Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
APITD1	378708	broad.mit.edu	37	1	10502399	10502399	+	Silent	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10502399A>G	uc001are.2	+	5	770	c.354A>G	c.(352-354)TCA>TCG	p.S118S	APITD1_uc001arf.2_Intron|APITD1_uc001arg.2_Intron|APITD1_uc001arh.2_Silent_p.S79S	NM_199294	NP_954988	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1 isoform	118					DNA repair|mitotic prometaphase|transcription initiation, DNA-dependent	chromosome, centromeric region|cytosol|Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		AAAAGAAGTCAGAGGATGGAA	0.408													17	96	---	---	---	---	PASS
UBIAD1	29914	broad.mit.edu	37	1	11345987	11345987	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11345987C>A	uc001asg.2	+	2	1150	c.816C>A	c.(814-816)TTC>TTA	p.F272L		NM_013319	NP_037451	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	272					menaquinone biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrion|nucleus	prenyltransferase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		ACCTGGTCTTCAGCATCCTGG	0.587													67	207	---	---	---	---	PASS
DNTTIP2	30836	broad.mit.edu	37	1	94335433	94335433	+	Silent	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94335433G>T	uc001dqf.2	-	7	2283	c.2245C>A	c.(2245-2247)CGA>AGA	p.R749R	DNTTIP2_uc010otm.1_RNA	NM_014597	NP_055412	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal,	749					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TTCTTCTTTCGGAACTTTTTT	0.333													3	87	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155630682	155630682	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155630682T>A	uc001fln.2	-	11	1181	c.1157A>T	c.(1156-1158)GAA>GTA	p.E386V	YY1AP1_uc001flg.2_Missense_Mutation_p.E125V|YY1AP1_uc010pgg.1_Missense_Mutation_p.E225V|YY1AP1_uc010pgh.1_Missense_Mutation_p.E329V|YY1AP1_uc010pgi.1_Missense_Mutation_p.E478V|YY1AP1_uc001flh.2_Missense_Mutation_p.E458V|YY1AP1_uc009wqt.2_Missense_Mutation_p.E309V|YY1AP1_uc001flk.2_Missense_Mutation_p.E329V|YY1AP1_uc001fll.2_Missense_Mutation_p.E340V|YY1AP1_uc009wqv.2_Missense_Mutation_p.E57V|YY1AP1_uc001flm.2_Missense_Mutation_p.E329V|YY1AP1_uc001fli.2_Missense_Mutation_p.E340V|YY1AP1_uc009wqu.2_Missense_Mutation_p.E173V|YY1AP1_uc001flj.2_Missense_Mutation_p.E320V|YY1AP1_uc009wqw.2_Missense_Mutation_p.E309V|YY1AP1_uc001flo.2_Missense_Mutation_p.E274V|YY1AP1_uc001flp.2_Missense_Mutation_p.E340V|YY1AP1_uc010pgj.1_Nonsense_Mutation_p.K413*	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	386					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CCGCAGTTCTTCCTGGATGGA	0.453													33	80	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220213565	220213565	+	Silent	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220213565G>A	uc001hly.1	-	2	363	c.93C>T	c.(91-93)TCC>TCT	p.S31S	EPRS_uc010puf.1_5'UTR|EPRS_uc001hlz.1_Silent_p.S31S|EPRS_uc009xdt.1_5'UTR	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	31					glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	CTTCTTCAACGGAAATGCTGA	0.284													34	199	---	---	---	---	PASS
CNIH4	29097	broad.mit.edu	37	1	224553688	224553688	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224553688A>G	uc001hom.1	+	3	278	c.246A>G	c.(244-246)ATA>ATG	p.I82M	CNIH4_uc001hon.1_RNA	NM_014184	NP_054903	Q9P003	CNIH4_HUMAN	cornichon homolog 4	82					intracellular signal transduction	endoplasmic reticulum|integral to membrane	protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.00341)		CTTGGAATATATATCGGTGAG	0.294													6	248	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235918806	235918806	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235918806A>C	uc001hxj.2	-	25	7376	c.7201T>G	c.(7201-7203)TTT>GTT	p.F2401V	LYST_uc009xga.1_5'Flank	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	2401					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGTCGACCAAAGAACATTTCG	0.328									Chediak-Higashi_syndrome				49	308	---	---	---	---	PASS
EPAS1	2034	broad.mit.edu	37	2	46587819	46587819	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46587819G>T	uc002ruv.2	+	5	985	c.497G>T	c.(496-498)CGG>CTG	p.R166L		NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	166					angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TCCACAGAGCGGGACTTCTTC	0.493													13	88	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63101502	63101502	+	Silent	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63101502T>C	uc002sby.2	+	11	1607	c.1125T>C	c.(1123-1125)CCT>CCC	p.P375P	EHBP1_uc010fcp.2_Silent_p.P340P|EHBP1_uc002sbz.2_Silent_p.P340P|EHBP1_uc002scb.2_Silent_p.P340P	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	375						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TTTATGAACCTAAATCAACTC	0.353									Hereditary_Prostate_Cancer				3	149	---	---	---	---	PASS
ARHGEF4	50649	broad.mit.edu	37	2	131803571	131803571	+	Intron	SNP	C	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131803571C>G	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_3'UTR|ARHGEF4_uc010fmx.1_Intron|ARHGEF4_uc002tsc.1_Intron	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		GGCACTCTGCCCTGGGCACCC	0.662													11	192	---	---	---	---	PASS
UPP2	151531	broad.mit.edu	37	2	158971713	158971713	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158971713T>C	uc002tzp.2	+	3	475	c.281T>C	c.(280-282)ATC>ACC	p.I94T	UPP2_uc002tzo.2_Missense_Mutation_p.I151T	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a	94					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0						ATAAAAGACATCTGTGCTGGG	0.473													18	116	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166170262	166170262	+	Silent	SNP	T	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166170262T>G	uc002udc.2	+	9	1457	c.1167T>G	c.(1165-1167)CTT>CTG	p.L389L	SCN2A_uc002udd.2_Silent_p.L389L|SCN2A_uc002ude.2_Silent_p.L389L	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	389	I.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	GGGAAAACCTTTATCAACTGG	0.373													28	156	---	---	---	---	PASS
CCDC150	284992	broad.mit.edu	37	2	197511118	197511118	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197511118C>A	uc002utp.1	+	2	201	c.66C>A	c.(64-66)AAC>AAA	p.N22K	CCDC150_uc002uto.1_Missense_Mutation_p.N22K|CCDC150_uc010zgq.1_Intron|CCDC150_uc010zgr.1_RNA|CCDC150_uc010zgs.1_5'UTR	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	22											0						CCCACATCAACGCTACAGCTT	0.373													25	152	---	---	---	---	PASS
GLB1	2720	broad.mit.edu	37	3	33114174	33114174	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33114174T>C	uc003cfi.1	-	2	224	c.107A>G	c.(106-108)TAT>TGT	p.Y36C	GLB1_uc003cfh.1_Missense_Mutation_p.Y6C|GLB1_uc003cfj.1_Missense_Mutation_p.Y36C|GLB1_uc011axk.1_Missense_Mutation_p.Y84C	NM_000404	NP_000395	P16278	BGAL_HUMAN	galactosidase, beta 1 isoform a preproprotein	36					carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)				GTCCCGGCTATAGTCAATTTC	0.522													38	52	---	---	---	---	PASS
PRKCD	5580	broad.mit.edu	37	3	53220309	53220309	+	Missense_Mutation	SNP	G	A	A	rs150331740		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53220309G>A	uc003dgl.2	+	13	1566	c.1213G>A	c.(1213-1215)GCA>ACA	p.A405T	PRKCD_uc003dgm.2_Missense_Mutation_p.A405T	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta	405	Protein kinase.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		GACACTTGCCGCAGAGAATCC	0.592													17	83	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129324730	129324730	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129324730C>A	uc003emx.2	-	1	853	c.753G>T	c.(751-753)AAG>AAT	p.K251N		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	251	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						AGGTGAAGAGCTTGGCCAGGT	0.647													9	29	---	---	---	---	PASS
DGKQ	1609	broad.mit.edu	37	4	954842	954842	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:954842G>C	uc003gbw.2	-	22	2796	c.2722C>G	c.(2722-2724)CCT>GCT	p.P908A	DGKQ_uc010ibn.2_Missense_Mutation_p.P895A	NM_001347	NP_001338	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta	908					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|platelet activation|protein kinase C signaling cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to ATP|thrombin receptor signaling pathway	cytoskeleton|cytosol|nuclear speck|plasma membrane	activating transcription factor binding|ATP binding|diacylglycerol kinase activity|kinase binding|metal ion binding|phospholipase binding			kidney(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CATACCTTAGGGCCAGCAGCT	0.687													7	53	---	---	---	---	PASS
