	109681436	109681436	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109681436G>T	uc003hzc.2	-	2	264	c.83C>A	c.(82-84)TCG>TAG	p.S28*	AGXT2L1_uc010imc.2_Nonsense_Mutation_p.S28*|AGXT2L1_uc011cfm.1_5'UTR|AGXT2L1_uc011cfn.1_Intron|AGXT2L1_uc011cfo.1_Intron	NM_031279	NP_112569	Q8TBG4	AT2L1_HUMAN	alanine-glyoxylate aminotransferase 2-like 1	28					cellular amino acid metabolic process	mitochondrion	alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000281)		GATGGGATCCGATGCAAAGAA	0.428													39	169	---	---	---	---	PASS
NAF1	92345	broad.mit.edu	37	4	164087855	164087855	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164087855C>A	uc003iqj.2	-	1	219	c.25G>T	c.(25-27)GCT>TCT	p.A9S	NAF1_uc010iqw.1_Missense_Mutation_p.A9S|NAF1_uc003iqk.2_RNA	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	9					rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				TCCAGCTGAGCGGCGGCGGCC	0.637													6	41	---	---	---	---	PASS
ENPP6	133121	broad.mit.edu	37	4	185138820	185138820	+	Silent	SNP	T	C	C	rs148715663		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185138820T>C	uc003iwc.2	-	1	295	c.153A>G	c.(151-153)AAA>AAG	p.K51K		NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	51	Extracellular (Potential).				lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		TCACAATCTCTTTGAAACCAG	0.498													14	77	---	---	---	---	PASS
DDX46	9879	broad.mit.edu	37	5	134153324	134153324	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134153324G>T	uc003kzw.2	+	20	2917	c.2749G>T	c.(2749-2751)GAA>TAA	p.E917*		NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	917					mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGAGAAACAAGAAGAAGAGAG	0.408													30	68	---	---	---	---	PASS
MGC29506	51237	broad.mit.edu	37	5	138724269	138724269	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138724269C>T	uc003lei.2	-	2	243	c.183G>A	c.(181-183)TGG>TGA	p.W61*	MGC29506_uc010jfd.2_Intron|MGC29506_uc010jfe.2_Nonsense_Mutation_p.W31*|MGC29506_uc003lej.2_Nonsense_Mutation_p.W2*	NM_016459	NP_057543	Q8WU39	PERP1_HUMAN	proapoptotic caspase adapter protein precursor	61					apoptosis|positive regulation of immunoglobulin biosynthetic process	cytoplasm|endoplasmic reticulum chaperone complex	protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCAGATTTTGCCACATCTGGA	0.577													3	8	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140166338	140166338	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140166338G>T	uc003lhb.2	+	1	463	c.463G>T	c.(463-465)GAA>TAA	p.E155*	PCDHA1_uc003lha.2_Nonsense_Mutation_p.E155*|PCDHA1_uc003lgz.2_Nonsense_Mutation_p.E155*	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	155	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTCCGATAGAAGGAGCTGC	0.438													12	206	---	---	---	---	PASS
DDX41	51428	broad.mit.edu	37	5	176942286	176942286	+	Intron	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176942286C>A	uc003mho.2	-						DDX41_uc003mhm.2_5'UTR|DDX41_uc003mhn.2_Intron|DDX41_uc003mhp.2_Intron|DDX41_uc003mhq.1_5'UTR	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt						apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			ACATCGTCTTCATGACtcaca	0.274													19	73	---	---	---	---	PASS
SKIV2L	6499	broad.mit.edu	37	6	31930533	31930533	+	Silent	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31930533G>A	uc003nyn.1	+	12	1643	c.1254G>A	c.(1252-1254)GAG>GAA	p.E418E	SKIV2L_uc011dou.1_Silent_p.E260E|SKIV2L_uc011dov.1_Silent_p.E225E	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	418	Helicase ATP-binding.					nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						GGGACCTGGAGTGGGTCATCT	0.572													24	107	---	---	---	---	PASS
UBR2	23304	broad.mit.edu	37	6	42600357	42600357	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42600357G>A	uc011dur.1	+	12	1349	c.1349G>A	c.(1348-1350)AGA>AAA	p.R450K	UBR2_uc011dus.1_Missense_Mutation_p.R95K|UBR2_uc010jxv.1_5'UTR|UBR2_uc003osh.2_RNA	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	450					cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			GATCATTTGAGACATCGAGAT	0.363													5	119	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56471874	56471874	+	Intron	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56471874G>T	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.Q1981K	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TATTGTACTTGAGGATTACTA	0.348													29	107	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71177153	71177153	+	3'UTR	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71177153G>A	uc003tvy.2	+	11					WBSCR17_uc003tvz.2_3'UTR	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TGGGGCACTGGAGCCTGGCCC	0.667													16	76	---	---	---	---	PASS
LRRC4	64101	broad.mit.edu	37	7	127670481	127670481	+	Silent	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127670481C>T	uc003vmk.2	-	2	350	c.213G>A	c.(211-213)CAG>CAA	p.Q71Q	SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron	NM_022143	NP_071426	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4 precursor	71	LRRNT.|Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4				Lung(243;0.124)		AGGGAATACCCTGCGGGACCT	0.647													25	125	---	---	---	---	PASS
TOP1MT	116447	broad.mit.edu	37	8	144391728	144391728	+	Intron	SNP	A	G	G	rs7386475	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144391728A>G	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_3'UTR	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GGGAGGCAGCATCAGCCCAGG	0.637													3	77	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117783425	117783425	+	3'UTR	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117783425G>A	uc004bjj.3	-	28					TNC_uc010mvf.2_3'UTR	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor						cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						TCACCCAGTGGTCCCTGGAAT	0.507													9	59	---	---	---	---	PASS
ZMYND11	10771	broad.mit.edu	37	10	298337	298337	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:298337C>A	uc010pzt.1	+	15	2164	c.1736C>A	c.(1735-1737)TCC>TAC	p.S579Y	ZMYND11_uc010pzu.1_Missense_Mutation_p.S579Y|ZMYND11_uc010pzv.1_Missense_Mutation_p.S524Y|ZMYND11_uc010pzw.1_Missense_Mutation_p.S494Y|ZMYND11_uc001ifm.2_Missense_Mutation_p.S525Y|ZMYND11_uc009xhg.2_Missense_Mutation_p.S562Y|ZMYND11_uc009xhh.2_Missense_Mutation_p.S453Y|ZMYND11_uc010pzy.1_Missense_Mutation_p.S431Y	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	zinc finger, MYND domain containing 11 isoform	539	MYND-type.				cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TGGAACACATCCTACTGCTCC	0.577													62	218	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72498659	72498659	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72498659G>C	uc001jrh.2	+	11	1661	c.1661G>C	c.(1660-1662)GGC>GCC	p.G554A	ADAMTS14_uc001jrg.2_Missense_Mutation_p.G557A|ADAMTS14_uc001jri.1_Missense_Mutation_p.G77A	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	554	TSP type-1 1.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						CAGGATGGAGGCTGGAGCTCC	0.627													10	67	---	---	---	---	PASS
TLL2	7093	broad.mit.edu	37	10	98182331	98182331	+	Silent	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98182331G>T	uc001kml.1	-	6	1018	c.792C>A	c.(790-792)ACC>ACA	p.T264T	TLL2_uc009xvf.1_Silent_p.T212T	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	264	Metalloprotease (By similarity).				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CCCTGATGATGGTGACATGTT	0.567													28	62	---	---	---	---	PASS
SEC31B	25956	broad.mit.edu	37	10	102249094	102249094	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102249094T>A	uc001krc.1	-	23	3188	c.3086A>T	c.(3085-3087)GAG>GTG	p.E1029V	SEC31B_uc010qpo.1_Missense_Mutation_p.E1028V|SEC31B_uc001krd.1_Missense_Mutation_p.E566V|SEC31B_uc001krf.1_Missense_Mutation_p.E461V|SEC31B_uc001kre.1_Missense_Mutation_p.E461V	NM_015490	NP_056305	Q9NQW1	SC31B_HUMAN	SEC31 homolog B	1029	Pro-rich.				protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane				ovary(1)	1		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CCCTTGTAGCTCAGGGGTGAG	0.527													11	37	---	---	---	---	PASS
