Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
C1orf159	54991	broad.mit.edu	37	1	1021312	1021312	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1021312A>C	uc001act.2	-	9	985	c.499T>G	c.(499-501)TTC>GTC	p.F167V	C1orf159_uc001acu.2_Missense_Mutation_p.F131V|C1orf159_uc001acr.2_RNA|C1orf159_uc001acs.2_RNA|C1orf159_uc010nyd.1_RNA|C1orf159_uc001acm.2_Missense_Mutation_p.F131V|C1orf159_uc009vju.1_Missense_Mutation_p.F109V|C1orf159_uc001acn.2_Missense_Mutation_p.F131V|C1orf159_uc001acp.2_Missense_Mutation_p.F131V	NM_017891	NP_060361	Q96HA4	CA159_HUMAN	hypothetical protein LOC54991	167	Helical; (Potential).					integral to membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.96e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.77e-22)|Colorectal(212;6.51e-05)|COAD - Colon adenocarcinoma(227;0.000214)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		TTGAGGTAGAAGAACCCAGCT	0.622													14	70	---	---	---	---	PASS
AGTRAP	57085	broad.mit.edu	37	1	11810282	11810282	+	3'UTR	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11810282G>T	uc001asv.2	+	5					AGTRAP_uc001ast.2_3'UTR|AGTRAP_uc001asu.2_3'UTR|AGTRAP_uc001asw.2_3'UTR|AGTRAP_uc001asx.2_3'UTR	NM_020350	NP_065083	Q6RW13	ATRAP_HUMAN	angiotensin II receptor-associated protein							cytoplasmic vesicle membrane|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein binding		AGTRAP/BRAF(2)	stomach(2)	2	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.46e-06)|COAD - Colon adenocarcinoma(227;0.000256)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGCCCCGGGCCTTCCTCGT	0.637													5	28	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17264218	17264218	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17264218A>G	uc001azt.2	+	10	1345	c.1276A>G	c.(1276-1278)AAG>GAG	p.K426E	CROCC_uc009voy.1_Missense_Mutation_p.K129E|CROCC_uc009voz.1_Missense_Mutation_p.K189E|CROCC_uc001azu.2_5'Flank	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	426	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCTCACTGAGAAGCTTGAGGC	0.602													7	33	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19447690	19447690	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19447690C>T	uc001bbi.2	-	68	10138	c.10134G>A	c.(10132-10134)GAG>GAA	p.E3378E	UBR4_uc001bbk.1_Silent_p.E1025E	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3378					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TACCATCTTTCTCCTTTTCTT	0.428													9	24	---	---	---	---	PASS
RPL11	6135	broad.mit.edu	37	1	24022342	24022342	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24022342A>T	uc001bhk.2	+	5	471	c.451A>T	c.(451-453)ATT>TTT	p.I151F	RPL11_uc001bhl.2_Missense_Mutation_p.I150F|RPL11_uc001bhm.2_Missense_Mutation_p.I140F|RPL11_uc001bhn.1_3'UTR	NM_000975	NP_000966	P62913	RL11_HUMAN	ribosomal protein L11	151					endocrine pancreas development|protein localization to nucleus|protein targeting|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|rRNA binding|structural constituent of ribosome			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		GACAGGCTGCATTGGGGCCAA	0.522													46	125	---	---	---	---	PASS
TRIM62	55223	broad.mit.edu	37	1	33612891	33612891	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33612891A>G	uc001bxb.2	-	5	1953	c.1315T>C	c.(1315-1317)TAC>CAC	p.Y439H		NM_018207	NP_060677	Q9BVG3	TRI62_HUMAN	tripartite motif-containing 62	439	B30.2/SPRY.					intracellular	zinc ion binding				0		Myeloproliferative disorder(586;0.0393)				CGGAAGGTGTAGAGCCAGGAC	0.557													18	28	---	---	---	---	PASS
SFRS11	9295	broad.mit.edu	37	1	70697699	70697699	+	Intron	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70697699A>G	uc001des.2	+						SFRS11_uc001det.2_Intron|SFRS11_uc001deu.2_Intron|SFRS11_uc001dev.2_Intron|SFRS11_uc001dew.2_5'UTR	NM_004768	NP_004759	Q05519	SRS11_HUMAN	splicing factor, arginine/serine-rich 11						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						AGTAGTGTGTATTGTGCTATT	0.333													3	10	---	---	---	---	PASS
KCNA2	3737	broad.mit.edu	37	1	111146166	111146166	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111146166G>C	uc001dzu.2	-	2	1735	c.1239C>G	c.(1237-1239)TTC>TTG	p.F413L	KCNA2_uc009wfv.1_Intron|KCNA2_uc009wfw.2_Missense_Mutation_p.F413L	NM_004974	NP_004965	P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related	413						juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(1)	1		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)		AGAAGTAGTTGAAATTGGACA	0.493													77	206	---	---	---	---	PASS
ATP1A1	476	broad.mit.edu	37	1	116941270	116941270	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116941270G>A	uc001ege.2	+	16	2491	c.2152G>A	c.(2152-2154)GGT>AGT	p.G718S	ATP1A1_uc010owv.1_Missense_Mutation_p.G687S|ATP1A1_uc010oww.1_Missense_Mutation_p.G718S|ATP1A1_uc010owx.1_Missense_Mutation_p.G687S|C1orf203_uc009whb.2_Intron|ATP1A1_uc001egh.2_5'Flank	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a	718	Cytoplasmic (Potential).				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	GACTGGTGACGGTGTGAATGA	0.493													7	442	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148011014	148011014	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148011014C>A	uc001eqf.2	-	14	1931	c.1896G>T	c.(1894-1896)TTG>TTT	p.L632F	LOC200030_uc001eqe.2_Missense_Mutation_p.L183F|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Missense_Mutation_p.L109F|NBPF14_uc001eqx.2_Missense_Mutation_p.L447F|NBPF14_uc001eqq.2_Missense_Mutation_p.L536F|NBPF14_uc010pad.1_RNA|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672	632	NBPF 4.					cytoplasm					0						GTGAGTCCTGCAAGACTTCAG	0.483													5	282	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154313463	154313463	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154313463T>G	uc001fex.2	+	13	1267	c.1267T>G	c.(1267-1269)TTC>GTC	p.F423V		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	409	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGAGTACATCTTCTCCGACAA	0.552													24	84	---	---	---	---	PASS
PBXIP1	57326	broad.mit.edu	37	1	154918597	154918597	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154918597T>G	uc001ffr.2	-	10	1612	c.1553A>C	c.(1552-1554)AAG>ACG	p.K518T	PBXIP1_uc001ffs.2_Missense_Mutation_p.K489T|PBXIP1_uc010pep.1_Missense_Mutation_p.K363T	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein	518					cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity			large_intestine(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCTGCCCTCCTTCCACCTTCC	0.592													25	62	---	---	---	---	PASS
HHAT	55733	broad.mit.edu	37	1	210637907	210637907	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210637907C>T	uc009xcx.2	+	8	1081	c.915C>T	c.(913-915)GGC>GGT	p.G305G	HHAT_uc010psq.1_Silent_p.G168G|HHAT_uc001hhz.3_Silent_p.G305G|HHAT_uc010psr.1_Silent_p.G306G|HHAT_uc010pss.1_Silent_p.G260G|HHAT_uc009xcy.2_Silent_p.G240G|HHAT_uc010pst.1_Silent_p.G242G|HHAT_uc010psu.1_Silent_p.G240G|HHAT_uc001hia.3_5'UTR	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	305	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TGCTCTTTGGCGTGCCTGCTC	0.572													4	176	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222717069	222717069	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222717069C>T	uc001hnh.1	-	2	842	c.784G>A	c.(784-786)GTG>ATG	p.V262M		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	262					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		GTGGTCAACACGATGTTCTTG	0.532													23	68	---	---	---	---	PASS
CHRM3	1131	broad.mit.edu	37	1	240070801	240070801	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240070801G>C	uc001hyp.2	+	5	829	c.50G>C	c.(49-51)AGC>ACC	p.S17T		NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	17	Extracellular (By similarity).				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	CCAAACATCAGCTCCTCCTGG	0.512													20	44	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241099905	241099905	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241099905A>G	uc001hyv.2	-	5	658	c.328T>C	c.(328-330)TTT>CTT	p.F110L	RGS7_uc010pyh.1_Missense_Mutation_p.F84L|RGS7_uc010pyj.1_Missense_Mutation_p.F26L|RGS7_uc001hyu.2_Missense_Mutation_p.F110L|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Missense_Mutation_p.F110L	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	110	DEP.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CTTACTTGAAACCGGTAAAAG	0.398													6	177	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243328076	243328076	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243328076C>G	uc001hzs.2	-	13	3594	c.3186G>C	c.(3184-3186)GAG>GAC	p.E1062D	CEP170_uc001hzt.2_Missense_Mutation_p.E964D|CEP170_uc001hzu.2_Missense_Mutation_p.E964D|CEP170_uc001hzv.1_Missense_Mutation_p.E440D	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	1062	Targeting to microtubules.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AATGTACATGCTCATCAGCTG	0.428													19	125	---	---	---	---	PASS
OR2L8	391190	broad.mit.edu	37	1	248112511	248112511	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248112511G>A	uc001idt.1	+	1	352	c.352G>A	c.(352-354)GCC>ACC	p.A118T	OR2L13_uc001ids.2_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GGCATCTATGGCCTATGATCG	0.448													133	448	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248263038	248263038	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248263038C>T	uc001ids.2	+	3	698	c.361C>T	c.(361-363)CGT>TGT	p.R121C		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GGCCTACGACCGTTATTTGGC	0.498													6	92	---	---	---	---	PASS
ADAM17	6868	broad.mit.edu	37	2	9634938	9634938	+	Intron	SNP	A	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9634938A>C	uc002qzu.2	-						IAH1_uc010yiz.1_RNA|ADAM17_uc010ewy.2_Intron|ADAM17_uc010ewz.2_Intron	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17						B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TTGTTCTGAGACCTGCCTCTC	0.468													13	30	---	---	---	---	PASS
TTC32	130502	broad.mit.edu	37	2	20101646	20101646	+	5'UTR	SNP	T	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20101646T>A	uc002rdg.2	-	1						NM_001008237	NP_001008238	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32								identical protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGTGTAGAATGGGGGTTGAC	0.542													55	142	---	---	---	---	PASS
TTC32	130502	broad.mit.edu	37	2	20101652	20101652	+	5'UTR	SNP	T	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20101652T>A	uc002rdg.2	-	1						NM_001008237	NP_001008238	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32								identical protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAATGGGGGTTGACCTCCGA	0.547													53	126	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33534505	33534505	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33534505C>T	uc002ros.2	+	23	3489	c.3489C>T	c.(3487-3489)ATC>ATT	p.I1163I	LTBP1_uc002rot.2_Silent_p.I837I|LTBP1_uc002rou.2_Silent_p.I836I|LTBP1_uc002rov.2_Silent_p.I783I|LTBP1_uc010ymz.1_Silent_p.I836I|LTBP1_uc010yna.1_Silent_p.I783I|LTBP1_uc010ynb.1_Silent_p.I102I	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1162	EGF-like 11; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TTTTAGATATCAATGAATGCT	0.338													80	222	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44073416	44073416	+	Silent	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44073416A>G	uc002rtq.2	+	3	378	c.288A>G	c.(286-288)AGA>AGG	p.R96R	ABCG8_uc010yoa.1_Silent_p.R96R	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	96	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TCAAAGTGAGAAGTGGGCAGA	0.522													4	77	---	---	---	---	PASS
AAK1	22848	broad.mit.edu	37	2	69741765	69741765	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69741765C>T	uc002sfp.2	-	13	2119	c.1614G>A	c.(1612-1614)CAG>CAA	p.Q538Q	AAK1_uc010fdk.2_Silent_p.Q538Q|AAK1_uc010yqm.1_Silent_p.Q538Q	NM_014911	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	538	Gln-rich.					coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity				0						gttgttgttgctgctgctgct	0.423													5	106	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128351179	128351179	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128351179A>G	uc002top.2	+	18	2257	c.2204A>G	c.(2203-2205)GAC>GGC	p.D735G		NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	735						apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTGCGGACAGACAAAGACTGG	0.602													4	72	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179458089	179458089	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179458089C>A	uc010zfg.1	-	248	51366	c.51142G>T	c.(51142-51144)GAA>TAA	p.E17048*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.E10743*|TTN_uc010zfi.1_Nonsense_Mutation_p.E10676*|TTN_uc010zfj.1_Nonsense_Mutation_p.E10551*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17975							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCTCTTTTCCAGGATGTAG	0.398													5	179	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179482120	179482120	+	Silent	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179482120G>T	uc010zfg.1	-	203	40212	c.39988C>A	c.(39988-39990)CGA>AGA	p.R13330R	TTN_uc010zfh.1_Silent_p.R7025R|TTN_uc010zfi.1_Silent_p.R6958R|TTN_uc010zfj.1_Silent_p.R6833R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14257							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCGCATCGCTCAATTATA	0.383													17	319	---	---	---	---	PASS
ALS2CR8	79800	broad.mit.edu	37	2	203818776	203818776	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203818776T>G	uc002uzo.2	+	6	756	c.476T>G	c.(475-477)GTG>GGG	p.V159G	ALS2CR8_uc002uzn.2_Missense_Mutation_p.V57G|ALS2CR8_uc002uzm.2_Missense_Mutation_p.V159G|ALS2CR8_uc010zhy.1_Missense_Mutation_p.V159G|ALS2CR8_uc010zhz.1_RNA|ALS2CR8_uc010ftu.1_RNA|ALS2CR8_uc010zia.1_Missense_Mutation_p.V83G|ALS2CR8_uc010zib.1_Missense_Mutation_p.V83G|ALS2CR8_uc010zic.1_Missense_Mutation_p.V71G|ALS2CR8_uc002uzp.2_Missense_Mutation_p.V159G	NM_001104586	NP_001098056	Q8N187	AL2S8_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	159										large_intestine(1)|ovary(1)	2						ACTGTAAGAGTGGATACTCTA	0.403													151	250	---	---	---	---	PASS
ZFAND2B	130617	broad.mit.edu	37	2	220073018	220073018	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220073018A>G	uc002vka.2	+	5	647	c.475A>G	c.(475-477)AGC>GGC	p.S159G	ZFAND2B_uc010zkt.1_Missense_Mutation_p.S159G|ZFAND2B_uc010fwd.1_Missense_Mutation_p.S159G|ZFAND2B_uc002vjy.1_Missense_Mutation_p.S159G|ZFAND2B_uc002vjz.1_Missense_Mutation_p.S159G|ZFAND2B_uc002vkb.1_Missense_Mutation_p.S50G	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	159						endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCTTCTACAAGCACTGTCCC	0.547													20	80	---	---	---	---	PASS
NGEF	25791	broad.mit.edu	37	2	233757610	233757610	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233757610C>T	uc002vts.2	-	7	1388	c.1140G>A	c.(1138-1140)CTG>CTA	p.L380L	NGEF_uc010zmm.1_Silent_p.L103L|NGEF_uc010fyg.1_Silent_p.L288L	NM_019850	NP_062824	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	380	DH.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		ACACTCACAGCAGCTGCTTAT	0.587													6	108	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234299102	234299102	+	Silent	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234299102T>C	uc002vui.1	+	3	333	c.321T>C	c.(319-321)AGT>AGC	p.S107S	DGKD_uc002vuj.1_Silent_p.S63S	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	107	PH.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CTGAATCCAGTACCAAAAACG	0.413													7	406	---	---	---	---	PASS
HJURP	55355	broad.mit.edu	37	2	234749785	234749785	+	Silent	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234749785A>G	uc002vvg.2	-	8	1707	c.1641T>C	c.(1639-1641)AAT>AAC	p.N547N	HJURP_uc010znd.1_Silent_p.N486N|HJURP_uc010zne.1_Silent_p.N455N	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	547					cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TTCCAGAACTATTTCCCTGAA	0.483													38	357	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191479	10191479	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191479C>G	uc003bvc.2	+	3	685	c.472C>G	c.(472-474)CTG>GTG	p.L158V	VHL_uc003bvd.2_Missense_Mutation_p.L117V	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	158	Interaction with Elongin BC complex.		L -> V (in VHLD; type I).|L -> P (in VHLD; type I-II; abolishes release from chaperonin complex and the interaction with Elongin BC complex).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.L158V(8)|p.L158Q(6)|p.L158P(3)|p.L158fs*16(3)|p.V155fs*15(2)|p.L158R(1)|p.L158_K159del(1)|p.L158fs*15(1)|p.T157_K159del(1)|p.Y156*(1)|p.L158fs*6(1)|p.L158fs*1(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGTGTATACTCTGAAAGAGCG	0.498		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				46	71	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48626394	48626394	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48626394C>A	uc003ctz.2	-	18	2350	c.2349G>T	c.(2347-2349)CAG>CAT	p.Q783H		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	783	Nonhelical region (NC1).|Fibronectin type-III 7.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CATTGAGGATCTGCAGCCTCG	0.602													9	17	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52678721	52678721	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52678721T>C	uc003des.2	-	8	910	c.898A>G	c.(898-900)AGG>GGG	p.R300G	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.R300G|PBRM1_uc003der.2_Missense_Mutation_p.S300G|PBRM1_uc003det.2_Missense_Mutation_p.R300G|PBRM1_uc003deu.2_Missense_Mutation_p.R300G|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.R300G|PBRM1_uc010hmk.1_Missense_Mutation_p.R300G|PBRM1_uc003dey.2_Missense_Mutation_p.R300G|PBRM1_uc003dez.1_Missense_Mutation_p.R300G|PBRM1_uc003dfb.1_Missense_Mutation_p.R198G	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	300					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TAAACCTACCTCATTCGAAGA	0.169			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								8	240	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56696456	56696456	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56696456T>C	uc003did.3	-	9	1218	c.1117A>G	c.(1117-1119)ATT>GTT	p.I373V	C3orf63_uc003dic.3_Translation_Start_Site|C3orf63_uc003die.3_Missense_Mutation_p.I373V	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	373										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		CTCAGAGAAATATAACACAAA	0.323													4	155	---	---	---	---	PASS
KIAA1524	57650	broad.mit.edu	37	3	108281998	108281998	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108281998G>A	uc003dxb.3	-	13	1878	c.1609C>T	c.(1609-1611)CCA>TCA	p.P537S	KIAA1524_uc010hpv.1_Missense_Mutation_p.P104S	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	537						cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						TCTGGCAGTGGAGCAGCCTCC	0.403													62	205	---	---	---	---	PASS