CTBP1	1487	broad.mit.edu	37	4	1206792	1206792	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1206792A>C	uc003gcv.1	-	8	1213	c.1048T>G	c.(1048-1050)TGT>GGT	p.C350G	uc003gcs.1_Intron|CTBP1_uc003gct.1_Missense_Mutation_p.C331G|CTBP1_uc003gcu.1_Missense_Mutation_p.C339G|CTBP1_uc003gcw.2_Missense_Mutation_p.C24G	NM_001328	NP_001319	Q13363	CTBP1_HUMAN	C-terminal binding protein 1 isoform 1	350	Interaction with GLIS2 2 (By similarity).				interspecies interaction between organisms|negative regulation of cell proliferation|negative regulation of histone H4 acetylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|protein phosphorylation|regulation of cell cycle|regulation of transcription by chromatin organization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|viral genome replication|white fat cell differentiation	cytoplasm|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein C-terminus binding|protein domain specific binding|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		TTGTTGACACAGTTCTTCAGG	0.637													15	95	---	---	---	---	PASS
SH3BP2	6452	broad.mit.edu	37	4	2826495	2826495	+	Intron	SNP	G	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2826495G>C	uc003gfi.3	+						SH3BP2_uc010icn.2_3'UTR|SH3BP2_uc011bvp.1_Intron|SH3BP2_uc003gfj.3_Intron|SH3BP2_uc003gfk.3_Intron|SH3BP2_uc003gfl.3_Intron|SH3BP2_uc003gfm.3_5'Flank	NM_001122681	NP_001116153	P78314	3BP2_HUMAN	SH3-domain binding protein 2 isoform a						signal transduction		SH3 domain binding|SH3/SH2 adaptor activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		AGGTGACTGGGGGTGTGGGCC	0.662									Cherubism				6	52	---	---	---	---	PASS
BBS7	55212	broad.mit.edu	37	4	122782609	122782609	+	Intron	SNP	A	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122782609A>C	uc003ied.2	-						BBS7_uc003iee.1_Intron|BBS7_uc010inq.1_Missense_Mutation_p.L87V	NM_176824	NP_789794	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7 protein isoform a						cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding			ovary(1)	1						CATCTATCCAAAATATTATAA	0.274									Bardet-Biedl_syndrome				10	69	---	---	---	---	PASS
SMARCA5	8467	broad.mit.edu	37	4	144474413	144474413	+	3'UTR	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144474413A>G	uc003ijg.2	+	24						NM_003601	NP_003592	O60264	SMCA5_HUMAN	SWI/SNF-related matrix-associated						CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding			skin(1)	1	all_hematologic(180;0.158)					GATGTACTGTACAATGCTCAA	0.303													3	29	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13753411	13753411	+	Silent	SNP	A	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13753411A>T	uc003jfd.2	-	63	10845	c.10803T>A	c.(10801-10803)CCT>CCA	p.P3601P	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3601	AAA 5 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CAATTAACAAAGGGTAACGAG	0.378									Kartagener_syndrome				39	176	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38427321	38427321	+	Missense_Mutation	SNP	G	A	A	rs144065923	byFrequency	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38427321G>A	uc003jlc.1	+	14	2345	c.2021G>A	c.(2020-2022)CGC>CAC	p.R674H	EGFLAM_uc003jlb.1_Missense_Mutation_p.R674H|EGFLAM_uc003jle.1_Missense_Mutation_p.R440H|EGFLAM_uc003jlf.1_Missense_Mutation_p.R40H	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	674	Laminin G-like 2.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					GTGGAGTTCCGCTTTGACTGT	0.512													54	260	---	---	---	---	PASS
HIST1H2BJ	8970	broad.mit.edu	37	6	27100369	27100369	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27100369C>T	uc003niv.2	-	1	207	c.161G>A	c.(160-162)GGC>GAC	p.G54D	HIST1H2BJ_uc003niu.1_RNA|HIST1H2AG_uc003niw.2_5'Flank	NM_021058	NP_066402	P06899	H2B1J_HUMAN	histone cluster 1, H2bj	54					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						GGACGAAATGCCGGTGTCAGG	0.547													6	310	---	---	---	---	PASS
SLC35B2	347734	broad.mit.edu	37	6	44222678	44222678	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44222678A>G	uc003oxd.2	-	4	1200	c.1064T>C	c.(1063-1065)ATC>ACC	p.I355T	SLC35B2_uc011dvt.1_Missense_Mutation_p.I258T|SLC35B2_uc011dvu.1_Missense_Mutation_p.I222T	NM_178148	NP_835361	Q8TB61	S35B2_HUMAN	solute carrier family 35, member B2	355	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGTGTAAAAGATGAAGAGCTG	0.582													12	43	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160515133	160515133	+	Intron	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160515133C>A	uc003qta.2	+						LOC729603_uc003qtb.2_RNA	NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		CCCCTTCTCCCAAAGTACTAC	0.463													2	2	---	---	---	---	PASS
C6orf70	55780	broad.mit.edu	37	6	170162545	170162545	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170162545T>A	uc003qxg.1	+	9	911	c.878T>A	c.(877-879)TTG>TAG	p.L293*	C6orf70_uc011ehb.1_Nonsense_Mutation_p.L167*|C6orf70_uc003qxh.1_Nonsense_Mutation_p.L293*|C6orf70_uc010kky.1_Nonsense_Mutation_p.L167*	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN	hypothetical protein LOC55780	293						integral to membrane				ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)		TGCGCCATATTGTTGCTGACA	0.323													23	148	---	---	---	---	PASS
RBAK	57786	broad.mit.edu	37	7	5085848	5085848	+	Intron	SNP	G	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5085848G>C	uc010kss.1	+						LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_5'UTR	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		GGCGGATCTGGGTCCCGGGAA	0.731													3	11	---	---	---	---	PASS
FZD9	8326	broad.mit.edu	37	7	72849660	72849660	+	Silent	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72849660G>T	uc003tyb.2	+	1	1552	c.1323G>T	c.(1321-1323)CTG>CTT	p.L441L		NM_003508	NP_003499	O00144	FZD9_HUMAN	frizzled 9 precursor	441	Cytoplasmic (Potential).				B cell differentiation|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|neuroblast proliferation|vasculature development	cell surface|filopodium membrane|integral to membrane|perinuclear region of cytoplasm	G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CAGAGAAGCTGGAGAAGCTCA	0.572													3	35	---	---	---	---	PASS
CCDC146	57639	broad.mit.edu	37	7	76912017	76912017	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76912017A>T	uc003uga.2	+	15	2190	c.2063A>T	c.(2062-2064)GAG>GTG	p.E688V	CCDC146_uc010ldp.2_Missense_Mutation_p.E402V|CCDC146_uc003ugc.2_Missense_Mutation_p.E25V	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	688	Potential.									ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AAGATTGCTGAGAAGCAAAGA	0.393													32	100	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82595361	82595361	+	Missense_Mutation	SNP	A	G	G	rs61995907		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82595361A>G	uc003uhx.2	-	4	4032	c.3743T>C	c.(3742-3744)CTA>CCA	p.L1248P	PCLO_uc003uhv.2_Missense_Mutation_p.L1248P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1187					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTCTGGGAGTAGCTTTTTGTC	0.393													149	389	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91712684	91712684	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91712684G>T	uc003ulg.2	+	33	8586	c.8361G>T	c.(8359-8361)AAG>AAT	p.K2787N	AKAP9_uc003ulf.2_Missense_Mutation_p.K2779N|AKAP9_uc003uli.2_Missense_Mutation_p.K2410N|AKAP9_uc003ulj.2_Missense_Mutation_p.K557N|AKAP9_uc003ulk.2_Missense_Mutation_p.K62N	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2799					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GGACTCTGAAGATCAGTAGCA	0.383			T	BRAF	papillary thyroid								10	77	---	---	---	---	PASS
DECR1	1666	broad.mit.edu	37	8	91013753	91013753	+	Silent	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91013753G>A	uc003yek.1	+	1	174	c.33G>A	c.(31-33)CTG>CTA	p.L11L	DECR1_uc011lgc.1_5'UTR|DECR1_uc011lgd.1_RNA	NM_001359	NP_001350	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1 precursor	11					fatty acid beta-oxidation|protein homotetramerization	mitochondrial matrix|nucleus|plasma membrane	2,4-dienoyl-CoA reductase (NADPH) activity|NADPH binding|oxidoreductase activity, acting on NADH or NADPH				0			BRCA - Breast invasive adenocarcinoma(11;0.00953)			TCTTTACTCTGGGGTCCCGGC	0.677											OREG0018857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	42	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77442693	77442693	+	Splice_Site	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77442693C>T	uc004ajl.1	-	7	1079	c.841_splice	c.e7+1	p.R281_splice	TRPM6_uc004ajk.1_Splice_Site_p.R276_splice|TRPM6_uc010mpb.1_Splice_Site|TRPM6_uc010mpc.1_Splice_Site_p.R281_splice|TRPM6_uc010mpd.1_Splice_Site_p.R281_splice|TRPM6_uc010mpe.1_Splice_Site_p.P281_splice|TRPM6_uc004ajn.1_Missense_Mutation_p.R281H	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GTGATACTCACGGCAGTGTAT	0.517													15	80	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84200429	84200429	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84200429C>T	uc004aly.2	-	18	2560	c.2119G>A	c.(2119-2121)GCT>ACT	p.A707T	TLE1_uc004alz.2_Missense_Mutation_p.A717T|TLE1_uc011lsr.1_Missense_Mutation_p.A692T	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1	707	WD 5.				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						CCACAGTAAGCAAATTTCAGG	0.483													4	89	---	---	---	---	PASS
