Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ANGPTL7	10218	broad.mit.edu	37	1	11254587	11254587	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11254587C>A	uc001ase.2	+	4	981	c.742C>A	c.(742-744)CGC>AGC	p.R248S	MTOR_uc001asd.2_Intron	NM_021146	NP_066969	O43827	ANGL7_HUMAN	angiopoietin-like 7 precursor	248	Fibrinogen C-terminal.				response to oxidative stress|signal transduction	extracellular region	receptor binding				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.39e-06)|COAD - Colon adenocarcinoma(227;0.000244)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0487)		CAACAGCTATCGCCTCTTCCT	0.517													62	144	---	---	---	---	PASS
PAFAH2	5051	broad.mit.edu	37	1	26288568	26288568	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26288568T>G	uc001bld.3	-	11	1271	c.1091A>C	c.(1090-1092)AAA>ACA	p.K364T	PAFAH2_uc001ble.3_Missense_Mutation_p.K364T	NM_000437	NP_000428	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2	364					lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding			ovary(2)	2		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		ATAGTCTTCTTTCAGGTCTGA	0.483													67	189	---	---	---	---	PASS
WASF2	10163	broad.mit.edu	37	1	27739130	27739130	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27739130A>T	uc001bof.1	-	7	976	c.760T>A	c.(760-762)TCT>ACT	p.S254T	WASF2_uc010ofl.1_Missense_Mutation_p.S254T	NM_006990	NP_008921	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	254					actin cytoskeleton organization|G-protein signaling, coupled to cAMP nucleotide second messenger	actin cytoskeleton|lamellipodium	actin binding			skin(2)|ovary(1)	3		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		GAAGAAGCAGAGTCTGACTGT	0.502													18	105	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111861178	111861178	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111861178C>A	uc001eas.2	+	9	896	c.793C>A	c.(793-795)CCT>ACT	p.P265T	CHIA_uc001ear.2_Missense_Mutation_p.P157T|CHIA_uc001eaq.2_Missense_Mutation_p.P157T|CHIA_uc009wgc.2_Missense_Mutation_p.P157T|CHIA_uc001eat.2_Missense_Mutation_p.P104T|CHIA_uc001eav.2_Missense_Mutation_p.P104T|CHIA_uc001eau.2_Missense_Mutation_p.P104T|CHIA_uc009wgd.2_Missense_Mutation_p.P104T	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	265					apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		CGTTGGATTCCCTACCTATGG	0.532													37	167	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004409	148004409	+	3'UTR	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004409T>C	uc001eqq.2	-	22					LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_3'UTR|NBPF14_uc010pac.1_3'UTR	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832							cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					CTGGCATGGTTTGAGAATAGG	0.493													5	56	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155313396	155313396	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155313396T>C	uc009wqq.2	-	23	8614	c.8134A>G	c.(8134-8136)AAA>GAA	p.K2712E	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.K2707E	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2712	BAH.				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AGCACGTACTTTTCATTCTTC	0.478													15	61	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247486484	247486484	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247486484T>C	uc001ico.2	-	5	1088	c.623A>G	c.(622-624)CAG>CGG	p.Q208R	ZNF496_uc009xgv.2_Missense_Mutation_p.Q208R|ZNF496_uc001icp.2_Missense_Mutation_p.Q208R|ZNF496_uc010pyv.1_Missense_Mutation_p.Q208R	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	208					positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			GGTCACCTGCTGTGTGTCCCG	0.532													8	116	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24494732	24494732	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24494732C>G	uc002rfe.2	-	19	2418	c.2160G>C	c.(2158-2160)CAG>CAC	p.Q720H	ITSN2_uc002rff.2_Missense_Mutation_p.Q693H|ITSN2_uc002rfg.2_Missense_Mutation_p.Q720H	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	720	Potential.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ttttttcttcctggagtcgct	0.020													46	156	---	---	---	---	PASS
LBH	81606	broad.mit.edu	37	2	30454520	30454520	+	5'UTR	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30454520C>G	uc002rne.2	+	1						NM_030915	NP_112177	Q53QV2	LBH_HUMAN	limb bud and heart development homolog						multicellular organismal development|transcription, DNA-dependent	cytoplasm|nucleolus					0	Acute lymphoblastic leukemia(172;0.155)					CCTGCCGTGCCCGTCTGCGCC	0.647													10	27	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33518334	33518334	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33518334C>T	uc002ros.2	+	20	3223	c.3223C>T	c.(3223-3225)CAC>TAC	p.H1075Y	LTBP1_uc002rot.2_Missense_Mutation_p.H749Y|LTBP1_uc002rou.2_Missense_Mutation_p.H748Y|LTBP1_uc002rov.2_Missense_Mutation_p.H695Y|LTBP1_uc010ymz.1_Missense_Mutation_p.H748Y|LTBP1_uc010yna.1_Missense_Mutation_p.H695Y|LTBP1_uc010ynb.1_Missense_Mutation_p.H14Y	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1074	EGF-like 8; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GACTCCGGACCACAAGCACTG	0.428													6	100	---	---	---	---	PASS
PRKCE	5581	broad.mit.edu	37	2	46378281	46378281	+	Silent	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46378281T>C	uc002rut.2	+	13	2030	c.1833T>C	c.(1831-1833)AAT>AAC	p.N611N		NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon	611	Protein kinase.				activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			AGGCCGACAATGAGGACGACC	0.582													9	33	---	---	---	---	PASS
CALM2	805	broad.mit.edu	37	2	47389525	47389525	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47389525C>T	uc002rvt.2	-	4	343	c.185G>A	c.(184-186)GGC>GAC	p.G62D	C2orf61_uc010fbd.2_Intron|CALM2_uc010fbe.2_Intron	NM_001743	NP_001734	P62158	CALM_HUMAN	calmodulin 2	62	EF-hand 2.|2.				activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding	p.0?(2)			0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	GTCAATTGTGCCATTACCTGA	0.358													32	124	---	---	---	---	PASS
CAPG	822	broad.mit.edu	37	2	85626330	85626330	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85626330C>A	uc002spl.1	-	6	845	c.595G>T	c.(595-597)GAC>TAC	p.D199Y	CAPG_uc002spm.1_Missense_Mutation_p.D199Y|CAPG_uc010ysq.1_Missense_Mutation_p.D199Y|CAPG_uc010fgi.1_Missense_Mutation_p.D199Y|CAPG_uc010fgj.1_Missense_Mutation_p.D93Y	NM_001747	NP_001738	P40121	CAPG_HUMAN	gelsolin-like capping protein	199					barbed-end actin filament capping|protein complex assembly	F-actin capping protein complex|melanosome|nuclear membrane|nucleolus	actin binding				0						CGCTCACTGTCCCGGATGGCC	0.602													4	62	---	---	---	---	PASS
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289													5	21	---	---	---	---	PASS
GYPC	2995	broad.mit.edu	37	2	127453643	127453643	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127453643T>G	uc002tnq.2	+	4	468	c.312T>G	c.(310-312)AGT>AGG	p.S104R	GYPC_uc002tnr.2_Missense_Mutation_p.S85R|GYPC_uc010flv.2_RNA	NM_002101	NP_002092	P04921	GLPC_HUMAN	glycophorin C isoform 1	104	Cytoplasmic.					cortical cytoskeleton|integral to plasma membrane	protein binding			central_nervous_system(1)	1	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		TTGCTGAGAGTGCAGATGCAG	0.552													23	101	---	---	---	---	PASS
ACVR2A	92	broad.mit.edu	37	2	148677880	148677880	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148677880G>T	uc002twg.2	+	9	1313	c.1044G>T	c.(1042-1044)GAG>GAT	p.E348D	ACVR2A_uc010zbn.1_Missense_Mutation_p.E240D|ACVR2A_uc002twh.2_Missense_Mutation_p.E348D	NM_001616	NP_001607	P27037	AVR2A_HUMAN	activin A receptor, type IIA precursor	348	Cytoplasmic (Potential).|Protein kinase.			E -> V (in Ref. 4; BAA06548).	activin receptor signaling pathway|BMP signaling pathway|positive regulation of activin receptor signaling pathway|positive regulation of bone mineralization|positive regulation of erythrocyte differentiation|positive regulation of osteoblast differentiation|positive regulation of protein phosphorylation	cytoplasm|inhibin-betaglycan-ActRII complex|integral to plasma membrane	ATP binding|coreceptor activity|inhibin beta-A binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|transforming growth factor beta receptor activity			stomach(8)|large_intestine(2)|lung(1)|breast(1)|kidney(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TAAAATTTGAGGCTGGCAAGT	0.368													4	157	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163695012	163695012	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163695012C>G	uc002uch.1	-	1	229	c.17G>C	c.(16-18)GGG>GCG	p.G6A	KCNH7_uc002uci.2_Missense_Mutation_p.G6A	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	6	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TGCCACATGCCCCCTGCGCAC	0.587													11	63	---	---	---	---	PASS
SESTD1	91404	broad.mit.edu	37	2	179979860	179979860	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179979860T>C	uc002uni.3	-	16	1921	c.1771A>G	c.(1771-1773)ACA>GCA	p.T591A	SESTD1_uc002unh.3_Missense_Mutation_p.T94A	NM_178123	NP_835224	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	591	Spectrin 3.				regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			GATGCTATTGTAAATTGTTTC	0.408													25	112	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190554621	190554621	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190554621C>T	uc002uqw.1	+	2	757	c.757C>T	c.(757-759)CCA>TCA	p.P253S	ANKAR_uc002uqu.2_RNA|ANKAR_uc002uqv.1_Missense_Mutation_p.P324S	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	324	Helical; (Potential).					integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TTTTCTGATTCCATTTCTACT	0.274													4	177	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211421408	211421408	+	5'UTR	SNP	T	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211421408T>A	uc002vee.3	+	1					CPS1_uc010fur.2_Intron	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b						carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		TATCACACAATCTCATAAAAT	0.353													23	62	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183863	10183863	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183863G>A	uc003bvc.2	+	1	545	c.332G>A	c.(331-333)AGC>AAC	p.S111N	VHL_uc003bvd.2_Missense_Mutation_p.S111N	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	111	Involved in binding to CCT complex.		S -> C (in VHLD; type II).|S -> R (in VHLD; type I).|S -> N (in VHLD; type I).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.S111N(3)|p.S111S(2)|p.S111R(2)|p.S111G(2)|p.S111fs*48(1)|p.S111fs*49(1)|p.?(1)|p.I109_R113del(1)|p.S111fs*22(1)|p.S111fs*45(1)|p.H110_S111del(1)|p.S111I(1)|p.S111_Y112del(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CGCATCCACAGCTACCGAGGT	0.642		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				3	7	---	---	---	---	PASS