CDV3	55573	broad.mit.edu	37	3	133302927	133302927	+	Silent	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133302927T>C	uc003epq.2	+	3	854	c.399T>C	c.(397-399)GGT>GGC	p.G133G	CDV3_uc003epp.3_Silent_p.G133G|CDV3_uc003epr.2_Silent_p.G31G	NM_017548	NP_060018	Q9UKY7	CDV3_HUMAN	carnitine deficiency-associated gene expressed	133	Poly-Gly.				cell proliferation	cytoplasm					0						GTGGTGGAGGTATGGAAAAAT	0.418													106	323	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505855	195505855	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505855G>T	uc011bto.1	-	3	12672	c.12212C>A	c.(12211-12213)TCC>TAC	p.S4071Y	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAGTGTCGGT	0.597													3	17	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39301920	39301920	+	Missense_Mutation	SNP	C	T	T	rs140065280		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39301920C>T	uc003gty.1	-	20	2787	c.2653G>A	c.(2653-2655)GTC>ATC	p.V885I	RFC1_uc003gtx.1_Missense_Mutation_p.V884I	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	885					DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						TTTTCCTGGACGAAGAGGGGT	0.483													46	115	---	---	---	---	PASS
LOC401127	401127	broad.mit.edu	37	4	39482624	39482624	+	RNA	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39482624T>C	uc011byn.1	+	1		c.750T>C			LOC401127_uc011byo.1_RNA	NR_026854				Homo sapiens WD repeat domain 5 pseudogene (LOC401127), non-coding RNA.												0						TTCATTTTAATCGTGATGGAT	0.468													38	91	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96761886	96761886	+	Silent	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761886C>A	uc003htr.3	+	1	648	c.585C>A	c.(583-585)GGC>GGA	p.G195G		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	195					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	ATGGGGATGGCGCTGCGAATC	0.473													4	96	---	---	---	---	PASS
UBE2D3	7323	broad.mit.edu	37	4	103720097	103720097	+	Intron	SNP	C	T	T	rs147920467		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103720097C>T	uc003hwk.2	-						UBE2D3_uc003hwh.2_5'Flank|UBE2D3_uc003hwi.2_Missense_Mutation_p.A146T|UBE2D3_uc003hwj.2_Intron|UBE2D3_uc003hwl.2_Intron|UBE2D3_uc011cet.1_Intron|UBE2D3_uc011ceu.1_Intron|UBE2D3_uc003hwo.2_Intron|UBE2D3_uc003hwp.2_Intron|UBE2D3_uc003hwq.2_Intron|UBE2D3_uc003hwr.2_Intron	NM_181887	NP_871616	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3 isoform 1						apoptosis|BMP signaling pathway|DNA repair|negative regulation of type I interferon production|proteasomal ubiquitin-dependent protein catabolic process|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein monoubiquitination|transforming growth factor beta receptor signaling pathway	endosome membrane|plasma membrane	ATP binding|protein binding|ubiquitin-protein ligase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TACAACATAGCGTATTTCTCT	0.378													4	256	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111397499	111397499	+	5'UTR	SNP	A	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111397499A>C	uc003iab.3	+	1						NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase						cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	CAATTTAAAAAGGAAGTCTGC	0.423													19	53	---	---	---	---	PASS
ZNF827	152485	broad.mit.edu	37	4	146744609	146744609	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146744609C>G	uc003ikn.2	-	8	2396	c.2348G>C	c.(2347-2349)AGT>ACT	p.S783T	ZNF827_uc003ikm.2_Missense_Mutation_p.S783T|ZNF827_uc010iox.2_Missense_Mutation_p.S433T|ZNF827_uc003ikl.2_5'UTR	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	783					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					CACGGAGTCACTGGGCAGCAG	0.443													12	634	---	---	---	---	PASS
PRMT10	90826	broad.mit.edu	37	4	148578942	148578942	+	Splice_Site	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148578942C>T	uc003ilc.2	-	8	1472	c.1330_splice	c.e8+1	p.D444_splice	PRMT10_uc003ilb.2_Splice_Site_p.D88_splice|PRMT10_uc003ild.2_Splice_Site_p.D331_splice	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10							cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2						ACAAGACCTACCTGCAAGGTC	0.393													25	82	---	---	---	---	PASS
SPOCK3	50859	broad.mit.edu	37	4	167656103	167656103	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167656103T>C	uc003iri.1	-	12	1421	c.1280A>G	c.(1279-1281)GAT>GGT	p.D427G	SPOCK3_uc011cjp.1_Missense_Mutation_p.D384G|SPOCK3_uc011cjq.1_Missense_Mutation_p.D436G|SPOCK3_uc011cjr.1_Missense_Mutation_p.D307G|SPOCK3_uc003irj.1_Missense_Mutation_p.D424G|SPOCK3_uc011cjs.1_Missense_Mutation_p.D376G|SPOCK3_uc011cjt.1_Missense_Mutation_p.D335G|SPOCK3_uc011cju.1_Missense_Mutation_p.D320G|SPOCK3_uc011cjv.1_Missense_Mutation_p.D329G	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2	427	Asp-rich.				signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		atcaccaccatcatcatcatc	0.045													7	658	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32089797	32089797	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32089797C>T	uc003jhl.2	+	20	6631	c.6243C>T	c.(6241-6243)AGC>AGT	p.S2081S	PDZD2_uc003jhm.2_Silent_p.S2081S	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2081					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TAATGGCCAGCGATCGCCTCG	0.552													21	23	---	---	---	---	PASS
PAPD4	167153	broad.mit.edu	37	5	78936786	78936786	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78936786C>T	uc010jae.1	+	6	996	c.578C>T	c.(577-579)CCA>CTA	p.P193L	PAPD4_uc003kgb.2_Missense_Mutation_p.P193L|PAPD4_uc010jaf.1_Missense_Mutation_p.P193L|PAPD4_uc003kga.2_Missense_Mutation_p.P193L|PAPD4_uc003kfz.2_Missense_Mutation_p.P193L	NM_001114393	NP_001107865	Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	193					histone mRNA catabolic process|mRNA processing|RNA polyadenylation	cytoplasm	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity			ovary(1)	1		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		CTGTTATTTCCACGTATGTTT	0.328													58	146	---	---	---	---	PASS
ANKRD32	84250	broad.mit.edu	37	5	94001674	94001674	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94001674T>C	uc003kkr.3	+	12	1557	c.1477T>C	c.(1477-1479)TTT>CTT	p.F493L		NM_032290	NP_115666	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	493										ovary(2)	2		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		TTTAGAGTTGTTTCAGTGTCC	0.383													7	480	---	---	---	---	PASS
ZNF608	57507	broad.mit.edu	37	5	123983986	123983986	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123983986C>T	uc003ktq.1	-	4	2214	c.2091G>A	c.(2089-2091)ATG>ATA	p.M697I	ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Missense_Mutation_p.M697I|ZNF608_uc003ktt.1_Missense_Mutation_p.M697I	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	697						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CCAGTTTAGGCATCTCAGCAG	0.438													30	87	---	---	---	---	PASS
PHAX	51808	broad.mit.edu	37	5	125939331	125939331	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125939331C>T	uc003kua.1	+	2	188	c.166C>T	c.(166-168)CAT>TAT	p.H56Y		NM_032177	NP_115553	Q9H814	PHAX_HUMAN	RNA U, small nuclear RNA export adaptor	56	Necessary for interaction with CBP80 (By similarity).				ncRNA metabolic process|protein transport|snRNA export from nucleus|spliceosomal snRNP assembly	Cajal body|cytosol	RNA binding				0						ACCAGTATCACATTATCGAGC	0.413													23	193	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128984589	128984589	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128984589G>A	uc003kvb.1	+	13	2084	c.2084G>A	c.(2083-2085)TGG>TAG	p.W695*	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	695	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TTCAGAGACTGGCAATGTCAG	0.458													19	259	---	---	---	---	PASS
RGL2	5863	broad.mit.edu	37	6	33260019	33260019	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33260019G>T	uc003odv.2	-	18	2327	c.2194C>A	c.(2194-2196)CAG>AAG	p.Q732K	RGL2_uc003odu.2_Missense_Mutation_p.Q292K|RGL2_uc010jur.2_Missense_Mutation_p.Q292K|RGL2_uc003odw.2_Missense_Mutation_p.Q650K	NM_004761	NP_004752	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation	732	Ras-associating.				Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity			skin(3)|lung(1)|breast(1)|pancreas(1)	6						CTTCGCCGCTGCCGCAGGAGG	0.582													9	61	---	---	---	---	PASS
ZNF318	24149	broad.mit.edu	37	6	43304999	43304999	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43304999C>T	uc003oux.2	-	10	6815	c.6737G>A	c.(6736-6738)AGG>AAG	p.R2246K	ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	2246					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TACCTGCTCCCTTGGAGGGGA	0.498													44	131	---	---	---	---	PASS
DEFB114	245928	broad.mit.edu	37	6	49928062	49928062	+	Silent	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49928062G>T	uc011dwp.1	-	2	153	c.153C>A	c.(151-153)TCC>TCA	p.S51S		NM_001037499	NP_001032588	Q30KQ6	DB114_HUMAN	beta-defensin 114 precursor	51					defense response to bacterium	extracellular region				ovary(1)	1	Lung NSC(77;0.042)					TTCTTGGTAAGGAACATATGT	0.383													78	221	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71234370	71234370	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71234370G>C	uc003pfj.2	+	13	1716	c.1583G>C	c.(1582-1584)AGT>ACT	p.S528T	FAM135A_uc003pfi.2_Intron|FAM135A_uc003pfh.2_Intron|FAM135A_uc003pfl.2_Intron|FAM135A_uc003pfn.2_Intron|FAM135A_uc003pfo.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c	528										central_nervous_system(1)	1						TGTTTGAAAAGTACAGCATCA	0.333													25	49	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128134336	128134336	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128134336C>T	uc003qbi.2	-	5	1769	c.1450G>A	c.(1450-1452)GAC>AAC	p.D484N	THEMIS_uc010kfa.2_Missense_Mutation_p.D387N|THEMIS_uc011ebt.1_Missense_Mutation_p.D484N|THEMIS_uc010kfb.2_Missense_Mutation_p.D449N	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	484	CABIT 2.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						TCTGTAATGTCCTCCTCCAAC	0.488													9	95	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128298087	128298087	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128298087T>C	uc003qbk.2	-	26	4188	c.3821A>G	c.(3820-3822)AAC>AGC	p.N1274S	PTPRK_uc003qbj.2_Missense_Mutation_p.N1275S|PTPRK_uc010kfc.2_Missense_Mutation_p.N1281S|PTPRK_uc011ebu.1_Missense_Mutation_p.N1297S	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1274	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		GTCGACTTCGTTTAACATCAC	0.373													6	392	---	---	---	---	PASS
C6orf115	58527	broad.mit.edu	37	6	139355338	139355338	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139355338T>C	uc003qil.2	+	2	241	c.41T>C	c.(40-42)ATT>ACT	p.I14T	C6orf115_uc003qim.2_Missense_Mutation_p.I14T	NM_021243	NP_067066	Q9P1F3	CF115_HUMAN	hypothetical protein LOC58527	14											0				GBM - Glioblastoma multiforme(68;0.000278)|OV - Ovarian serous cystadenocarcinoma(155;0.000413)		GTGGAGGAAATTCATCGTTTG	0.418													7	568	---	---	---	---	PASS
EIF3B	8662	broad.mit.edu	37	7	2402391	2402391	+	Silent	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2402391T>C	uc003slx.2	+	3	887	c.804T>C	c.(802-804)GAT>GAC	p.D268D	EIF3B_uc003sly.2_Silent_p.D268D|EIF3B_uc003slz.1_Silent_p.D229D|EIF3B_uc003sma.2_5'UTR	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,	268	Sufficient for interaction with EIF3E.|RRM.|Sufficient for interaction with EIF3J.				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		TCTTTACGGATTTTGACAAGT	0.423													4	79	---	---	---	---	PASS
POU6F2	11281	broad.mit.edu	37	7	39500263	39500263	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39500263A>T	uc003thb.1	+	9	1562	c.1520A>T	c.(1519-1521)CAG>CTG	p.Q507L		NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1	507	POU-specific.				central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						CAGGTGGGACAGGCTCTCAGT	0.602													7	18	---	---	---	---	PASS
ZMIZ2	83637	broad.mit.edu	37	7	44805642	44805642	+	Intron	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44805642G>A	uc003tlr.2	+						ZMIZ2_uc003tlq.2_Intron|ZMIZ2_uc003tls.2_Intron|ZMIZ2_uc003tlt.2_Intron|ZMIZ2_uc010kyj.2_Intron|ZMIZ2_uc003tlu.2_5'UTR|ZMIZ2_uc010kyk.1_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						TGCAAAACCCGCTGTTGTTTG	0.577													3	10	---	---	---	---	PASS
FIGNL1	63979	broad.mit.edu	37	7	50513982	50513982	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50513982C>T	uc003tpc.2	-	4	1381	c.1004G>A	c.(1003-1005)GGG>GAG	p.G335E	FIGNL1_uc003tpb.2_Missense_Mutation_p.G224E|FIGNL1_uc003tpd.2_Missense_Mutation_p.G335E|FIGNL1_uc003tpe.2_Missense_Mutation_p.G335E|FIGNL1_uc010kyy.2_Missense_Mutation_p.G335E	NM_001042762	NP_001036227	Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	335					ATP metabolic process|negative regulation of apoptosis|osteoblast differentiation|osteoblast proliferation|regulation of cell cycle	cytoplasm|nucleus	ATP binding|magnesium ion binding|nucleoside-triphosphatase activity			ovary(3)	3	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				TCCAAGTATCCCTCGGGATCT	0.468													53	133	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57188569	57188569	+	Missense_Mutation	SNP	A	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57188569A>T	uc010kzo.2	-	5	824	c.553T>A	c.(553-555)TTC>ATC	p.F185I		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	185	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			TTACATTTGAAATGTTTATTT	0.294													97	252	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	71142217	71142217	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71142217G>C	uc003tvy.2	+	9	1426	c.1426G>C	c.(1426-1428)GAC>CAC	p.D476H	WBSCR17_uc003tvz.2_Missense_Mutation_p.D175H	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	476	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CAAGGCAAAAGACGTCTGCTT	0.547													33	97	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	91924303	91924303	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91924303C>A	uc003ulw.2	+	2	387	c.11C>A	c.(10-12)ACA>AAA	p.T4K		NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	4							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATGGGAAATACAACCACCAAA	0.378													46	207	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103341421	103341421	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103341421G>T	uc003vca.2	-	9	998	c.838C>A	c.(838-840)CCC>ACC	p.P280T	RELN_uc010liz.2_Missense_Mutation_p.P280T	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	280					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATGATGCTGGGGTCTGAATAA	0.323													21	466	---	---	---	---	PASS
CFTR	1080	broad.mit.edu	37	7	117251654	117251654	+	Silent	SNP	T	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117251654T>G	uc003vjd.2	+	20	3291	c.3159T>G	c.(3157-3159)ACT>ACG	p.T1053T	CFTR_uc011knq.1_Silent_p.T459T	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	1053	Cytoplasmic (Potential).|ABC transmembrane type-1 2.				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	CAATTTTCACTCATCTTGTTA	0.358									Cystic_Fibrosis				22	265	---	---	---	---	PASS
FAM160B2	64760	broad.mit.edu	37	8	21956566	21956566	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21956566C>G	uc011kyx.1	+	8	1124	c.1073C>G	c.(1072-1074)ACG>AGG	p.T358R	FAM160B2_uc011kyy.1_RNA	NM_022749	NP_073586	Q86V87	F16B2_HUMAN	retinoic acid induced 16	358											0						GAGGCACACACGGTGAGCAGG	0.607													15	71	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30706524	30706524	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30706524C>A	uc003xil.2	-	1	10	c.10G>T	c.(10-12)GAT>TAT	p.D4Y	TEX15_uc011lbc.1_Missense_Mutation_p.D391Y	NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	4										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TCTTTGGCATCACTGGGCATA	0.368													13	49	---	---	---	---	PASS
LSM1	27257	broad.mit.edu	37	8	38027383	38027383	+	Silent	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38027383G>A	uc003xkw.2	-	3	356	c.168C>T	c.(166-168)TAC>TAT	p.Y56Y	LSM1_uc003xkx.2_RNA	NM_014462	NP_055277	O15116	LSM1_HUMAN	Lsm1 protein	56					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|mRNA processing|RNA splicing, via transesterification reactions	cytosol|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0	Colorectal(12;0.000442)					GAATATCACCGTATTTTTTGC	0.378													30	385	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48875407	48875407	+	Silent	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48875407A>G	uc003xqk.1	+	6	680	c.585A>G	c.(583-585)CAA>CAG	p.Q195Q	PRKDC_uc003xqi.2_5'Flank|PRKDC_uc003xqj.2_5'Flank|PRKDC_uc011ldh.1_5'Flank|MCM4_uc003xql.1_Silent_p.Q195Q|MCM4_uc011ldi.1_Silent_p.Q182Q|MCM4_uc010lxw.1_RNA	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	195					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TATACATGCAACGACTTGGGG	0.303													7	589	---	---	---	---	PASS
PMP2	5375	broad.mit.edu	37	8	82357068	82357068	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82357068T>C	uc003ycb.1	-	2	328	c.230A>G	c.(229-231)GAC>GGC	p.D77G	PMP2_uc010lzv.1_Intron	NM_002677	NP_002668	P02689	MYP2_HUMAN	peripheral myelin protein 2	77						cytoplasm	cholesterol binding|fatty acid binding|transporter activity				0			Epithelial(68;0.186)			CTTTCTATTGTCAGCTGTGGT	0.388													41	714	---	---	---	---	PASS
CNBD1	168975	broad.mit.edu	37	8	88363919	88363919	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88363919T>A	uc003ydy.2	+	9	1097	c.1049T>A	c.(1048-1050)GTG>GAG	p.V350E		NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	350	cNMP.									ovary(3)	3						TCAGTGATAGTGGAAAGTGGA	0.254													26	617	---	---	---	---	PASS
MTDH	92140	broad.mit.edu	37	8	98718854	98718854	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98718854A>G	uc003yhz.2	+	8	1476	c.1148A>G	c.(1147-1149)AAT>AGT	p.N383S	MTDH_uc010mbf.2_RNA	NM_178812	NP_848927	Q86UE4	LYRIC_HUMAN	metadherin	383	Lung-homing for mammary tumors (By similarity).|Cytoplasmic (Potential).				lipopolysaccharide-mediated signaling pathway|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein kinase B signaling cascade	apical plasma membrane|endoplasmic reticulum membrane|integral to membrane|intercellular canaliculus|nuclear body|nuclear membrane|nucleolus|perinuclear region of cytoplasm|tight junction	NF-kappaB binding|RNA polymerase II transcription factor binding|transcription coactivator activity			liver(1)|central_nervous_system(1)	2	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			TAAATTTTAGATGGTCTGTCT	0.378													5	171	---	---	---	---	PASS
TRHR	7201	broad.mit.edu	37	8	110100141	110100141	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110100141C>A	uc003ymz.3	+	1	416	c.400C>A	c.(400-402)CAG>AAG	p.Q134K		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	134	Cytoplasmic (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CATCAAAGCCCAGTTTCTCTG	0.408													5	267	---	---	---	---	PASS