FAM22G	441457	broad.mit.edu	37	9	99700276	99700276	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99700276T>A	uc004awq.1	+	6	2148	c.1433T>A	c.(1432-1434)CTT>CAT	p.L478H	HIATL2_uc004awr.1_Intron	NM_001045477	NP_001038942	Q5VZR2	FA22G_HUMAN	hypothetical protein LOC441457	478										skin(1)	1		Acute lymphoblastic leukemia(62;0.0527)				GGACTCACCCTTGCCCAGGTA	0.607													37	169	---	---	---	---	PASS
FAM21B	55747	broad.mit.edu	37	10	47945835	47945835	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47945835C>A	uc009xni.2	+	27	3335	c.3335C>A	c.(3334-3336)CCT>CAT	p.P1112H	FAM21B_uc001jep.3_Missense_Mutation_p.P986H|FAM21B_uc001jeq.3_Missense_Mutation_p.P179H	NM_018232	NP_060702	Q5SNT6	FA21B_HUMAN	hypothetical protein LOC55747	1112					retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						AATACCTTTCCTCTCCTGGAA	0.418													4	132	---	---	---	---	PASS
DKK1	22943	broad.mit.edu	37	10	54076514	54076514	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54076514G>A	uc001jjr.2	+	4	902	c.748G>A	c.(748-750)GAT>AAT	p.D250N	uc001jjq.1_5'Flank|uc009xox.1_5'Flank	NM_012242	NP_036374	O94907	DKK1_HUMAN	dickkopf homolog 1 precursor	250	DKK-type Cys-2.				negative regulation of peptidyl-serine phosphorylation|negative regulation of protein complex assembly|negative regulation of transcription from RNA polymerase II promoter|positive regulation of heart induction by negative regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization	extracellular space|plasma membrane	growth factor activity|low-density lipoprotein particle receptor binding|receptor antagonist activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						GATACAGAAAGATCACCATCA	0.418													4	74	---	---	---	---	PASS
PHYHIPL	84457	broad.mit.edu	37	10	60994152	60994152	+	Silent	SNP	A	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60994152A>C	uc001jkk.3	+	2	461	c.195A>C	c.(193-195)TCA>TCC	p.S65S	PHYHIPL_uc001jkl.3_Silent_p.S19S|PHYHIPL_uc001jkm.3_Silent_p.S39S	NM_032439	NP_115815	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting	65	Fibronectin type-III.										0						CGTGTGACTCATTCAAGATTT	0.353													29	107	---	---	---	---	PASS
KIF11	3832	broad.mit.edu	37	10	94397051	94397051	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94397051G>C	uc001kic.2	+	15	2294	c.1986G>C	c.(1984-1986)TTG>TTC	p.L662F	KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	662					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						AGACTTCATTGACAGTGGCCG	0.323													50	118	---	---	---	---	PASS
ANKRD2	26287	broad.mit.edu	37	10	99343409	99343409	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99343409G>C	uc001knw.2	+	9	1219	c.1010G>C	c.(1009-1011)GGG>GCG	p.G337A	DHDPSL_uc001knx.2_5'Flank|DHDPSL_uc001kny.2_5'Flank|DHDPSL_uc001knz.2_5'Flank|PI4K2A_uc010qoy.1_5'Flank|ANKRD2_uc009xvu.2_Missense_Mutation_p.G304A	NM_020349	NP_065082	Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 isoform a	337					muscle contraction|muscle organ development		structural constituent of muscle				0		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		CCTGAGCCGGGGGCTGAGCAT	0.687													9	12	---	---	---	---	PASS
C10orf28	27291	broad.mit.edu	37	10	99969616	99969616	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99969616A>G	uc001kow.3	+	4	2040	c.1745A>G	c.(1744-1746)AAC>AGC	p.N582S	C10orf28_uc001kox.3_Missense_Mutation_p.N582S|C10orf28_uc001koy.3_Missense_Mutation_p.N582S|C10orf28_uc009xvx.2_Missense_Mutation_p.N582S|C10orf28_uc009xvy.2_Intron|C10orf28_uc001koz.3_Intron	NM_014472	NP_055287	Q4KMY3	Q4KMY3_HUMAN	growth inhibition and differentiation related	582							nucleotide binding			large_intestine(1)|skin(1)	2		Colorectal(252;0.234)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)		TCTATGTTTAACGATGATGGT	0.393													3	165	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123845033	123845033	+	Silent	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123845033G>A	uc001lfv.2	+	4	3378	c.3018G>A	c.(3016-3018)CAG>CAA	p.Q1006Q	TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Silent_p.Q1006Q|TACC2_uc010qtv.1_Silent_p.Q1006Q	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	1006						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AAGGCAGCCAGCATGAAGAAG	0.527													23	44	---	---	---	---	PASS
NLRP6	171389	broad.mit.edu	37	11	281628	281628	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:281628G>A	uc010qvs.1	+	4	1894	c.1894G>A	c.(1894-1896)GCG>ACG	p.A632T	NLRP6_uc010qvt.1_Missense_Mutation_p.A632T	NM_138329	NP_612202	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	632						cytoplasm	ATP binding			upper_aerodigestive_tract(1)|skin(1)	2		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCAGGAGGACGCGTTTGTGCG	0.642													32	178	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61897770	61897770	+	Silent	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61897770C>A	uc001nsw.1	+	4	973	c.771C>A	c.(769-771)CTC>CTA	p.L257L	INCENP_uc009ynv.2_Silent_p.L257L|INCENP_uc009ynw.1_Silent_p.L257L|INCENP_uc001nsx.1_Silent_p.L257L	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	257					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						CGTCTAAGCTCAGGATTGCGC	0.637													44	95	---	---	---	---	PASS
LOC645332	645332	broad.mit.edu	37	11	67560590	67560590	+	3'UTR	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67560590C>T	uc001omt.3	-	4					LOC645332_uc001omu.3_3'UTR	NR_024249				SubName: Full=cDNA FLJ57700, weakly similar to Protein FAM86A;												0						AAGTTTTATCCGCTTTCCCAT	0.413													3	15	---	---	---	---	PASS
MTMR2	8898	broad.mit.edu	37	11	95581057	95581057	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95581057C>G	uc001pfu.2	-	10	1253	c.1000G>C	c.(1000-1002)GGT>CGT	p.G334R	MTMR2_uc001pfv.2_Missense_Mutation_p.G262R|MTMR2_uc001pfs.2_Missense_Mutation_p.G262R|MTMR2_uc001pft.2_Missense_Mutation_p.G262R|MTMR2_uc010ruj.1_Missense_Mutation_p.G317R	NM_016156	NP_057240	Q13614	MTMR2_HUMAN	myotubularin-related protein 2 isoform 1	334	Myotubularin phosphatase.					nucleus	inositol or phosphatidylinositol phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TAACCTCCACCCTTTGCCTGG	0.328													9	83	---	---	---	---	PASS
MMP13	4322	broad.mit.edu	37	11	102822797	102822797	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102822797C>T	uc001phl.2	-	5	771	c.743G>A	c.(742-744)GGC>GAC	p.G248D		NM_002427	NP_002418	P45452	MMP13_HUMAN	matrix metalloproteinase 13 preproprotein	248					collagen catabolic process|proteolysis	extracellular space	metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)		GTGGCTTTTGCCGGTGTAGGT	0.448													5	370	---	---	---	---	PASS
SPATS2	65244	broad.mit.edu	37	12	49888698	49888698	+	Missense_Mutation	SNP	C	A	A	rs142287017		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49888698C>A	uc001rud.2	+	7	1428	c.439C>A	c.(439-441)CTC>ATC	p.L147I	SPATS2_uc001rue.2_RNA|SPATS2_uc009zli.1_Missense_Mutation_p.L147I|SPATS2_uc001ruf.2_Missense_Mutation_p.L147I|SPATS2_uc001rug.2_Missense_Mutation_p.L147I	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	147						cytoplasm				breast(1)	1						TGTGGACTCACTCAGTGAAGG	0.463													3	100	---	---	---	---	PASS
IL23A	51561	broad.mit.edu	37	12	56733621	56733621	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56733621G>T	uc001sla.2	+	3	574	c.408G>T	c.(406-408)CAG>CAT	p.Q136H		NM_016584	NP_057668	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19 precursor	136					defense response to Gram-negative bacterium|inflammatory response|innate immune response|negative regulation of interleukin-10 production|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to virus|tissue remodeling	interleukin-23 complex	cytokine activity				0						AACTCCTGCAGGTATGAAGTA	0.562													19	186	---	---	---	---	PASS
IGF1	3479	broad.mit.edu	37	12	102811474	102811474	+	3'UTR	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102811474C>T	uc001tjp.3	-	4					IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						TCCATCACATCATCATCTAGC	0.398													12	33	---	---	---	---	PASS
C12orf34	84915	broad.mit.edu	37	12	110205829	110205829	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110205829C>T	uc001tpd.1	+	3	654	c.95C>T	c.(94-96)GCC>GTC	p.A32V	MGC14436_uc010sxs.1_Intron|MGC14436_uc001tpe.2_Intron|C12orf34_uc001tpf.1_Missense_Mutation_p.A32V	NM_032829	NP_116218	Q5U5X8	CL034_HUMAN	hypothetical protein LOC84915	32										ovary(1)	1						GAGGCGGTGGCCAGCGCCATG	0.657													11	45	---	---	---	---	PASS