CAND2	23066	broad.mit.edu	37	3	12858807	12858807	+	Silent	SNP	T	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12858807T>G	uc003bxk.2	+	10	2425	c.2376T>G	c.(2374-2376)GGT>GGG	p.G792G	CAND2_uc003bxj.2_Silent_p.G699G	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	792	HEAT 17.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						CTGTGGATGGTGGGCCTGGCC	0.637													6	77	---	---	---	---	PASS
RPL14	9045	broad.mit.edu	37	3	40498824	40498824	+	5'UTR	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40498824T>C	uc003ckg.2	+	1					RPL14_uc003ckh.2_5'Flank|RPL14_uc003cki.2_5'Flank	NM_003973	NP_003964	P50914	RL14_HUMAN	ribosomal protein L14						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TGGGCGGGTCTTCTTCCTTCT	0.572													7	17	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52696169	52696169	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52696169G>A	uc003des.2	-	4	520	c.508C>T	c.(508-510)CAG>TAG	p.Q170*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.Q170*|PBRM1_uc003der.2_Nonsense_Mutation_p.Q170*|PBRM1_uc003det.2_Nonsense_Mutation_p.Q170*|PBRM1_uc003deu.2_Nonsense_Mutation_p.Q170*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.Q170*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.Q170*|PBRM1_uc003dey.2_Nonsense_Mutation_p.Q170*|PBRM1_uc003dez.1_Nonsense_Mutation_p.Q170*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.Q68*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	170					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ACTGTGCCCTGATTGTCTTGC	0.493			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								107	251	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132361598	132361598	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132361598G>A	uc003eov.3	-	3	678	c.298C>T	c.(298-300)CCC>TCC	p.P100S	ACAD11_uc003eoy.2_Missense_Mutation_p.P100S	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	100						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						TTGGGAACGGGGAATCCAATT	0.323													5	253	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184040913	184040913	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184040913C>A	uc003fnp.2	+	14	2170	c.1972C>A	c.(1972-1974)CAA>AAA	p.Q658K	EIF4G1_uc003fno.1_Missense_Mutation_p.Q599K|EIF4G1_uc010hxw.1_Missense_Mutation_p.Q494K|EIF4G1_uc003fnt.2_Missense_Mutation_p.Q369K|EIF4G1_uc003fnq.2_Missense_Mutation_p.Q571K|EIF4G1_uc003fnr.2_Missense_Mutation_p.Q494K|EIF4G1_uc010hxx.2_Missense_Mutation_p.Q665K|EIF4G1_uc003fns.2_Missense_Mutation_p.Q618K|EIF4G1_uc010hxy.2_Missense_Mutation_p.Q665K|EIF4G1_uc003fnv.3_Missense_Mutation_p.Q658K|EIF4G1_uc003fnu.3_Missense_Mutation_p.Q658K|EIF4G1_uc003fnw.2_Missense_Mutation_p.Q665K|EIF4G1_uc003fnx.2_Missense_Mutation_p.Q462K|EIF4G1_uc003fny.3_Missense_Mutation_p.Q462K|SNORD66_uc003fnz.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	658	MIF4G.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CACTAGACTACAAGGCATAAA	0.562													4	287	---	---	---	---	PASS
GRPEL1	80273	broad.mit.edu	37	4	7064157	7064157	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7064157A>C	uc003gjy.1	-	3	303	c.262T>G	c.(262-264)TTA>GTA	p.L88V	GRPEL1_uc003gjz.1_Missense_Mutation_p.L88V	NM_025196	NP_079472	Q9HAV7	GRPE1_HUMAN	GrpE-like 1, mitochondrial precursor	88					protein folding|protein import into mitochondrial matrix	mitochondrial matrix	adenyl-nucleotide exchange factor activity|chaperone binding|protein homodimerization activity|unfolded protein binding				0						CTCTGCCGTAAGTTCTCAGTG	0.328													7	272	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36130283	36130283	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36130283C>T	uc003gsq.1	-	21	3850	c.3512G>A	c.(3511-3513)AGA>AAA	p.R1171K		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1171	Rho-GAP.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TTTAAAGCTTCTTGCATCCTT	0.363													7	106	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69870669	69870669	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69870669C>A	uc011cao.1	-	9	1517	c.1381G>T	c.(1381-1383)GCT>TCT	p.A461S	UGT2B10_uc011can.1_Missense_Mutation_p.A377S			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GCCACACAGGCCAGCAGGAAC	0.448													10	230	---	---	---	---	PASS
AMBN	258	broad.mit.edu	37	4	71469169	71469169	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71469169A>C	uc003hfl.2	+	11	820	c.745A>C	c.(745-747)AAT>CAT	p.N249H		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	249					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			TTTTGGAGCAAATCAATTGGT	0.274													15	149	---	---	---	---	PASS
RAB33B	83452	broad.mit.edu	37	4	140394375	140394375	+	3'UTR	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140394375G>A	uc003ihv.2	+	2						NM_031296	NP_112586	Q9H082	RB33B_HUMAN	RAB33B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding				0	all_hematologic(180;0.162)					AACTATAATGGGTCATCTTGA	0.299													4	15	---	---	---	---	PASS
GPBP1	65056	broad.mit.edu	37	5	56558502	56558502	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56558502A>G	uc003jrh.3	+	12	2619	c.1345A>G	c.(1345-1347)AGC>GGC	p.S449G	GPBP1_uc010iwg.2_Missense_Mutation_p.S469G|GPBP1_uc003jri.3_Missense_Mutation_p.S278G|GPBP1_uc003jrj.3_Missense_Mutation_p.S441G|GPBP1_uc003jrk.3_Missense_Mutation_p.S456G|GPBP1_uc003jrl.3_RNA	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1	449					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		GTGGAAGAACAGCACTTTCAA	0.383													48	136	---	---	---	---	PASS
CWC27	10283	broad.mit.edu	37	5	64314204	64314204	+	3'UTR	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64314204A>C	uc003jtn.1	+	14					CWC27_uc010iwt.1_3'UTR	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0						TGGCCTTGTAACAGCCATTGT	0.353													11	22	---	---	---	---	PASS
C5orf44	80006	broad.mit.edu	37	5	64946709	64946709	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64946709G>C	uc003jtz.3	+	6	831	c.501G>C	c.(499-501)CAG>CAC	p.Q167H	C5orf44_uc003jua.3_Missense_Mutation_p.Q167H|C5orf44_uc003juc.3_Missense_Mutation_p.Q167H|C5orf44_uc010iwv.2_Missense_Mutation_p.Q167H	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2	167										ovary(1)	1						TCAAATTTCAGGTATTGAATA	0.338													11	46	---	---	---	---	PASS
CXCL14	9547	broad.mit.edu	37	5	134907433	134907433	+	3'UTR	SNP	T	C	C	rs71956713		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134907433T>C	uc003lay.2	-	4						NM_004887	NP_004878	O95715	CXL14_HUMAN	small inducible cytokine B14 precursor						cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAAGAAAGGCttttttttttt	0.318													3	8	---	---	---	---	PASS
CTNNA1	1495	broad.mit.edu	37	5	138118951	138118951	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138118951C>G	uc003ldh.2	+	3	286	c.191C>G	c.(190-192)TCT>TGT	p.S64C	CTNNA1_uc011cyx.1_Intron|CTNNA1_uc011cyy.1_Translation_Start_Site|CTNNA1_uc003ldi.2_Missense_Mutation_p.L6V|CTNNA1_uc003ldj.2_Missense_Mutation_p.S64C	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	64	Involved in homodimerization.				adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTGGCTGCATCTGTTGAACAA	0.428													26	103	---	---	---	---	PASS
SNRNP48	154007	broad.mit.edu	37	6	7594021	7594021	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7594021T>A	uc003mxr.2	+	2	270	c.211T>A	c.(211-213)TTG>ATG	p.L71M	SNRNP48_uc003mxs.2_RNA	NM_152551	NP_689764	Q6IEG0	SNR48_HUMAN	U11/U12 snRNP 48K	71	CHHC-type.				mRNA processing	cytoplasm|U12-type spliceosomal complex	metal ion binding				0						TAAATCATCTTTGGCAAAGCA	0.308													49	144	---	---	---	---	PASS
C6orf106	64771	broad.mit.edu	37	6	34664294	34664294	+	Silent	SNP	G	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34664294G>T	uc003ojr.2	-	1	332	c.87C>A	c.(85-87)TCC>TCA	p.S29S	C6orf106_uc003ojs.2_Silent_p.S29S	NM_024294	NP_077270	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106 isoform a	29										skin(2)|ovary(1)	3						TCTGGAACTCGGAGATGAGCA	0.647													3	36	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56472115	56472115	+	Intron	SNP	G	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56472115G>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Silent_p.A1900A	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GACTTAACAAGGCACTTAGCC	0.388													37	129	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97052642	97052642	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97052642A>T	uc003pos.1	+	4	581	c.176A>T	c.(175-177)GAC>GTC	p.D59V	FHL5_uc003pot.1_Missense_Mutation_p.D59V	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	59	LIM zinc-binding 1.					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		TGTTACAAAGACCGGCACTGG	0.433													42	108	---	---	---	---	PASS
LPAL2	80350	broad.mit.edu	37	6	160908435	160908435	+	RNA	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160908435G>A	uc003qtj.2	-	4		c.538C>T			LPAL2_uc011efy.1_RNA	NR_028093				Homo sapiens cDNA FLJ43922 fis, clone TESTI4012406.												0		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		CGAACAATCCGGATTCCTGCA	0.493													9	61	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72413896	72413896	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72413896A>G	uc003twk.2	+	11	3364	c.3364A>G	c.(3364-3366)ACC>GCC	p.T1122A	POM121_uc003twj.2_Missense_Mutation_p.T857A|POM121_uc010lam.1_Missense_Mutation_p.T857A	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	1122	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				AGGCTCCAGCACCACCACCGG	0.637													3	60	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88963886	88963886	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88963886T>G	uc011khi.1	+	4	2128	c.1590T>G	c.(1588-1590)GAT>GAG	p.D530E		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	530						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TCCAAGAAGATTATCAATATC	0.363										HNSCC(36;0.09)			30	95	---	---	---	---	PASS
MTERF	7978	broad.mit.edu	37	7	91503200	91503200	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91503200A>C	uc003ulb.1	-	2	952	c.908T>G	c.(907-909)CTT>CGT	p.L303R	MTERF_uc010let.1_Intron|MTERF_uc003ulc.1_Missense_Mutation_p.L303R|MTERF_uc011khm.1_Missense_Mutation_p.L283R|MTERF_uc010leu.1_Missense_Mutation_p.L283R	NM_006980	NP_008911	Q99551	MTERF_HUMAN	mitochondrial transcription termination factor	303					DNA geometric change|regulation of transcription, DNA-dependent|termination of mitochondrial transcription	mitochondrial nucleoid	double-stranded DNA binding				0	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			AGTACATCCAAGAGAAAACAG	0.408													34	125	---	---	---	---	PASS