TLE1	7088	broad.mit.edu	37	9	84205823	84205823	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84205823C>T	uc004aly.2	-	16	2167	c.1726G>A	c.(1726-1728)GCC>ACC	p.A576T	TLE1_uc004alz.2_Missense_Mutation_p.A586T|TLE1_uc011lsr.1_Missense_Mutation_p.A561T|TLE1_uc004ama.1_Missense_Mutation_p.A575T	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1	576	WD 3.				negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						GCGTAGCAGGCGGGGGCCGAG	0.617													7	18	---	---	---	---	PASS
OR1Q1	158131	broad.mit.edu	37	9	125377098	125377098	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125377098T>C	uc011lyy.1	+	1	82	c.82T>C	c.(82-84)TTC>CTC	p.F28L		NM_012364	NP_036496	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q,	28	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AATCCCACTCTTCCTTGTTTT	0.468													5	221	---	---	---	---	PASS
DNM1	1759	broad.mit.edu	37	9	131012518	131012518	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131012518C>T	uc011mau.1	+	20	2288	c.2201C>T	c.(2200-2202)GCA>GTA	p.A734V	DNM1_uc011mat.1_Missense_Mutation_p.A734V|DNM1_uc004bub.1_Missense_Mutation_p.A107V|DNM1_uc004buc.1_Missense_Mutation_p.A201V|DNM1_uc004bud.3_RNA|uc004buf.1_5'Flank	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1	734	GED.				receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2						ATGTACCACGCACTGAAGGAG	0.657													3	11	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135145048	135145048	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135145048C>T	uc004cbk.2	-	25	7424	c.7241G>A	c.(7240-7242)CGA>CAA	p.R2414Q	SETX_uc004cbj.2_Missense_Mutation_p.R2033Q|SETX_uc010mzt.2_Missense_Mutation_p.R2000Q	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	2414					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GTACTTGGCTCGTGTGATGGT	0.438													4	204	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071478	141071478	+	Missense_Mutation	SNP	G	C	C	rs147600849	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071478G>C	uc004com.2	+	4	1142	c.881G>C	c.(880-882)AGC>ACC	p.S294T	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						ATGTCAGCCAGCTTCATTGGG	0.507													5	54	---	---	---	---	PASS
BMI1	648	broad.mit.edu	37	10	22607938	22607938	+	5'Flank	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22607938A>G	uc001irh.2	+						COMMD3_uc001ire.2_3'UTR|COMMD3_uc001irf.2_Silent_p.E173E|COMMD3_uc001irg.2_RNA|BMI1_uc009xkg.2_Missense_Mutation_p.N134S	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene						hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						GCAGCATGGAACAATTACAGG	0.328													7	673	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64946137	64946137	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64946137C>T	uc001jmn.2	-	19	6877	c.6577G>A	c.(6577-6579)GTG>ATG	p.V2193M	JMJD1C_uc001jml.2_Missense_Mutation_p.V1956M|JMJD1C_uc001jmm.2_Missense_Mutation_p.V1905M|JMJD1C_uc010qiq.1_Missense_Mutation_p.V2011M|JMJD1C_uc009xpi.2_Missense_Mutation_p.V2011M|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmo.2_Missense_Mutation_p.V100M	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2193					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCAGAAACCACTGCAGGCTTA	0.274													4	217	---	---	---	---	PASS
CCAR1	55749	broad.mit.edu	37	10	70532818	70532818	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70532818A>G	uc001joo.2	+	19	2731	c.2612A>G	c.(2611-2613)GAC>GGC	p.D871G	CCAR1_uc010qiz.1_Missense_Mutation_p.D856G|CCAR1_uc010qjb.1_RNA	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1	871	Glu-rich.				apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						GATGAATATGACCCTATGGAA	0.274													7	459	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84745303	84745303	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84745303G>A	uc001kco.2	+	9	2060	c.2033G>A	c.(2032-2034)CGA>CAA	p.R678Q	NRG3_uc010qlz.1_Missense_Mutation_p.R677Q|NRG3_uc001kcp.2_Missense_Mutation_p.R481Q|NRG3_uc001kcq.2_Missense_Mutation_p.R328Q|NRG3_uc001kcr.2_Missense_Mutation_p.R352Q	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	702	Cytoplasmic (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		AAATCAGAACGAGAGGCGCAA	0.468													18	40	---	---	---	---	PASS
EXOC6	54536	broad.mit.edu	37	10	94669323	94669323	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94669323C>T	uc001kig.2	+	6	664	c.598C>T	c.(598-600)CTC>TTC	p.L200F	EXOC6_uc010qnr.1_Missense_Mutation_p.L216F|EXOC6_uc001kie.2_Missense_Mutation_p.L195F|EXOC6_uc009xub.2_Missense_Mutation_p.L200F|EXOC6_uc009xuc.2_Missense_Mutation_p.L200F	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a	200					protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				CATGTCTGATCTCAAAGACTT	0.323													4	249	---	---	---	---	PASS
C10orf4	118924	broad.mit.edu	37	10	95441244	95441244	+	Silent	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95441244T>C	uc001kiz.1	-	11	978	c.780A>G	c.(778-780)AAA>AAG	p.K260K	C10orf4_uc001kiv.1_RNA|C10orf4_uc001kja.1_Silent_p.K260K	NM_145246	NP_660289	Q70Z53	F10C1_HUMAN	FRA10AC1 protein	260	Lys-rich.					nucleus	protein binding				0		Colorectal(252;0.122)				TACCTTTATCTTTTTTCTTGG	0.313													8	790	---	---	---	---	PASS
FAM178A	55719	broad.mit.edu	37	10	102684302	102684302	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102684302C>G	uc001krt.3	+	5	2086	c.1544C>G	c.(1543-1545)TCT>TGT	p.S515C	FAM178A_uc001krr.1_Missense_Mutation_p.S515C|FAM178A_uc001krs.2_Missense_Mutation_p.S515C|FAM178A_uc001kru.1_Missense_Mutation_p.S450C	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	515											0						TCTGGGCATTCTACAGAATCC	0.398													11	89	---	---	---	---	PASS
RIC8A	60626	broad.mit.edu	37	11	208842	208842	+	5'UTR	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:208842T>C	uc001log.2	+	1					BET1L_uc001loe.2_5'Flank|BET1L_uc001lod.2_5'Flank|RIC8A_uc001lof.2_5'UTR|RIC8A_uc001loh.2_5'Flank	NM_021932	NP_068751	Q9NPQ8	RIC8A_HUMAN	resistance to inhibitors of cholinesterase 8							cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity				0		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CGTCCCGCCTTCCCCGGCGCG	0.562													3	11	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11976637	11976637	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11976637C>T	uc001mjs.2	+	27	4582	c.3819C>T	c.(3817-3819)GAC>GAT	p.D1273D	USP47_uc001mjr.2_Silent_p.D1205D|USP47_uc009ygi.2_Silent_p.D75D	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	1293					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		AGGATTTAGACTGGAATCCTA	0.358													5	599	---	---	---	---	PASS
SPTY2D1	144108	broad.mit.edu	37	11	18636132	18636132	+	Silent	SNP	T	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18636132T>G	uc001moy.2	-	3	1905	c.1689A>C	c.(1687-1689)CTA>CTC	p.L563L	SPTY2D1_uc010rdi.1_Silent_p.L563L	NM_194285	NP_919261	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1	563										breast(1)	1						TGTAGCCAGATAGGGGAGGCT	0.418													55	140	---	---	---	---	PASS
PTPN5	84867	broad.mit.edu	37	11	18764949	18764949	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18764949C>T	uc001mpd.2	-	5	750	c.319G>A	c.(319-321)GGT>AGT	p.G107S	PTPN5_uc001mpb.2_Intron|PTPN5_uc001mpc.2_Missense_Mutation_p.G107S|PTPN5_uc001mpe.2_Intron|PTPN5_uc010rdj.1_Intron|PTPN5_uc001mpf.2_Missense_Mutation_p.G83S|PTPN5_uc010rdk.1_Missense_Mutation_p.G52S	NM_006906	NP_008837	P54829	PTN5_HUMAN	protein-tyrosine-phosphatase non-receptor 5	107				G -> A (in Ref. 2; CAD38632).		integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(2)	2						TGGCCATAACCGCTGAACCAG	0.607													29	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30926700	30926700	+	RNA	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30926700C>T	uc001mss.1	-	9		c.1219G>A			uc009yjk.1_Silent_p.S820S|uc009yjj.1_RNA					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		CCTTGTCACACGACAAATCAA	0.363													41	116	---	---	---	---	PASS
PDE2A	5138	broad.mit.edu	37	11	72292494	72292494	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72292494C>T	uc010rrc.1	-	23	2195	c.1952G>A	c.(1951-1953)CGG>CAG	p.R651Q	PDE2A_uc001oso.2_Missense_Mutation_p.R630Q|PDE2A_uc010rra.1_Missense_Mutation_p.R644Q|PDE2A_uc001osn.2_Missense_Mutation_p.R395Q|PDE2A_uc010rrb.1_Missense_Mutation_p.R642Q|PDE2A_uc010rrd.1_Missense_Mutation_p.R536Q	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1	651	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	GGGGGGATCCCGGTAGCCCTT	0.577													5	96	---	---	---	---	PASS
CCDC82	79780	broad.mit.edu	37	11	96117717	96117717	+	Silent	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96117717T>C	uc009ywp.2	-	1	438	c.195A>G	c.(193-195)GAA>GAG	p.E65E	CCDC82_uc009ywq.2_Silent_p.E65E|CCDC82_uc001pfx.3_Silent_p.E65E|CCDC82_uc009ywr.2_Silent_p.E65E|CCDC82_uc009yws.2_Silent_p.E65E	NM_024725	NP_079001	Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	65							protein binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		TATCAAGCTCTTCATCATTTT	0.338													7	685	---	---	---	---	PASS
FAM55D	54827	broad.mit.edu	37	11	114442140	114442140	+	Silent	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114442140C>A	uc001ppc.2	-	6	1336	c.1155G>T	c.(1153-1155)GTG>GTT	p.V385V	FAM55D_uc001ppd.2_Silent_p.V101V	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	385						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		TATCCAAATCCACAGCAAGCT	0.408													75	174	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	970307	970307	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:970307G>T	uc001qio.3	+	7	2256	c.1749G>T	c.(1747-1749)AAG>AAT	p.K583N	WNK1_uc001qip.3_Missense_Mutation_p.K583N|WNK1_uc001qir.3_Missense_Mutation_p.K30N	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	583					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			AAAAAAAAAAGCAGGAAGAGA	0.468													4	61	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14796510	14796510	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14796510T>C	uc001rcd.2	-	17	2065	c.1928A>G	c.(1927-1929)AAG>AGG	p.K643R		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	643	Cytoplasmic (Potential).|Protein kinase.				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						TTACAGACCCTTTTTTGGAGG	0.388													13	229	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	44915937	44915937	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44915937C>T	uc001rog.2	-	18	2616	c.2021G>A	c.(2020-2022)CGG>CAG	p.R674Q	NELL2_uc001rof.3_Missense_Mutation_p.R673Q|NELL2_uc001roh.2_Missense_Mutation_p.R674Q|NELL2_uc009zkd.2_Missense_Mutation_p.R626Q|NELL2_uc010skz.1_Missense_Mutation_p.R724Q|NELL2_uc010sla.1_Missense_Mutation_p.R697Q	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	674	VWFC 3.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		ACAGACCATCCGTCGACACAT	0.363													38	118	---	---	---	---	PASS
SUOX	6821	broad.mit.edu	37	12	56397616	56397616	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56397616T>C	uc001six.2	+	6	769	c.443T>C	c.(442-444)GTG>GCG	p.V148A	SUOX_uc001siy.2_Missense_Mutation_p.V148A|SUOX_uc001siz.2_Missense_Mutation_p.V148A|SUOX_uc001sja.2_Missense_Mutation_p.V148A	NM_000456	NP_000447	P51687	SUOX_HUMAN	sulfite oxidase precursor	148	Cytochrome b5 heme-binding.					mitochondrial intermembrane space	electron carrier activity|molybdenum ion binding|sulfite oxidase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			CAGTCCCATGTGCGTGAGTTA	0.562													32	65	---	---	---	---	PASS
TCTN1	79600	broad.mit.edu	37	12	111078208	111078208	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111078208C>T	uc009zvs.2	+	8	972	c.864C>T	c.(862-864)TCC>TCT	p.S288S	TCTN1_uc009zvr.1_RNA|TCTN1_uc001trl.2_RNA|TCTN1_uc001trm.2_Silent_p.S228S|TCTN1_uc010syc.1_RNA|TCTN1_uc001tro.2_RNA|TCTN1_uc001trp.3_Silent_p.S274S|TCTN1_uc001trn.3_Silent_p.S288S|TCTN1_uc001trj.1_Silent_p.S232S|TCTN1_uc001trk.3_RNA|HVCN1_uc001trq.1_Intron	NM_001082537	NP_001076006	Q2MV58	TECT1_HUMAN	tectonic family member 1 isoform 2	288					multicellular organismal development	extracellular region					0						CTGTTCAGTCCATCGTCATTC	0.502													4	200	---	---	---	---	PASS
CCNA1	8900	broad.mit.edu	37	13	37016753	37016753	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37016753A>G	uc001uvr.3	+	9	1699	c.1349A>G	c.(1348-1350)TAC>TGC	p.Y450C	CCNA1_uc010teo.1_Missense_Mutation_p.Y406C|CCNA1_uc010abq.2_Missense_Mutation_p.Y406C|CCNA1_uc010abp.2_Missense_Mutation_p.Y406C|CCNA1_uc001uvs.3_Missense_Mutation_p.Y449C|CCNA1_uc010abr.2_RNA	NM_003914	NP_003905	P78396	CCNA1_HUMAN	cyclin A1 isoform a	450					cell division|G2/M transition of mitotic cell cycle|male meiosis I|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|spermatogenesis	cytosol|microtubule cytoskeleton|nucleoplasm	protein kinase binding			lung(2)|skin(2)|ovary(1)	5		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		TGTTTCAGGTACCTGTGTGTG	0.438													6	479	---	---	---	---	PASS
FNDC3A	22862	broad.mit.edu	37	13	49752708	49752708	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49752708A>G	uc001vcm.2	+	14	1840	c.1535A>G	c.(1534-1536)TAT>TGT	p.Y512C	FNDC3A_uc001vcn.2_Missense_Mutation_p.Y512C|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcp.1_Missense_Mutation_p.Y438C|FNDC3A_uc001vcq.2_Missense_Mutation_p.Y456C	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	512	Fibronectin type-III 3.					Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		TTCCAGGGATATGGTTTTAAG	0.338													5	492	---	---	---	---	PASS
INTS6	26512	broad.mit.edu	37	13	51943326	51943326	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51943326G>T	uc001vfk.2	-	16	2839	c.2225C>A	c.(2224-2226)GCC>GAC	p.A742D	INTS6_uc001vfi.2_Missense_Mutation_p.A426D|INTS6_uc001vfj.2_Missense_Mutation_p.A729D|INTS6_uc001vfl.2_Missense_Mutation_p.A564D	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a	742					snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		CAGTAAACTGGCTGGAGAAGA	0.408													43	167	---	---	---	---	PASS
HEATR5A	25938	broad.mit.edu	37	14	31817065	31817065	+	Silent	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31817065G>A	uc001wrf.3	-	13	1955	c.1878C>T	c.(1876-1878)GCC>GCT	p.A626A	HEATR5A_uc010ami.2_Silent_p.A524A|HEATR5A_uc001wrg.1_Silent_p.A508A|HEATR5A_uc010tpk.1_Silent_p.A919A	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	913							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GGGACCCCAAGGCCAATGAGT	0.373													49	141	---	---	---	---	PASS
GNB5	10681	broad.mit.edu	37	15	52414934	52414934	+	3'UTR	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52414934A>G	uc002abt.1	-	13					GNB5_uc002abr.1_3'UTR|GNB5_uc002abs.1_3'UTR	NM_016194	NP_057278	O14775	GBB5_HUMAN	guanine nucleotide-binding protein, beta-5							heterotrimeric G-protein complex	GTPase activity|signal transducer activity			lung(1)	1				all cancers(107;0.0163)		GGTATACATGAGTGCACTGTC	0.373													6	275	---	---	---	---	PASS
LYSMD4	145748	broad.mit.edu	37	15	100269225	100269225	+	3'UTR	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100269225T>C	uc002bvk.2	-	3					LYSMD4_uc002bvj.1_Intron|LYSMD4_uc010bou.1_Intron|LYSMD4_uc002bvl.2_3'UTR|LYSMD4_uc002bvm.2_3'UTR|LYSMD4_uc010bov.2_3'UTR			Q5XG99	LYSM4_HUMAN	SubName: Full=cDNA FLJ77040, highly similar to Homo sapiens LysM, putative peptidoglycan-binding, domain containing 4, mRNA; SubName: Full=LysM, putative peptidoglycan-binding, domain containing 4, isoform CRA_c;						cell wall macromolecule catabolic process	integral to membrane					0	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)			GTGTCCATCCTTCCCCGGAAG	0.507													3	10	---	---	---	---	PASS
PARN	5073	broad.mit.edu	37	16	14576651	14576651	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14576651C>T	uc010uzd.1	-	22	1656	c.1514G>A	c.(1513-1515)CGG>CAG	p.R505Q	PARN_uc010uzc.1_Missense_Mutation_p.R444Q|PARN_uc010uze.1_Missense_Mutation_p.R459Q|PARN_uc010uzf.1_Missense_Mutation_p.R330Q	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation	505					female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						GGTTTGGATCCGATAGCTTTC	0.408													5	639	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													5	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268081	70268081	+	RNA	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268081G>A	uc010cfp.1	-	3		c.334C>T								Homo sapiens cDNA, FLJ98908.																		TCTTACTGTTGGCTAAAAGGC	0.373													3	21	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71679621	71679621	+	3'UTR	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71679621T>C	uc002fax.2	-	18					PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_3'UTR	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						TCCTGCTGGCTCTTCCGTACA	0.468													4	24	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577097	7577097	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577097C>A	uc002gim.2	-	8	1035	c.841G>T	c.(841-843)GAC>TAC	p.D281Y	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.D281Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D149Y|TP53_uc010cng.1_Missense_Mutation_p.D149Y|TP53_uc002gii.1_Missense_Mutation_p.D149Y|TP53_uc010cnh.1_Missense_Mutation_p.D281Y|TP53_uc010cni.1_Missense_Mutation_p.D281Y|TP53_uc002gij.2_Missense_Mutation_p.D281Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	281	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> A (in sporadic cancers; somatic mutation).|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.D281E(25)|p.D281H(19)|p.D281N(18)|p.D281G(10)|p.0?(7)|p.D281Y(6)|p.D281D(5)|p.D281V(3)|p.D281fs*63(2)|p.?(2)|p.R280_D281delRD(2)|p.D281A(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.G279fs*59(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.D281R(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGCGCCGGTCTCTCCCAGGA	0.547		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	78	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577565	7577565	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577565T>C	uc002gim.2	-	7	910	c.716A>G	c.(715-717)AAC>AGC	p.N239S	TP53_uc002gig.1_Missense_Mutation_p.N239S|TP53_uc002gih.2_Missense_Mutation_p.N239S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.N107S|TP53_uc010cng.1_Missense_Mutation_p.N107S|TP53_uc002gii.1_Missense_Mutation_p.N107S|TP53_uc010cnh.1_Missense_Mutation_p.N239S|TP53_uc010cni.1_Missense_Mutation_p.N239S|TP53_uc002gij.2_Missense_Mutation_p.N239S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.N146S|TP53_uc002gio.2_Missense_Mutation_p.N107S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	239	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		N -> Y (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> D (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.N239D(31)|p.N239S(19)|p.N239fs*25(12)|p.0?(7)|p.N239Y(6)|p.N239K(6)|p.N239T(4)|p.N239_C242delNSSC(3)|p.N239_S240insX(2)|p.N239fs*8(2)|p.N239_S240delNS(2)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.M237_N239delMCN(1)|p.N239fs*26(1)|p.C238fs*21(1)|p.N239N(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.N239fs*0(1)|p.N239_C242del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCAGGAACTGTTACACATGTA	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			4	69	---	---	---	---	PASS