TAF5	6877	broad.mit.edu	37	10	105133273	105133273	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105133273T>G	uc001kwv.2	+	2	741	c.718T>G	c.(718-720)TTT>GTT	p.F240V	TAF5_uc010qqq.1_Missense_Mutation_p.F240V	NM_006951	NP_008882	Q15542	TAF5_HUMAN	TBP-associated factor 5	240					histone acetylation|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|transcription factor TFIID complex|transcription factor TFTC complex	protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)	2		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		GTCCCAACTTTTTTATCCTCT	0.383													50	173	---	---	---	---	PASS
CARS	833	broad.mit.edu	37	11	3039892	3039892	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3039892T>G	uc001lxh.2	-	12	1308	c.1234A>C	c.(1234-1236)AAA>CAA	p.K412Q	CARS_uc001lxe.2_Missense_Mutation_p.K402Q|CARS_uc001lxf.2_Missense_Mutation_p.K495Q|CARS_uc001lxg.2_Missense_Mutation_p.K412Q|CARS_uc010qxo.1_Missense_Mutation_p.K495Q|CARS_uc010qxp.1_Missense_Mutation_p.K425Q	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b	412					cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ATGAAGTTTTTTAGTGACTTT	0.478			T	ALK	ALCL								44	169	---	---	---	---	PASS
ARFGAP2	84364	broad.mit.edu	37	11	47193064	47193064	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47193064C>A	uc001ndt.2	-	10	869	c.854G>T	c.(853-855)CGT>CTT	p.R285L	ARFGAP2_uc010rha.1_Missense_Mutation_p.R16L|ARFGAP2_uc010rhb.1_Missense_Mutation_p.R257L|ARFGAP2_uc001ndu.2_Missense_Mutation_p.R149L|ARFGAP2_uc010rhc.1_Missense_Mutation_p.R16L	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating	285	Required for interaction with coatomer.|Potential.				protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						CTCTTTCTTACGATCAATCTG	0.547													44	163	---	---	---	---	PASS
TMEM138	51524	broad.mit.edu	37	11	61135582	61135582	+	Intron	SNP	A	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61135582A>C	uc001nrl.1	+						TMEM138_uc010rli.1_Missense_Mutation_p.D163A|TMEM138_uc001nrm.2_3'UTR	NM_016464	NP_057548	Q9NPI0	TM138_HUMAN	transmembrane protein 138							integral to membrane					0						GATGGTTGTGACAGCCACACC	0.567													9	19	---	---	---	---	PASS
SLC22A6	9356	broad.mit.edu	37	11	62752225	62752225	+	5'UTR	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62752225C>T	uc001nwk.2	-	1					SLC22A6_uc001nwl.2_5'UTR|SLC22A6_uc001nwj.2_5'UTR|SLC22A6_uc001nwm.2_5'UTR	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a						alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						CTCTGTCTGTCTGCCTGCCTG	0.667													3	11	---	---	---	---	PASS
BBS1	582	broad.mit.edu	37	11	66278152	66278152	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66278152G>A	uc001oij.1	+	1	34	c.22G>A	c.(22-24)GAT>AAT	p.D8N	BBS1_uc001oii.1_Intron|BBS1_uc010rpf.1_RNA|BBS1_uc010rpg.1_Missense_Mutation_p.D8N|BBS1_uc001oik.1_5'UTR|BBS1_uc001oil.1_Missense_Mutation_p.D8N	NM_024649	NP_078925	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	8					nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	BBSome|cilium membrane|cytoplasm	protein binding			ovary(1)	1						GTCCTCATCGGATTCCGACGC	0.662									Bardet-Biedl_syndrome				12	43	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108383516	108383516	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108383516G>T	uc001pkk.2	-	6	2829	c.2718C>A	c.(2716-2718)TTC>TTA	p.F906L	EXPH5_uc010rvy.1_Missense_Mutation_p.F718L|EXPH5_uc010rvz.1_Missense_Mutation_p.F750L|EXPH5_uc010rwa.1_Missense_Mutation_p.F830L	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	906					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTCTCCTGGAGAACACTGTAG	0.428													58	261	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118375278	118375278	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118375278G>T	uc001pta.2	+	27	8685	c.8662G>T	c.(8662-8664)GAA>TAA	p.E2888*	MLL_uc001ptb.2_Nonsense_Mutation_p.E2891*	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2888					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		CAGTAATCGTGAAAAAGACAT	0.443			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								78	314	---	---	---	---	PASS
FEZ1	9638	broad.mit.edu	37	11	125324081	125324081	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125324081T>G	uc001qbx.2	-	7	1117	c.965A>C	c.(964-966)AAC>ACC	p.N322T	FEZ1_uc001qbw.2_Missense_Mutation_p.N112T	NM_005103	NP_005094	Q99689	FEZ1_HUMAN	zygin 1 isoform 1	322					axon guidance|cell adhesion|transport	microtubule|plasma membrane				central_nervous_system(3)|ovary(1)	4	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CTGCAGAATGTTGGAGATGCC	0.552													12	55	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082243	8082243	+	Intron	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082243C>T	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		AAGTGAAATACTTTAAGACAC	0.254													3	43	---	---	---	---	PASS
SLC2A3	6515	broad.mit.edu	37	12	8082245	8082245	+	Intron	SNP	T	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8082245T>G	uc001qtr.2	-						SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GTGAAATACTTTAAGACACGT	0.254													3	46	---	---	---	---	PASS
PRIM1	5557	broad.mit.edu	37	12	57139904	57139904	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57139904C>T	uc001smd.2	-	5	568	c.504G>A	c.(502-504)TGG>TGA	p.W168*	PRIM1_uc001sme.1_RNA|PRIM1_uc009zoz.1_RNA|PRIM1_uc001smf.2_Missense_Mutation_p.G169E	NM_000946	NP_000937	P49642	PRI1_HUMAN	DNA primase polypeptide 1	168					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0						CATCACAGACCCAACAATGAA	0.373													16	92	---	---	---	---	PASS
OS9	10956	broad.mit.edu	37	12	58114744	58114744	+	3'UTR	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58114744C>T	uc001spj.2	+	15					OS9_uc010srx.1_3'UTR|OS9_uc001spk.2_3'UTR|OS9_uc001spl.2_3'UTR|OS9_uc001spm.2_3'UTR|OS9_uc001spn.2_3'UTR|OS9_uc010sry.1_3'UTR|OS9_uc010srz.1_3'UTR	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum						ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CCTGGACTGGCTTGCCTCCTC	0.612													8	31	---	---	---	---	PASS
TSC22D1	8848	broad.mit.edu	37	13	45008837	45008837	+	Silent	SNP	A	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45008837A>G	uc001uzn.3	-	3	3638	c.3147T>C	c.(3145-3147)CCT>CCC	p.P1049P	TSC22D1_uc001uzo.1_Intron|TSC22D1_uc001uzm.3_Silent_p.P120P	NM_183422	NP_904358	Q15714	T22D1_HUMAN	TSC22 domain family, member 1 isoform 1	1049					transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		GGGTGGTGGCAGGGGGGGAGC	0.642													6	29	---	---	---	---	PASS
SLC25A30	253512	broad.mit.edu	37	13	45969907	45969907	+	3'UTR	SNP	A	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45969907A>G	uc001vag.2	-	10					SLC25A30_uc010tfs.1_3'UTR|SLC25A30_uc001vah.2_3'UTR|SLC25A30_uc010tft.1_3'UTR|SLC25A30_uc001vaf.2_3'UTR	NM_001010875	NP_001010875	Q5SVS4	KMCP1_HUMAN	solute carrier family 25, member 30						mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding			breast(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)		TAGTGTTTGGATGTTAGTTTA	0.388													2	11	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19553710	19553710	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19553710G>A	uc001vuz.1	+	1	346	c.294G>A	c.(292-294)ATG>ATA	p.M98I	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	98										ovary(1)	1						GGAGCAAGATGGGCAAGTGGT	0.622													17	254	---	---	---	---	PASS