EGLN3	112399	broad.mit.edu	37	14	34419867	34419867	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34419867A>G	uc001wsa.3	-	1	418	c.92T>C	c.(91-93)CTG>CCG	p.L31P	EGLN3_uc001wry.2_Intron|EGLN3_uc001wrz.2_Missense_Mutation_p.L31P|EGLN3_uc001wsb.1_Missense_Mutation_p.L31P	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	egl nine homolog 3	31					apoptosis	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding				0	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)	GAAGTTGTCCAGGTAGCAGAA	0.672													3	80	---	---	---	---	PASS
FAM179B	23116	broad.mit.edu	37	14	45468576	45468576	+	Silent	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45468576G>A	uc001wvv.2	+	3	2423	c.2214G>A	c.(2212-2214)GGG>GGA	p.G738G	FAM179B_uc001wvw.2_Silent_p.G738G|FAM179B_uc010anc.2_RNA|FAM179B_uc001wvu.2_Silent_p.G738G	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116	738							binding			skin(2)|upper_aerodigestive_tract(1)	3						GTACTACTGGGACTCATCAAA	0.333													20	151	---	---	---	---	PASS
PRPF39	55015	broad.mit.edu	37	14	45571777	45571777	+	Silent	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45571777T>C	uc001wvz.3	+	5	785	c.615T>C	c.(613-615)TCT>TCC	p.S205S	PRPF39_uc001wvy.3_Silent_p.S84S|PRPF39_uc010and.2_5'UTR	NM_017922	NP_060392	Q86UA1	PRP39_HUMAN	PRP39 pre-mRNA processing factor 39 homolog	205	HAT 3.				mRNA processing|RNA splicing	nucleus	binding			ovary(1)|breast(1)	2						ATTTCCGTTCTGACAGACTGT	0.353													19	107	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65253682	65253682	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65253682C>G	uc001xht.2	-	15	3055	c.3001G>C	c.(3001-3003)GAG>CAG	p.E1001Q	SPTB_uc001xhr.2_Missense_Mutation_p.E1001Q|SPTB_uc001xhs.2_Missense_Mutation_p.E1001Q|SPTB_uc001xhu.2_Missense_Mutation_p.E1001Q	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	1001	Spectrin 7.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ACGTCACGCTCCAGCCCTGAC	0.597													9	78	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65253739	65253739	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65253739C>G	uc001xht.2	-	15	2998	c.2944G>C	c.(2944-2946)GAC>CAC	p.D982H	SPTB_uc001xhr.2_Missense_Mutation_p.D982H|SPTB_uc001xhs.2_Missense_Mutation_p.D982H|SPTB_uc001xhu.2_Missense_Mutation_p.D982H	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	982	Spectrin 7.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CGCCCCAGGTCTTTTGTGGAC	0.602													13	44	---	---	---	---	PASS
ZFP36L1	677	broad.mit.edu	37	14	69256177	69256177	+	3'UTR	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69256177A>G	uc001xkh.1	-	2					ZFP36L1_uc001xki.1_Intron	NM_004926	NP_004917	Q07352	TISB_HUMAN	butyrate response factor 1						regulation of mRNA stability	cytosol|nucleus	DNA binding|mRNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGGGATGGGTAGGGAGAAGAG	0.577											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	43	---	---	---	---	PASS
RBM25	58517	broad.mit.edu	37	14	73570019	73570019	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73570019G>T	uc001xno.2	+	10	1195	c.987G>T	c.(985-987)AGG>AGT	p.R329S	RBM25_uc010ttu.1_Missense_Mutation_p.R329S|RBM25_uc001xnp.2_Missense_Mutation_p.R124S	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	329	Necessary for nuclear speckle localization.|Glu-rich.|Arg-rich.				apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		aacgagaaagggaaagagaac	0.000													3	15	---	---	---	---	PASS
TTC8	123016	broad.mit.edu	37	14	89307274	89307274	+	Splice_Site	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89307274T>C	uc010ath.2	+	3	433	c.299_splice	c.e3+2	p.R100_splice	TTC8_uc010atg.1_Intron|TTC8_uc001xxl.2_Splice_Site|TTC8_uc010ati.2_Splice_Site|TTC8_uc001xxm.2_Splice_Site_p.R100_splice|TTC8_uc010atj.2_Intron|TTC8_uc001xxi.2_Splice_Site_p.R110_splice|TTC8_uc001xxj.2_Splice_Site_p.R100_splice|TTC8_uc001xxk.2_Splice_Site_p.R100_splice	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8 isoform B						cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding				0						GGCCGTTAGGTATGTACTTCT	0.388									Bardet-Biedl_syndrome				15	90	---	---	---	---	PASS
TTC7B	145567	broad.mit.edu	37	14	91110479	91110479	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91110479A>T	uc001xyp.2	-	15	1786	c.1664T>A	c.(1663-1665)CTT>CAT	p.L555H	TTC7B_uc001xyo.2_Translation_Start_Site|TTC7B_uc010ats.2_RNA|uc001xyq.2_Intron	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	555	TPR 7.						binding			ovary(2)	2		Melanoma(154;0.222)				CAGGAGGGCAAGGAGGTGCAG	0.493													41	160	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25313022	25313022	+	Intron	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25313022T>C	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-5_uc001yxq.2_RNA|SNORD116-8_uc001yxr.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TCATCAGAACTGAGGTCCAGC	0.493													55	133	---	---	---	---	PASS
GNB5	10681	broad.mit.edu	37	15	52476835	52476835	+	Silent	SNP	T	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52476835T>G	uc002abt.1	-	2	104	c.39A>C	c.(37-39)TCA>TCC	p.S13S	uc002abv.2_Intron	NM_016194	NP_057278	O14775	GBB5_HUMAN	guanine nucleotide-binding protein, beta-5	13						heterotrimeric G-protein complex	GTPase activity|signal transducer activity			lung(1)	1				all cancers(107;0.0163)		ATTTGTCACATGAGCCAAATA	0.398													48	124	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85056021	85056021	+	RNA	SNP	T	C	C	rs1062001		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85056021T>C	uc002bkm.2	-	6		c.539A>G				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						GTAGCTGCTCTACCTTAGATG	0.502													3	19	---	---	---	---	PASS
GGA2	23062	broad.mit.edu	37	16	23494281	23494281	+	Silent	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23494281C>A	uc002dlq.2	-	9	919	c.843G>T	c.(841-843)CGG>CGT	p.R281R	GGA2_uc010bxo.1_RNA	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2	281	GAT.			R -> W (in Ref. 1; AAF05708).	intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		CACTCGCCAACCGGAACAGCG	0.572													6	48	---	---	---	---	PASS
IL4R	3566	broad.mit.edu	37	16	27375116	27375116	+	Missense_Mutation	SNP	G	T	T	rs147700319	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27375116G>T	uc002don.2	+	11	2685	c.2443G>T	c.(2443-2445)GTC>TTC	p.V815F	IL4R_uc002dop.3_Missense_Mutation_p.V800F|IL4R_uc010bxy.2_Missense_Mutation_p.V815F|IL4R_uc002doo.2_Missense_Mutation_p.V655F	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	815	Cytoplasmic (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CGTGAACTTTGTCTCCGTGGG	0.527													68	208	---	---	---	---	PASS
XPO6	23214	broad.mit.edu	37	16	28181115	28181115	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28181115T>C	uc002dpa.1	-	5	1022	c.521A>G	c.(520-522)AAG>AGG	p.K174R	XPO6_uc002dpb.1_Missense_Mutation_p.K160R|XPO6_uc010vcp.1_Missense_Mutation_p.K174R	NM_015171	NP_055986	Q96QU8	XPO6_HUMAN	exportin 6	174					protein export from nucleus		protein binding|protein transporter activity			ovary(1)|skin(1)	2						CAGTAGCAGCTTCCGCAACTC	0.582													10	78	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47733444	47733444	+	3'UTR	SNP	A	G	G			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47733444A>G	uc002eev.3	+	31					PHKB_uc002eeu.3_3'UTR|PHKB_uc002eew.3_3'UTR	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TAGCCAATCTAACGGTAATGG	0.388													5	12	---	---	---	---	PASS
CLEC18B	497190	broad.mit.edu	37	16	74455087	74455087	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74455087C>T	uc002fct.2	-	1	282	c.82G>A	c.(82-84)GTG>ATG	p.V28M	CLEC18B_uc002fcu.2_Missense_Mutation_p.V28M|CLEC18B_uc010vmu.1_Missense_Mutation_p.V28M|CLEC18B_uc010vmw.1_Missense_Mutation_p.V28M	NM_001011880	NP_001011880	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	28						extracellular region	sugar binding				0						GGTGGCCACACCTCTGCCCAG	0.657													23	140	---	---	---	---	PASS
TBKBP1	9755	broad.mit.edu	37	17	45773464	45773464	+	5'UTR	SNP	G	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45773464G>C	uc002ilu.2	+	1						NM_014726	NP_055541	A7MCY6	TBKB1_HUMAN	TBK1 binding protein 1						innate immune response						0						TGTGGGCCGCGGCCCGGCCCT	0.662													9	30	---	---	---	---	PASS
UNC13D	201294	broad.mit.edu	37	17	73835999	73835999	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73835999A>C	uc002jpp.2	-	12	1356	c.976T>G	c.(976-978)TCG>GCG	p.S326A	UNC13D_uc010wsk.1_Missense_Mutation_p.S326A|UNC13D_uc002jpq.1_5'UTR|UNC13D_uc010dgq.1_Missense_Mutation_p.S123A	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	326	Interaction with RAB27A.				positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGACTCAGCGACCCGTCCCAG	0.662									Familial_Hemophagocytic_Lymphohistiocytosis				13	64	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28993413	28993413	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28993413G>A	uc002kwq.2	+	16	3113	c.2978G>A	c.(2977-2979)GGC>GAC	p.G993D	DSG4_uc002kwr.2_Missense_Mutation_p.G1012D	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	993	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GTGATGAGCGGCAATATTTTA	0.483													4	165	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56246434	56246434	+	Nonsense_Mutation	SNP	A	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56246434A>C	uc002lhj.3	-	4	1788	c.1574T>G	c.(1573-1575)TTA>TGA	p.L525*		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	525							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						CTTGCTCCATAAGTCCTTTCC	0.522											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	276	---	---	---	---	PASS