CHD3	1107	broad.mit.edu	37	17	7804567	7804567	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7804567C>T	uc002gje.2	+	20	3276	c.3126C>T	c.(3124-3126)TCC>TCT	p.S1042S	CHD3_uc002gjd.2_Silent_p.S1101S|CHD3_uc002gjf.2_Silent_p.S1042S|CHD3_uc002gjh.2_5'Flank	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1042					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				TTCAGGAGTCCCCCAAACTCC	0.562													3	42	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10428646	10428646	+	Silent	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10428646C>T	uc010coi.2	-	33	4685	c.4557G>A	c.(4555-4557)ACG>ACA	p.T1519T	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.T1519T|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1519	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CAATCTGTTCCGTGAGGTCAG	0.388													7	272	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15952284	15952284	+	Silent	SNP	T	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15952284T>G	uc002gpo.2	-	41	6651	c.6411A>C	c.(6409-6411)CCA>CCC	p.P2137P	NCOR1_uc002gpn.2_Silent_p.P2034P|NCOR1_uc002gpl.2_Silent_p.P152P|NCOR1_uc002gpm.2_Silent_p.P657P|NCOR1_uc010vwb.1_Silent_p.P721P|NCOR1_uc010coy.2_Silent_p.P1045P|NCOR1_uc010vwc.1_Silent_p.P947P	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	2137	Interaction with C1D (By similarity).				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GACTCCTCTCTGGGGATTTTC	0.473													15	29	---	---	---	---	PASS
CCT6B	10693	broad.mit.edu	37	17	33266728	33266728	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33266728A>G	uc002hig.2	-	9	1067	c.973T>C	c.(973-975)TCT>CCT	p.S325P	CCT6B_uc010ctg.2_Missense_Mutation_p.S288P|CCT6B_uc010wcc.1_Missense_Mutation_p.S280P	NM_006584	NP_006575	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B	325					chaperone-mediated protein complex assembly|protein folding|spermatogenesis	cytoplasm	ATP binding|protein transporter activity|unfolded protein binding			pancreas(1)	1		Ovarian(249;0.17)				CAAGCAAGAGAGAGTCTGAAA	0.363													6	277	---	---	---	---	PASS
WFIKKN2	124857	broad.mit.edu	37	17	48918195	48918195	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48918195C>G	uc002isv.3	+	2	2240	c.1546C>G	c.(1546-1548)CCC>GCC	p.P516A	WFIKKN2_uc010dbu.2_Missense_Mutation_p.P423A	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	WFIKKN2 protein	516	NTR.					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			CTGGGCATGCCCCTGCCCCAA	0.612													12	22	---	---	---	---	PASS
KCNJ16	3773	broad.mit.edu	37	17	68128362	68128362	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68128362T>C	uc002jin.2	+	5	620	c.134T>C	c.(133-135)GTC>GCC	p.V45A	KCNJ16_uc002jio.2_Missense_Mutation_p.V45A|KCNJ16_uc002jip.2_Missense_Mutation_p.V45A|KCNJ16_uc002jiq.2_Missense_Mutation_p.V77A	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	45	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					AGCTGTAATGTCTACTTCAAG	0.448													7	521	---	---	---	---	PASS
AFMID	125061	broad.mit.edu	37	17	76203110	76203110	+	3'UTR	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76203110T>C	uc002jva.3	+	11					AFMID_uc002jvb.3_3'UTR|AFMID_uc002juz.3_3'UTR	NM_001010982	NP_001010982	Q63HM1	AFMID_HUMAN	arylformamidase isoform 1							cytosol|nucleus	arylformamidase activity			large_intestine(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.134)			AGCTTCAGTTTCCCCCAGCAC	0.557													6	80	---	---	---	---	PASS
C17orf56	146705	broad.mit.edu	37	17	79204474	79204474	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79204474G>A	uc002jzu.1	-	11	921	c.899C>T	c.(898-900)GCG>GTG	p.A300V	C17orf56_uc002jzr.1_5'UTR|C17orf56_uc002jzs.1_Missense_Mutation_p.A216V|C17orf56_uc002jzt.1_Missense_Mutation_p.A216V|C17orf56_uc002jzv.1_Missense_Mutation_p.A148V|uc002jzw.1_RNA	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705	300						integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGCACACAGCGCCCTCTGCGG	0.672											OREG0024811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	6	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80765530	80765530	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80765530G>A	uc002kfz.2	+	11	1264	c.1134G>A	c.(1132-1134)TGG>TGA	p.W378*	TBCD_uc002kfx.1_Nonsense_Mutation_p.W361*|TBCD_uc002kfy.1_Nonsense_Mutation_p.W378*	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	378	HEAT 1.				'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TCGTGCGGTGGTCTGCAGCCA	0.592													12	39	---	---	---	---	PASS
KIAA1012	22878	broad.mit.edu	37	18	29450351	29450351	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29450351T>C	uc002kxc.3	-	16	2736	c.2372A>G	c.(2371-2373)GAA>GGA	p.E791G	KIAA1012_uc002kxb.3_Missense_Mutation_p.E737G|KIAA1012_uc002kxd.3_RNA	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	791					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						TTTAACTTCTTCATTATCCTT	0.323													5	168	---	---	---	---	PASS
ADNP2	22850	broad.mit.edu	37	18	77896713	77896713	+	3'UTR	SNP	A	C	C	rs59145777		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77896713A>C	uc002lnw.2	+	4						NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2						cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		AAAAAAAAAAAGTAACTCTAA	0.338													5	5	---	---	---	---	PASS
MUM1	84939	broad.mit.edu	37	19	1357017	1357017	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1357017C>T	uc010xgm.1	+	2	136	c.67C>T	c.(67-69)CGA>TGA	p.R23*	MUM1_uc010dsi.2_5'UTR|MUM1_uc002lrz.2_Nonsense_Mutation_p.R24*|MUM1_uc002lsb.2_5'UTR|MUM1_uc002lsc.1_5'Flank			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;	23					chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTTTTGGCCCGAACCGCGAC	0.353													6	555	---	---	---	---	PASS
MATK	4145	broad.mit.edu	37	19	3783901	3783901	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3783901C>T	uc002lyt.2	-	6	893	c.493G>A	c.(493-495)GAC>AAC	p.D165N	MATK_uc002lyv.2_Missense_Mutation_p.D166N|MATK_uc002lyu.2_Missense_Mutation_p.D124N|MATK_uc010dtq.2_Missense_Mutation_p.D165N	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform	165	SH2.				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGATGACGTCGCGGCCAAAG	0.662													3	11	---	---	---	---	PASS
PIAS4	51588	broad.mit.edu	37	19	4013124	4013124	+	Silent	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4013124G>A	uc002lzg.2	+	2	241	c.231G>A	c.(229-231)CCG>CCA	p.P77P		NM_015897	NP_056981	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4	77					positive regulation of protein sumoylation|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|PML body	DNA binding|SUMO ligase activity|ubiquitin protein ligase binding|zinc ion binding			pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCACAGCCGCACCGGCCCC	0.637													7	10	---	---	---	---	PASS
ARHGEF18	23370	broad.mit.edu	37	19	7509264	7509264	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7509264G>A	uc002mgi.2	+	4	1224	c.971G>A	c.(970-972)CGC>CAC	p.R324H	ARHGEF18_uc010xjm.1_Missense_Mutation_p.R166H|ARHGEF18_uc002mgh.2_Missense_Mutation_p.R166H|ARHGEF18_uc002mgj.1_5'Flank	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18	324	DH.				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				CTCAAGGAGCGCCGCCAGGAG	0.617													8	30	---	---	---	---	PASS
COPE	11316	broad.mit.edu	37	19	19021795	19021795	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19021795G>A	uc002nkk.2	-	3	317	c.275C>T	c.(274-276)GCC>GTC	p.A92V	COPE_uc002nkl.2_Missense_Mutation_p.A92V|COPE_uc002nkm.2_Missense_Mutation_p.A92V|COPE_uc002nkn.2_Missense_Mutation_p.A92V|HOMER3_uc002nko.1_RNA|HOMER3_uc002nkp.1_Intron	NM_007263	NP_009194	O14579	COPE_HUMAN	epsilon subunit of coatomer protein complex	92					COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	binding|structural molecule activity				0						ACTCTCGTGGGCGAGGTAGTC	0.627													13	34	---	---	---	---	PASS
LOC100101266	100101266	broad.mit.edu	37	19	24345286	24345286	+	RNA	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24345286A>G	uc010edb.1	-	1		c.964T>C				NR_003603				Homo sapiens hepatitis A virus cellular receptor 1 pseudogene (LOC100101266), non-coding RNA.												0						CATTTTGCAAAGCTTTAGTTT	0.378													15	378	---	---	---	---	PASS
C19orf47	126526	broad.mit.edu	37	19	40829950	40829950	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40829950C>T	uc002oni.3	-	8	738	c.737G>A	c.(736-738)GGC>GAC	p.G246D	C19orf47_uc002ong.2_Missense_Mutation_p.G105D|C19orf47_uc002onh.2_Missense_Mutation_p.G179D	NM_178830	NP_849152	Q8N9M1	CS047_HUMAN	hypothetical protein LOC126526	246										ovary(1)|skin(1)	2			Lung(22;0.000636)			GGTCTCGGCGCCGAGGCGGTC	0.632													15	66	---	---	---	---	PASS
ZNF28	7576	broad.mit.edu	37	19	53321205	53321205	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53321205G>C	uc002qad.2	-	2	127	c.7C>G	c.(7-9)CTT>GTT	p.L3V	ZNF28_uc002qac.2_5'UTR|ZNF28_uc010eqe.2_5'UTR	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	3					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		ACCTGAGGAAGAGCCATCCCT	0.463													62	142	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54313326	54313326	+	Silent	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54313326G>A	uc002qch.3	-	3	1807	c.1587C>T	c.(1585-1587)GAC>GAT	p.D529D	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.D529D|NLRP12_uc002qcj.3_Silent_p.D529D|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.D529D	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	529					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CCTCCCCCTCGTCCAGGATAT	0.537													13	36	---	---	---	---	PASS
LILRA1	11024	broad.mit.edu	37	19	55106239	55106239	+	Silent	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55106239G>A	uc002qgh.1	+	4	362	c.180G>A	c.(178-180)CTG>CTA	p.L60L	LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Silent_p.L60L	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,	60	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)		AGTACCGTCTGTATAGAGAAA	0.572													6	195	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3215511	3215511	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3215511A>G	uc002wig.2	-	2	214	c.166T>C	c.(166-168)TTC>CTC	p.F56L	SLC4A11_uc010zqe.1_Missense_Mutation_p.F83L|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.F40L	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	56	Cytoplasmic (Potential).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						CGGGCTTCGAAGGTGTCATCT	0.552													4	70	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42788569	42788569	+	Silent	SNP	G	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42788569G>A	uc002xli.1	-	2	1731	c.858C>T	c.(856-858)ACC>ACT	p.T286T		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	286	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TCTCGGTGGTGGTGGCGTCGA	0.706													3	21	---	---	---	---	PASS
SOD1	6647	broad.mit.edu	37	21	33038805	33038805	+	Silent	SNP	A	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33038805A>G	uc002ypa.2	+	3	361	c.213A>G	c.(211-213)AAA>AAG	p.K71K	SOD1_uc002ypb.2_Silent_p.K52K|SOD1_uc002ypc.2_RNA	NM_000454	NP_000445	P00441	SODC_HUMAN	superoxide dismutase 1, soluble	71					activation of MAPK activity|auditory receptor cell stereocilium organization|cell aging|cellular iron ion homeostasis|DNA fragmentation involved in apoptotic nuclear change|double-strand break repair|embryo implantation|glutathione metabolic process|heart contraction|hydrogen peroxide biosynthetic process|locomotory behavior|muscle cell homeostasis|myeloid cell homeostasis|negative regulation of cholesterol biosynthetic process|negative regulation of neuron apoptosis|neurofilament cytoskeleton organization|ovarian follicle development|peripheral nervous system myelin maintenance|placenta development|platelet activation|platelet degranulation|positive regulation of cytokine production|regulation of blood pressure|regulation of mitochondrial membrane potential|regulation of multicellular organism growth|regulation of organ growth|regulation of T cell differentiation in thymus|relaxation of vascular smooth muscle|removal of superoxide radicals|response to axon injury|response to drug|response to ethanol|response to heat|response to hydrogen peroxide|retina homeostasis|sensory perception of sound|spermatogenesis|thymus development	cytoplasmic vesicle|cytosol|dendrite cytoplasm|extracellular matrix|extracellular space|mitochondrial matrix|neuronal cell body|nucleus|peroxisome|protein complex	chaperone binding|copper ion binding|protein homodimerization activity|protein phosphatase 2B binding|superoxide dismutase activity|zinc ion binding				0						TATCCAGAAAACACGGTGGGC	0.353													6	314	---	---	---	---	PASS
C22orf31	25770	broad.mit.edu	37	22	29456415	29456415	+	Silent	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29456415T>C	uc003aej.1	-	2	547	c.420A>G	c.(418-420)GGA>GGG	p.G140G		NM_015370	NP_056185	O95567	CV031_HUMAN	hypothetical protein LOC25770	140											0						CTCTGATGCCTCCTGCAGGCC	0.517													49	142	---	---	---	---	PASS
SCML1	6322	broad.mit.edu	37	X	17763603	17763603	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17763603G>T	uc004cyb.2	+	3	386	c.61G>T	c.(61-63)GAA>TAA	p.E21*	SCML1_uc004cyc.2_Intron|SCML1_uc004cyd.2_Intron|SCML1_uc004cye.2_Intron	NM_001037540	NP_001032629	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 isoform a	21					anatomical structure morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)	3	Hepatocellular(33;0.183)					TACTTACGATGAAGATGACAA	0.284													102	285	---	---	---	---	PASS
GPR64	10149	broad.mit.edu	37	X	19042026	19042026	+	Splice_Site	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19042026C>T	uc004cyx.2	-	12	674	c.510_splice	c.e12+1	p.E170_splice	GPR64_uc004cyy.2_Splice_Site_p.E167_splice|GPR64_uc004cyz.2_Splice_Site_p.E156_splice|GPR64_uc004czb.2_Splice_Site_p.E170_splice|GPR64_uc004czc.2_Splice_Site_p.E154_splice|GPR64_uc004czd.2_Splice_Site_p.E146_splice|GPR64_uc004cze.2_Splice_Site_p.E140_splice|GPR64_uc004czf.2_Splice_Site_p.E132_splice|GPR64_uc004cza.2_Splice_Site_p.E148_splice|GPR64_uc004cyw.2_Splice_Site_p.E154_splice|GPR64_uc010nfj.2_Splice_Site_p.E140_splice	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1						neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					ACTATGATTACCTCACTTAGG	0.348													41	639	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32662269	32662269	+	Silent	SNP	A	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32662269A>T	uc004dda.1	-	11	1555	c.1311T>A	c.(1309-1311)GCT>GCA	p.A437A	DMD_uc004dcz.2_Silent_p.A314A|DMD_uc004dcy.1_Silent_p.A433A|DMD_uc004ddb.1_Silent_p.A429A|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Silent_p.A429A|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron|MIR548F5_hsa-mir-548f-5|MI0006378_5'Flank	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	437	Spectrin 1.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTCCATGCTAGCTACCCTGA	0.348													8	564	---	---	---	---	PASS
PHF16	9767	broad.mit.edu	37	X	46887397	46887397	+	Silent	SNP	A	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46887397A>C	uc004dgx.2	+	6	630	c.579A>C	c.(577-579)CTA>CTC	p.L193L	PHF16_uc004dgy.2_Silent_p.L193L	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	193					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						AGGAAGGGCTAGGCATAGAGT	0.448													42	499	---	---	---	---	PASS
AKAP4	8852	broad.mit.edu	37	X	49957227	49957227	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49957227T>A	uc004dow.1	-	5	2261	c.2137A>T	c.(2137-2139)AAG>TAG	p.K713*	AKAP4_uc004dov.1_Nonsense_Mutation_p.K330*|AKAP4_uc010njp.1_Nonsense_Mutation_p.K535*|AKAP4_uc004dou.1_Nonsense_Mutation_p.K704*	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	713					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					TTGCTATACTTAGCCATGATA	0.478													52	135	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50125575	50125575	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50125575T>C	uc010njr.1	-	18	2636	c.2576A>G	c.(2575-2577)AAC>AGC	p.N859S		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	859					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					GAAGTAGTTGTTCATGACACA	0.413													7	677	---	---	---	---	PASS
USP51	158880	broad.mit.edu	37	X	55514285	55514285	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55514285C>G	uc004dun.1	-	2	1167	c.1088G>C	c.(1087-1089)AGA>ACA	p.R363T	USP51_uc011moo.1_Missense_Mutation_p.R67T	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	363					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						GATTAGCCCTCTCAGGCCTAC	0.408													64	121	---	---	---	---	PASS
EDA	1896	broad.mit.edu	37	X	69176977	69176977	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69176977C>A	uc004dxs.2	+	2	739	c.497C>A	c.(496-498)GCA>GAA	p.A166E	EDA_uc004dxr.2_Missense_Mutation_p.A166E|EDA_uc011mpj.1_Missense_Mutation_p.A166E|EDA_uc004dxp.1_3'UTR|EDA_uc004dxq.1_Missense_Mutation_p.A166E	NM_001399	NP_001390	Q92838	EDA_HUMAN	ectodysplasin A isoform EDA-A1	166	Extracellular (Potential).				cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding			ovary(2)|large_intestine(1)	3						AATGAAGGAGCAGATGGTAAG	0.348													5	407	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	6077	6077	+	5'UTR	SNP	C	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6077C>T	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		AACGTTATCGTCACAGCCCAT	0.493													7	73	---	---	---	---	PASS
WDR8	49856	broad.mit.edu	37	1	3563513	3563513	+	Intron	DEL	C	-	-	rs34514629		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3563513delC	uc001ako.2	-						WDR8_uc001akn.3_Intron|WDR8_uc010nzi.1_Intron	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8							centrosome	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TTAAAACCAGCAGAGACCCGA	0.512													10	5	---	---	---	---	
NPPA	4878	broad.mit.edu	37	1	11906969	11906969	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11906969delC	uc001ati.2	-						CLCN6_uc010oav.1_Intron|CLCN6_uc010oaw.1_Intron|CLCN6_uc010oax.1_Intron|CLCN6_uc010oay.1_Intron|CLCN6_uc010oaz.1_Intron|CLCN6_uc010oba.1_Intron	NM_006172	NP_006163	P01160	ANF_HUMAN	natriuretic peptide precursor A preproprotein						cGMP biosynthetic process|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size	extracellular region	hormone activity			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ctgtgcccagccCCCCCCCCT	0.249													2	6	---	---	---	---	
LOC440563	440563	broad.mit.edu	37	1	13184079	13184080	+	5'Flank	INS	-	T	T	rs146762683	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13184079_13184080insT	uc010obg.1	-							NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN	heterogeneous nuclear ribonucleoprotein C-like							ribonucleoprotein complex	nucleic acid binding|nucleotide binding				0						GAAAAGCACAACAACATTTTTG	0.342													4	2	---	---	---	---	