RPGRIP1	57096	broad.mit.edu	37	14	21796688	21796688	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21796688A>G	uc001wag.2	+	18	3001	c.3001A>G	c.(3001-3003)AGC>GGC	p.S1001G	RPGRIP1_uc001wah.2_Missense_Mutation_p.S643G|RPGRIP1_uc001wai.2_Missense_Mutation_p.S327G|RPGRIP1_uc001wak.2_Missense_Mutation_p.S476G|RPGRIP1_uc010aim.2_Missense_Mutation_p.S384G|RPGRIP1_uc001wal.2_Missense_Mutation_p.S360G|RPGRIP1_uc001wam.2_Missense_Mutation_p.S318G	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator	1001	Interaction with RPGR.				response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CCAGGTTGTGAGCTACTCAAG	0.433													4	122	---	---	---	---	PASS
PSMB11	122706	broad.mit.edu	37	14	23511526	23511526	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23511526G>A	uc010ake.1	+	1	151	c.92G>A	c.(91-93)CGG>CAG	p.R31Q		NM_001099780	NP_001093250	A5LHX3	PSB11_HUMAN	proteasome beta 11 subunit precursor	31					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		GCTGTGCCCCGGGGTTGTGAC	0.652													28	117	---	---	---	---	PASS
G2E3	55632	broad.mit.edu	37	14	31071304	31071304	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31071304A>T	uc001wqk.2	+	10	1131	c.977A>T	c.(976-978)CAG>CTG	p.Q326L	G2E3_uc010tpe.1_Missense_Mutation_p.Q241L|G2E3_uc010tpf.1_Missense_Mutation_p.Q280L	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	326					apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						TTACCCAGACAGTCACCTGGA	0.348													5	137	---	---	---	---	PASS
FNTB	2342	broad.mit.edu	37	14	65482387	65482387	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65482387C>G	uc001xia.2	+	4	492	c.327C>G	c.(325-327)CAC>CAG	p.H109Q	FNTB_uc010tsl.1_Missense_Mutation_p.H143Q|FNTB_uc010tsm.1_Missense_Mutation_p.H63Q|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_5'UTR|FNTB_uc010tso.1_Missense_Mutation_p.H24Q	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta	109					protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GGATCCTGCACAGCTTGGAAC	0.488													30	172	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106236319	106236319	+	RNA	SNP	A	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106236319A>T	uc010tyt.1	-	3616		c.57625T>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						CCAGGAGTTCAGGTGCTGAGG	0.602													16	68	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106668020	106668020	+	Intron	SNP	A	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106668020A>T	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						AACCCAGCTCAGCCCAAACTC	0.488													50	204	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22482973	22482973	+	IGR	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482973C>A								OR4N3P (68588 upstream) : MIR1268 (30256 downstream)																							CCATTGCCAGCATTGATCCAT	0.527													75	657	---	---	---	---	PASS
TMEM87A	25963	broad.mit.edu	37	15	42512318	42512318	+	Silent	SNP	T	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42512318T>A	uc010udd.1	-	16	1578	c.1419A>T	c.(1417-1419)CCA>CCT	p.P473P		NM_015497	NP_056312	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A isoform 1	473						integral to membrane				ovary(1)	1		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		CCTCAGACAATGGTGAAAAGG	0.318													42	224	---	---	---	---	PASS
MYO5A	4644	broad.mit.edu	37	15	52702579	52702579	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52702579C>G	uc002aby.2	-	6	951	c.707G>C	c.(706-708)GGT>GCT	p.G236A	MYO5A_uc002abx.3_Missense_Mutation_p.G236A|MYO5A_uc010uge.1_Missense_Mutation_p.G105A	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	236	Myosin head-like.				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CATATTGGCACCAATGATTCG	0.358													19	278	---	---	---	---	PASS
CCDC78	124093	broad.mit.edu	37	16	775560	775560	+	Silent	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:775560C>T	uc002cjg.2	-	4	394	c.288G>A	c.(286-288)CGG>CGA	p.R96R	CCDC78_uc002cjf.2_5'Flank|CCDC78_uc002cji.3_Silent_p.R170R|CCDC78_uc002cjj.3_Intron|CCDC78_uc002cjh.2_5'UTR|CCDC78_uc010uuo.1_Silent_p.R96R|CCDC78_uc002cjk.2_Silent_p.R96R|HAGHL_uc002cjl.1_5'Flank|HAGHL_uc002cjm.1_5'Flank|HAGHL_uc002cjn.1_5'Flank|HAGHL_uc002cjo.1_5'Flank|HAGHL_uc010uup.1_5'Flank	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	96	Potential.									central_nervous_system(1)	1		Hepatocellular(780;0.0218)				GCTCCAGTACCCGGCTCTCCA	0.657													14	57	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30735820	30735820	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30735820G>C	uc002dze.1	+	25	5460	c.5075G>C	c.(5074-5076)GGA>GCA	p.G1692A	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.G1487A|SRCAP_uc010bzz.1_Missense_Mutation_p.G1262A	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1692	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CCCACTCTTGGAGGCTCATCT	0.562													60	227	---	---	---	---	PASS
PYDC1	260434	broad.mit.edu	37	16	31228342	31228342	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31228342G>C	uc002ebo.2	-	1	57	c.8C>G	c.(7-9)ACG>AGG	p.T3R	TRIM72_uc002ebn.1_Intron	NM_152901	NP_690865	Q8WXC3	PYDC1_HUMAN	pyrin domain containing 1	3	DAPIN.				innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein kinase activity|positive regulation of interleukin-1 beta secretion|proteolysis|tumor necrosis factor-mediated signaling pathway	IkappaB kinase complex|nucleus	cysteine-type endopeptidase activity|protein binding				0						CTCGCGCTTCGTTCCCATGGC	0.647													8	20	---	---	---	---	PASS
C16orf70	80262	broad.mit.edu	37	16	67166548	67166548	+	Intron	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67166548G>A	uc002erc.2	+						C16orf70_uc002erd.2_Intron|C16orf70_uc002ere.1_Missense_Mutation_p.V137I	NM_025187	NP_079463	Q9BSU1	CP070_HUMAN	lin-10											ovary(2)	2		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		TGTGGGGTTGGTACTTGGGTG	0.517													13	41	---	---	---	---	PASS
HAS3	3038	broad.mit.edu	37	16	69149149	69149149	+	Silent	SNP	T	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69149149T>C	uc010cfh.2	+	4	1866	c.1642T>C	c.(1642-1644)TTG>CTG	p.L548L	HAS3_uc002ewk.2_Intron|HAS3_uc002ewl.2_Silent_p.L548L	NM_005329	NP_005320	O00219	HAS3_HUMAN	hyaluronan synthase 3 isoform a	548	Extracellular (Potential).				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GCAGTACAGCTTGGCTTTTGC	0.443													20	109	---	---	---	---	PASS
SPG7	6687	broad.mit.edu	37	16	89616876	89616876	+	Intron	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89616876C>A	uc002fnj.2	+						SPG7_uc002fnk.1_Intron|SPG7_uc002fnl.2_5'UTR	NM_003119	NP_003110	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 isoform 1						cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		ccaccgcgcccAACTCATACC	0.254													16	69	---	---	---	---	PASS
DBNDD1	79007	broad.mit.edu	37	16	90076458	90076458	+	Intron	SNP	T	C	C			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90076458T>C	uc002fqf.1	-						DBNDD1_uc002fqe.1_5'UTR|DBNDD1_uc002fqg.1_Intron	NM_001042610	NP_001036075	Q9H9R9	DBND1_HUMAN	dysbindin (dystrobrevin binding protein 1)							cytoplasm					0		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)		TCTCCCATGtttatttatttt	0.244													21	88	---	---	---	---	PASS
NUP88	4927	broad.mit.edu	37	17	5322749	5322749	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5322749T>A	uc002gbo.1	-	1	248	c.222A>T	c.(220-222)GAA>GAT	p.E74D	NUP88_uc010vsx.1_Missense_Mutation_p.E74D|NUP88_uc010cle.1_Missense_Mutation_p.E74D|NUP88_uc010vsy.1_Missense_Mutation_p.E74D|RPAIN_uc010vsz.1_5'Flank|RPAIN_uc002gbp.1_5'Flank|RPAIN_uc010vta.1_5'Flank|RPAIN_uc002gbq.2_5'Flank|RPAIN_uc010vtb.1_5'Flank|RPAIN_uc002gbs.2_5'Flank|RPAIN_uc002gbt.2_5'Flank|RPAIN_uc002gbu.2_5'Flank|RPAIN_uc002gbv.2_5'Flank|RPAIN_uc002gbr.2_5'Flank|RPAIN_uc002gbw.2_5'Flank	NM_002532	NP_002523	Q99567	NUP88_HUMAN	nucleoporin 88kDa	74					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1						AGGAGCTGTCTTCTCCGTCCC	0.627													26	121	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36486397	36486397	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36486397G>T	uc002hpz.2	-	11	3076	c.3055C>A	c.(3055-3057)CAC>AAC	p.H1019N		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1019	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GGGGAGTGGTGGCCTCGCTCT	0.617													26	103	---	---	---	---	PASS