IFRD1	3475	broad.mit.edu	37	7	112108122	112108122	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112108122C>G	uc003vgh.2	+	10	1436	c.993C>G	c.(991-993)GAC>GAG	p.D331E	IFRD1_uc011kmn.1_Missense_Mutation_p.D281E|IFRD1_uc003vgj.2_Missense_Mutation_p.D331E|IFRD1_uc011kmo.1_RNA|IFRD1_uc011kmp.1_Missense_Mutation_p.D281E|IFRD1_uc003vgk.2_Missense_Mutation_p.D48E	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	331					multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						CCAAAGTGGACAAGAGAAAGC	0.443													5	81	---	---	---	---	PASS
WRN	7486	broad.mit.edu	37	8	30977877	30977877	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30977877G>A	uc003xio.3	+	21	3355	c.2567G>A	c.(2566-2568)GGT>GAT	p.G856D	WRN_uc010lvk.2_Missense_Mutation_p.G323D	NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	856	Helicase C-terminal.				base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GGTAGAGCTGGTCGTGATGGA	0.393			Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				58	170	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113349868	113349868	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113349868C>A	uc003ynu.2	-	43	6904	c.6745G>T	c.(6745-6747)GAA>TAA	p.E2249*	CSMD3_uc003yns.2_Nonsense_Mutation_p.E1451*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.E2209*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.E2145*|CSMD3_uc003ynw.1_5'UTR	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2249	Extracellular (Potential).|Sushi 12.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGGAAACATTCAAATGAAATG	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			39	165	---	---	---	---	PASS
MTSS1	9788	broad.mit.edu	37	8	125568525	125568525	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125568525G>A	uc003yrk.2	-	12	1886	c.1352C>T	c.(1351-1353)GCA>GTA	p.A451V	NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_5'UTR|MTSS1_uc011lin.1_Missense_Mutation_p.A225V|MTSS1_uc011lio.1_Missense_Mutation_p.A341V|MTSS1_uc003yri.2_Missense_Mutation_p.A169V|MTSS1_uc003yrj.2_Missense_Mutation_p.A426V|MTSS1_uc003yrl.2_Missense_Mutation_p.A455V	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	451					actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTCCTCAGCTGCTGCAGGTGG	0.632													14	45	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18706914	18706914	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18706914C>A	uc003zne.3	+	14	1871	c.1744C>A	c.(1744-1746)CCA>ACA	p.P582T		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	582	TSP type-1 4.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		TTATGCAGGCCCATGCAGCGG	0.577													3	42	---	---	---	---	PASS
TJP2	9414	broad.mit.edu	37	9	71862959	71862959	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71862959G>A	uc004ahe.2	+	19	2899	c.2699G>A	c.(2698-2700)CGC>CAC	p.R900H	TJP2_uc011lrs.1_Missense_Mutation_p.R877H|TJP2_uc004ahd.2_Missense_Mutation_p.R900H|TJP2_uc004ahf.2_Missense_Mutation_p.R900H|TJP2_uc011lru.1_Missense_Mutation_p.R904H|TJP2_uc011lrv.1_Missense_Mutation_p.R922H|TJP2_uc010mom.1_Missense_Mutation_p.R60H	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)	900					cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						CCCGAAGACCGCATGTCCTAC	0.552													4	195	---	---	---	---	PASS
GTF3C5	9328	broad.mit.edu	37	9	135926204	135926204	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135926204A>G	uc004cci.3	+	4	944	c.607A>G	c.(607-609)AAT>GAT	p.N203D	GTF3C5_uc010mzz.2_Missense_Mutation_p.N78D|GTF3C5_uc004ccj.3_Missense_Mutation_p.N203D	NM_012087	NP_036219	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5	203						transcription factor TFIIIC complex	DNA binding|protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		CTCAGGTGAGAATCTGATTGG	0.607													22	118	---	---	---	---	PASS
INPP5E	56623	broad.mit.edu	37	9	139324071	139324071	+	3'UTR	SNP	G	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139324071G>C	uc004cho.2	-	10					INPP5E_uc010nbm.2_3'UTR	NM_019892	NP_063945	Q9NRR6	INP5E_HUMAN	inositol polyphosphate-5-phosphatase E							cilium axoneme|cytoskeleton|Golgi cisterna membrane	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity			skin(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		TTCCCAGTGGGTTTTGATCAA	0.557													73	199	---	---	---	---	PASS
PITRM1	10531	broad.mit.edu	37	10	3209166	3209166	+	Nonsense_Mutation	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3209166A>C	uc010qah.1	-	2	164	c.132T>G	c.(130-132)TAT>TAG	p.Y44*	PITRM1_uc001igr.1_Nonsense_Mutation_p.Y76*|PITRM1_uc001igt.1_Nonsense_Mutation_p.Y76*|PITRM1_uc001igu.1_Nonsense_Mutation_p.Y68*|PITRM1_uc010qai.1_Nonsense_Mutation_p.Y47*|PITRM1_uc001igw.1_Nonsense_Mutation_p.Y76*			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;	44					proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						CCAGGTGTAAATACCTGGCTC	0.398													6	23	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34400114	34400114	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34400114T>C	uc010qej.1	-	25	4054	c.4054A>G	c.(4054-4056)AGG>GGG	p.R1352G	PARD3_uc010qek.1_Missense_Mutation_p.R1349G|PARD3_uc010qel.1_Missense_Mutation_p.R1315G|PARD3_uc010qem.1_Missense_Mutation_p.R1336G|PARD3_uc010qen.1_Missense_Mutation_p.R1306G|PARD3_uc010qeo.1_Missense_Mutation_p.R1269G|PARD3_uc010qep.1_Missense_Mutation_p.R1262G|PARD3_uc010qeq.1_Missense_Mutation_p.R1240G|uc001ixe.1_5'Flank	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	1352					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				TAGAAGGGCCTCCCTTTCTCA	0.507													3	181	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37418819	37418819	+	Splice_Site	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37418819A>G	uc001iza.1	+	2	153	c.54_splice	c.e2-2	p.R18_splice		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TCACTCTCGTAGGACTGCTCT	0.448													11	39	---	---	---	---	PASS
FAM35B2	439965	broad.mit.edu	37	10	47416942	47416942	+	Silent	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47416942C>T	uc010qga.1	+	5	734	c.405C>T	c.(403-405)CTC>CTT	p.L135L	FAM35B2_uc010qfz.1_RNA					SubName: Full=cDNA FLJ59018, highly similar to Protein FAM35A;												0						AGATTCTTCTCAACATTTCTG	0.378													5	145	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89692973	89692973	+	Missense_Mutation	SNP	G	T	T	rs9651492		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89692973G>T	uc001kfb.2	+	6	1488	c.457G>T	c.(457-459)GAT>TAT	p.D153Y		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	153	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.D153N(1)|p.D153fs*27(1)|p.D153Y(1)|p.D153D(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGAGGCCCTAGATTTCTATGG	0.378		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			38	136	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117024695	117024695	+	Silent	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117024695A>G	uc001lcg.2	+	11	2099	c.1713A>G	c.(1711-1713)CCA>CCG	p.P571P		NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	571	Kelch 5.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AAATACTACCAAAACCAAATC	0.244													55	172	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118318744	118318744	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118318744G>T	uc001lcm.2	+	10	1052	c.1009G>T	c.(1009-1011)GAT>TAT	p.D337Y		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	337					lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	GAAAACAAATGATGTGGGCCA	0.368													21	115	---	---	---	---	PASS
CYP2E1	1571	broad.mit.edu	37	10	135345243	135345243	+	Intron	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135345243G>A	uc001lnj.1	+						CYP2E1_uc001lnk.1_Intron|CYP2E1_uc009ybl.1_Intron|CYP2E1_uc009ybm.1_Intron|CYP2E1_uc001lnl.1_5'UTR	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,						drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	CCCAAGGTGCGTATCTGCTGC	0.617									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				13	61	---	---	---	---	PASS
KRTAP5-1	387264	broad.mit.edu	37	11	1605898	1605898	+	Silent	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1605898C>T	uc001ltu.1	-	1	616	c.582G>A	c.(580-582)AAG>AAA	p.K194K	LOC338651_uc009ycx.1_Intron|LOC338651_uc001ltt.1_Intron	NM_001005922	NP_001005922	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	194	8 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CACAACCCCCCTTGGATCCCC	0.672													11	40	---	---	---	---	PASS
OR52E4	390081	broad.mit.edu	37	11	5906001	5906001	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5906001C>T	uc010qzs.1	+	1	479	c.479C>T	c.(478-480)CCA>CTA	p.P160L	TRIM5_uc001mbq.1_Intron	NM_001005165	NP_001005165	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E,	160	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTTGTAACCCCATTTGTGTTT	0.493													63	161	---	---	---	---	PASS
SOX6	55553	broad.mit.edu	37	11	16133398	16133398	+	Silent	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16133398A>G	uc001mme.2	-	7	921	c.888T>C	c.(886-888)GCT>GCC	p.A296A	SOX6_uc001mmd.2_Silent_p.A286A|SOX6_uc001mmf.2_Silent_p.A283A|SOX6_uc001mmg.2_Silent_p.A283A	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	283	Poly-Ala.				muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						GTTGGGCAGCAGCAGCTGCTG	0.488													27	106	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46389268	46389268	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46389268G>A	uc001ncn.1	+	4	1029	c.904G>A	c.(904-906)GGG>AGG	p.G302R	DGKZ_uc001nch.1_Missense_Mutation_p.G130R|DGKZ_uc010rgq.1_Missense_Mutation_p.G79R|DGKZ_uc001ncj.1_Missense_Mutation_p.G79R|DGKZ_uc010rgr.1_Missense_Mutation_p.G78R|DGKZ_uc001nck.1_5'UTR|DGKZ_uc001ncl.2_Missense_Mutation_p.G113R|DGKZ_uc001ncm.2_Missense_Mutation_p.G113R|DGKZ_uc009yky.1_Missense_Mutation_p.G113R|DGKZ_uc010rgs.1_Missense_Mutation_p.G113R|DGKZ_uc001nci.1_Missense_Mutation_p.G79R	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	302	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CTGCTACGTTGGGGAGCAGTA	0.637											OREG0020942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	42	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135733	55135733	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135733G>C	uc010rif.1	+	1	374	c.374G>C	c.(373-375)TGT>TCT	p.C125S		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	125	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TTTCAGGGTTGTATGGCTCAA	0.398													80	282	---	---	---	---	PASS