MKNK2	2872	broad.mit.edu	37	19	2041090	2041090	+	Silent	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2041090G>T	uc002lus.2	-	12	1304	c.1059C>A	c.(1057-1059)GCC>GCA	p.A353A	MKNK2_uc002luq.1_Silent_p.A97A|MKNK2_uc010xgu.1_Silent_p.A192A|MKNK2_uc010xgv.1_Silent_p.A222A|MKNK2_uc002lur.2_Silent_p.A353A|MKNK2_uc002lut.1_Silent_p.A97A	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2	353	Protein kinase.				cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTCTGCTTGGCGTCACGGA	0.657													35	87	---	---	---	---	PASS
GNG7	2788	broad.mit.edu	37	19	2514984	2514984	+	3'UTR	SNP	A	G	G	rs62121669		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2514984A>G	uc002lwd.2	-	5					GNG7_uc010dte.1_Intron	NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gagagagagaaagagagagag	0.303													3	41	---	---	---	---	PASS
CHAF1A	10036	broad.mit.edu	37	19	4430546	4430546	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4430546G>T	uc002mal.2	+	11	1955	c.1855G>T	c.(1855-1857)GAT>TAT	p.D619Y		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	619	Poly-Asp.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCTTTTGAGGATGATGATGA	0.373								Chromatin_Structure					31	76	---	---	---	---	PASS
TICAM1	148022	broad.mit.edu	37	19	4817858	4817858	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4817858G>T	uc002mbi.2	-	2	783	c.532C>A	c.(532-534)CTC>ATC	p.L178I		NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	178					apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GGGCGTGGGAGGCTCCTGGTC	0.642													21	157	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19329806	19329806	+	Silent	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19329806G>A	uc002nlz.2	+	3	255	c.156G>A	c.(154-156)GCG>GCA	p.A52A		NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	52	Ig-like V-type.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			CTGCGCTGGCGGAGCTGGTGG	0.647													14	56	---	---	---	---	PASS
PSENEN	55851	broad.mit.edu	37	19	36237651	36237651	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36237651T>C	uc002obi.1	+	4	413	c.209T>C	c.(208-210)GTG>GCG	p.V70A	TMEM149_uc010eej.2_5'Flank|U2AF1L4_uc002obh.1_5'Flank|U2AF1L4_uc002obe.2_5'Flank|U2AF1L4_uc002obf.2_5'Flank|U2AF1L4_uc002obg.2_5'Flank|PSENEN_uc002obj.1_Missense_Mutation_p.V70A|PSENEN_uc002obk.1_Intron|LIN37_uc002obm.2_5'Flank	NM_172341	NP_758844	Q9NZ42	PEN2_HUMAN	presenilin enhancer 2	70	Helical; (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	aspartic-type endopeptidase activity|protein binding			ovary(2)	2	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGGGTGATAGTGCTCACCTCC	0.602													49	123	---	---	---	---	PASS
PLAUR	5329	broad.mit.edu	37	19	44171782	44171782	+	Silent	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44171782G>A	uc002oxf.1	-	2	347	c.117C>T	c.(115-117)TGC>TGT	p.C39C	PLAUR_uc002oxd.1_Silent_p.C39C|PLAUR_uc002oxe.1_Silent_p.C34C|PLAUR_uc002oxg.1_Silent_p.C39C	NM_002659	NP_002650	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	39	UPAR/Ly6 1.				attachment of GPI anchor to protein|blood coagulation|C-terminal protein lipidation|cellular component movement|chemotaxis|fibrinolysis|regulation of proteolysis	anchored to membrane|cell surface|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|extrinsic to membrane|integral to membrane|plasma membrane	enzyme binding|U-plasminogen activator receptor activity			ovary(1)	1		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Urokinase(DB00013)	GTCCCAGGGCGCACTCTTCCA	0.632													4	85	---	---	---	---	PASS
ZNF223	7766	broad.mit.edu	37	19	44571333	44571333	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44571333G>C	uc002oyf.1	+	5	1605	c.1352G>C	c.(1351-1353)AGT>ACT	p.S451T	ZNF284_uc010ejd.2_RNA	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN	zinc finger protein 223	451					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0352)				AAAAACCACAGTGGAGAAAAT	0.348													24	99	---	---	---	---	PASS
KLK8	11202	broad.mit.edu	37	19	51503868	51503868	+	Intron	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51503868C>T	uc002pur.1	-						KLK9_uc002puw.1_Intron|KLK8_uc002puq.1_Nonsense_Mutation_p.W59*|KLK8_uc002pus.1_Intron|KLK8_uc002put.1_Intron|KLK8_uc002puu.1_Intron|KLK9_uc002puv.1_Intron	NM_007196	NP_009127	O60259	KLK8_HUMAN	kallikrein 8 isoform 1 preproprotein						cell death|keratinocyte proliferation|memory|negative regulation of axon regeneration|negative regulation of myelination|neuron projection morphogenesis|proteolysis|regulation of synapse organization|response to wounding	cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(1)	1		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		GGTTGGATCGCCACCCTCTGG	0.617													20	96	---	---	---	---	PASS
CSRP2BP	57325	broad.mit.edu	37	20	18123411	18123411	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18123411C>T	uc002wqj.2	+	2	729	c.107C>T	c.(106-108)ACG>ATG	p.T36M	CSRP2BP_uc002wqk.2_5'Flank	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	36					histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						GAGGGAGAGACGCTCCTGATC	0.537													6	73	---	---	---	---	PASS
SALL4	57167	broad.mit.edu	37	20	50408862	50408862	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50408862C>T	uc002xwh.3	-	2	261	c.160G>A	c.(160-162)GAG>AAG	p.E54K	SALL4_uc010gii.2_Missense_Mutation_p.E54K|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	54					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CTCGCCACCTCGTCATTCCCT	0.488													14	101	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15481370	15481370	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15481370T>C	uc002yjm.2	-	10	1400	c.1390A>G	c.(1390-1392)AAA>GAA	p.K464E	uc002yjk.2_Intron|uc002yjl.2_Intron	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	443					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TCTCTGTCTTTAAGTACAATA	0.343													77	174	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38119680	38119680	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38119680C>A	uc003atr.2	+	7	1388	c.1117C>A	c.(1117-1119)CCC>ACC	p.P373T	TRIOBP_uc003atu.2_Missense_Mutation_p.P201T|TRIOBP_uc003atq.1_Missense_Mutation_p.P373T|TRIOBP_uc003ats.1_Missense_Mutation_p.P201T	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	373					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TACTTGTACTCCCCAGCGGGA	0.557													63	149	---	---	---	---	PASS
XRCC6	2547	broad.mit.edu	37	22	42054277	42054277	+	Silent	SNP	C	T	T	rs139850731		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42054277C>T	uc003bao.1	+	11	1513	c.1443C>T	c.(1441-1443)CCC>CCT	p.P481P	XRCC6_uc003bap.1_Silent_p.P440P|XRCC6_uc011apc.1_Silent_p.P431P|XRCC6_uc003baq.1_Silent_p.P481P|XRCC6_uc003bar.1_Silent_p.P481P|XRCC6_uc003bas.1_Silent_p.P431P	NM_001469	NP_001460	P12956	XRCC6_HUMAN	ATP-dependent DNA helicase II, 70 kDa subunit	481					DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding			skin(2)|ovary(1)|lung(1)|kidney(1)	5						TTGAGAACCCCGTGCTGCAGC	0.418								Direct_reversal_of_damage|NHEJ					12	121	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73071200	73071200	+	RNA	SNP	G	T	T			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73071200G>T	uc004ebm.1	-	1		c.1389C>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						ACTGCGGCAAGACCTTCAGCC	0.527													43	154	---	---	---	---	PASS