EIF1	10209	broad.mit.edu	37	17	39846142	39846142	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39846142A>T	uc002hxj.2	+	2	308	c.144A>T	c.(142-144)CAA>CAT	p.Q48H	JUP_uc010wfs.1_Intron|EIF1_uc002hxk.2_Intron	NM_005801	NP_005792	P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1	48					regulation of translational initiation|response to stress	cytoplasm	translation initiation factor activity				0		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CTACTGTCCAAGGGATCGCTG	0.413											OREG0024409	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	90	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	6311557	6311557	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6311557C>T	uc002kmz.3	-	3	228	c.68G>A	c.(67-69)CGC>CAC	p.R23H	L3MBTL4_uc010dkt.2_Missense_Mutation_p.R23H	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4	23					chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				TCTTACCAAGCGTCCGTCCTG	0.498													93	411	---	---	---	---	PASS
APC2	10297	broad.mit.edu	37	19	1467881	1467881	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1467881C>G	uc002lsr.1	+	15	4789	c.4581C>G	c.(4579-4581)CAC>CAG	p.H1527Q	APC2_uc002lss.1_Missense_Mutation_p.H1109Q|APC2_uc002lst.1_Missense_Mutation_p.H1527Q|APC2_uc002lsu.1_Missense_Mutation_p.H1526Q|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	1527	Interaction with CTNNB1.|5 X 20 AA approximate repeat of F-X-V-E- X-T-P-X-C-F-S-R-X-S-S-L-S-S-L-S.|Pro-rich.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCAACCCACCGGCGCACAT	0.726													8	24	---	---	---	---	PASS
OR7A10	390892	broad.mit.edu	37	19	14952548	14952548	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14952548C>T	uc002mzx.1	-	1	142	c.142G>A	c.(142-144)GCC>ACC	p.A48T		NM_001005190	NP_001005190	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A,	48	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					GAGATTGTGGCCAGGATGATG	0.527													21	110	---	---	---	---	PASS
JAK3	3718	broad.mit.edu	37	19	17945490	17945490	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17945490G>T	uc002nhn.3	-	17	2340	c.2240C>A	c.(2239-2241)CCC>CAC	p.P747H	JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Missense_Mutation_p.P747H	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	747	Protein kinase 1.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						TGTCCACTTGGGGGCCGGCAG	0.587		2	Mis		acute megakaryocytic leukemia|								16	108	---	---	---	---	PASS
ZNF880	400713	broad.mit.edu	37	19	52887959	52887959	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52887959G>T	uc002pzc.2	+	4	1175	c.1126G>T	c.(1126-1128)GGA>TGA	p.G376*		NM_001145434	NP_001138906	Q6PDB4	ZN880_HUMAN	zinc finger protein LOC400713	376					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATCCATACTGGAGAGAAACC	0.388													3	47	---	---	---	---	PASS
PLUNC	51297	broad.mit.edu	37	20	31825651	31825651	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31825651C>A	uc002wyv.2	+	2	204	c.134C>A	c.(133-135)ACA>AAA	p.T45K	PLUNC_uc002wyt.3_Missense_Mutation_p.T45K|PLUNC_uc002wyu.3_Missense_Mutation_p.T45K	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated	45					innate immune response	extracellular region	lipid binding				0						TTGAGTCCCACAGGTCTTGCA	0.418													4	141	---	---	---	---	PASS
STX16	8675	broad.mit.edu	37	20	57251366	57251366	+	3'UTR	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57251366G>T	uc002xzi.2	+	9					STX16_uc010zzq.1_3'UTR|STX16_uc002xzk.2_3'UTR|STX16_uc002xzm.2_3'UTR|STX16_uc002xzj.2_3'UTR|STX16_uc002xzl.2_3'UTR	NM_001001433	NP_001001433	O14662	STX16_HUMAN	syntaxin 16 isoform a						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity			ovary(1)	1	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			GGGTTTTCGTGTGTGCCGCGC	0.567													27	125	---	---	---	---	PASS
KRTAP12-1	353332	broad.mit.edu	37	21	46101867	46101867	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46101867C>T	uc002zfv.2	-	1	212	c.172G>A	c.(172-174)GTG>ATG	p.V58M	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_181686	NP_859014	P59990	KR121_HUMAN	keratin associated protein 12-1	58	8.|14 X 5 AA approximate repeats.					keratin filament				skin(2)	2						CTGCAGCTCACGGGCACGCAC	0.657													8	95	---	---	---	---	PASS
ADARB1	104	broad.mit.edu	37	21	46642103	46642103	+	Silent	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46642103C>A	uc002zgy.2	+	12	2652	c.2217C>A	c.(2215-2217)CTC>CTA	p.L739L	ADARB1_uc002zgr.2_Intron|ADARB1_uc002zgs.2_RNA|ADARB1_uc002zgw.2_Intron|ADARB1_uc002zgv.2_RNA|ADARB1_uc002zgt.2_Silent_p.L699L|ADARB1_uc010gpx.2_RNA|ADARB1_uc002zgq.2_RNA|ADARB1_uc002zgu.2_RNA	NM_015833	NP_056648	P78563	RED1_HUMAN	RNA-specific adenosine deaminase B1 isoform 2	739					adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding			skin(1)	1				Colorectal(79;0.115)		AGTTCTCACTCACGCCCTGAC	0.647													6	29	---	---	---	---	PASS
CLTCL1	8218	broad.mit.edu	37	22	19184099	19184099	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19184099C>A	uc002zpb.2	-	26	4017	c.3942G>T	c.(3940-3942)ATG>ATT	p.M1314I	CLTCL1_uc011agv.1_Missense_Mutation_p.M1314I|CLTCL1_uc011agw.1_Missense_Mutation_p.M1293I|CLTCL1_uc011agt.1_Missense_Mutation_p.M105I|CLTCL1_uc011agu.1_Missense_Mutation_p.M105I|CLTCL1_uc010grm.1_Missense_Mutation_p.M74I|CLTCL1_uc002zpe.2_3'UTR|CLTCL1_uc002zpd.1_Missense_Mutation_p.M221I	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1	1314	Involved in binding clathrin light chain (By similarity).|Proximal segment.|Heavy chain arm.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					TGAACATGCCCATGTGGGCCC	0.577			T	?	ALCL								7	18	---	---	---	---	PASS
LIMK2	3985	broad.mit.edu	37	22	31674310	31674310	+	Silent	SNP	C	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31674310C>A	uc003akh.2	+	16	1945	c.1800C>A	c.(1798-1800)TCC>TCA	p.S600S	LIMK2_uc003aki.2_Silent_p.S354S|LIMK2_uc003akk.2_Silent_p.S579S|LIMK2_uc011aln.1_Silent_p.S517S	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	600	Protein kinase.					mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						TGGAGGACTCCTTTGAGGCCC	0.433													105	449	---	---	---	---	PASS
H1F0	3005	broad.mit.edu	37	22	38201647	38201647	+	Silent	SNP	C	T	T	rs151035348		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38201647C>T	uc003aty.2	+	1	534	c.96C>T	c.(94-96)ATC>ATT	p.I32I	GCAT_uc003atz.2_5'Flank|GCAT_uc003aua.1_5'Flank	NM_005318	NP_005309	P07305	H10_HUMAN	H1 histone family, member 0	32	H15.				DNA fragmentation involved in apoptotic nuclear change|nucleosome assembly	actin cytoskeleton|Golgi apparatus|nucleoplasm|nucleosome	DNA binding				0	Melanoma(58;0.045)					CAGACATGATCGTGGCTGCCA	0.592													18	93	---	---	---	---	PASS
RPS4X	6191	broad.mit.edu	37	X	71493721	71493721	+	Silent	SNP	G	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71493721G>T	uc004ear.2	-	5	558	c.462C>A	c.(460-462)ATC>ATA	p.I154I	RPS4X_uc011mqb.1_3'UTR	NM_001007	NP_000998	P62701	RS4X_HUMAN	ribosomal protein S4, X-linked X isoform	154					endocrine pancreas development|positive regulation of cell proliferation|positive regulation of translation|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0	Renal(35;0.156)					CATTCACCTTGATGAGGGGAT	0.483													3	40	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117707866	117707866	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117707866G>A	uc004eqp.2	+	12	1337	c.1274G>A	c.(1273-1275)CGT>CAT	p.R425H	DOCK11_uc004eqq.2_Missense_Mutation_p.R191H	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	425					blood coagulation	cytosol	GTP binding			ovary(3)	3						CCATCTGTCCGTGAAATGCTG	0.448													5	160	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9991	9991	+	5'Flank	SNP	A	G	G			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9991A>G	uc004cov.3	+						uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens potential LAG1 interactor mRNA, partial cds.																		ATGAGGGTCTTACTCTTTTAG	0.348													2	4	---	---	---	---	PASS