DPF2	5977	broad.mit.edu	37	11	65107952	65107952	+	Silent	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65107952C>T	uc001odm.2	+	2	141	c.129C>T	c.(127-129)GAC>GAT	p.D43D	DPF2_uc001odn.2_Silent_p.D43D|DPF2_uc010roe.1_Silent_p.D43D	NM_006268	NP_006259	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	43					apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						CTTTCTTGGACTCACAGACCG	0.572													5	172	---	---	---	---	PASS
LRTOMT	220074	broad.mit.edu	37	11	71821373	71821373	+	3'UTR	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71821373A>C	uc010rqv.1	+	9					LRTOMT_uc010rqw.1_3'UTR|LRTOMT_uc001ors.3_3'UTR|C11orf51_uc009ytc.1_Intron|C11orf51_uc001orv.2_Intron|C11orf51_uc001orw.2_Intron	NM_001145309	NP_001138781	Q96E66	LRC51_HUMAN	leucine rich transmembrane and							cytoplasm					0						ATGACCCCCTACCCCGACACT	0.562													18	105	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92532099	92532099	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92532099G>A	uc001pdj.3	+	9	5937	c.5920G>A	c.(5920-5922)GAA>AAA	p.E1974K		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1974	Cadherin 17.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CATGGTTAAAGAAGCCATGGA	0.418										TCGA Ovarian(4;0.039)			63	204	---	---	---	---	PASS
HSPA8	3312	broad.mit.edu	37	11	122929405	122929405	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122929405A>G	uc001pyo.2	-	7	1535	c.1457T>C	c.(1456-1458)CTC>CCC	p.L486P	HSPA8_uc009zbc.2_Missense_Mutation_p.L250P|HSPA8_uc001pyp.2_Intron|HSPA8_uc010rzu.1_Missense_Mutation_p.L409P	NM_006597	NP_006588	P11142	HSP7C_HUMAN	heat shock 70kDa protein 8 isoform 1	486					cellular membrane organization|interspecies interaction between organisms|mRNA metabolic process|negative regulation of transcription, DNA-dependent|neurotransmitter secretion|post-Golgi vesicle-mediated transport|protein folding|response to unfolded protein|transcription, DNA-dependent	cell surface|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|melanosome|plasma membrane|ribonucleoprotein complex	ATP binding|ATPase activity, coupled|protein binding			central_nervous_system(7)|lung(1)	8		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGAGACATTGAGTATACCATT	0.458													48	174	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22069954	22069954	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22069954T>C	uc001rfi.1	-	4	510	c.490A>G	c.(490-492)AAC>GAC	p.N164D	ABCC9_uc001rfh.2_Missense_Mutation_p.N164D|ABCC9_uc001rfj.1_Missense_Mutation_p.N164D	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	164	Extracellular (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AAACGCAGGTTTGATATGTCC	0.423													62	286	---	---	---	---	PASS
SSPN	8082	broad.mit.edu	37	12	26383977	26383977	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26383977A>G	uc001rhe.2	+	3	800	c.700A>G	c.(700-702)ACG>GCG	p.T234A	SSPN_uc001rhd.2_Missense_Mutation_p.T131A|SSPN_uc009zjf.2_Intron|SSPN_uc001rhf.3_Intron	NM_005086	NP_005077	Q14714	SSPN_HUMAN	sarcospan isoform 1	234	Cytoplasmic (Potential).				cell adhesion|muscle contraction	cell junction|dystrophin-associated glycoprotein complex|integral to plasma membrane|postsynaptic membrane|sarcolemma|transport vesicle					0	Colorectal(261;0.0847)					ATGCTCCCTCACGGCTTCCGA	0.458													3	115	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43824240	43824240	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43824240C>A	uc010skx.1	-	23	3296	c.3296G>T	c.(3295-3297)CGA>CTA	p.R1099L	ADAMTS20_uc001rno.1_Missense_Mutation_p.R253L|ADAMTS20_uc001rnp.1_Missense_Mutation_p.R253L	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1099	TSP type-1 6.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TTTAACATCTCGCATCTGATA	0.388													3	81	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199447	86199447	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199447A>C	uc001taf.1	-	2	680	c.341T>G	c.(340-342)TTG>TGG	p.L114W		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	114	Ras-associating.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						TGCTTTAACCAAAACAAATTG	0.468													57	218	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20077377	20077377	+	Translation_Start_Site	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20077377G>A	uc001umd.2	-	2	209	c.-2C>T	c.(-4-0)CACGT>CATGT		TPTE2_uc009zzl.2_Translation_Start_Site|TPTE2_uc001ume.2_Translation_Start_Site|TPTE2_uc009zzm.2_Translation_Start_Site|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid							endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TCATTCATACGTGCCTCTGGG	0.353													12	101	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20601355	20601355	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20601355T>G	uc001umr.2	+	10	2046	c.1748T>G	c.(1747-1749)ATT>AGT	p.I583S	ZMYM2_uc001ums.2_Missense_Mutation_p.I583S|ZMYM2_uc001umt.2_Missense_Mutation_p.I583S|ZMYM2_uc010tco.1_RNA|ZMYM2_uc001umv.2_5'UTR|ZMYM2_uc001umw.2_Missense_Mutation_p.I36S	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	583	MYM-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TTGGGAATTATTTGCCATTTT	0.318													3	20	---	---	---	---	PASS
FAM123A	219287	broad.mit.edu	37	13	25745612	25745612	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25745612C>T	uc001uqb.2	-	1	246	c.146G>A	c.(145-147)TGT>TAT	p.C49Y	FAM123A_uc001uqa.2_Missense_Mutation_p.C49Y|FAM123A_uc001uqc.2_Missense_Mutation_p.C49Y	NM_152704	NP_689917	Q8N7J2	F123A_HUMAN	hypothetical protein LOC219287 isoform 1	49	Gly-rich.									ovary(2)|large_intestine(1)|lung(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TTCGGCGGCACAGTCACAATG	0.657													8	27	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26152975	26152975	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26152975T>C	uc001uqk.2	+	21	1947	c.1805T>C	c.(1804-1806)CTT>CCT	p.L602P	ATP8A2_uc010tdi.1_Missense_Mutation_p.L562P|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.L112P	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	562	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TTTGAGAGACTTTCAAAAGAC	0.383													22	67	---	---	---	---	PASS
ABCC4	10257	broad.mit.edu	37	13	95838971	95838971	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95838971G>A	uc001vmd.3	-	11	1648	c.1529C>T	c.(1528-1530)GCT>GTT	p.A510V	ABCC4_uc010afk.2_Missense_Mutation_p.A510V|ABCC4_uc001vme.2_Missense_Mutation_p.A510V|ABCC4_uc010tih.1_Missense_Mutation_p.A435V|ABCC4_uc001vmf.2_Missense_Mutation_p.A467V|ABCC4_uc010afl.1_Missense_Mutation_p.A467V|ABCC4_uc010afm.1_Missense_Mutation_p.A523V	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	510	ABC transporter 1.				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	CAGAGCACAAGCCTTTATGAC	0.373													16	104	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24878974	24878974	+	Silent	SNP	A	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24878974A>T	uc001wpf.3	+	4	2292	c.1974A>T	c.(1972-1974)GCA>GCT	p.A658A		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	658					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						AAGCACCTGCAGCTTCCAAAG	0.572													6	16	---	---	---	---	PASS
PSMC6	5706	broad.mit.edu	37	14	53185145	53185145	+	Intron	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53185145C>G	uc010tqx.1	+						PSMC6_uc010tqw.1_3'UTR	NM_002806	NP_002797	P62333	PRS10_HUMAN	proteasome 26S ATPase subunit 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding, bridging			lung(1)	1	Breast(41;0.176)					CTCTCTTAATCTGTAATTGTG	0.249													14	75	---	---	---	---	PASS
SERPINA9	327657	broad.mit.edu	37	14	94936172	94936172	+	Silent	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94936172T>C	uc001ydf.2	-	2	221	c.60A>G	c.(58-60)GCA>GCG	p.A20A	SERPINA9_uc001yde.2_Silent_p.A20A|SERPINA9_uc010avc.2_Intron|SERPINA9_uc001ydg.2_Intron|SERPINA9_uc001ydh.1_Silent_p.A20A|SERPINA9_uc001ydi.1_Intron	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade	2					regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		AAAGGTAAGATGCCATTTTGG	0.517													28	70	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31332463	31332463	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31332463A>G	uc001zfm.2	-	17	2236	c.2108T>C	c.(2107-2109)CTG>CCG	p.L703P	TRPM1_uc010azy.2_Missense_Mutation_p.L610P|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	703	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CCAGTTTTTCAGCTCGTAGGT	0.532													3	121	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42632072	42632072	+	Silent	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42632072G>A	uc001zpi.2	+	17	2363	c.2049G>A	c.(2047-2049)CTG>CTA	p.L683L		NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	683					carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		GGTATTCTCTGTTCTACCATG	0.517													30	87	---	---	---	---	PASS
PRSS27	83886	broad.mit.edu	37	16	2764245	2764245	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2764245A>C	uc002crf.2	-	4	720	c.329T>G	c.(328-330)GTG>GGG	p.V110G	PRSS27_uc002cre.2_Missense_Mutation_p.V74G|PRSS27_uc002crg.2_Missense_Mutation_p.V8G|PRSS27_uc010bst.1_Missense_Mutation_p.V8G	NM_031948	NP_114154	Q9BQR3	PRS27_HUMAN	marapsin precursor	110	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						GTTGCTCTCCACCTGCCTCAC	0.662													5	35	---	---	---	---	PASS
PRSS21	10942	broad.mit.edu	37	16	2871075	2871075	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2871075G>T	uc002crt.2	+	5	776	c.670G>T	c.(670-672)GCT>TCT	p.A224S	PRSS21_uc002crs.2_Missense_Mutation_p.A222S|PRSS21_uc002crr.2_Intron	NM_006799	NP_006790	Q9Y6M0	TEST_HUMAN	testisin isoform 1	224	Peptidase S1.				proteolysis	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	serine-type endopeptidase activity			ovary(1)|skin(1)	2						CATGGTTTGTGCTGGCAATGC	0.502													83	426	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15719413	15719413	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15719413C>A	uc002ddr.2	-	8	1962	c.1769G>T	c.(1768-1770)TGT>TTT	p.C590F	KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Missense_Mutation_p.C586F|KIAA0430_uc010uzw.1_Missense_Mutation_p.C588F	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	589						peroxisome	nucleotide binding|RNA binding				0						CTTTGTTTCACAGAGTTCTCT	0.373													40	182	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30495241	30495241	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30495241C>G	uc002dyi.3	+	8	992	c.816C>G	c.(814-816)AAC>AAG	p.N272K	ITGAL_uc010veu.1_RNA|ITGAL_uc002dyj.3_Missense_Mutation_p.N189K|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	272	VWFA.|Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	ACAGTGGCAACATCGATGCGG	0.587													56	217	---	---	---	---	PASS