SPANXN1	494118	broad.mit.edu	37	X	144337657	144337657	+	3'UTR	SNP	G	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144337657G>A	uc004fcb.2	+	2						NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN	SPANX-N1 protein												0	Acute lymphoblastic leukemia(192;6.56e-05)					TCTAGGTCAAGAAATGAAATC	0.259													12	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2648	2648	+	5'Flank	SNP	T	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2648T>C	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		gctccacgagggttcagctgt	0.129													7	1	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	16517923	16517926	+	IGR	DEL	GGAG	-	-	rs111976774		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16517923_16517926delGGAG								EPHA2 (35359 upstream) : ARHGEF19 (6673 downstream)																							agggagggatggagggagggaggg	0.221													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	100088781	100088781	+	IGR	DEL	A	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100088781delA								LPPR4 (313645 upstream) : PALMD (22650 downstream)																							accctgttgcaaaaaaaaaaa	0.045													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	103688796	103688797	+	IGR	INS	-	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103688796_103688797insC								COL11A1 (114744 upstream) : RNPC3 (379781 downstream)																							cttcttcttcttctccctcctt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	188416136	188416139	+	IGR	DEL	TTCC	-	-	rs112749943		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188416136_188416139delTTCC								None (None upstream) : None (None downstream)																							GGATTTCTATttccttccttcctt	0.157													7	4	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201792492	201792493	+	3'UTR	DEL	GT	-	-	rs4025039		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201792492_201792493delGT	uc001gwu.2	+	29					NAV1_uc001gwx.2_3'UTR	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						TGAtgtctgcgtgtgtgtgtgt	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223352884	223352885	+	IGR	INS	-	CTTT	CTTT	rs61837572	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223352884_223352885insCTTT								TLR5 (36260 upstream) : SUSD4 (41278 downstream)																							ttccttccttcctttctttctt	0.045													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26958076	26958077	+	IGR	INS	-	AC	AC	rs143104762	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26958076_26958077insAC								KCNK3 (4010 upstream) : C2orf18 (29065 downstream)																							ccaactttcCAacacacacaca	0.173													3	3	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218537764	218537765	+	Intron	INS	-	G	G	rs145256552	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218537764_218537765insG	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						GCCAAAAAAGCGGGGGGAAAAA	0.431													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	2106996	2106998	+	IGR	DEL	AAG	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2106996_2106998delAAG								CNTN6 (661719 upstream) : CNTN4 (33552 downstream)																							gaaggaaggaaagaaaggaaagg	0.074													8	6	---	---	---	---	
OSBPL10	114884	broad.mit.edu	37	3	32022334	32022335	+	Intron	DEL	CA	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32022334_32022335delCA	uc003cev.2	-						OSBPL10_uc011axf.1_Intron|ZNF860_uc011axg.1_5'Flank	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10						lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		cacacgcacgcacacacacaca	0.485													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	33782635	33782636	+	IGR	INS	-	TG	TG	rs148294883	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33782635_33782636insTG								CLASP2 (22787 upstream) : PDCD6IP (57430 downstream)																							atgtgtaaatatgtgtgtgtgt	0.000													4	2	---	---	---	---	
DBR1	51163	broad.mit.edu	37	3	137888783	137888783	+	Intron	DEL	A	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137888783delA	uc003erv.2	-						DBR1_uc003eru.2_Intron	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1							nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						tcaaaaaaagaaaaaaaaaaG	0.149													4	2	---	---	---	---	
PLS1	5357	broad.mit.edu	37	3	142402698	142402698	+	Intron	DEL	T	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142402698delT	uc010huv.2	+						PLS1_uc003euz.2_Intron|PLS1_uc003eva.2_Intron	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1							cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						aaaccatgTGTTTTTTTTTTT	0.109													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172992494	172992494	+	IGR	DEL	C	-	-	rs79222726		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172992494delC								SPATA16 (133462 upstream) : NLGN1 (123750 downstream)																							aacaaacaaacaaaaacatgt	0.000													6	3	---	---	---	---	
GPR125	166647	broad.mit.edu	37	4	22422864	22422865	+	Intron	INS	-	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22422864_22422865insA	uc003gqm.1	-						GPR125_uc010ieo.1_Intron|GPR125_uc003gqn.1_Intron|GPR125_uc003gqo.2_Intron	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				ATAACTGGCAGAATAAAAAAAA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53356461	53356464	+	IGR	DEL	GGAA	-	-	rs28785473		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53356461_53356464delGGAA								SPATA18 (393004 upstream) : USP46 (100665 downstream)																							aagaaggaagggaaggaaggaagg	0.000													4	2	---	---	---	---	
CCDC158	339965	broad.mit.edu	37	4	77272457	77272457	+	Intron	DEL	A	-	-	rs112268994		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77272457delA	uc003hkb.3	-							NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6						TGTACGATTTAAAAAAAAAAC	0.174													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2744188	2744197	+	IGR	DEL	GTGTGTGTGT	-	-	rs141265523		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2744188_2744197delGTGTGTGTGT								IRX4 (861308 upstream) : IRX2 (2084 downstream)																							GAATGGAGTCgtgtgtgtgtgtgtgtgtgt	0.343													4	2	---	---	---	---	
FBXL7	23194	broad.mit.edu	37	5	15626654	15626655	+	Intron	DEL	TG	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15626654_15626655delTG	uc003jfn.1	+							NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						ATTCGTTTCCtgtgtgtgtgtg	0.277													4	2	---	---	---	---	
CDH12	1010	broad.mit.edu	37	5	21880723	21880724	+	Intron	INS	-	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21880723_21880724insC	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						cttccttccttccttctttctt	0.000										HNSCC(59;0.17)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28377270	28377271	+	IGR	DEL	TC	-	-	rs149733183	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28377270_28377271delTC								None (None upstream) : None (None downstream)																							TATGCGTCTTTCTCtgtgtgtg	0.337													1	5	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35087525	35087526	+	Intron	DEL	TG	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35087525_35087526delTG	uc003jjm.2	-						PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_5'Flank	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	CTCTTTCCTTtgtgtgtgtgtg	0.371													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99332823	99332823	+	IGR	DEL	C	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99332823delC								None (None upstream) : LOC100133050 (382386 downstream)																							TGACTTACTACCGTCATAAAG	0.388													4	2	---	---	---	---	
DDX46	9879	broad.mit.edu	37	5	134140864	134140864	+	Intron	DEL	T	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134140864delT	uc003kzw.2	+						DDX46_uc003kzv.1_Intron	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46						mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAGAACTGTAttttttttttt	0.204													4	2	---	---	---	---	
TRPC7	57113	broad.mit.edu	37	5	135561876	135561879	+	Frame_Shift_Del	DEL	CTTC	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135561876_135561879delCTTC	uc003lbn.1	-	8	2105_2108	c.2102_2105delGAAG	c.(2101-2106)GGAAGAfs	p.G701fs	TRPC7_uc010jef.1_Frame_Shift_Del_p.G638fs|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Frame_Shift_Del_p.G632fs|TRPC7_uc010jei.1_Frame_Shift_Del_p.G577fs|TRPC7_uc010jej.1_Frame_Shift_Del_p.G253fs	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	702_703	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGGTAGAGTTCTTCCTTCATCAAA	0.412													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	143495695	143495696	+	IGR	INS	-	TG	TG	rs57935139		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143495695_143495696insTG								HMHB1 (295413 upstream) : YIPF5 (42035 downstream)																							TAGATTAGCTCtgtgtgtgtgt	0.030													5	4	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154292267	154292267	+	Intron	DEL	A	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154292267delA	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCTAAGTAACAAAAAAAAAAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	10644727	10644730	+	IGR	DEL	CCTG	-	-	rs146524714	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10644727_10644730delCCTG								GCNT2 (15127 upstream) : C6orf52 (26923 downstream)																							ttccttccttcctgcctgcctgcc	0.074													5	5	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32522327	32522328	+	Intron	INS	-	CCCAGTAG	CCCAGTAG	rs144707340	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32522327_32522328insCCCAGTAG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						ACAGGGCTACCCCCAGTGACCT	0.510													5	4	---	---	---	---	