PAX7	5081	broad.mit.edu	37	1	19057068	19057068	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19057068delT	uc001bay.2	+						PAX7_uc001baz.2_Intron|PAX7_uc010oct.1_Intron	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1						anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CGATTGCCCCTTCTAATTGCA	0.622			T	FOXO1A	alveolar rhabdomyosarcoma								4	2	---	---	---	---	
WNT4	54361	broad.mit.edu	37	1	22446108	22446109	+	3'UTR	INS	-	T	T	rs146578382	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22446108_22446109insT	uc001bfs.3	-	5					WNT4_uc010odt.1_3'UTR	NM_030761	NP_110388	P56705	WNT4_HUMAN	wingless-type MMTV integration site family,						adrenal gland development|androgen biosynthetic process|anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|dermatome development|endoderm development|epithelial to mesenchymal transition|establishment of protein localization in plasma membrane|female gonad development|female sex determination|liver development|male gonad development|mesonephric tubule development|metanephric mesenchymal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of male gonad development|negative regulation of testicular blood vessel morphogenesis|negative regulation of testosterone biosynthetic process|negative regulation of transcription, DNA-dependent|oocyte development|paramesonephric duct development|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of collagen biosynthetic process|positive regulation of cortisol biosynthetic process|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein palmitoylation|renal vesicle formation|smooth muscle cell differentiation|somatotropin secreting cell differentiation|tertiary branching involved in mammary gland duct morphogenesis|thyroid-stimulating hormone-secreting cell differentiation|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|extracellular space|Golgi apparatus|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|signal transducer activity|transcription corepressor activity			ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GTTAAGAGTTCTTTTTTCCAGA	0.505													3	4	---	---	---	---	
AHDC1	27245	broad.mit.edu	37	1	27887475	27887476	+	Intron	DEL	CT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27887475_27887476delCT	uc009vsy.2	-						AHDC1_uc009vsz.1_Intron|AHDC1_uc001boh.1_Intron	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1								DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		ccctcccttcctctctctctct	0.248													4	2	---	---	---	---	
RHBDL2	54933	broad.mit.edu	37	1	39377275	39377290	+	Intron	DEL	TGTGTGTGTGTGTGTG	-	-	rs72059549		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39377275_39377290delTGTGTGTGTGTGTGTG	uc001ccu.1	-						RHBDL2_uc010oin.1_Intron|RHBDL2_uc010oio.1_Intron	NM_017821	NP_060291	Q9NX52	RHBL2_HUMAN	rhomboid protease 2						proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			ttcttttttctgtgtgtgtgtgtgtgtgtgtgtgtg	0.120													5	3	---	---	---	---	
ZNF684	127396	broad.mit.edu	37	1	41006036	41006036	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41006036delT	uc001cft.1	+							NM_152373	NP_689586	Q5T5D7	ZN684_HUMAN	zinc finger protein 684						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			ttgaaaagacttttttttccc	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	43971675	43971675	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43971675delC								HYI (51757 upstream) : PTPRF (24872 downstream)																							CCCCCAAGTTCCCCATCCACA	0.512													4	2	---	---	---	---	
ZYG11A	440590	broad.mit.edu	37	1	53320545	53320546	+	Intron	INS	-	T	T	rs71864973		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53320545_53320546insT	uc001cuk.2	+						ZYG11A_uc001cul.2_Intron	NM_001004339	NP_001004339	Q6WRX3	ZY11A_HUMAN	zyg-11 homolog A								binding				0						ctctagctttgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61082894	61082894	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61082894delT								C1orf87 (543468 upstream) : NFIA (460052 downstream)																							CCACATTGCCTACCTGTCTTC	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68065474	68065474	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68065474delT								SERBP1 (169351 upstream) : GADD45A (85409 downstream)																							aacccttttcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	83179821	83179821	+	IGR	DEL	T	-	-	rs143547720		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83179821delT								LPHN2 (721715 upstream) : None (None downstream)																							gtagtgtatcttttttttttt	0.000													3	3	---	---	---	---	
VAV3	10451	broad.mit.edu	37	1	108297775	108297775	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108297775delA	uc001dvk.1	-						VAV3_uc010ouw.1_Intron|VAV3_uc001dvl.1_Intron|VAV3_uc010oux.1_Intron	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		GAAAGAAAAGAAAAAAAAAGT	0.323													5	3	---	---	---	---	
LRIG2	9860	broad.mit.edu	37	1	113635623	113635623	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113635623delA	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		aaaaaaaaagaaaaaaaaaag	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142804874	142804874	+	Intron	DEL	T	-	-	rs140820497		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142804874delT	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		ATTTTGCTGCTTTTTTTTTTT	0.303													4	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145024584	145024585	+	Intron	INS	-	ACAT	ACAT	rs72171398		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024584_145024585insACAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		cacacacacacacacatacaca	0.262			T	PDGFRB	MPD								4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145200777	145200777	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145200777delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						AACTTTGCCGTTTTTTTTTTT	0.144													3	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145213726	145213727	+	Intron	DEL	GG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145213726_145213727delGG	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AATTTATAAAGGTCACTTTGAC	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149032494	149032494	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149032494delA								LOC645166 (79440 upstream) : LOC388692 (246982 downstream)																							CAGAGAATTCATCACTGACTT	0.294													6	4	---	---	---	---	
ETV3L	440695	broad.mit.edu	37	1	157071368	157071368	+	5'Flank	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157071368delA	uc001fqq.1	-							NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				ctTAAGACTTAAAAAAAAAAA	0.025													6	6	---	---	---	---	
SYT2	127833	broad.mit.edu	37	1	202657051	202657052	+	Intron	INS	-	A	A	rs72169169		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202657051_202657052insA	uc010pqb.1	-						SYT2_uc009xaf.2_Intron	NM_177402	NP_796376	Q8N9I0	SYT2_HUMAN	synaptotagmin II						neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	ATAAGCAAGGGAAAAAAAATGT	0.460													5	3	---	---	---	---	
CR1	1378	broad.mit.edu	37	1	207806287	207806287	+	Intron	DEL	G	-	-	rs55861581		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207806287delG	uc001hfy.2	+						CR1_uc001hfx.2_Intron	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor						complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						ggaaaagtCAGGCAGAACTGA	0.219													4	2	---	---	---	---	
HHAT	55733	broad.mit.edu	37	1	210808150	210808151	+	Intron	INS	-	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210808150_210808151insA	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_Intron	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		GATTGCAATACAAAATTTCTAT	0.396													4	2	---	---	---	---	
RPS6KC1	26750	broad.mit.edu	37	1	213291009	213291010	+	Intron	INS	-	GT	GT			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213291009_213291010insGT	uc010ptr.1	+						RPS6KC1_uc001hkd.2_Intron|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_Intron|RPS6KC1_uc001hke.2_Intron	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide						cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		aattaatggtatcttagaattg	0.079													3	3	---	---	---	---	
C1orf100	200159	broad.mit.edu	37	1	244538932	244538932	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244538932delT	uc001iah.2	+						C1orf100_uc001iai.2_Intron	NM_001012970	NP_001012988	Q5SVJ3	CA100_HUMAN	hypothetical protein LOC200159												0	all_cancers(71;3.94e-05)|all_epithelial(71;0.000138)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|all_lung(81;0.0736)|Ovarian(71;0.0761)|Lung NSC(105;0.103)		all cancers(7;8.19e-08)|GBM - Glioblastoma multiforme(7;2.05e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.000984)			ACTGTTAATGTTTTTTTTTTT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	247996951	247996954	+	IGR	DEL	GTGA	-	-	rs138799150		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247996951_247996954delGTGA								OR14A16 (17920 upstream) : OR11L1 (7276 downstream)																							GGAGACCACTGTGAGTGAGAGGGA	0.544													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	3162557	3162559	+	IGR	DEL	ACC	-	-	rs144413085		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3162557_3162559delACC								MYT1L (827512 upstream) : TSSC1 (30182 downstream)																							taacatcatgaccaccacactac	0.148													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4956617	4956617	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4956617delA								None (None upstream) : SOX11 (876182 downstream)																							TCAAAGCAAGAAAAAAAAAAC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7546551	7546551	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7546551delA								RNF144A (362244 upstream) : LOC339788 (516007 downstream)																							TTATTTTTAGAAAAAAAAAAG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17534766	17534767	+	IGR	DEL	CA	-	-	rs151221086		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17534766_17534767delCA								FAM49A (687670 upstream) : RAD51AP2 (157219 downstream)																							TATCTGTGTGCACAGAGTCACA	0.416													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20766075	20766075	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20766075delC								RHOB (116875 upstream) : HS1BP3 (51489 downstream)																							CTGACTCCTTCCCAGCTGAGT	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22748473	22748473	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22748473delA								None (None upstream) : None (None downstream)																							GGAGGACTATAAAAAATAATC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91729144	91729144	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91729144delG								None (None upstream) : LOC654342 (76048 downstream)																							agaaagacttgttttTTTTTT	0.119													4	2	---	---	---	---	
KCNIP3	30818	broad.mit.edu	37	2	96010663	96010663	+	Intron	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96010663delG	uc002sup.2	+						KCNIP3_uc002suq.2_5'Flank	NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1						apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)		ggcactacctgggcacaggct	0.174													4	2	---	---	---	---	
MRPL30	51263	broad.mit.edu	37	2	99779655	99779655	+	Intron	DEL	C	-	-	rs68130738		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99779655delC	uc002szr.2	+						MRPL30_uc002szl.1_Intron	NM_145213	NP_660214	Q8TCC3	RM30_HUMAN	SubName: Full=HCG1989457, isoform CRA_a; SubName: Full=Putative uncharacterized protein MRPL30;						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						AAAAAAAAAACAAAACACAAC	0.323													14	7	---	---	---	---	
RGPD5	84220	broad.mit.edu	37	2	113175049	113175049	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113175049delA	uc002ths.1	-						RGPD8_uc010fkk.1_Intron|RGPD5_uc002tht.1_Intron|RGPD5_uc010yxm.1_Intron	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0						TCAACCTTATAAATGAAAACA	0.269													7	6	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133008670	133008670	+	Intron	DEL	T	-	-	rs111946818		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133008670delT	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						TAATCTTCAGTTTTTTTCCTC	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133028130	133028131	+	IGR	DEL	AC	-	-	rs145524384		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133028130_133028131delAC								NCRNA00164 (12588 upstream) : GPR39 (146016 downstream)																							ggacagacagacagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175649582	175649583	+	IGR	DEL	GT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175649582_175649583delGT								CHRNA1 (20382 upstream) : CHN1 (14459 downstream)																							caaaggagtagtaggcactttc	0.158													4	2	---	---	---	---	
ZNF385B	151126	broad.mit.edu	37	2	180682778	180682779	+	Intron	DEL	TG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180682778_180682779delTG	uc002unn.3	-							NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			tgtgtgtgaatgtgtgtgtgta	0.252													4	2	---	---	---	---	
DNAH7	56171	broad.mit.edu	37	2	196602560	196602560	+	3'UTR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196602560delA	uc002utj.3	-	65					DNAH7_uc002uti.3_3'UTR	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TTAAACAAACAAAAAAAAAGG	0.279													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	209906966	209906966	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209906966delT								PTH2R (202148 upstream) : MAP2 (381805 downstream)																							TGTTTTTCTCTTTTTTTTGCA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216794580	216794581	+	IGR	DEL	CT	-	-	rs144935809		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216794580_216794581delCT								FN1 (493789 upstream) : MREG (12734 downstream)																							aaccatcaccctctctcaattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	218139989	218139989	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218139989delC								TNP1 (415207 upstream) : DIRC3 (8759 downstream)																							CACGCTTCCTCCCCAAGGAGT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224334189	224334189	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224334189delA								KCNE4 (413836 upstream) : SCG2 (127471 downstream)																							tctaggcctcaaaaggtcacg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227028267	227028268	+	Intron	INS	-	T	T	rs79824515		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227028267_227028268insT	uc002vog.1	+											Homo sapiens similar to Alu subfamily SX sequence contamination warning entry, mRNA (cDNA clone IMAGE:4246459), with apparent retained intron.																		ATGGACATCTAtttttttttaa	0.198													4	3	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230654636	230654637	+	Intron	DEL	TT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230654636_230654637delTT	uc002vpw.1	-						TRIP12_uc002vpx.1_Intron|TRIP12_uc002vpy.1_Intron	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AATCTTCCCATTTTATCTTATA	0.347													19	11	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	237032937	237032937	+	3'UTR	DEL	C	-	-	rs35912223		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237032937delC	uc002vvs.2	+	18					AGAP1_uc002vvt.2_3'UTR	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						ACCTGGACATCCCTCAAGGGG	0.612													4	5	---	---	---	---	
ILKAP	80895	broad.mit.edu	37	2	239079047	239079047	+	3'UTR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239079047delA	uc002vxv.2	-	12					ILKAP_uc010zns.1_3'UTR|ILKAP_uc002vxw.2_3'UTR	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein							cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		AAAGACTAGGAAAAAAAAAGA	0.363													3	3	---	---	---	---	
STK25	10494	broad.mit.edu	37	2	242435659	242435662	+	Intron	DEL	AAGG	-	-	rs33918796		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242435659_242435662delAAGG	uc002wbm.2	-						STK25_uc002wbk.2_Intron|STK25_uc002wbl.2_3'UTR|STK25_uc002wbn.2_Intron|STK25_uc002wbo.2_Intron|STK25_uc010zos.1_Intron|STK25_uc010zot.1_Intron|STK25_uc002wbp.2_Intron|STK25_uc010fzo.2_Intron|STK25_uc010zou.1_Intron|STK25_uc010zov.1_Intron	NM_006374	NP_006365	O00506	STK25_HUMAN	serine/threonine kinase 25						response to oxidative stress|signal transduction	Golgi apparatus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GGGTCCAAACAAGGAAGAGGATGC	0.618													3	3	---	---	---	---	
CIDEC	63924	broad.mit.edu	37	3	10002213	10002213	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10002213delC	uc003bto.2	-									Q96AQ7	CIDEC_HUMAN	Homo sapiens unknown mRNA.						apoptosis|induction of apoptosis	cytosol|focal adhesion|nucleus				central_nervous_system(1)	1	Medulloblastoma(99;0.227)					AGGGACAGCACCTCCTGTTGG	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14620361	14620362	+	IGR	INS	-	C	C	rs151056281		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14620361_14620362insC								GRIP2 (36773 upstream) : C3orf19 (72891 downstream)																							GCTGTTTTTTTTTTTTCTCTCT	0.337													4	2	---	---	---	---	
LZTFL1	54585	broad.mit.edu	37	3	45892568	45892568	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45892568delC	uc003coy.1	-						LZTFL1_uc011bak.1_Intron	NM_020347	NP_065080	Q9NQ48	LZTL1_HUMAN	leucine zipper transcription factor-like 1												0				BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		GCTCCCCACACCCCATCATAG	0.483													4	2	---	---	---	---	
ARHGEF3	50650	broad.mit.edu	37	3	57097201	57097201	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57097201delC	uc003dih.2	-						SPATA12_uc003dij.1_Intron	NM_001128615	NP_001122087	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		ccctgaggtgcccacgcaggg	0.000													4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65629483	65629483	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65629483delC	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		tccaccaccacccacgccagc	0.000													4	2	---	---	---	---	
CNTN3	5067	broad.mit.edu	37	3	74385951	74385951	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74385951delA	uc003dpm.1	-							NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor						cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		TTGGGAATACAAAAAAAAAAA	0.323													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	105960358	105960358	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105960358delG								CBLB (372092 upstream) : LOC100302640 (595302 downstream)																							TCACTGTCCTGGGGGCTGAGA	0.418													4	2	---	---	---	---	