SLC5A2	6524	broad.mit.edu	37	16	31500191	31500191	+	Intron	SNP	T	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31500191T>A	uc002ecf.3	+						SLC5A2_uc010car.2_Intron|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose						carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						TCCGACGGCCTCCGCCGCAGG	0.706													6	47	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61851421	61851421	+	Silent	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61851421C>A	uc002eog.1	-	7	1491	c.1239G>T	c.(1237-1239)GTG>GTT	p.V413V	CDH8_uc002eoh.2_Silent_p.V182V	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	413	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CACGAGCAGTCACTTGCCCAA	0.428													26	101	---	---	---	---	PASS
CHRNB1	1140	broad.mit.edu	37	17	7350951	7350951	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7350951C>A	uc002ghb.2	+	6	633	c.592C>A	c.(592-594)CAT>AAT	p.H198N	CHRNB1_uc010vty.1_Missense_Mutation_p.H126N|CHRNB1_uc010vtz.1_Missense_Mutation_p.H32N	NM_000747	NP_000738	P11230	ACHB_HUMAN	nicotinic acetylcholine receptor beta 1 subunit	198	Extracellular (Potential).				behavioral response to nicotine|muscle contraction|muscle fiber development|neuromuscular synaptic transmission|postsynaptic membrane organization|regulation of membrane potential|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine binding|receptor activity			ovary(2)	2		Prostate(122;0.157)				AATCCACATTCATGAAGGGAC	0.423													7	131	---	---	---	---	PASS
FAM18B2	201158	broad.mit.edu	37	17	15406151	15406151	+	3'UTR	SNP	G	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15406151G>T	uc002goq.2	-	6					CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	NM_145301	NP_660344	Q96ET8	F18B2_HUMAN	hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)		tctctcCTGCGAGGAGCTTCA	0.269													3	37	---	---	---	---	PASS
GOSR1	9527	broad.mit.edu	37	17	28849291	28849291	+	Silent	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28849291C>T	uc002hfe.2	+	9	674	c.648C>T	c.(646-648)AAC>AAT	p.N216N	GOSR1_uc002hfd.2_Silent_p.N214N|GOSR1_uc002hff.2_Silent_p.N151N	NM_004871	NP_004862	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1 isoform 1	216	Cytoplasmic (Potential).				intra-Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|SNARE complex	SNAP receptor activity				0						CTGCTGTAAACAGCCTGATCC	0.468													186	553	---	---	---	---	PASS
AOC2	314	broad.mit.edu	37	17	40997546	40997546	+	Silent	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40997546T>C	uc002ibu.2	+	1	938	c.903T>C	c.(901-903)TCT>TCC	p.S301S	AOC2_uc002ibt.2_Silent_p.S301S	NM_009590	NP_033720	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 isoform b	301					catecholamine metabolic process|visual perception	cytoplasm|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|electron carrier activity|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			ovary(2)	2		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CTCGGAACTCTCCAGGTCCTC	0.557													35	128	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43596475	43596475	+	5'Flank	SNP	G	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43596475G>T	uc010wjq.1	-						uc010wjr.1_5'Flank|uc010wjs.1_5'Flank|uc010wjt.1_3'UTR					Homo sapiens cDNA FLJ10120 fis, clone HEMBA1002863.												0						GTTTCCTGTGGTTGGCAGTTT	0.433													11	502	---	---	---	---	PASS
MYOM1	8736	broad.mit.edu	37	18	3119942	3119942	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3119942T>A	uc002klp.2	-	20	3377	c.3043A>T	c.(3043-3045)AAC>TAC	p.N1015Y	MYOM1_uc002klq.2_Missense_Mutation_p.N919Y	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	1015	Fibronectin type-III 4.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CCAGCCATGTTCATGGCTGCC	0.498													4	18	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14542654	14542654	+	Silent	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14542654C>A	uc010dln.2	-	1	946	c.492G>T	c.(490-492)ACG>ACT	p.T164T	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	164	ANK 1.									skin(3)	3						TGTTCATGTCCGTGTCCCTGA	0.592													5	254	---	---	---	---	PASS
MEP1B	4225	broad.mit.edu	37	18	29775406	29775406	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29775406A>G	uc002kxj.3	+	5	255	c.208A>G	c.(208-210)AGA>GGA	p.R70G		NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor	70	Extracellular (Potential).|Metalloprotease.				digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						AGAAAAGTATAGATGGCCTCA	0.338													22	62	---	---	---	---	PASS
BCL2	596	broad.mit.edu	37	18	60985489	60985489	+	Silent	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60985489G>A	uc002lit.1	-	2	904	c.411C>T	c.(409-411)CTC>CTT	p.L137L	BCL2_uc002liu.1_Silent_p.L137L|BCL2_uc002liv.1_Silent_p.L137L	NM_000633	NP_000624	P10415	BCL2_HUMAN	B-cell lymphoma protein 2 alpha isoform	137	BH1.				activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CGTCCCTGAAGAGCTCCTCCA	0.657			T	IGH@	NHL|CLL								24	99	---	---	---	---	PASS
ADNP2	22850	broad.mit.edu	37	18	77896105	77896105	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77896105C>T	uc002lnw.2	+	4	3264	c.2809C>T	c.(2809-2811)CGC>TGC	p.R937C		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	937					cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CCATTTGGTGCGCTGCAGAAG	0.557													4	155	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7806690	7806690	+	3'UTR	SNP	T	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7806690T>A	uc002mht.2	-	7					CD209_uc010xju.1_3'UTR|CD209_uc010dvp.2_3'UTR|CD209_uc002mhr.2_3'UTR|CD209_uc002mhs.2_3'UTR|CD209_uc002mhu.2_3'UTR|CD209_uc010dvq.2_3'UTR|CD209_uc002mhq.2_3'UTR|CD209_uc002mhv.2_3'UTR|CD209_uc002mhx.2_3'UTR|CD209_uc002mhw.2_3'UTR|CD209_uc010dvr.2_3'UTR	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1						cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						GCTTGTCTCCTCCTTTGGCAA	0.468													4	32	---	---	---	---	PASS
KLHL26	55295	broad.mit.edu	37	19	18778755	18778755	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18778755C>G	uc002njz.1	+	3	575	c.548C>G	c.(547-549)TCG>TGG	p.S183W		NM_018316	NP_060786	Q53HC5	KLH26_HUMAN	kelch-like 26	183	BACK.									ovary(1)	1						CTGCGAGAGTCGGTGGATGCC	0.632													23	79	---	---	---	---	PASS
SHKBP1	92799	broad.mit.edu	37	19	41083150	41083150	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41083150C>A	uc002oob.2	+	2	149	c.100C>A	c.(100-102)CGC>AGC	p.R34S	SHKBP1_uc002ooc.2_Missense_Mutation_p.R34S|SHKBP1_uc002ood.2_Missense_Mutation_p.R34S|SHKBP1_uc010xvl.1_5'UTR|SHKBP1_uc002ooe.2_5'UTR|SHKBP1_uc002oof.2_5'Flank|SHKBP1_uc010xvm.1_5'Flank	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	34	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAGTACCTCTCGCCAGACTCT	0.617													4	125	---	---	---	---	PASS
PSG3	5671	broad.mit.edu	37	19	43243171	43243171	+	Silent	SNP	A	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43243171A>T	uc002oue.2	-	2	267	c.135T>A	c.(133-135)GTT>GTA	p.V45V	PSG3_uc002ouf.2_RNA|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_Silent_p.V67V	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	45	Ig-like V-type.				defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				TCCCCTTGGAAACTTTGGTTG	0.463													58	313	---	---	---	---	PASS
ZNF221	7638	broad.mit.edu	37	19	44471076	44471076	+	Silent	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44471076T>C	uc002oxx.2	+	6	1750	c.1422T>C	c.(1420-1422)GGT>GGC	p.G474G	ZNF221_uc010ejb.1_Silent_p.G474G|ZNF221_uc010xws.1_Silent_p.G474G	NM_013359	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	474					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Prostate(69;0.0352)				TCCACACGGGTGAGAGACCCT	0.458													3	158	---	---	---	---	PASS
RSPH6A	81492	broad.mit.edu	37	19	46317992	46317992	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46317992T>G	uc002pdm.2	-	1	586	c.443A>C	c.(442-444)CAG>CCG	p.Q148P		NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	148						intracellular				ovary(1)|central_nervous_system(1)	2						GAGGTTGAACTGGCCCAAGGG	0.607													20	65	---	---	---	---	PASS
ZNF83	55769	broad.mit.edu	37	19	53116221	53116221	+	3'UTR	SNP	T	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53116221T>A	uc002pzu.3	-	2					ZNF83_uc002pzv.3_3'UTR|ZNF83_uc010eps.2_3'UTR|ZNF83_uc010ept.2_3'UTR|ZNF83_uc010epu.2_3'UTR|ZNF83_uc010epv.2_3'UTR|ZNF83_uc010epw.2_3'UTR|ZNF83_uc010epx.2_3'UTR|ZNF83_uc010epy.2_3'UTR|ZNF83_uc010epz.2_3'UTR	NM_018300	NP_060770	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		GTATAAATTATTGTATGTCTT	0.353													17	40	---	---	---	---	PASS
CRYAA	1409	broad.mit.edu	37	21	44589355	44589355	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44589355G>A	uc002zdd.1	+	1	215	c.146G>A	c.(145-147)CGC>CAC	p.R49H		NM_000394	NP_000385	P02489	CRYAA_HUMAN	crystallin, alpha A	49			R -> C (in ADC; nuclear cataract).		anti-apoptosis|negative regulation of intracellular transport|protein homooligomerization|response to heat|visual perception	cytoplasm|nucleus	structural constituent of eye lens|unfolded protein binding			breast(1)|central_nervous_system(1)	2						CCCTACTACCGCCAGTCCCTC	0.632													9	130	---	---	---	---	PASS
LRRC3	81543	broad.mit.edu	37	21	45876771	45876771	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45876771G>A	uc002zfa.2	+	2	537	c.244G>A	c.(244-246)GGG>AGG	p.G82R		NM_030891	NP_112153	Q9BY71	LRRC3_HUMAN	leucine-rich repeat-containing 3 precursor	82	LRR 1.					integral to membrane	protein binding				0		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		CCTCCCGGACGGGGCCTTCCA	0.677													17	85	---	---	---	---	PASS
ADORA2A	135	broad.mit.edu	37	22	24836571	24836571	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24836571G>A	uc002zzx.2	+	5	1116	c.353G>A	c.(352-354)GGC>GAC	p.G118D	ADORA2A_uc002zzy.3_Missense_Mutation_p.G118D|ADORA2A_uc011ajs.1_5'UTR|ADORA2A_uc010gup.2_Missense_Mutation_p.G118D|ADORA2A_uc010guq.2_Missense_Mutation_p.G118D|ADORA2A_uc003aab.2_Missense_Mutation_p.G118D|ADORA2A_uc003aac.2_5'UTR|C22orf45_uc003aad.1_Intron	NM_000675	NP_000666	P29274	AA2AR_HUMAN	adenosine A2a receptor	118	Cytoplasmic.				apoptosis|blood coagulation|cAMP biosynthetic process|cellular defense response|inflammatory response|nerve growth factor receptor signaling pathway|phagocytosis|sensory perception	integral to plasma membrane|membrane fraction	enzyme binding				0	Colorectal(2;0.196)				Caffeine(DB00201)|Defibrotide(DB04932)|Pegademase bovine(DB00061)|Theophylline(DB00277)	TTGGTGACCGGCACGAGGGCT	0.572													5	192	---	---	---	---	PASS