SLC26A8	116369	broad.mit.edu	37	6	35927057	35927057	+	Intron	DEL	T	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35927057delT	uc003olm.2	-						SLC26A8_uc010jwa.2_Intron|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						ATCTTGTGCCTTTTTTTTTTC	0.413													6	3	---	---	---	---	
RNGTT	8732	broad.mit.edu	37	6	89342264	89342265	+	Intron	DEL	AC	-	-	rs72317268		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89342264_89342265delAC	uc003pmr.2	-						RNGTT_uc003pms.2_Intron|RNGTT_uc011dzu.1_Intron	NM_003800	NP_003791	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase						interspecies interaction between organisms|mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	GTP binding|mRNA guanylyltransferase activity|polynucleotide 5'-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		agacacacagacacacacacac	0.193													4	2	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117704316	117704316	+	Intron	DEL	G	-	-	rs4945582	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117704316delG	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CAAATAAGGCGCTTTTTTTTC	0.308			T	GOPC|ROS1	glioblastoma|NSCLC								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168087718	168087719	+	Intron	DEL	TG	-	-	rs141067302		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168087718_168087719delTG	uc003qvy.1	-											Homo sapiens cDNA FLJ32038 fis, clone NTONG2000583.																		tttgtgtgattgtgtgtgtgtg	0.228													1	5	---	---	---	---	
INTS1	26173	broad.mit.edu	37	7	1514107	1514108	+	Intron	INS	-	AC	AC	rs143283428	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1514107_1514108insAC	uc003skn.2	-						INTS1_uc003skm.1_Intron	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GCTGCCCCCCAACCACCCTCCT	0.728													4	3	---	---	---	---	
EIF3B	8662	broad.mit.edu	37	7	2403105	2403106	+	Intron	INS	-	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2403105_2403106insA	uc003slx.2	+						EIF3B_uc003sly.2_Intron|EIF3B_uc003slz.1_Intron|EIF3B_uc003sma.2_Intron	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		gactctgtctcaaaaaaaaaag	0.183													5	3	---	---	---	---	
BZW2	28969	broad.mit.edu	37	7	16725502	16725503	+	Intron	DEL	TT	-	-	rs148097168		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16725502_16725503delTT	uc003stl.2	+						BZW2_uc011jxx.1_Intron|BZW2_uc003stm.2_Intron|BZW2_uc003stj.2_Intron|BZW2_uc003stk.2_Intron|BZW2_uc003stn.1_Intron|BZW2_uc003sto.1_Intron|BZW2_uc003stp.2_Intron|BZW2_uc010kua.2_Intron	NM_001159767	NP_001153239	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2						cell differentiation|nervous system development|RNA metabolic process		protein binding			ovary(2)	2	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		tttctttttctttttttttttt	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	88269890	88269891	+	IGR	INS	-	T	T	rs113056340		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88269890_88269891insT								STEAP4 (333681 upstream) : ZNF804B (118862 downstream)																							AGAAGGAGCACTTTTTTTTTTT	0.248													4	2	---	---	---	---	
WASL	8976	broad.mit.edu	37	7	123336466	123336467	+	Intron	INS	-	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123336466_123336467insA	uc003vkz.2	-							NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein						actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						GCAGCTGCCTTAAAAAAAAAAA	0.287													4	2	---	---	---	---	
LOC100128542	100128542	broad.mit.edu	37	7	150451251	150451252	+	Intron	INS	-	GAAA	GAAA	rs72059403		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150451251_150451252insGAAA	uc011kuw.1	+							NM_001162367	NP_001155839			hypothetical protein LOC100128542												0						aaggagggaaggaaaggaagga	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2700779	2700784	+	IGR	DEL	ACACAC	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2700779_2700784delACACAC								MYOM2 (607400 upstream) : CSMD1 (92092 downstream)																							caaaaTacatacacacacacacacac	0.068													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50103352	50103355	+	IGR	DEL	CCTC	-	-	rs77568781		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50103352_50103355delCCTC								C8orf22 (114711 upstream) : SNTG1 (718994 downstream)																							ttctttccttcctccctccctccc	0.098													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58332252	58332252	+	IGR	DEL	T	-	-	rs68140715		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58332252delT								C8orf71 (134964 upstream) : FAM110B (574861 downstream)																							aagttttttcttttttttttt	0.000													4	4	---	---	---	---	
LAPTM4B	55353	broad.mit.edu	37	8	98827797	98827797	+	Intron	DEL	T	-	-	rs111936259		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98827797delT	uc003yia.2	+						LAPTM4B_uc010mbg.2_Intron	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			ATACTGGAAAttttttttttt	0.159													4	2	---	---	---	---	
FXN	2395	broad.mit.edu	37	9	71668387	71668388	+	Intron	INS	-	GATGGATG	GATGGATG	rs73647061	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71668387_71668388insGATGGATG	uc004aha.2	+						FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Intron	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein						cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						actctgtcatagatggatggat	0.069													4	3	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14709868	14709872	+	Intron	DEL	AGTAG	-	-	rs113901025		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14709868_14709872delAGTAG	uc001ina.1	-						FAM107B_uc010qbu.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						ATAAATGCCAAGTAGAGTAGAGTAA	0.434													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34255570	34255571	+	IGR	INS	-	C	C			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34255570_34255571insC								NRP1 (631564 upstream) : PARD3 (144527 downstream)																							ccttccttcctttcttcctttc	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35956531	35956543	+	IGR	DEL	TCACTACCACCCC	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35956531_35956543delTCACTACCACCCC								FZD8 (26169 upstream) : None (None downstream)																							accaccaccatcactaccaccccccaccatcac	0.000													4	2	---	---	---	---	
ASCC1	51008	broad.mit.edu	37	10	73949561	73949562	+	Intron	DEL	AA	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73949561_73949562delAA	uc001jst.1	-						ASCC1_uc001jsr.1_Intron|ASCC1_uc001jss.1_Intron|ASCC1_uc001jsu.1_Intron|ASCC1_uc010qju.1_Intron			Q8N9N2	ASCC1_HUMAN	RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0						actccatctcaaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13125675	13125675	+	IGR	DEL	A	-	-	rs148991958		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13125675delA								RASSF10 (93028 upstream) : ARNTL (173650 downstream)																							gaaagaaaagaaaaaaaagaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	46191164	46191164	+	IGR	DEL	G	-	-	rs56217151		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46191164delG								PHF21A (48179 upstream) : CREB3L1 (108064 downstream)																							aaggaaggaaggaaagaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64211760	64211763	+	IGR	DEL	TTCC	-	-	rs7943485	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64211760_64211763delTTCC								RPS6KA4 (72074 upstream) : SLC22A11 (111335 downstream)																							ctttctttctttccttccttcctt	0.000													6	4	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892834	76892835	+	Intron	INS	-	G	G	rs11371875		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892834_76892835insG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						tgtttttttttttttttttttt	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	98001221	98001222	+	IGR	INS	-	A	A	rs140908201	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98001221_98001222insA								None (None upstream) : CNTN5 (890649 downstream)																							GGCTTTCCTACAAAAAACATAG	0.381													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115497786	115497787	+	IGR	DEL	TT	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115497786_115497787delTT								CADM1 (122545 upstream) : None (None downstream)																							ttccccctcctttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	9122131	9122131	+	IGR	DEL	A	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9122131delA								M6PR (19879 upstream) : KLRG1 (20090 downstream)																							TATTTTAGTTaaaaaaaaaag	0.249													3	3	---	---	---	---	