LOC100125556	100125556	broad.mit.edu	37	3	125642892	125642893	+	Intron	INS	-	AGAC	AGAC			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125642892_125642893insAGAC	uc003eif.3	+						LOC100125556_uc003eid.3_Intron|LOC100125556_uc003eie.3_Intron	NR_024251				Homo sapiens family with sequence similarity 86, member A pseudogene, mRNA (cDNA clone IMAGE:4425123).												0						ACTGCCAACTTAGCCCCAGAGT	0.554													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	127056485	127056485	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127056485delT	uc003ejj.2	-											Homo sapiens, clone IMAGE:4618125, mRNA.																		ttaatttacatttagtgtata	0.060													4	2	---	---	---	---	
CCDC48	79825	broad.mit.edu	37	3	128758917	128758917	+	3'UTR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128758917delT	uc011bkt.1	+	8						NM_024768	NP_079044	Q9HA90	CCD48_HUMAN	coiled-coil domain containing 48												0						AGCCCCTGCATTCCTGCCACC	0.602													4	2	---	---	---	---	
MRPL3	11222	broad.mit.edu	37	3	131184012	131184012	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131184012delA	uc003eoh.2	-						MRPL3_uc011blo.1_Intron|MRPL3_uc011blp.1_Intron	NM_007208	NP_009139	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3						translation	mitochondrial large ribosomal subunit	RNA binding|structural constituent of ribosome				0						TTAATAGTTCAAAAGGGACTA	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147090930	147090930	+	IGR	DEL	A	-	-	rs149042891		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147090930delA								PLSCR5 (766927 upstream) : ZIC4 (12907 downstream)																							CAAAGGAGCTAAAAAAAAAAA	0.438													7	4	---	---	---	---	
IGSF10	285313	broad.mit.edu	37	3	151177231	151177231	+	5'Flank	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151177231delA	uc011bod.1	-							NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor						cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGTCCCTGCCAAAAAAAAAGA	0.363													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155812148	155812148	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155812148delT								GMPS (156630 upstream) : KCNAB1 (26189 downstream)																							GCATTTGCAATTTTTTTTTTC	0.393													4	2	---	---	---	---	
LRRC31	79782	broad.mit.edu	37	3	169589918	169589918	+	5'Flank	DEL	G	-	-	rs9841073	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169589918delG	uc003fgc.1	-						LRRC31_uc010hwp.1_5'Flank	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31											ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			GGAAATCCCTGGAAAAGGAAT	0.438													4	2	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195713302	195713303	+	Intron	INS	-	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195713302_195713303insA	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						TCCCTTATGTCTATGACTCATA	0.297													3	3	---	---	---	---	
SH3TC1	54436	broad.mit.edu	37	4	8242814	8242814	+	3'UTR	DEL	T	-	-	rs67520179		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8242814delT	uc003gkv.3	+	18					SH3TC1_uc003gkw.3_3'UTR|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_RNA	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3						ATGGGTTTTGTTTTTTTTTTG	0.552													4	2	---	---	---	---	
MIR572	693157	broad.mit.edu	37	4	11369491	11369491	+	5'Flank	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11369491delT	hsa-mir-572|MI0003579	+																							0						AAATGATTTATTTTTTTCAGG	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29239916	29239916	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29239916delA								None (None upstream) : None (None downstream)																							tgtgtatcagaaaaaaaaaaG	0.169													4	2	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39217323	39217323	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39217323delA	uc003gtv.2	+						WDR19_uc010ifl.1_Intron|WDR19_uc003gtu.1_Intron|WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_5'Flank	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						TTCCTAGTCTAAAAAAAAAAC	0.289													6	3	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	40866871	40866874	+	Intron	DEL	TTTT	-	-	rs35743832		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40866871_40866874delTTTT	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						CGTTTGAttctttttttttttttt	0.221													4	2	---	---	---	---	
SCFD2	152579	broad.mit.edu	37	4	53893425	53893425	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53893425delT	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CACACACTTCTTTTTTTTTTT	0.512													1	5	---	---	---	---	
BTC	685	broad.mit.edu	37	4	75676091	75676091	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75676091delT	uc003hig.2	-							NM_001729	NP_001720	P35070	BTC_HUMAN	betacellulin precursor						positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity			central_nervous_system(1)|skin(1)	2			Lung(101;0.219)			GTAATTTCAATTTTTTTTTGC	0.269													5	4	---	---	---	---	
USO1	8615	broad.mit.edu	37	4	76729900	76729901	+	Intron	INS	-	TC	TC	rs72010473		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76729900_76729901insTC	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			tgattttttttttttgcatggg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	92843550	92843550	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92843550delA								FAM190A (320181 upstream) : GRID2 (382000 downstream)																							taagattgccaaaagagacaa	0.000													4	2	---	---	---	---	
PDLIM5	10611	broad.mit.edu	37	4	95578858	95578859	+	Intron	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95578858_95578859insT	uc003hti.2	+						PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron|PDLIM5_uc003htl.2_Intron	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		AACTATGTAGAttttttttttt	0.134													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97472025	97472025	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97472025delT								PDHA2 (709401 upstream) : None (None downstream)																							CCAGTGGTGATTTTCTTTCCT	0.398													4	2	---	---	---	---	
DKK2	27123	broad.mit.edu	37	4	107918772	107918772	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107918772delA	uc003hyi.2	-						DKK2_uc010ilw.1_Intron|DKK2_uc003hyj.1_Intron	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor						multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		AATTTCATCCAAAAAAAGTTA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	113673305	113673305	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113673305delG								LARP7 (94564 upstream) : ANK2 (65934 downstream)																							ATTCTCCACTGGACACTGTGT	0.443													4	2	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114274007	114274007	+	Intron	DEL	T	-	-	rs34053670	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114274007delT	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TTTTCAGTTGTTTTTTTTTTC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138077456	138077456	+	IGR	DEL	C	-	-	rs113901229		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138077456delC								None (None upstream) : PCDH18 (362620 downstream)																							atatccaccaccagaaatgct	0.085													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	178159014	178159014	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178159014delA								VEGFC (445119 upstream) : NEIL3 (71977 downstream)																							CCACCCGCACAAAAAAAATAA	0.333													4	2	---	---	---	---	
KIAA1430	57587	broad.mit.edu	37	4	186084196	186084197	+	Intron	INS	-	A	A	rs149667777	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186084196_186084197insA	uc003ixf.3	-							NM_020827	NP_065878	Q9P2B7	K1430_HUMAN	hypothetical protein LOC57587												0		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		tctcgactaggatgcacttcag	0.149													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189038197	189038197	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189038197delT								TRIML2 (7775 upstream) : TRIML1 (22401 downstream)																							cacctggctattttttcacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189091103	189091104	+	IGR	DEL	TG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189091103_189091104delTG								TRIML1 (22454 upstream) : None (None downstream)																							cagaaatgactgTGTATGACAG	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190545398	190545399	+	IGR	INS	-	ATT	ATT	rs35790619		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190545398_190545399insATT								None (None upstream) : FRG1 (316575 downstream)																							ttgtggaagacgttgtgatcac	0.119													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190573651	190573651	+	IGR	DEL	A	-	-	rs72414164		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190573651delA								None (None upstream) : FRG1 (288323 downstream)																							GTGGAATAAGAGGTAGAGGGT	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190678704	190678704	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190678704delT								None (None upstream) : FRG1 (183270 downstream)																							ACCATAGCAATTTCCCTCTCA	0.403													5	3	---	---	---	---	
SLC6A19	340024	broad.mit.edu	37	5	1209807	1209808	+	Intron	DEL	CT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1209807_1209808delCT	uc003jbw.3	+							NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			catcctcctcctctctctctct	0.000													3	3	---	---	---	---	
SLC6A3	6531	broad.mit.edu	37	5	1424520	1424520	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1424520delA	uc003jck.2	-							NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter						cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	GCAAGGTCTCATCACTGAGAG	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1533575	1533575	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1533575delT								LPCAT1 (9499 upstream) : SDHAP3 (35062 downstream)																							gaggttcaccttttttttttg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3564141	3564141	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3564141delT								C5orf38 (808629 upstream) : IRX1 (32027 downstream)																							ATGGTTAGAATTTTTTTTCAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	27273629	27273630	+	IGR	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27273629_27273630insT								CDH9 (234940 upstream) : None (None downstream)																							gctctgttctatttttttttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35568328	35568328	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35568328delT								PRLR (337534 upstream) : SPEF2 (49661 downstream)																							TAGTTGTGTGtttttttttta	0.204													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	36810356	36810356	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36810356delA								SLC1A3 (121922 upstream) : NIPBL (66505 downstream)																							TGATATTTCCAAAAAAGGAGA	0.378													4	2	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	38958387	38958387	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38958387delA	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CAAAAAAATTAAAAAAAAAGA	0.174													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51145398	51145398	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51145398delG								ISL1 (454841 upstream) : ITGA1 (938376 downstream)																							taaatggtcaggatgagtaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	53617413	53617414	+	IGR	INS	-	T	T	rs142147497	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53617413_53617414insT								ARL15 (11010 upstream) : HSPB3 (134031 downstream)																							TCTGGACGTGCTTATTCCACCA	0.460													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	54848361	54848361	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54848361delC								PPAP2A (17488 upstream) : SLC38A9 (73315 downstream)																							AGGATGACCGCGCGCAGGAGT	0.637													7	5	---	---	---	---	
ERBB2IP	55914	broad.mit.edu	37	5	65316998	65316998	+	Intron	DEL	A	-	-	rs74766207		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65316998delA	uc003juk.1	+						ERBB2IP_uc003juh.1_Intron|ERBB2IP_uc003jui.1_Intron|ERBB2IP_uc003juj.1_Intron|ERBB2IP_uc011cqx.1_Intron|ERBB2IP_uc011cqy.1_Intron|ERBB2IP_uc011cqz.1_Intron|ERBB2IP_uc010iwx.1_Intron|ERBB2IP_uc003jul.1_Intron	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2						basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		TCTGACttttaaaatttttta	0.224													2	4	---	---	---	---	
SV2C	22987	broad.mit.edu	37	5	75577192	75577193	+	Intron	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75577192_75577193insT	uc003kei.1	+							NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GTCTATATGCCTTTTTTAAAAA	0.287													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	82684656	82684657	+	IGR	DEL	CA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82684656_82684657delCA								XRCC4 (35079 upstream) : VCAN (82836 downstream)																							TCCAGCTTTTCACATAATCAGA	0.356													4	2	---	---	---	---	
MEF2C	4208	broad.mit.edu	37	5	88033903	88033903	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88033903delA	uc003kjj.2	-						MEF2C_uc003kji.2_Intron|MEF2C_uc003kjk.2_Intron|MEF2C_uc003kjm.2_Intron|MEF2C_uc003kjl.2_Intron	NM_002397	NP_002388	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C isoform 1						apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		AGTTGGGGACAAAAAAAAGAT	0.398										HNSCC(66;0.2)			4	2	---	---	---	---	
FAM172A	83989	broad.mit.edu	37	5	93381640	93381640	+	Intron	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93381640delG	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0						AAAATGGGAAGAAAAGAAATC	0.194													4	2	---	---	---	---	
ERAP2	64167	broad.mit.edu	37	5	96230734	96230734	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96230734delA	uc003kmq.2	+						uc003kmo.1_Intron|ERAP2_uc003kmt.2_Intron|ERAP2_uc003kmr.2_Intron|ERAP2_uc003kms.2_Intron|ERAP2_uc003kmu.2_Intron	NM_022350	NP_071745	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2						antigen processing and presentation of endogenous peptide antigen via MHC class I|proteolysis|regulation of blood pressure	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding				0		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		GAGAACACACAAAAAAAAGAA	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	98053281	98053281	+	IGR	DEL	A	-	-	rs74488321		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98053281delA								None (None upstream) : RGMB (51718 downstream)																							ctgtctctacaaaaaaaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	99414082	99414082	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99414082delA								None (None upstream) : LOC100133050 (301127 downstream)																							cccagcactgaacctggcaca	0.124													4	2	---	---	---	---	
FBXL17	64839	broad.mit.edu	37	5	107379968	107379968	+	Intron	DEL	A	-	-	rs78784575		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107379968delA	uc011cvc.1	-						FBXL17_uc003kon.3_Intron	NM_001163315	NP_001156787	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		ggtcataatgaaaaaaaacat	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124478764	124478764	+	IGR	DEL	A	-	-	rs113213307		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124478764delA								ZNF608 (394264 upstream) : None (None downstream)																							tccacaggctaaatacacaga	0.000													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124917325	124917325	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124917325delA								ZNF608 (832825 upstream) : GRAMD3 (778463 downstream)																							ACTGGCACAGAAAAAATTTTG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135084975	135084975	+	IGR	DEL	C	-	-	rs12518942		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135084975delC								LOC340074 (95351 upstream) : LOC153328 (85390 downstream)																							GTTCCACACACAAAAAAAAAC	0.478													4	2	---	---	---	---	
ADRB2	154	broad.mit.edu	37	5	148207792	148207793	+	3'UTR	DEL	AA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148207792_148207793delAA	uc003lpr.1	+	1					SH3TC2_uc003lpp.1_Intron	NM_000024	NP_000015	P07550	ADRB2_HUMAN	adrenergic, beta-2-, receptor, surface						activation of transmembrane receptor protein tyrosine kinase activity|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|endosome to lysosome transport|positive regulation of MAPKKK cascade|receptor-mediated endocytosis	endosome|integral to plasma membrane|lysosome|receptor complex	beta2-adrenergic receptor activity|norepinephrine binding|potassium channel regulator activity|protein homodimerization activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Alprenolol(DB00866)|Arformoterol(DB01274)|Bambuterol(DB01408)|Bisoprolol(DB00612)|Bitolterol(DB00901)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Nadolol(DB01203)|Norepinephrine(DB00368)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Terbutaline(DB00871)|Timolol(DB00373)	TTTAAGCTGTAAAAAGAGAGAA	0.292													4	2	---	---	---	---	
G3BP1	10146	broad.mit.edu	37	5	151179246	151179246	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151179246delA	uc003lun.2	+						G3BP1_uc003lum.2_Intron|G3BP1_uc011dcu.1_Intron|G3BP1_uc010jhz.2_Intron|G3BP1_uc003luq.2_Intron	NM_005754	NP_005745	Q13283	G3BP1_HUMAN	Ras-GTPase-activating protein SH3-domain-binding						Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding			skin(3)|ovary(1)	4		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			actctggctcaaaaaaaaaaa	0.164													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153447487	153447488	+	IGR	INS	-	TTTG	TTTG	rs143416177	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153447487_153447488insTTTG								MFAP3 (10473 upstream) : GALNT10 (122807 downstream)																							TTTGGTGGGTTtttgtttgttt	0.089													4	2	---	---	---	---	
CYFIP2	26999	broad.mit.edu	37	5	156803126	156803127	+	Intron	INS	-	T	T	rs139010870	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156803126_156803127insT	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCTGCCCCTCCTCTCAGGCCCA	0.485													1	5	---	---	---	---	
CDHR2	54825	broad.mit.edu	37	5	176019430	176019432	+	Intron	DEL	TGG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176019430_176019432delTGG	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						gtgatggtgatggtggtgatgat	0.000													2	7	---	---	---	---	