SDF4	51150	broad.mit.edu	37	1	1158534	1158535	+	Intron	INS	-	AC	AC			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1158534_1158535insAC	uc001adh.3	-						SDF4_uc001adg.2_5'Flank|SDF4_uc001adi.3_Intron|SDF4_uc009vjv.2_Intron|SDF4_uc009vjw.2_Intron|SDF4_uc001adj.1_3'UTR	NM_016176	NP_057260	Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4 isoform 2						cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding			upper_aerodigestive_tract(1)|large_intestine(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		actcatacacgacacacacggc	0.168													8	5	---	---	---	---	
PRKCZ	5590	broad.mit.edu	37	1	1988167	1988167	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1988167delA	uc001aiq.2	+							NM_002744	NP_002735	Q05513	KPCZ_HUMAN	protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)		tttttctttgacttttttttt	0.174													4	2	---	---	---	---	
TARDBP	23435	broad.mit.edu	37	1	11077260	11077260	+	Intron	DEL	T	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11077260delT	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		GTTACCtttcttttttttttt	0.025													4	3	---	---	---	---	
CROCCL1	84809	broad.mit.edu	37	1	16960912	16960913	+	Intron	DEL	GC	-	-	rs58743071	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16960912_16960913delGC	uc001azg.1	-						CROCCL1_uc001azf.2_5'Flank|CROCCL1_uc001azi.1_Intron|uc001azj.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0						gtgtgtgtgtgcgcgtgtgtgA	0.109													4	2	---	---	---	---	
EYA3	2140	broad.mit.edu	37	1	28316444	28316445	+	Intron	DEL	TA	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28316444_28316445delTA	uc001bpi.1	-						EYA3_uc010ofs.1_Intron|EYA3_uc010oft.1_Intron|EYA3_uc001bpj.2_Intron|EYA3_uc001bpk.1_Intron|EYA3_uc010ofu.1_Intron	NM_001990	NP_001981	Q99504	EYA3_HUMAN	eyes absent 3						anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		TGAGTATGTTtatatatatata	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33601715	33601722	+	IGR	DEL	CCTTCCTT	-	-	rs112467974		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33601715_33601722delCCTTCCTT								ADC (15584 upstream) : TRIM62 (9282 downstream)																							AGGGGCCAGCccttccttccttccttcc	0.274													6	3	---	---	---	---	
NTNG1	22854	broad.mit.edu	37	1	107805968	107805968	+	Intron	DEL	T	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107805968delT	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		cctttttttcttTTTTTTTCC	0.184													4	2	---	---	---	---	
TOR3A	64222	broad.mit.edu	37	1	179064560	179064561	+	3'UTR	INS	-	AGAT	AGAT	rs145389283	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179064560_179064561insAGAT	uc001gmd.2	+	6					TOR3A_uc010pnd.1_3'UTR	NM_022371	NP_071766	Q9H497	TOR3A_HUMAN	torsin family 3, member A precursor						chaperone mediated protein folding requiring cofactor	endoplasmic reticulum	ATP binding			pancreas(1)	1						aggtcccaccgagatagatagg	0.327													4	6	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	216824065	216824066	+	Intron	INS	-	ACT	ACT	rs11572711		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216824065_216824066insACT	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AAGATAAAAGCACTACGGTCAA	0.401													4	2	---	---	---	---	
KIF26B	55083	broad.mit.edu	37	1	245775394	245775409	+	Intron	DEL	GTGTGTGTGTGTGTGA	-	-	rs56802914	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245775394_245775409delGTGTGTGTGTGTGTGA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron|KIF26B_uc001ibg.1_Intron	NM_018012	NP_060482	Q2KJY2	KI26B_HUMAN	kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			gtgtgtgtgtgtgtgtgtgtgtgtgagagagagaga	0.181													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	247622015	247622016	+	IGR	DEL	GT	-	-	rs147013127	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247622015_247622016delGT								OR2B11 (6731 upstream) : OR2W5 (32414 downstream)																							CTGgtgtgtggtgtgtgtgtgt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10356283	10356284	+	IGR	INS	-	GGAA	GGAA			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10356283_10356284insGGAA								C2orf48 (4427 upstream) : HPCAL1 (86756 downstream)																							gaaaaggaaagggaaggaagga	0.139													5	5	---	---	---	---	
GGCX	2677	broad.mit.edu	37	2	85781577	85781578	+	Intron	INS	-	TTGTTGTTG	TTGTTGTTG	rs145024834	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85781577_85781578insTTGTTGTTG	uc002sps.2	-						GGCX_uc010yss.1_Intron|GGCX_uc010yst.1_Intron	NM_000821	NP_000812	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase isoform 1						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane|membrane fraction	gamma-glutamyl carboxylase activity			ovary(1)	1					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|L-Glutamic Acid(DB00142)|Menadione(DB00170)|Phytonadione(DB01022)	CTCTAGgttgtttgttgttgtt	0.233													5	3	---	---	---	---	
IL1B	3553	broad.mit.edu	37	2	113596300	113596301	+	5'Flank	INS	-	TTTCTTTC	TTTCTTTC	rs11297581		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113596300_113596301insTTTCTTTC	uc002tii.1	-							NM_000576	NP_000567	P01584	IL1B_HUMAN	interleukin 1, beta proprotein						activation of MAPK activity|anti-apoptosis|apoptosis|cell-cell signaling|cellular response to drug|cellular response to mechanical stimulus|cytokine-mediated signaling pathway|embryo implantation|fever generation|negative regulation of adiponectin secretion|negative regulation of cell proliferation|negative regulation of glucose transport|negative regulation of insulin receptor signaling pathway|negative regulation of lipid catabolic process|negative regulation of MAP kinase activity|positive regulation of angiogenesis|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of cell adhesion molecule production|positive regulation of cell division|positive regulation of fever generation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of heterotypic cell-cell adhesion|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of interferon-gamma production|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of lipid catabolic process|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mitosis|positive regulation of monocyte chemotactic protein-1 production|positive regulation of myosin light chain kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|positive regulation of protein export from nucleus|positive regulation of T cell proliferation|positive regulation vascular endothelial growth factor production|regulation of insulin secretion|sequestering of triglyceride|smooth muscle adaptation	cytosol|extracellular space	cytokine activity|growth factor activity|interleukin-1 receptor binding|protein domain specific binding			lung(3)|breast(1)	4					Anakinra(DB00026)|Minocycline(DB01017)|Procaterol(DB01366)	ctttcttttcttttctttcttt	0.109													5	3	---	---	---	---	
PHLDB2	90102	broad.mit.edu	37	3	111574252	111574255	+	Intron	DEL	CTTC	-	-	rs142542788		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111574252_111574255delCTTC	uc003dyc.2	+							NM_001134437	NP_001127909	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						CTCTCTctttcttccttccttcct	0.191													6	3	---	---	---	---	