MIR1293	100302220	broad.mit.edu	37	12	50627995	50627995	+	RNA	DEL	T	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50627995delT	hsa-mir-1293|MI0006355	-			c.1delT			LIMA1_uc001rwj.3_Intron|LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron																	0						CAGAACAACCttttttttttt	0.229													5	4	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54730822	54730829	+	Intron	DEL	AAAAAAAG	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54730822_54730829delAAAAAAAG	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron|uc010sou.1_5'Flank|MIR148B_hsa-mir-148b|MI0000811_5'Flank	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						aaaaaaaaaaaaaaaaagaaGCCCCTGA	0.197													9	4	---	---	---	---	
DOCK9	23348	broad.mit.edu	37	13	99567413	99567414	+	Intron	DEL	GT	-	-	rs150790463		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99567413_99567414delGT	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron|DOCK9_uc010afu.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTCAGGGAAGTAAGTTATAAT	0.252													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106824931	106824932	+	Intron	INS	-	CT	CT	rs145829689	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106824931_106824932insCT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						TAGAGCTGCCCGTTTTCAGTGG	0.559													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63320780	63320783	+	IGR	DEL	ACAC	-	-	rs146009293		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63320780_63320783delACAC								TLN2 (183953 upstream) : TPM1 (14055 downstream)																							acacatgtatacacacacacacac	0.368													4	2	---	---	---	---	
ARNT2	9915	broad.mit.edu	37	15	80806062	80806063	+	Intron	INS	-	AAAAA	AAAAA	rs36113299		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80806062_80806063insAAAAA	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			TCTTCAGTCACaaaaaaaaaaa	0.406													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84063020	84063021	+	IGR	INS	-	AGGG	AGGG	rs59433795	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84063020_84063021insAGGG								BNC1 (109552 upstream) : SH3GL3 (53070 downstream)																							gggaggaaggaagggagggagg	0.153													3	3	---	---	---	---	
TTLL13	440307	broad.mit.edu	37	15	90795053	90795054	+	Intron	INS	-	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90795053_90795054insA	uc002bpd.1	+						TTLL13_uc002bpe.1_Intron	NM_001029964	NP_001025135	A6NNM8	TTL13_HUMAN	tubulin tyrosine ligase-like family, member 13						protein modification process		ATP binding|tubulin-tyrosine ligase activity				0	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TCACAGTAAACAAGAAAAAAAA	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33395820	33395821	+	IGR	INS	-	CAG	CAG	rs144984499	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33395820_33395821insCAG								SLC6A10P (499357 upstream) : MIR1826 (569687 downstream)																							aataataataataataatTTTT	0.183													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34858334	34858341	+	IGR	DEL	TCCTTCCT	-	-	rs144688987	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34858334_34858341delTCCTTCCT								LOC146481 (143367 upstream) : None (None downstream)																							cttttctttatccttccttccttccttc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46421815	46421815	+	IGR	DEL	C	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46421815delC								None (None upstream) : ANKRD26P1 (81434 downstream)																							caaaagaaatcatcaaatgga	0.000													4	2	---	---	---	---	
MPRIP	23164	broad.mit.edu	37	17	17064775	17064776	+	Intron	INS	-	C	C	rs72535824		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17064775_17064776insC	uc002gqu.1	+						MPRIP_uc002gqv.1_Intron|MPRIP_uc002gqw.1_Intron	NM_201274	NP_958431	Q6WCQ1	MPRIP_HUMAN	myosin phosphatase-Rho interacting protein							cytoplasm|cytoskeleton	actin binding				0						CTGAGCAGGGGTGTCTCCCAGG	0.569													2	5	---	---	---	---	
C18orf34	374864	broad.mit.edu	37	18	30951748	30951749	+	Intron	INS	-	ACAC	ACAC	rs146013235	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30951748_30951749insACAC	uc002kxn.2	-						C18orf34_uc010xbr.1_Intron|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Intron|C18orf34_uc002kxp.2_Intron	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1											ovary(1)	1						TAAacatatatacacacacaca	0.228													4	2	---	---	---	---	
MIR520F	574464	broad.mit.edu	37	19	54185252	54185253	+	5'Flank	INS	-	G	G	rs6509808		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54185252_54185253insG	hsa-mir-520f|MI0003146	+																							0						ggtcttgatctcctgacctcgt	0.040													4	3	---	---	---	---	
PDRG1	81572	broad.mit.edu	37	20	30542460	30542461	+	5'Flank	INS	-	AAGG	AAGG	rs34345343		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30542460_30542461insAAGG	uc002wxd.2	-							NM_030815	NP_110442	Q9NUG6	PDRG1_HUMAN	p53 and DNA damage-regulated protein						protein folding	prefoldin complex	unfolded protein binding				0			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			agaaagaaagaaaggaaggaag	0.005													6	6	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32376885	32376885	+	Intron	DEL	T	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32376885delT	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron|ZNF341_uc002wzz.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						AGGCCTCTCCttttttttttt	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	23934705	23934706	+	IGR	INS	-	CACA	CACA	rs139246737	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23934705_23934706insCACA								None (None upstream) : None (None downstream)																							ttctcaccatgcacacacacac	0.040													4	4	---	---	---	---	
SETD4	54093	broad.mit.edu	37	21	37420404	37420407	+	Intron	DEL	AGGC	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37420404_37420407delAGGC	uc002yuw.1	-						SETD4_uc002yux.1_Intron|SETD4_uc002yuu.2_Intron|SETD4_uc002yuv.2_Intron|SETD4_uc002yuy.2_Intron|SETD4_uc002yuz.2_Intron|SETD4_uc002yva.2_Intron	NM_017438	NP_059134	Q9NVD3	SETD4_HUMAN	SET domain containing 4 isoform a											large_intestine(1)|ovary(1)	2						ggagggaggaaggcaggcaggcag	0.147													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44756755	44756755	+	IGR	DEL	A	-	-			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756755delA								CRYAA (163842 upstream) : SIK1 (77643 downstream)																							caccatcaccaccaccatcac	0.000													6	3	---	---	---	---	
SLC19A1	6573	broad.mit.edu	37	21	46935342	46935343	+	3'UTR	INS	-	C	C	rs148071918	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46935342_46935343insC	uc002zhl.1	-	6					SLC19A1_uc010gpy.1_Intron|SLC19A1_uc011aft.1_3'UTR|SLC19A1_uc002zhm.1_Intron|SLC19A1_uc010gpz.1_3'UTR	NM_194255	NP_919231	P41440	S19A1_HUMAN	solute carrier family 19 member 1						folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity				0				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)		TCTTCCAGCAACAAAGCCCGCG	0.668													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25855683	25855684	+	Intron	DEL	GT	-	-	rs72063487		TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25855683_25855684delGT	uc003abt.2	+						uc003abu.2_Intron|uc003abv.2_Intron					Homo sapiens cDNA clone IMAGE:3542716, partial cds.																		CTGGCAGCTGgtgtgtgtgtgt	0.401													4	2	---	---	---	---	
SH3BP1	23616	broad.mit.edu	37	22	38041195	38041196	+	Intron	INS	-	C	C	rs143917543	by1000genomes	TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38041195_38041196insC	uc003ati.2	+						SH3BP1_uc003atg.1_Intron|SH3BP1_uc011anl.1_Intron|SH3BP1_uc003ath.1_Intron|SH3BP1_uc003atj.1_Intron|SH3BP1_uc003atk.1_Intron|uc003atl.1_Intron	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1						signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					ggtggcctggactaggacagag	0.203													4	6	---	---	---	---	
SMC1B	27127	broad.mit.edu	37	22	45750241	45750242	+	Intron	INS	-	GTATGTAT	GTATGTAT			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45750241_45750242insGTATGTAT	uc003bgc.2	-						SMC1B_uc003bgd.2_Intron	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes						chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GTTCTGATAGGgtatgtatgta	0.149													3	3	---	---	---	---	
STAG2	10735	broad.mit.edu	37	X	123197782	123197783	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BP-5191-01A-01D-1429-08	TCGA-BP-5191-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123197782_123197783insA	uc004etz.3	+	19	2245_2246	c.1906_1907insA	c.(1906-1908)TACfs	p.Y636fs	STAG2_uc004eua.2_Frame_Shift_Ins_p.Y636fs|STAG2_uc004eub.2_Frame_Shift_Ins_p.Y636fs|STAG2_uc004euc.2_Frame_Shift_Ins_p.Y636fs|STAG2_uc004eud.2_Frame_Shift_Ins_p.Y636fs|STAG2_uc004eue.2_Frame_Shift_Ins_p.Y636fs	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	636					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TTCTAAAACTTACCATGCACTC	0.356													40	37	---	---	---	---	