MN1	4330	broad.mit.edu	37	22	28192870	28192870	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28192870G>A	uc003adj.2	-	1	4617	c.3662C>T	c.(3661-3663)GCA>GTA	p.A1221V		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	1221							binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						GCTGTGCTCTGCCATCAGCGA	0.667			T	ETV6	AML|meningioma								31	79	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50538014	50538014	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50538014T>C	uc003bjj.2	+	3	508	c.425T>C	c.(424-426)CTG>CCG	p.L142P	MOV10L1_uc003bjk.3_Missense_Mutation_p.L142P|MOV10L1_uc011arp.1_Missense_Mutation_p.L122P|MOV10L1_uc010han.2_Missense_Mutation_p.L122P	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	142					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TACTTCTCTCTGGAGAGTGTG	0.463													21	75	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53245075	53245075	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53245075T>A	uc004drz.2	-	7	1398	c.865A>T	c.(865-867)AAG>TAG	p.K289*	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Nonsense_Mutation_p.K222*|KDM5C_uc004dsa.2_Nonsense_Mutation_p.K288*	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	289					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						AGGAAGGTCTTAGGCGATGTT	0.547			N|F|S		clear cell renal carcinoma								27	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	14973	14973	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:14973G>A	uc004coy.2	+	1	213	c.138G>A	c.(136-138)TGG>TGA	p.W46*	uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		CGTAAATTATGGCTGAATCAT	0.483													3	30	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	4204666	4204667	+	IGR	DEL	CA	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4204666_4204667delCA								LOC100133612 (370789 upstream) : LOC284661 (267444 downstream)																							ccaccaccatcacaccattatc	0.025													5	3	---	---	---	---	
TNFRSF8	943	broad.mit.edu	37	1	12195569	12195570	+	Intron	INS	-	CC	CC			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12195569_12195570insCC	uc001atq.2	+						TNFRSF8_uc010obc.1_Intron|TNFRSF8_uc001atr.2_Intron|TNFRSF8_uc001ats.2_Intron	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,						cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		AGGAGGACCATTTGCCAATAGT	0.604													22	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16492713	16492716	+	IGR	DEL	CCAG	-	-	rs56998604		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16492713_16492716delCCAG								EPHA2 (10149 upstream) : ARHGEF19 (31883 downstream)																							atccatccatccagccatccatcc	0.186													4	2	---	---	---	---	
EPHA8	2046	broad.mit.edu	37	1	22913274	22913275	+	Intron	INS	-	GGGT	GGGT	rs66713995		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22913274_22913275insGGGT	uc001bfx.1	+						EPHA8_uc001bfw.2_Intron	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGTCTGAGGTGGGGGGGGTGAC	0.658													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32830052	32830052	+	5'Flank	DEL	T	-	-	rs111465260		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32830052delT	uc001bve.1	-											Homo sapiens cDNA FLJ36415 fis, clone THYMU2010917.																		TCAGACttccttttttttttt	0.189													4	2	---	---	---	---	
ANKRD13C	81573	broad.mit.edu	37	1	70740180	70740188	+	Intron	DEL	GAAAGAAAG	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70740180_70740188delGAAAGAAAG	uc001dex.3	-						ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C						protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						aaaaaaaaaagaaagaaAGAAAATCTACT	0.167													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	92066062	92066062	+	IGR	DEL	A	-	-	rs144829580		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92066062delA								CDC7 (74742 upstream) : HSP90B3P (34506 downstream)																							CCTTTCATTTAAAAAAAAAAA	0.294													9	5	---	---	---	---	
AKNAD1	254268	broad.mit.edu	37	1	109391940	109391940	+	Intron	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109391940delA	uc001dwa.2	-						AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_Intron	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268											ovary(3)	3						ccacatctacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	154100027	154100029	+	Intron	DEL	TTC	-	-	rs10531787		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154100027_154100029delTTC	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CCAAAGTAGGttctttttttttt	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203865225	203865226	+	IGR	DEL	AC	-	-	rs71952264		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203865225_203865226delAC								SNRPE (24947 upstream) : C1orf157 (136349 downstream)																							actcTCCAAAacacacacacac	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207273434	207273439	+	IGR	DEL	TGTGTA	-	-	rs35665980		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273434_207273439delTGTGTA								C4BPB (99 upstream) : C4BPA (4072 downstream)																							tgtgtgtgtgtgtgtatgtgtgtgtg	0.257													3	4	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	240062606	240062609	+	Intron	DEL	TGTA	-	-	rs71168861		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240062606_240062609delTGTA	uc001hyp.2	+							NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	tgtgtgtgtgtgtATATACACACA	0.172													0	7	---	---	---	---	
LTBP1	4052	broad.mit.edu	37	2	33534348	33534348	+	Intron	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33534348delA	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron|LTBP1_uc010ynb.1_Intron	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				actccgtctcaaaaaaaaaaa	0.090													3	3	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113127925	113127925	+	Intron	DEL	T	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113127925delT	uc002ths.1	-						RGPD8_uc010fkk.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						CCTTTTTTGGTGGGGGGGGGG	0.189													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	185259444	185259447	+	IGR	DEL	TGTG	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185259444_185259447delTGTG								None (None upstream) : ZNF804A (203646 downstream)																							TCTCCCCAGTtgtgtgtgtgtgtg	0.240													6	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225773133	225773136	+	Intron	DEL	TGTG	-	-	rs112804845		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225773133_225773136delTGTG	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002vod.1_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CATCATCGTTtgtgtgtgtgtgtg	0.245													3	4	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242433012	242433013	+	Intron	INS	-	T	T	rs113589065		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242433012_242433013insT	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GCAATGCtttgttttttttttt	0.243													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99045093	99045094	+	IGR	INS	-	A	A	rs138319375	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99045093_99045094insA								DCBLD2 (424560 upstream) : COL8A1 (312360 downstream)																							gaatttgagggaaaaaaaaAAC	0.213													4	3	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													4	3	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171759202	171759217	+	Intron	DEL	TCCTTCCTTCCTTCCT	-	-	rs68136138		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171759202_171759217delTCCTTCCTTCCTTCCT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		tccttctctctccttccttccttccttccttccttc	0.134													5	4	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21513788	21513811	+	Intron	DEL	GGAGGGAGGAAGGAAGGAACGAAC	-	-	rs68124536		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21513788_21513811delGGAGGGAGGAAGGAAGGAACGAAC	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				agggagggagggagggaggaaggaaggaacgaacgaaggaacga	0.098													8	11	---	---	---	---	
SHROOM3	57619	broad.mit.edu	37	4	77439725	77439728	+	Intron	DEL	TGCT	-	-	rs71659329		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77439725_77439728delTGCT	uc011cbx.1	+							NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			ccttcTtgcctgcttgcctgcctg	0.127													5	4	---	---	---	---	
HERC5	51191	broad.mit.edu	37	4	89400800	89400802	+	Intron	DEL	CAT	-	-	rs78308763		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89400800_89400802delCAT	uc003hrt.2	+						HERC5_uc011cdm.1_Intron	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		tttaaaattacatcatacatata	0.133													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7372660	7372662	+	IGR	DEL	CAT	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7372660_7372662delCAT								PAPD7 (615499 upstream) : ADCY2 (23681 downstream)																							ccaccaccaccatcaccaccacc	0.000													4	2	---	---	---	---	
HCN1	348980	broad.mit.edu	37	5	45396489	45396489	+	Intron	DEL	T	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45396489delT	uc003jok.2	-							NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ATTTTATCTCTTTTTTTTTTT	0.289													4	2	---	---	---	---	
SLC22A5	6584	broad.mit.edu	37	5	131714344	131714345	+	Intron	INS	-	ATC	ATC	rs141106891	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131714344_131714345insATC	uc003kww.3	+						SLC22A5_uc003kwx.3_Intron	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5						positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	AGAGCCAACAAATCTGACTCCG	0.416													11	10	---	---	---	---	
TMEM14C	51522	broad.mit.edu	37	6	10724954	10724955	+	Intron	INS	-	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10724954_10724955insA	uc003mzh.2	+						TMEM14C_uc010joq.1_Intron|TMEM14C_uc003mzi.2_Intron	NM_016462	NP_057546	Q9P0S9	TM14C_HUMAN	transmembrane protein 14C						heme biosynthetic process	integral to membrane|mitochondrial membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)	Epithelial(50;0.246)			TAAGAGTAGACTGCCTgggatg	0.248													17	8	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32548188	32548189	+	Intron	INS	-	AGGAGCAGAG	AGGAGCAGAG	rs144368132	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32548188_32548189insAGGAGCAGAG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron|HLA-DRB1_uc011dqc.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AAGGAGCAGAAACAGACCATGT	0.485													2	5	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117724069	117724069	+	Intron	DEL	G	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117724069delG	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		aaaaaaaaaagaaaagaaaag	0.000			T	GOPC|ROS1	glioblastoma|NSCLC								4	2	---	---	---	---	