DNAJC13	23317	broad.mit.edu	37	3	132193659	132193660	+	Intron	DEL	CC	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132193659_132193660delCC	uc003eor.2	+							NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						AAAATCTATTCCCCCCCCCCCC	0.198													6	5	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41421683	41421683	+	Intron	DEL	T	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41421683delT	uc003gvu.3	+						LIMCH1_uc003gvt.1_Intron|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						ccttccttccttccttccttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49104557	49104558	+	IGR	INS	-	GGATG	GGATG			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49104557_49104558insGGATG								CWH43 (40464 upstream) : None (None downstream)																							cattccattccattccattcca	0.000													4	2	---	---	---	---	
HPSE	10855	broad.mit.edu	37	4	84231513	84231514	+	Intron	INS	-	T	T	rs141868874		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84231513_84231514insT	uc003hoj.3	-						HPSE_uc010ika.2_Intron|HPSE_uc011ccq.1_Intron|HPSE_uc011ccr.1_Intron|HPSE_uc011ccs.1_Intron|HPSE_uc011cct.1_Intron|HPSE_uc003hok.3_Intron	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor						carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	CAGAGAGAATCTTTTTTTTTTT	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	157439123	157439126	+	IGR	DEL	GGAG	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157439123_157439126delGGAG								CTSO (564075 upstream) : PDGFC (243638 downstream)																							aggaaggaaaggagggagggaggg	0.118													5	3	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70828418	70828421	+	Intron	DEL	TTTG	-	-	rs34000891		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70828418_70828421delTTTG	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron|BDP1_uc003kbr.1_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAGCAATGATTTTGTTTGTTTGTG	0.279													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	92941957	92941958	+	IGR	INS	-	AC	AC	rs77593669		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92941957_92941958insAC								NR2F1 (12179 upstream) : FAM172A (11474 downstream)																							TATTTAACAAGacacacacaca	0.317													4	3	---	---	---	---	
DCP2	167227	broad.mit.edu	37	5	112328171	112328171	+	Intron	DEL	T	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112328171delT	uc003kqh.2	+						DCP2_uc011cwa.1_Intron|DCP2_uc010jcc.2_Intron	NM_152624	NP_689837	Q8IU60	DCP2_HUMAN	DCP2 decapping enzyme						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus|RNA-induced silencing complex	exoribonuclease activity, producing 5'-phosphomonoesters|manganese ion binding|protein binding|protein binding|RNA binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		TGTTGAAGACTTTTTTTTTTT	0.348													4	2	---	---	---	---	
NSD1	64324	broad.mit.edu	37	5	176634907	176634908	+	Intron	DEL	GT	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176634907_176634908delGT	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		tgtccagctagtgtgtgtgtgt	0.000			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			4	3	---	---	---	---	
PGM3	5238	broad.mit.edu	37	6	83900377	83900377	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83900377delA	uc003pjv.2	-						PGM3_uc003pjw.2_Intron|PGM3_uc011dyz.1_Intron|RWDD2A_uc003pjx.3_5'Flank|RWDD2A_uc011dza.1_5'Flank	NM_015599	NP_056414	O95394	AGM1_HUMAN	phosphoglucomutase 3						dolichol-linked oligosaccharide biosynthetic process|embryo development ending in birth or egg hatching|glucose 1-phosphate metabolic process|hemopoiesis|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	magnesium ion binding|phosphoacetylglucosamine mutase activity|phosphoglucomutase activity				0		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		TCATGCTCTTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	104346664	104346675	+	IGR	DEL	AGGAAGGAAGGA	-	-	rs7748915		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104346664_104346675delAGGAAGGAAGGA								None (None upstream) : HACE1 (829293 downstream)																							ggagggagggaggaaggaaggaaggaaggaag	0.000													4	2	---	---	---	---	
EIF3B	8662	broad.mit.edu	37	7	2406291	2406291	+	Intron	DEL	T	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2406291delT	uc003slx.2	+						EIF3B_uc003sly.2_Intron|EIF3B_uc003sma.2_Intron	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GTGTGGTGCCTTTCCTTATTT	0.532													29	13	---	---	---	---	
RAC1	5879	broad.mit.edu	37	7	6442157	6442157	+	3'UTR	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6442157delA	uc003spx.2	+	6					RAC1_uc003spw.2_3'UTR	NM_006908	NP_008839	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1						actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)	aaaaaaaaacaaaaaaaaaaa	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	29729591	29729592	+	Intron	DEL	AC	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29729591_29729592delAC	uc003tah.1	+											Homo sapiens DPY-19-like 2 pseudogene 3 (DPY19L2P3) pseudogene mRNA, complete sequence.																		GTGTTTGCATACACACACACAC	0.272													4	2	---	---	---	---	
GBAS	2631	broad.mit.edu	37	7	56031481	56031483	+	5'Flank	DEL	TCC	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56031481_56031483delTCC	uc003tre.1	+						GBAS_uc003trf.1_5'Flank	NM_001483	NP_001474	O75323	NIPS2_HUMAN	nipsnap homolog 2							integral to plasma membrane|membrane fraction|mitochondrion	protein binding			central_nervous_system(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ctcccttccttcctcctttcttt	0.044													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65226819	65226819	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226819delA	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		AATGGGGACCAAAAAAAAAAT	0.353													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	88269890	88269891	+	IGR	INS	-	T	T	rs113056340		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88269890_88269891insT								STEAP4 (333681 upstream) : ZNF804B (118862 downstream)																							AGAAGGAGCACTTTTTTTTTTT	0.248													4	2	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100230357	100230357	+	Intron	DEL	G	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100230357delG	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					aaaaaaaaaagaacctttttt	0.000													6	6	---	---	---	---	
POT1	25913	broad.mit.edu	37	7	124537448	124537448	+	Intron	DEL	A	-	-	rs11349684		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124537448delA	uc003vlm.2	-						POT1_uc011koe.1_Intron|POT1_uc003vlk.2_Intron|POT1_uc003vll.2_Intron|POT1_uc003vlo.2_Intron|POT1_uc003vln.2_Intron	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1						DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						ACAGAAACTTAAAAAAAAAAG	0.274													4	3	---	---	---	---	
CSGALNACT1	55790	broad.mit.edu	37	8	19265979	19265980	+	Intron	INS	-	T	T	rs72443837		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19265979_19265980insT	uc011kyn.1	-						CSGALNACT1_uc011kyo.1_Intron|CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		tcTGGAATAGCttttttttttt	0.203													4	3	---	---	---	---	
ADAM32	203102	broad.mit.edu	37	8	39009194	39009195	+	Intron	INS	-	T	T	rs67270213		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39009194_39009195insT	uc003xmt.3	+						ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			AACATCTTATCttttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49826831	49826831	+	IGR	DEL	A	-	-	rs141577976		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49826831delA								EFCAB1 (178961 upstream) : SNAI2 (3408 downstream)																							ggaaaaaggcaaaaaaaAAAa	0.070													6	3	---	---	---	---	