LOC285780	285780	broad.mit.edu	37	6	6535929	6535929	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6535929delA	uc003mww.3	-						LOC285780_uc003mwx.2_Intron	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0						AGCTATCTTTAAATAATTTTT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15095955	15095955	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15095955delT								CD83 (958809 upstream) : JARID2 (149779 downstream)																							CATGACTTCATAGTGTCCTCA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15155866	15155866	+	IGR	DEL	T	-	-	rs35721781		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15155866delT								None (None upstream) : JARID2 (89868 downstream)																							aatttcgttgttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28144241	28144241	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28144241delA								ZNF389 (6866 upstream) : LOC222699 (38875 downstream)																							TATACATCAGAAAATCCACAC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29348254	29348255	+	IGR	DEL	AT	-	-	rs143279477		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29348254_29348255delAT								OR12D3 (5186 upstream) : OR12D2 (16161 downstream)																							ctttgtcctcatagtcttgata	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	39007118	39007119	+	IGR	INS	-	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39007118_39007119insC								DNAH8 (8551 upstream) : GLP1R (9438 downstream)																							ccaggacctttcccctaaacca	0.218													4	2	---	---	---	---	
PHIP	55023	broad.mit.edu	37	6	79666231	79666231	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79666231delT	uc003pir.2	-						PHIP_uc003piq.2_Intron|PHIP_uc011dyp.1_Intron|PHIP_uc003pio.3_Intron	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		tattctcatgttaatatactt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	99140265	99140265	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99140265delG								MIR2113 (667768 upstream) : POU3F2 (142315 downstream)																							ttctctgggaggggactatca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	102651680	102651680	+	IGR	DEL	A	-	-	rs66576851		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102651680delA								GRIK2 (133723 upstream) : None (None downstream)																							AAAGGTACGTAAGCTGATGAT	0.338													2	6	---	---	---	---	
SEC63	11231	broad.mit.edu	37	6	108225614	108225614	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108225614delA	uc003psc.3	-						SEC63_uc003psb.3_Intron	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein						protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		actccatctcaaaaaaaaaaa	0.104													4	4	---	---	---	---	
FOXO3	2309	broad.mit.edu	37	6	108932302	108932302	+	Intron	DEL	T	-	-	rs77668898		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108932302delT	uc003psk.2	+						FOXO3_uc003psn.2_Intron|FOXO3_uc003psm.2_Intron|FOXO3_uc011ean.1_Intron	NM_201559	NP_963853	O43524	FOXO3_HUMAN	forkhead box O3A						antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			central_nervous_system(4)|lung(2)	6		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		tgtagagtcattactgtatgt	0.000													2	5	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117739393	117739398	+	Intron	DEL	ACAATT	-	-	rs71554880		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117739393_117739398delACAATT	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ccaaagccacacaattacatagagac	0.136			T	GOPC|ROS1	glioblastoma|NSCLC								1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138332845	138332846	+	IGR	INS	-	C	C	rs142413695	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138332845_138332846insC								TNFAIP3 (128400 upstream) : PERP (76796 downstream)																							AACAGAGCAGACCCCCCCCAGA	0.391													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150187301	150187301	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150187301delT	uc003qni.1	+						LRP11_uc003qng.2_5'Flank|LRP11_uc003qnh.1_5'Flank					Homo sapiens low density lipoprotein receptor-related protein 11, mRNA (cDNA clone IMAGE:4072521), partial cds.																		CCATCAAAGATTTTCCTGCAT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153626396	153626397	+	IGR	INS	-	CCTTCT	CCTTCT			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153626396_153626397insCCTTCT								RGS17 (174007 upstream) : OPRM1 (705239 downstream)																							cttccccttctccttctccttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	155688549	155688550	+	IGR	INS	-	A	A	rs150601106	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155688549_155688550insA								TFB1M (52923 upstream) : NOX3 (27953 downstream)																							AGGGAAAAGTTaaaaaaaatta	0.158													3	3	---	---	---	---	
IGF2R	3482	broad.mit.edu	37	6	160525112	160525112	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160525112delA	uc003qta.2	+							NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor						receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		gctgttctttaaaaaaaaaac	0.065													3	3	---	---	---	---	
MLLT4	4301	broad.mit.edu	37	6	168262795	168262796	+	Intron	DEL	TA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168262795_168262796delTA	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GCTAAATTTGTATAGAAATTTT	0.386			T	MLL	AL								4	2	---	---	---	---	
EIF3B	8662	broad.mit.edu	37	7	2403011	2403024	+	Intron	DEL	TTGAGCCTGGGAGG	-	-	rs66483346		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2403011_2403024delTTGAGCCTGGGAGG	uc003slx.2	+						EIF3B_uc003sly.2_Intron|EIF3B_uc003slz.1_Intron|EIF3B_uc003sma.2_Intron	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		ggaggatcacttgagcctgggaggttgagcctgg	0.009													3	3	---	---	---	---	
POU6F2	11281	broad.mit.edu	37	7	39246850	39246850	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39246850delT	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						CTACCAATCATTTTTTTTTAA	0.318													3	3	---	---	---	---	
POU6F2	11281	broad.mit.edu	37	7	39415224	39415224	+	Intron	DEL	T	-	-	rs72463292		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39415224delT	uc003thb.1	+							NM_007252	NP_009183	P78424	PO6F2_HUMAN	POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1						TCCTCCTTGATTTTTTTTTTT	0.458													3	6	---	---	---	---	
C7orf72	100130988	broad.mit.edu	37	7	50144059	50144060	+	Intron	INS	-	TA	TA	rs146114368	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50144059_50144060insTA	uc011kcj.1	+							NM_001161834	NP_001155306			hypothetical protein LOC100130988											ovary(1)	1						tttcattgtattatatatatat	0.188													21	11	---	---	---	---	
ZNF92	168374	broad.mit.edu	37	7	64864567	64864567	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64864567delT	uc003ttz.2	+	4	1683	c.1540delT	c.(1540-1542)TGTfs	p.C514fs	ZNF92_uc003tua.2_Frame_Shift_Del_p.C445fs|ZNF92_uc010kzu.2_Frame_Shift_Del_p.C482fs|ZNF92_uc003tub.2_Frame_Shift_Del_p.C438fs	NM_152626	NP_689839	Q03936	ZNF92_HUMAN	zinc finger protein 92 isoform 2	514	C2H2-type 14; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(55;0.159)				ATGTGAAAAATGTGGCAATGC	0.348													110	53	---	---	---	---	
AUTS2	26053	broad.mit.edu	37	7	69114501	69114501	+	Intron	DEL	T	-	-	rs74531286		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69114501delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CACTGTATGCTTTTTTTTTTG	0.458													4	2	---	---	---	---	
DLX6AS	285987	broad.mit.edu	37	7	96641462	96641462	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96641462delT	uc003uol.2	-						DLX6AS_uc010lfo.1_5'Flank	NR_015448				Homo sapiens cDNA FLJ34048 fis, clone FCBBF3000102.												0						AGCCCGCTGATTACAGCGTTT	0.333													4	2	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102196082	102196083	+	Intron	INS	-	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102196082_102196083insC	uc011kkx.1	+						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron|POLR2J3_uc011kkw.1_Intron|SPDYE2_uc003vaa.1_5'Flank	NM_001031618	NP_001026789	Q495Y8	SPDE2_HUMAN	speedy homolog E2												0						aacaacaacaaaaaaaaaaaaa	0.238													4	2	---	---	---	---	
SRPK2	6733	broad.mit.edu	37	7	104805326	104805326	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104805326delA	uc003vct.2	-						SRPK2_uc003vcu.2_Intron|SRPK2_uc003vcv.2_Intron|SRPK2_uc003vcw.1_Intron	NM_182691	NP_872633	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						TATAAAGAGCAAAAAATCTGA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	110179056	110179056	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110179056delT								EIF3IP1 (578786 upstream) : IMMP2L (124054 downstream)																							CACCATGATATTTTTTTTTTA	0.328													4	2	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	113937110	113937110	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113937110delT	uc003vgv.1	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgt.1_Intron	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						ACTATATGCATTTTTTTTTTT	0.378													4	3	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122412607	122412607	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122412607delA	uc010lkp.2	-						CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TTAAATTTGCAAAAAATCAAC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123903601	123903601	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123903601delC	uc011koc.1	+											Homo sapiens disrupted in Rett 1 mRNA sequence.																		gctaaggtggccttgtgtcta	0.000													4	2	---	---	---	---	
SND1	27044	broad.mit.edu	37	7	127292577	127292578	+	Intron	INS	-	G	G			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127292577_127292578insG	uc003vmi.2	+							NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CTCCACCTTCCGCCAGCCTGCT	0.619													5	3	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128312236	128312236	+	5'Flank	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128312236delT	uc003vnk.3	+						FAM71F2_uc010llm.1_5'Flank|FAM71F2_uc003vnl.2_5'Flank|FAM71F2_uc010lln.1_5'Flank	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						CTTCCTCTTCTTTTTTTTTTC	0.483													8	4	---	---	---	---	
KEL	3792	broad.mit.edu	37	7	142653526	142653526	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142653526delT	uc003wcb.2	-							NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					TCAGTAGCTCTTTTTTTTTTT	0.408													5	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152104372	152104373	+	Intron	INS	-	A	A	rs11428134		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152104372_152104373insA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TAAGAAACATTAAAAAATAACG	0.327			N		medulloblastoma								5	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152110157	152110157	+	Intron	DEL	A	-	-	rs11335639		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152110157delA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CACTTCTGAGAAAAAAAACAA	0.254			N		medulloblastoma								10	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152772073	152772074	+	IGR	INS	-	T	T	rs143516740	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152772073_152772074insT								ACTR3B (219610 upstream) : DPP6 (812345 downstream)																							GGGCAGTGATGTTTGTTACTGG	0.396													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155212229	155212230	+	IGR	DEL	CA	-	-	rs67513664		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155212229_155212230delCA								INSIG1 (110287 upstream) : EN2 (38594 downstream)																							catgaacacccacacacacaca	0.149													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158129924	158129925	+	Intron	DEL	CA	-	-	rs66592921		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158129924_158129925delCA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CACTAACACCCACATTCTCACC	0.500													6	3	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17914872	17914872	+	3'UTR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17914872delA	uc003wyl.2	-	14					ASAH1_uc010ltb.1_RNA|ASAH1_uc003wym.2_3'UTR|ASAH1_uc003wyn.2_3'UTR|ASAH1_uc003wyo.2_3'UTR	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		TGATAGGGGGAAAAAAAAAAG	0.378													4	4	---	---	---	---	
PXDNL	137902	broad.mit.edu	37	8	52261737	52261738	+	Intron	DEL	GT	-	-	rs113594565		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52261737_52261738delGT	uc003xqu.3	-						PXDNL_uc003xqt.3_Intron	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				gtgtgtgggggtgtgtgtgtgt	0.401													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53832115	53832116	+	IGR	DEL	CC	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53832115_53832116delCC								RB1CC1 (205089 upstream) : NPBWR1 (20352 downstream)																							TTTTCAGGTTCCATATGCACAC	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57524789	57524790	+	IGR	INS	-	A	A	rs150171506	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57524789_57524790insA								PENK (165507 upstream) : IMPAD1 (345701 downstream)																							AGGGACATGATACGATAGGTCC	0.465													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	57816760	57816760	+	IGR	DEL	C	-	-	rs10710641		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57816760delC								PENK (457478 upstream) : IMPAD1 (53731 downstream)																							CAAAAATTTACCCCTATCATT	0.269													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60938584	60938584	+	IGR	DEL	T	-	-	rs145393486		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60938584delT								TOX (906817 upstream) : CA8 (162839 downstream)																							tttcttggtattttttttttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	82252636	82252636	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82252636delT								FABP5 (55628 upstream) : PMP2 (99928 downstream)																							TTGGCAGCTATTTTTTTTAAT	0.393													4	2	---	---	---	---	
CNBD1	168975	broad.mit.edu	37	8	88114117	88114119	+	Intron	DEL	TTT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88114117_88114119delTTT	uc003ydy.2	+							NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1											ovary(3)	3						GTAGATTTAAttttttttttttt	0.187													4	2	---	---	---	---	
INTS8	55656	broad.mit.edu	37	8	95886476	95886476	+	Intron	DEL	T	-	-	rs35033167		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95886476delT	uc003yhb.2	+						INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron|INTS8_uc010mba.2_Intron	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					ATTTTGTCCGTTTTTTTTTTT	0.164													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	104090029	104090030	+	IGR	INS	-	G	G	rs150328671	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104090029_104090030insG								ATP6V1C1 (4745 upstream) : C8orf56 (55162 downstream)																							AGGACTAACCTGGCTGGGAATG	0.411													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109906519	109906519	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109906519delC								TMEM74 (106749 upstream) : TRHR (193220 downstream)																							gtggtccccaccccccaccca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	118786109	118786111	+	IGR	DEL	CAC	-	-	rs141128606	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118786109_118786111delCAC								MED30 (233610 upstream) : EXT1 (25491 downstream)																							caaagcaaaacacaacaaacaaa	0.296													4	2	---	---	---	---	
ATAD2	29028	broad.mit.edu	37	8	124415205	124415206	+	Intron	DEL	AG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124415205_124415206delAG	uc003yqi.3	-						uc003yqk.2_5'Flank|uc003yql.2_5'Flank|uc003yqm.1_5'Flank			Q6PL18	ATAD2_HUMAN	Homo sapiens PRO2000 mRNA, complete cds.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			tcttatccacagAGTGATTTGT	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134158492	134158492	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134158492delG								TG (11351 upstream) : WISP1 (44820 downstream)																							aaaaaaaaaagaaTGTCATAA	0.249													4	2	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139241989	139241990	+	Intron	DEL	GG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139241989_139241990delGG	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			tcacatggctggggaggcctca	0.010										HNSCC(54;0.14)			4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141013536	141013536	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141013536delA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						cgtctctgctaaaaatacaaa	0.000													4	2	---	---	---	---	
CYP11B2	1585	broad.mit.edu	37	8	143993101	143993102	+	3'UTR	INS	-	GGA	GGA	rs142951814	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143993101_143993102insGGA	uc003yxk.1	-	9						NM_000498	NP_000489	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B,						aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)	AGCCAGCGCTGGGAGTAGAGTC	0.619									Familial_Hyperaldosteronism_type_I				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66455714	66455714	+	Intron	DEL	G	-	-	rs111864374		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66455714delG	uc010mng.1	-						uc004aec.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		TCCTCTTGGTGCTGTGGGCCC	0.572													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68457870	68457870	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68457870delA								FAM27B (663681 upstream) : MIR1299 (544369 downstream)																							TCATATTTACAGTTGAAGATG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68491207	68491207	+	IGR	DEL	C	-	-	rs113658224		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68491207delC								FAM27B (697018 upstream) : MIR1299 (511032 downstream)																							tatcttctcacagctctgaag	0.010													4	3	---	---	---	---	
ZNF782	158431	broad.mit.edu	37	9	99589621	99589621	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99589621delT	uc004awp.1	-						ZNF782_uc011lup.1_Intron	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				cttttcttactttttttttta	0.189													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120301823	120301823	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120301823delA								ASTN2 (124506 upstream) : TLR4 (164637 downstream)																							CAATTGGGTTAAATGTGTAAC	0.448													4	2	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126213261	126213261	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126213261delT	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						ATGGCACAGATTTTTTTTTTC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	128990917	128990918	+	IGR	DEL	AC	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128990917_128990918delAC								PBX3 (261264 upstream) : FAM125B (98210 downstream)																							CAATGGACGGACACACACACAC	0.490											OREG0019490	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
KCNT1	57582	broad.mit.edu	37	9	138648851	138648851	+	Intron	DEL	C	-	-	rs56334445		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138648851delC	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron|KCNT1_uc004cgo.1_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		tcccccacctcccccaccctc	0.184													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3880354	3880354	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3880354delG								KLF6 (52881 upstream) : LOC100216001 (741090 downstream)																							ACGCTGTCCTGGGGCTGTGGG	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4308092	4308093	+	IGR	DEL	GA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4308092_4308093delGA								KLF6 (480619 upstream) : LOC100216001 (313351 downstream)																							tggcaaaagtgagagagactgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	9407816	9407818	+	IGR	DEL	TTC	-	-	rs75306414		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9407816_9407818delTTC								None (None upstream) : None (None downstream)																							ttcttcttctttctccttctcct	0.054													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	9867449	9867449	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9867449delA								None (None upstream) : SFTA1P (958953 downstream)																							aggagaaaggaaaaaacctga	0.169													4	2	---	---	---	---	