ECHDC1	55862	broad.mit.edu	37	6	127611607	127611607	+	Intron	DEL	C	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127611607delC	uc003qax.2	-						ECHDC1_uc003qaz.3_Intron|ECHDC1_uc010key.2_Intron|ECHDC1_uc003qay.3_Intron|ECHDC1_uc010kez.2_Intron|ECHDC1_uc010kex.2_Intron	NM_001139510	NP_001132982	Q9NTX5	ECHD1_HUMAN	enoyl Coenzyme A hydratase domain containing 1								catalytic activity				0				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TTTAAAACTTCCCTTTGAAAA	0.299													3	4	---	---	---	---	
ACAT2	39	broad.mit.edu	37	6	160199454	160199455	+	Intron	DEL	TT	-	-	rs71808548		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160199454_160199455delTT	uc010kjy.2	+						ACAT2_uc011efw.1_Intron	NM_005891	NP_005882	Q9BWD1	THIC_HUMAN	acetyl-Coenzyme A acetyltransferase 2							mitochondrion|nucleolus	acetyl-CoA C-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTTCCCAAGGTTTaaaaaaaaa	0.317													3	3	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5353601	5353601	+	Intron	DEL	T	-	-	rs67749478		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5353601delT	uc003soi.3	-							NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		tttgtttttgttttttttttg	0.219													10	5	---	---	---	---	
CYTH3	9265	broad.mit.edu	37	7	6230060	6230061	+	Intron	DEL	TT	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6230060_6230061delTT	uc003spt.2	-							NM_004227	NP_004218	O43739	CYH3_HUMAN	cytohesin 3						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0						GGATTTTTGGTTTTTTTTTTTT	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64975077	64975078	+	IGR	INS	-	AGAC	AGAC			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64975077_64975078insAGAC								ZNF92 (109080 upstream) : INTS4L2 (137699 downstream)																							AGTGCACCCGAAAACAAAGATG	0.455													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141036751	141036752	+	IGR	INS	-	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141036751_141036752insA								MRPS33 (321970 upstream) : AGK (214326 downstream)																							accatcaccaccaccaccatca	0.000													4	3	---	---	---	---	
SH2D4A	63898	broad.mit.edu	37	8	19218625	19218626	+	Intron	INS	-	T	T	rs72575532		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19218625_19218626insT	uc003wzb.2	+						SH2D4A_uc011kym.1_Intron|SH2D4A_uc003wzc.2_Intron	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A							cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		CCGGGTACCCCGTCCTTCAGGA	0.272													5	4	---	---	---	---	
FAM82B	51115	broad.mit.edu	37	8	87496947	87496948	+	Intron	INS	-	A	A	rs34599016		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87496947_87496948insA	uc003ydu.2	-						FAM82B_uc011lfz.1_Intron|FAM82B_uc011lga.1_Intron	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1							microtubule|spindle pole	binding			ovary(1)	1						aactccgtctcaaaaaaaaaaa	0.005													6	3	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126317179	126317182	+	Intron	DEL	AAGG	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126317179_126317182delAAGG	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			gaaggaaagaaaggaaggaaggaa	0.015													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144255289	144255297	+	IGR	DEL	AAAGAAAAG	-	-	rs57412437		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144255289_144255297delAAAGAAAAG								LY6H (13236 upstream) : GPIHBP1 (39771 downstream)																							aaagaaaagaaaagaaaagaGAGACAgag	0.057													3	3	---	---	---	---	
RFX3	5991	broad.mit.edu	37	9	3271276	3271277	+	Intron	INS	-	A	A			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3271276_3271277insA	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		GGAAGTGGAAGAAAAAAAAAAA	0.347													4	2	---	---	---	---	
FAM189A2	9413	broad.mit.edu	37	9	72000680	72000684	+	Intron	DEL	TTTTT	-	-	rs67899498		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72000680_72000684delTTTTT	uc010mon.1	+						FAM189A2_uc004ahg.2_Intron|FAM189A2_uc010moo.1_Intron	NM_001127608	NP_001121080	Q15884	F1892_HUMAN	chromosome 9 open reading frame 61 precursor							integral to membrane					0						GTTTCGCCTCttttttttttttttt	0.429													9	4	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13233564	13233567	+	Intron	DEL	AAGC	-	-	rs112703555		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13233564_13233567delAAGC	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						ATAAATAAATaagcaagcaagcaa	0.137													6	3	---	---	---	---	
SUFU	51684	broad.mit.edu	37	10	104316494	104316495	+	Intron	DEL	AA	-	-	rs72435769		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104316494_104316495delAA	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		agtgagactcaaaaaaaaaaaa	0.020			D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				4	2	---	---	---	---	
HTRA1	5654	broad.mit.edu	37	10	124273409	124273410	+	Intron	INS	-	TT	TT	rs72367263		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124273409_124273410insTT	uc001lgj.2	+							NM_002775	NP_002766	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1 precursor						proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				aaacctggctcttttttttttt	0.000													3	3	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													5	4	---	---	---	---	
SAA4	6291	broad.mit.edu	37	11	18253712	18253713	+	Intron	INS	-	AGCCCCTGCACCC	AGCCCCTGCACCC	rs143986842	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18253712_18253713insAGCCCCTGCACCC	uc001mny.2	-							NM_006512	NP_006503	P35542	SAA4_HUMAN	serum amyloid A4, constitutive precursor						acute-phase response	high-density lipoprotein particle					0						ttacaggtgtgagcccctgcac	0.208													9	4	---	---	---	---	
CD6	923	broad.mit.edu	37	11	60785952	60785953	+	Intron	INS	-	AAGGGGAAAAGGAGAAAGG	AAGGGGAAAAGGAGAAAGG	rs144632420	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60785952_60785953insAAGGGGAAAAGGAGAAAGG	uc001nqq.2	+						CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						TGCATTCGCTCAAGGGGAAAAG	0.391													4	3	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73795753	73795753	+	Intron	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73795753delA	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					tctttaaactaaaAAAAAAAA	0.154													8	4	---	---	---	---	
PVRL1	5818	broad.mit.edu	37	11	119519005	119519006	+	Intron	INS	-	TGA	TGA			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119519005_119519006insTGA	uc001pwu.1	-							NM_203285	NP_976030	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 2						adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		ggtgatggtggtggtggtggtg	0.000													9	5	---	---	---	---	
ST8SIA1	6489	broad.mit.edu	37	12	22440423	22440423	+	Intron	DEL	A	-	-	rs71444167		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22440423delA	uc001rfo.3	-						ST8SIA1_uc009zix.2_Intron	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3						ATTTCACAGCAAAAAAAAAAA	0.333													4	2	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54744006	54744007	+	Intron	INS	-	T	T			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54744006_54744007insT	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						CAGTAACTCCCTTTTTTTTTTT	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	100124044	100124061	+	IGR	DEL	GGAAGGGAGGGAGGAGAG	-	-	rs144948938	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100124044_100124061delGGAAGGGAGGGAGGAGAG								UBAC2 (85293 upstream) : TM9SF2 (29667 downstream)																							agggaaggaaggaagggagggaggagagggaaggaagg	0.087													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112849941	112849941	+	IGR	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112849941delA								SOX1 (123921 upstream) : C13orf28 (180728 downstream)																							ACAAGAATTTAGTACCAATTG	0.274													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850045	112850048	+	IGR	DEL	CCCC	-	-	rs112803567		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850045_112850048delCCCC								SOX1 (124025 upstream) : C13orf28 (180621 downstream)																							tctttcctttcccccttcctccct	0.020													3	3	---	---	---	---	
PROZ	8858	broad.mit.edu	37	13	113815125	113815126	+	Intron	INS	-	TT	TT			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113815125_113815126insTT	uc001vta.1	+						PROZ_uc010agr.1_Intron	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	AAACAGGAAAATTGTGCATTGT	0.287													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34669613	34669616	+	IGR	DEL	GAAG	-	-	rs71451998		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669613_34669616delGAAG								EGLN3 (249326 upstream) : C14orf147 (232529 downstream)																							agaagaaagagaaggaaggaagga	0.181													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	44498097	44498098	+	IGR	INS	-	CG	CG			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44498097_44498098insCG								None (None upstream) : FSCB (475257 downstream)																							acacacacacacacacacacaa	0.000													4	2	---	---	---	---	
TRIM9	114088	broad.mit.edu	37	14	51532771	51532778	+	Intron	DEL	GAAGGAAG	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51532771_51532778delGAAGGAAG	uc001wyx.3	-						TRIM9_uc001wyy.2_Intron|TRIM9_uc001wyz.3_Intron	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN	tripartite motif protein 9 isoform 1						proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)					ATCTCTTTTAgaaggaaggaaggaagga	0.216													5	4	---	---	---	---	
ERO1L	30001	broad.mit.edu	37	14	53150865	53150870	+	Intron	DEL	ACACAG	-	-	rs10611819		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53150865_53150870delACACAG	uc001wzv.2	-						ERO1L_uc001wzw.2_Intron|ERO1L_uc010aof.2_Intron	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor						chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					acacacacacacacaGAGAGAGTTGG	0.228													4	2	---	---	---	---	