CCNE2	9134	broad.mit.edu	37	8	95897955	95897955	+	Intron	DEL	C	-	-	rs75264984	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95897955delC	uc003yhc.2	-						CCNE2_uc003yhd.2_Intron	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2						cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)					CAttttctttctttttttttt	0.055													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125757979	125757982	+	IGR	DEL	TCCC	-	-	rs11783009		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125757979_125757982delTCCC								MTSS1 (17249 upstream) : LOC157381 (193902 downstream)																							cttccttccttccctccctccctc	0.049													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131179561	131179561	+	Intron	DEL	A	-	-	rs111521624		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131179561delA	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						aagaaaaaagaaaaaaaaaaa	0.174													9	6	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139603869	139603870	+	Intron	DEL	CT	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139603869_139603870delCT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTAAACCACCCTGAGCACACAC	0.465										HNSCC(7;0.00092)			4	7	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143353608	143353615	+	Intron	DEL	TCCACCTG	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143353608_143353615delTCCACCTG	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					catctacccatccacctgcccgtctaca	0.058													4	2	---	---	---	---	
CA9	768	broad.mit.edu	37	9	35677613	35677613	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35677613delA	uc003zxo.3	+						C9orf100_uc003zxl.2_5'Flank|CA9_uc003zxp.3_Intron	NM_001216	NP_001207	Q16790	CAH9_HUMAN	carbonic anhydrase IX precursor						one-carbon metabolic process	integral to membrane|microvillus membrane|nucleolus	carbonate dehydratase activity|zinc ion binding			ovary(4)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CACTGTCTCTAAAAAAAAAAA	0.393													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	79183353	79183360	+	IGR	DEL	AAGGAAGA	-	-	rs71354664		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79183353_79183360delAAGGAAGA								GCNT1 (61023 upstream) : PRUNE2 (42933 downstream)																							ggaaggaaggaaggaagaaaggaaggaa	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3325617	3325624	+	IGR	DEL	TTCTTTCC	-	-	rs72763757		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3325617_3325624delTTCTTTCC								PITRM1 (110614 upstream) : KLF6 (492565 downstream)																							ctttctttctttctttccttccttcctt	0.000													4	2	---	---	---	---	
PRPF18	8559	broad.mit.edu	37	10	13645295	13645297	+	Intron	DEL	GGT	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13645295_13645297delGGT	uc001imp.2	+						PRPF18_uc001imq.2_Intron	NM_003675	NP_003666	Q99633	PRP18_HUMAN	PRP18 pre-mRNA processing factor 18 homolog						mRNA processing|RNA splicing	nuclear speck|spliceosomal complex				central_nervous_system(1)	1						TTTTGGGGGAggtggtggtggtg	0.232													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	43063100	43063101	+	IGR	INS	-	A	A	rs34202394		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43063100_43063101insA								ZNF37B (14820 upstream) : ZNF33B (6532 downstream)																							TTTGGAGCCAGAAAAAAAAAAA	0.218													6	4	---	---	---	---	
PARVA	55742	broad.mit.edu	37	11	12499254	12499255	+	Intron	INS	-	C	C	rs148790777	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12499254_12499255insC	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692	Q9NVD7	PARVA_HUMAN	parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)		acatagtgagaccccatctcaa	0.109													10	5	---	---	---	---	
SLC35F2	54733	broad.mit.edu	37	11	107686320	107686320	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107686320delA	uc001pjq.2	-						SLC35F2_uc010rvu.1_Intron|SLC35F2_uc001pjs.2_Intron	NM_017515	NP_059985	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2						transport	integral to membrane				central_nervous_system(1)	1		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		acacacacacaaaaaaaaaaa	0.149													4	3	---	---	---	---	
ZBTB16	7704	broad.mit.edu	37	11	114106514	114106514	+	Intron	DEL	T	-	-	rs2511238		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114106514delT	uc001pop.2	+						ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997	Q05516	ZBT16_HUMAN	promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		ttccttcTCCTTTTTTTTTTT	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	118830736	118830739	+	IGR	DEL	AAGC	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118830736_118830739delAAGC								UPK2 (1468 upstream) : FOXR1 (11678 downstream)																							gagagagagaaagcaagcaagcaa	0.059													5	4	---	---	---	---	
KDM5A	5927	broad.mit.edu	37	12	415910	415910	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:415910delA	uc001qif.1	-						KDM5A_uc001qie.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						ctccatctccaaaaaaaaaaa	0.124			T 	NUP98	AML								6	3	---	---	---	---	
METTL7A	25840	broad.mit.edu	37	12	51324058	51324058	+	3'UTR	DEL	T	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51324058delT	uc001rxb.2	+	2					METTL7A_uc010smv.1_3'UTR	NM_014033	NP_054752	Q9H8H3	MET7A_HUMAN	methyltransferase like 7A precursor							endoplasmic reticulum|lipid particle|membrane	methyltransferase activity				0						TTGTTGTTGGttttttttttt	0.179													5	3	---	---	---	---	
PDE1B	5153	broad.mit.edu	37	12	54967640	54967641	+	Intron	INS	-	GA	GA	rs142403478	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54967640_54967641insGA	uc001sgd.1	+						PDE1B_uc010soz.1_Intron|PDE1B_uc010spa.1_Intron|PDE1B_uc001sgf.2_Intron|PDE1B_uc001sge.2_Intron|PDE1B_uc009znq.2_Intron	NM_000924	NP_000915	Q01064	PDE1B_HUMAN	phosphodiesterase 1B isoform 1						activation of phospholipase C activity|apoptosis|nerve growth factor receptor signaling pathway|platelet activation	cytosol|nucleus	3',5'-cyclic-AMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						CATCTCTATGTGAGAGAGAGAG	0.342													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55516330	55516330	+	IGR	DEL	T	-	-	rs111880775		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55516330delT								NEUROD4 (92530 upstream) : OR9K2 (7223 downstream)																							ttttgtcgaatttttttttct	0.000													4	2	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	70970258	70970258	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70970258delA	uc001swb.3	-	9	2122	c.2092delT	c.(2092-2094)TCCfs	p.S698fs	PTPRB_uc010sto.1_Frame_Shift_Del_p.S698fs|PTPRB_uc010stp.1_Frame_Shift_Del_p.S608fs|PTPRB_uc001swc.3_Frame_Shift_Del_p.S916fs|PTPRB_uc001swa.3_Intron|PTPRB_uc001swd.3_Frame_Shift_Del_p.S915fs|PTPRB_uc009zrr.1_Frame_Shift_Del_p.S795fs	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	698	Fibronectin type-III 8.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GAGCTGAAGGAACATTCTCTG	0.522													10	7	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72271279	72271280	+	Intron	DEL	CC	-	-	rs11178976	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72271279_72271280delCC	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						tcctgtttttccttccttcctt	0.000													3	4	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													4	3	---	---	---	---	
RNF34	80196	broad.mit.edu	37	12	121858152	121858152	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121858152delA	uc001ual.1	+						RNF34_uc001uak.1_Intron|RNF34_uc001uam.1_Intron	NM_025126	NP_079402	Q969K3	RNF34_HUMAN	ring finger protein 34 isoform 2						apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		GGCCACCTATAAAATTTGGTT	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850045	112850048	+	IGR	DEL	CCCC	-	-	rs112803567		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850045_112850048delCCCC								SOX1 (124025 upstream) : C13orf28 (180621 downstream)																							tctttcctttcccccttcctccct	0.020													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21622710	21622711	+	IGR	DEL	GA	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21622710_21622711delGA								ZNF219 (49847 upstream) : OR5AU1 (386 downstream)																							ctcgggggtggagagagagaga	0.020													6	4	---	---	---	---	