AHSA1	10598	broad.mit.edu	37	14	77935239	77935240	+	Intron	INS	-	G	G	rs141792523	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77935239_77935240insG	uc001xtw.2	+							NM_012111	NP_036243	O95433	AHSA1_HUMAN	activator of heat shock 90kDa protein ATPase						protein folding|response to stress	cytosol|endoplasmic reticulum	ATPase activator activity|chaperone binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		ttagtagagatggagtttcacc	0.005													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28900331	28900331	+	Intron	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28900331delA	uc010uan.1	+						uc010azc.2_Intron|uc010uao.1_5'Flank					Homo sapiens cDNA FLJ55955 complete cds, highly similar to HECT domain and RCC1-like domain-containing protein 2.																		actctgtctcaaaaaaaaaaa	0.114													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31128275	31128275	+	IGR	DEL	T	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31128275delT								ARHGAP11B (150466 upstream) : MTMR15 (67780 downstream)																							TTTGATAAGCTTTTTTTTTTT	0.313													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63288157	63288160	+	IGR	DEL	AAGG	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63288157_63288160delAAGG								TLN2 (151330 upstream) : TPM1 (46678 downstream)																							acaaagaaaaaaggaaggaaggaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	66672340	66672341	+	IGR	INS	-	TT	TT	rs11631602		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66672340_66672341insTT								TIPIN (23286 upstream) : MAP2K1 (6870 downstream)																							ttctttctttcttttttttttt	0.173													2	4	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33124039	33124039	+	IGR	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33124039delA								SLC6A10P (227576 upstream) : MIR1826 (841469 downstream)																							AATAAATACTAAAAAAAAAAA	0.368													4	2	---	---	---	---	
TNFSF12-TNFSF13	407977	broad.mit.edu	37	17	7451454	7451455	+	5'Flank	INS	-	TCCTTCCTTCCT	TCCTTCCTTCCT			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7451454_7451455insTCCTTCCTTCCT	uc002ghi.1	+						TNFSF12_uc002ghg.2_5'Flank|TNFSF12_uc002ghh.2_5'Flank	NM_172089	NP_742086	Q8IZK7	Q8IZK7_HUMAN	TNFSF12-TNFSF13 protein						immune response	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0		Prostate(122;0.157)				gccAATTTTGGtccttccttcc	0.010													4	2	---	---	---	---	
TOM1L2	146691	broad.mit.edu	37	17	17782721	17782722	+	Intron	INS	-	A	A	rs146626059	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17782721_17782722insA	uc002grz.3	-						TOM1L2_uc002gry.3_Intron|TOM1L2_uc010vwy.1_Intron|TOM1L2_uc010cpr.2_Intron|TOM1L2_uc010vwz.1_Intron|TOM1L2_uc010vxa.1_Intron|TOM1L2_uc010vxb.1_Intron	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3						intracellular protein transport	intracellular					0	all_neural(463;0.228)					ttataatcaggaaaaaaaTGTT	0.218													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	26771494	26771494	+	IGR	DEL	G	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26771494delG								SLC46A1 (38266 upstream) : SLC13A2 (29170 downstream)																							aaaaaaaaaagaaGTTTAACT	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	67999165	67999165	+	IGR	DEL	C	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67999165delC								MAP2K6 (460703 upstream) : KCNJ16 (72261 downstream)																							ttccttccttcccttccttcc	0.144													4	3	---	---	---	---	
THOC1	9984	broad.mit.edu	37	18	260109	260109	+	Intron	DEL	A	-	-	rs74972597		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:260109delA	uc002kkj.3	-						THOC1_uc002kkk.3_Intron|THOC1_uc002kkl.2_Intron	NM_005131	NP_005122	Q96FV9	THOC1_HUMAN	THO complex 1						apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding			ovary(1)	1		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				aaataaatttaaaaaaaaaaa	0.328													3	3	---	---	---	---	
NOL4	8715	broad.mit.edu	37	18	31774390	31774391	+	Intron	INS	-	GGAAGGAAGGAA	GGAAGGAAGGAA			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31774390_31774391insGGAAGGAAGGAA	uc010dmi.2	-						NOL4_uc002kxr.3_Intron|NOL4_uc010xbt.1_Intron|NOL4_uc010dmh.2_Intron|NOL4_uc010xbu.1_Intron|NOL4_uc002kxt.3_Intron	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4							nucleolus	RNA binding			ovary(3)	3						gagggagggagggaaggaagga	0.050													7	4	---	---	---	---	
MOCOS	55034	broad.mit.edu	37	18	33800306	33800306	+	Intron	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33800306delA	uc002kzq.3	+							NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	tcatctctacaaaaaaaaaaa	0.124													8	4	---	---	---	---	
UBXN6	80700	broad.mit.edu	37	19	4452146	4452146	+	Intron	DEL	A	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4452146delA	uc002man.1	-						UBXN6_uc010dty.1_Intron|UBXN6_uc002mam.1_Intron	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6							microtubule organizing center|nucleus	protein binding				0						actccatctcaaaaaaaaaaa	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5388291	5388298	+	IGR	DEL	GAAGGAAA	-	-	rs56187085	by1000genomes	TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5388291_5388298delGAAGGAAA								PTPRS (47477 upstream) : ZNRF4 (67128 downstream)																							aggaaggaaggaaggaaagaaggaaaga	0.000													4	3	---	---	---	---	
PNPLA6	10908	broad.mit.edu	37	19	7623628	7623628	+	Intron	DEL	T	-	-	rs149281719		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7623628delT	uc010xjq.1	+						PNPLA6_uc002mgq.1_Intron|PNPLA6_uc010xjp.1_Intron|PNPLA6_uc002mgr.1_Intron|PNPLA6_uc002mgs.2_Intron|PNPLA6_uc002mgt.1_Intron	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b						cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						GTATTCTCTCTTTTTTTTTTG	0.542													4	2	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11517667	11517667	+	Intron	DEL	T	-	-	rs5827125		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11517667delT	uc002mrp.2	-						RGL3_uc002mrn.2_Intron|RGL3_uc002mrm.2_Intron|RGL3_uc002mro.2_Intron	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						CTCTCTTAAAttttttttttt	0.020													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13709274	13709275	+	IGR	INS	-	AAGAAAGG	AAGAAAGG	rs79314340		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709274_13709275insAAGAAAGG								CACNA1A (92000 upstream) : CCDC130 (133299 downstream)																							accctgtcaaaaaggaaggaag	0.000											OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	4	---	---	---	---	
KDELR1	10945	broad.mit.edu	37	19	48893549	48893549	+	Intron	DEL	C	-	-	rs36034010		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48893549delC	uc002pjb.1	-						KDELR1_uc002pja.1_Intron	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum						intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		agagtccaggcccccggcccc	0.000													4	8	---	---	---	---	
GNAS	2778	broad.mit.edu	37	20	57466762	57466764	+	Intron	DEL	CCG	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57466762_57466764delCCG	uc002xzw.2	+						GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_Intron|GNAS_uc002xzx.2_Intron|GNAS_uc010gjr.2_Intron|GNAS_uc002xzy.2_Intron|GNAS_uc002yaa.2_5'UTR|GNAS_uc010zzt.1_5'Flank|GNAS_uc002yab.2_5'Flank	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas						activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			cggccgcgccccgccgccgccgc	0.315			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			4	2	---	---	---	---	
TH1L	51497	broad.mit.edu	37	20	57564216	57564219	+	Intron	DEL	AGAA	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57564216_57564219delAGAA	uc002yag.2	+						TH1L_uc010zzu.1_Intron|TH1L_uc002yaf.1_Intron|TH1L_uc002yah.2_Intron	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)			CCTTACACTGAGAAAGAAAAGTGT	0.328													11	8	---	---	---	---	
SLMO2	51012	broad.mit.edu	37	20	57609945	57609946	+	3'UTR	INS	-	A	A	rs138739647		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57609945_57609946insA	uc002yam.2	-	6					ATP5E_uc002yal.2_5'Flank|SLMO2_uc010zzv.1_3'UTR	NM_016045	NP_057129	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2											skin(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)			ACCAACTTATCAAAAAAAAAAA	0.297													4	2	---	---	---	---	
RTEL1	51750	broad.mit.edu	37	20	62324809	62324810	+	Intron	INS	-	CCA	CCA	rs77223947		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62324809_62324810insCCA	uc002yfu.1	+						RTEL1_uc011abc.1_Intron|RTEL1_uc002yft.1_Intron|RTEL1_uc011abd.1_Intron|RTEL1_uc011abe.1_Intron|RTEL1_uc002yfw.2_Intron|RTEL1_uc002yfx.1_Intron|TNFRSF6B_uc002yfy.2_5'Flank	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			cagcaccacctccacctccacc	0.233													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16292002	16292003	+	IGR	DEL	GT	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16292002_16292003delGT								POTEH (4065 upstream) : OR11H1 (156823 downstream)																							gtgtgtgtgcgtgtgtgtgtgt	0.505													6	4	---	---	---	---	
ZC3H7B	23264	broad.mit.edu	37	22	41735630	41735630	+	Intron	DEL	A	-	-	rs66971293		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41735630delA	uc003azw.2	+						ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B						interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						actccgtctcaaaaaaaaaaa	0.249													6	3	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46136597	46136598	+	Intron	INS	-	AT	AT	rs67765053		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136597_46136598insAT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		cacacacacacacatatatata	0.114													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	668918	668918	+	IGR	DEL	C	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:668918delC								SHOX (48773 upstream) : CRLF2 (645969 downstream)																							ttcgttttctcccttcctttc	0.000													4	2	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774840	2774841	+	Intron	INS	-	ATCT	ATCT	rs142965389		TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774840_2774841insATCT	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				atctatctatcatctatctatc	0.173													3	7	---	---	---	---	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Translation_Start_Site	DEL	TCCTCGAGGCAGCC	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	uc010njt.2	-	1						NM_018159	NP_060629	Q96G61	NUD11_HUMAN	nudix-type motif 11							cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.584										HNSCC(48;0.14)			7	4	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118759508	118759508	+	Intron	DEL	T	-	-			TCGA-BP-5195-01A-02D-1429-08	TCGA-BP-5195-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118759508delT	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						ACTGATACTCttttttttttt	0.244													4	3	---	---	---	---	