AKAP6	9472	broad.mit.edu	37	14	33294193	33294194	+	Intron	INS	-	A	A	rs144813756	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33294193_33294194insA	uc001wrq.2	+							NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TGAAGCAAAAGAAAAAAAAAAC	0.322													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95043934	95043935	+	IGR	INS	-	ATGG	ATGG	rs34159327		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95043934_95043935insATGG								SERPINA4 (7693 upstream) : SERPINA5 (3796 downstream)																							tggatggataaatggatggatg	0.153													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106934205	106934205	+	Intron	DEL	A	-	-	rs35485687		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106934205delA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						ctaaaaagtgaaaaaaaaaaa	0.204													5	4	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10776187	10776188	+	Intron	INS	-	T	T	rs142893480	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10776187_10776188insT	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						gtcctttattcttttttttttg	0.248													5	5	---	---	---	---	
CLEC18A	348174	broad.mit.edu	37	16	69988604	69988605	+	Intron	INS	-	T	T			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69988604_69988605insT	uc010vlo.1	+						CLEC18C_uc002exy.2_Intron|CLEC18A_uc002exz.2_Intron|CLEC18A_uc002eya.2_Intron|CLEC18A_uc010vlp.1_Intron	NM_001136214	NP_001129686	A5D8T8	CL18A_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						TTTAGttttacttttttttttt	0.223													3	3	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74394379	74394380	+	Intron	INS	-	A	A	rs142790741	by1000genomes	TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394379_74394380insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TAGTCATCCTTAAACAAAATTC	0.327													2	4	---	---	---	---	
KLHL36	79786	broad.mit.edu	37	16	84691436	84691436	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84691436delG	uc002fig.2	+	3	1164	c.1023delG	c.(1021-1023)GCGfs	p.A341fs	KLHL36_uc010chl.2_Frame_Shift_Del_p.A340fs	NM_024731	NP_079007	Q8N4N3	KLH36_HUMAN	kelch-like 36	341	Kelch 1.									skin(2)	2						ACTGTGTCGCGGTGCTGGGGG	0.637													31	14	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20139969	20139969	+	Intron	DEL	T	-	-	rs67335487		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20139969delT	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Intron|CYTSB_uc002gwt.2_Intron|CYTSB_uc002gwu.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						GCAGTCTGGCttttttttttt	0.423													6	3	---	---	---	---	
ARHGAP27	201176	broad.mit.edu	37	17	43481096	43481096	+	Intron	DEL	G	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43481096delG	uc002iix.2	-						ARHGAP27_uc010dak.2_Intron|ARHGAP27_uc010wjl.1_Intron	NM_199282	NP_954976	Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27 isoform a						positive regulation of Cdc42 GTPase activity|receptor-mediated endocytosis|signal transduction	cytoplasm|membrane	Rac GTPase activator activity|SH3 domain binding				0	Renal(3;0.0405)					GTGGGGAAGTGGGGGTGGCAG	0.488													52	25	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393860	77393861	+	IGR	INS	-	TGCTGCTGA	TGCTGCTGA			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393860_77393861insTGCTGCTGA								NFATC1 (104538 upstream) : CTDP1 (45940 downstream)																							agtggtggtggtggtgatggtg	0.000													3	3	---	---	---	---	
MED16	10025	broad.mit.edu	37	19	871768	871774	+	Intron	DEL	GGGGAGA	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:871768_871774delGGGGAGA	uc002lqd.1	-						MED16_uc010drw.1_Intron|MED16_uc002lqe.2_Intron|MED16_uc002lqf.2_Intron	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		agaggggagcggggagaggggagaggg	0.024													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8230724	8230724	+	IGR	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8230724delA								FBN3 (18343 upstream) : LASS4 (43493 downstream)																							ggaaggaaagaaaggaaggga	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	39477045	39477060	+	IGR	DEL	TCTTTCCTTCTTTCTC	-	-	rs76176945		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39477045_39477060delTCTTTCCTTCTTTCTC								FBXO17 (10665 upstream) : FBXO27 (37604 downstream)																							ttcttttctttctttccttctttctctctttccttc	0.028													7	4	---	---	---	---	
POU2F2	5452	broad.mit.edu	37	19	42595752	42595753	+	Intron	DEL	GA	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42595752_42595753delGA	uc002osp.2	-						POU2F2_uc002osn.2_Intron|POU2F2_uc002oso.2_Intron|POU2F2_uc002osq.2_Intron	NM_002698	NP_002689	P09086	PO2F2_HUMAN	POU domain, class 2, transcription factor 2						humoral immune response|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2		Prostate(69;0.059)				GGCTGGCGGGGAGAGAGAGAGG	0.688													4	2	---	---	---	---	
LIG1	3978	broad.mit.edu	37	19	48636047	48636048	+	Intron	INS	-	AAAAAAAAAAA	AAAAAAAAAAA			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48636047_48636048insAAAAAAAAAAA	uc002pia.1	-						LIG1_uc010xze.1_Intron|LIG1_uc002phz.1_Intron|LIG1_uc002pib.1_Intron|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Intron	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	gactctgtctcaaaaaaaaaaa	0.218								NER					9	4	---	---	---	---	
ADRA1D	146	broad.mit.edu	37	20	4208360	4208361	+	Intron	INS	-	C	C	rs5840025		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4208360_4208361insC	uc002wkr.2	-							NM_000678	NP_000669	P25100	ADA1D_HUMAN	alpha-1D-adrenergic receptor						cell proliferation|cell-cell signaling|DNA metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|multicellular organismal development|positive regulation of cell proliferation	integral to plasma membrane	alpha1-adrenergic receptor activity				0					Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Methotrimeprazine(DB01403)|Norepinephrine(DB00368)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)	cctccttccttccttccttcct	0.015													4	3	---	---	---	---	
C20orf186	149954	broad.mit.edu	37	20	31677536	31677536	+	Intron	DEL	C	-	-	rs67782664		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31677536delC	uc010zue.1	+							NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor							cytoplasm|extracellular region	lipid binding				0						CTCCCAAACACCCCCCCCGAG	0.617													4	2	---	---	---	---	
RBPJL	11317	broad.mit.edu	37	20	43944381	43944381	+	Intron	DEL	A	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43944381delA	uc002xns.2	+						RBPJL_uc002xnt.2_Intron	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L						signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				attcagtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57104949	57104949	+	Intron	DEL	T	-	-	rs150113339		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57104949delT	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																		gggcctggagttttttttttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37388193	37388194	+	IGR	INS	-	A	A	rs112036301		TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37388193_37388194insA								RUNX1 (31146 upstream) : SETD4 (18646 downstream)																							ATCTGAGAGAGAAAAAAAAAAA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16419352	16419352	+	IGR	DEL	T	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16419352delT								POTEH (131415 upstream) : OR11H1 (29474 downstream)																							GAATCGACGATTTTTTTTTTG	0.398													3	3	---	---	---	---	
SHROOM4	57477	broad.mit.edu	37	X	50378780	50378781	+	Intron	DEL	AA	-	-			TCGA-BP-5182-01A-01D-1429-08	TCGA-BP-5182-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378780_50378781delAA	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron|SHROOM4_uc004dpf.1_Intron	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GAGGGTAGGCAAAAAAAAAAAA	0.485													4	2	---	---	---	---	