CCDC3	83643	broad.mit.edu	37	10	12951119	12951119	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12951119delC	uc001ilq.1	-						CCDC3_uc009xjb.1_Intron|CCDC3_uc001ilr.2_Intron|CCDC3_uc009xjc.1_Intron	NM_031455	NP_113643	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3 precursor							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			ACCTTGGATGCCTCTGCTTGT	0.512													4	2	---	---	---	---	
OLAH	55301	broad.mit.edu	37	10	15103480	15103480	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15103480delT	uc001inu.2	+						ACBD7_uc010qby.1_Intron|OLAH_uc001int.2_Intron	NM_001039702	NP_001034791	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase isoform 2						fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity				0						agttcctttgttttttttttt	0.035													4	2	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47019229	47019230	+	Intron	DEL	CT	-	-	rs140104666		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47019229_47019230delCT	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						tacagtgggcctctctgtatca	0.000													4	2	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47090315	47090316	+	Intron	INS	-	A	A	rs112966378		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47090315_47090316insA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						ccagaatttgcatgataacatc	0.000													6	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47123266	47123266	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47123266delA	uc001jed.3	-						uc001jef.2_Intron			P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						TCTGAAACCTAAGGACACCTT	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	60817363	60817363	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60817363delA								BICC1 (228518 upstream) : PHYHIPL (118985 downstream)																							ATGCCTCTAGAACCTGAAGCC	0.522													4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61949918	61949918	+	Intron	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61949918delG	uc001jky.2	-						ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron|ANK3_uc001jlc.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						ACAATACATTGGCAATTTTAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82023837	82023837	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82023837delA								ANXA11 (58404 upstream) : MAT1A (7740 downstream)																							GTCAGAGGGCAAATGCCCCCA	0.587													4	2	---	---	---	---	
OPN4	94233	broad.mit.edu	37	10	88420872	88420872	+	Intron	DEL	A	-	-	rs72462066		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88420872delA	uc001kdq.2	+						OPN4_uc001kdp.2_Intron|OPN4_uc010qmk.1_Intron|OPN4_uc009xsx.1_Intron	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 1						phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1						gcgacagagcaaaaaaaaaaa	0.239													4	4	---	---	---	---	
PYROXD2	84795	broad.mit.edu	37	10	100154524	100154525	+	Intron	DEL	GA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100154524_100154525delGA	uc001kpc.2	-						PYROXD2_uc001kpb.2_Intron|PYROXD2_uc001kpd.2_Intron	NM_032709	NP_116098	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			central_nervous_system(1)	1						AAGGAACAGTGAGAGAGAAGGG	0.391													4	2	---	---	---	---	
SCD	6319	broad.mit.edu	37	10	102122879	102122879	+	3'UTR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102122879delG	uc001kqy.2	+	6						NM_005063	NP_005054	O00767	ACOD_HUMAN	stearoyl-CoA desaturase 1						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity				0		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		GCTGAGACCTGGGATTTGAGA	0.512													4	2	---	---	---	---	
DMBT1	1755	broad.mit.edu	37	10	124325819	124325819	+	Intron	DEL	T	-	-	rs67584122		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124325819delT	uc001lgk.1	+						DMBT1_uc001lgl.1_Intron|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Intron|DMBT1_uc010qtx.1_Intron	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b						epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GTACCTTTTCtttttttttct	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	7908361	7908361	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7908361delA	uc001mfs.1	-											Homo sapiens cDNA FLJ34536 fis, clone HLUNG2008384.																		accctgtctcaaaaaaaaaga	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	14957523	14957523	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14957523delA								CYP2R1 (43772 upstream) : CALCA (30693 downstream)																							ACACCTCCTGAAATGACTACT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27505351	27505352	+	IGR	INS	-	AAAA	AAAA	rs11030023	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27505351_27505352insAAAA								LGR4 (11017 upstream) : LIN7C (10619 downstream)																							aacaaacaaacaaaaaaacaCA	0.218													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30973744	30973744	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30973744delA	uc009yjk.1	-						uc009yjl.1_Intron|DCDC1_uc001msu.1_Intron					RecName: Full=Doublecortin domain-containing protein 5;																		gtgtgtgcctaagaattaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	36708507	36708507	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36708507delT								C11orf74 (12117 upstream) : None (None downstream)																							TGAATAGGGCTTTAGGGcaat	0.189													4	2	---	---	---	---	
PRDM11	56981	broad.mit.edu	37	11	45235135	45235135	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45235135delT	uc001myo.2	+						uc001myp.2_3'UTR	NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11											upper_aerodigestive_tract(1)	1						TGTGCTTGCCTTTTTTGGAGT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48441736	48441736	+	IGR	DEL	T	-	-	rs147108249		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48441736delT								OR4C45 (67737 upstream) : OR4A47 (68609 downstream)																							TTTTTTTTCATTTTTTTTTTC	0.323													4	2	---	---	---	---	
MS4A8B	83661	broad.mit.edu	37	11	60467178	60467178	+	5'UTR	DEL	A	-	-	rs34321729		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60467178delA	uc001npv.2	+	1					MS4A8B_uc009yne.1_5'UTR	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0						TTCTCTCAGGAAAAAAAACAA	0.483													3	3	---	---	---	---	
FAT3	120114	broad.mit.edu	37	11	92229513	92229513	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92229513delC	uc001pdj.3	+							NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGCCTCTCCACCGCACCCTCT	0.363										TCGA Ovarian(4;0.039)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	96653476	96653476	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96653476delT								JRKL (526749 upstream) : None (None downstream)																							gcaggttgcattccatgggaa	0.154													4	2	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103025063	103025063	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103025063delC	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ATCTATTAAACATACACAAGT	0.244													16	8	---	---	---	---	
DYNC2H1	79659	broad.mit.edu	37	11	103025065	103025073	+	Intron	DEL	TACACAAGT	-	-	rs148506746	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103025065_103025073delTACACAAGT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTATTAAACATACACAAGTGTGTGTGTAC	0.234													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116568066	116568067	+	IGR	INS	-	TGTTT	TGTTT	rs66482393		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116568066_116568067insTGTTT								None (None upstream) : BUD13 (50821 downstream)																							tccgaagccTAtgttttgtttt	0.050													2	4	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126382188	126382189	+	Intron	DEL	GT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126382188_126382189delGT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TGGCTCTGAGGTGTGTGTGTTA	0.490													4	2	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134043313	134043313	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134043313delC	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		AGAAAGCCTTCCCCCAGAGCT	0.582													4	2	---	---	---	---	
B4GALNT3	283358	broad.mit.edu	37	12	607810	607811	+	Intron	INS	-	C	C	rs147393394	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:607810_607811insC	uc001qii.1	+							NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta							Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GATTGGAATGACAAGCTGAGAA	0.450													3	4	---	---	---	---	
ADIPOR2	79602	broad.mit.edu	37	12	1815366	1815367	+	Intron	INS	-	T	T	rs143835922	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1815366_1815367insT	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			tatccagaaagtttaccctcag	0.114													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4472702	4472702	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4472702delT								C12orf5 (3514 upstream) : FGF23 (4691 downstream)																							aatgcaaaactttttgagcac	0.000													4	2	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	11994269	11994269	+	Intron	DEL	A	-	-	rs33997269		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11994269delA	uc001qzz.2	+							NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GCGTTGATCTAAAAGGCCAAA	0.517			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								4	4	---	---	---	---	
CALCOCO1	57658	broad.mit.edu	37	12	54106356	54106356	+	Intron	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54106356delG	uc001sef.2	-						CALCOCO1_uc001see.2_Intron|CALCOCO1_uc010som.1_Intron|CALCOCO1_uc010son.1_Intron|CALCOCO1_uc001seh.2_3'UTR|CALCOCO1_uc009znd.2_Intron|CALCOCO1_uc001seg.2_Intron	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform						steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						GGGAATAAAAGGGAAGGCAGA	0.537													4	2	---	---	---	---	
ANKRD52	283373	broad.mit.edu	37	12	56645586	56645586	+	Intron	DEL	T	-	-	rs112384328		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56645586delT	uc001skm.3	-							NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52								protein binding			ovary(2)	2						TACTTTTGGGTTTTTTTTTCC	0.328													3	3	---	---	---	---	
KCNC2	3747	broad.mit.edu	37	12	75550029	75550030	+	Intron	INS	-	T	T	rs142127763	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75550029_75550030insT	uc001sxg.1	-						KCNC2_uc009zry.2_Intron|KCNC2_uc001sxe.2_Intron|KCNC2_uc001sxf.2_Intron|KCNC2_uc010stw.1_Intron	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel						energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						ctctcgaaacattttttttttg	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	97624834	97624834	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97624834delG								NEDD1 (277373 upstream) : RMST (233965 downstream)																							agagcaggctggggacagata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	105897327	105897327	+	IGR	DEL	T	-	-	rs112926078		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105897327delT								C12orf75 (132032 upstream) : NUAK1 (559798 downstream)																							AATGATGATCTTTTTTTTTTT	0.299													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131962224	131962225	+	IGR	INS	-	ATA	ATA	rs67902503		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131962224_131962225insATA								LOC116437 (264749 upstream) : SFRS8 (233410 downstream)																							tggtaatggtggtgatgatggt	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19298431	19298432	+	IGR	INS	-	A	A	rs142759522	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19298431_19298432insA								None (None upstream) : LOC284232 (110111 downstream)																							ACCTCTTTGGGAAAAAAATATT	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	21816984	21816984	+	IGR	DEL	T	-	-	rs112717607		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21816984delT								MRP63 (63766 upstream) : ZDHHC20 (133526 downstream)																							CTACAGGCTATTTTTTTTTCA	0.413													3	3	---	---	---	---	
SPATA13	221178	broad.mit.edu	37	13	24849184	24849184	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24849184delT	uc001upg.1	+						SPATA13_uc001upd.1_Intron|C1QTNF9_uc001upe.2_Intron|SPATA13_uc010tcy.1_Intron|SPATA13_uc010tcz.1_Intron|SPATA13_uc010tda.1_Intron|SPATA13_uc001uph.2_Intron|SPATA13_uc010tdb.1_Intron	NM_153023	NP_694568	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		AGTCAGGGGCTTTTTTTTTCC	0.428													4	2	---	---	---	---	
ENOX1	55068	broad.mit.edu	37	13	43877814	43877814	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43877814delT	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		aaagtaacacttttttttttg	0.015													4	2	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	49034105	49034107	+	Intron	DEL	CTC	-	-	rs9562824		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49034105_49034107delCTC	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ctttctttctctctttctttctt	0.025		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			7	6	---	---	---	---	
DIAPH3	81624	broad.mit.edu	37	13	60336596	60336597	+	Intron	INS	-	AAC	AAC	rs35499994		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60336596_60336597insAAC	uc001vht.2	-							NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		aaaggtgtgaaaaagaggcaga	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	68889835	68889835	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68889835delT								None (None upstream) : None (None downstream)																							gtagtggacatttttttttta	0.104													4	2	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74361599	74361602	+	Intron	DEL	TAAA	-	-	rs67074393		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74361599_74361602delTAAA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		AATTATTGATTAAATAATCAGTAA	0.088													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	84255064	84255065	+	IGR	INS	-	A	A	rs144371446	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84255064_84255065insA								None (None upstream) : SLITRK1 (196279 downstream)																							GTTGAAACAGTaaaaaaaaaca	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	87343980	87343981	+	IGR	INS	-	A	A	rs68001807		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87343980_87343981insA								SLITRK6 (970497 upstream) : SLITRK5 (980889 downstream)																							agcataaaatgaaaaAAAAAAA	0.119													4	2	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95900172	95900173	+	Intron	INS	-	CACACACACA	CACACACACA	rs145006616	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95900172_95900173insCACACACACA	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	gttaacatgtgcacacacacac	0.054													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	98742913	98742913	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98742913delG								IPO5 (66364 upstream) : FARP1 (51903 downstream)																							gagaggcagtggtggtgatgg	0.000													4	2	---	---	---	---	
FGF14	2259	broad.mit.edu	37	13	102543276	102543276	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102543276delT	uc001vpe.2	-						FGF14_uc001vpf.2_Intron	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCAAGAGCCTTTTTTTTTTC	0.458													7	4	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114871479	114871479	+	Intron	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114871479delG	uc001vui.2	-						RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CCATTCCTCTGGGGCCACGGC	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20965336	20965336	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20965336delG								PNP (20090 upstream) : RNASE10 (8360 downstream)																							GTCATGAAGAGGttttttttt	0.219													4	2	---	---	---	---	
SDCCAG1	9147	broad.mit.edu	37	14	50117349	50117350	+	Intron	INS	-	A	A			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50117349_50117350insA	uc010anj.1	-						POLE2_uc010ann.2_Intron|POLE2_uc001wwu.2_Intron|POLE2_uc001wwv.2_Intron|POLE2_uc010ano.2_Intron	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		TGTATTTTAGGAAAAAAAATCT	0.198													4	2	---	---	---	---	
CALM1	801	broad.mit.edu	37	14	90866396	90866396	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90866396delT	uc001xyl.1	+						CALM1_uc010atq.1_Intron|CALM1_uc010atr.1_Intron|CALM1_uc001xym.1_Intron	NM_006888	NP_008819	P62158	CALM_HUMAN	calmodulin 1 isoform 1						activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding			central_nervous_system(1)	1		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	TAACCTTTTCTTTCTTCATAT	0.383											OREG0022864	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	161	107	---	---	---	---	
GOLGA8F	100132565	broad.mit.edu	37	15	28630217	28630218	+	Intron	INS	-	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28630217_28630218insC	uc010uag.1	+						GOLGA8G_uc001zbp.3_Intron|GOLGA8G_uc001zbo.2_Intron|GOLGA8G_uc001zbn.2_Intron	NM_001164328	NP_001157800			golgi autoantigen, golgin subfamily a, 8F												0						tcttttcttttttttttttttt	0.485													5	3	---	---	---	---	
NUSAP1	51203	broad.mit.edu	37	15	41657842	41657842	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41657842delA	uc001zns.3	+						NUSAP1_uc001znq.3_Intron|NUSAP1_uc001znr.3_Intron|NUSAP1_uc010bce.2_Intron|NUSAP1_uc001znt.3_Intron|NUSAP1_uc001znv.3_Intron|NUSAP1_uc001znu.3_Intron|NUSAP1_uc010ucw.1_Intron|NUSAP1_uc001znw.3_Intron	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		TGGACTATATAAAAAAAAAAt	0.204													4	2	---	---	---	---	
CAPN3	825	broad.mit.edu	37	15	42692884	42692884	+	Intron	DEL	A	-	-	rs79160618		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42692884delA	uc001zpn.1	+						CAPN3_uc001zpk.1_Intron|CAPN3_uc001zpl.1_Intron|CAPN3_uc010udf.1_Intron|CAPN3_uc010udg.1_Intron|CAPN3_uc001zpo.1_Intron|CAPN3_uc001zpp.1_Intron|CAPN3_uc001zpq.1_5'Flank	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a						muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		accctgcctcaaaaaaaaaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	46952383	46952384	+	IGR	DEL	TA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46952383_46952384delTA								SQRDL (968905 upstream) : SEMA6D (524019 downstream)																							ATGAGATGCTTATTGGCATCCT	0.332													4	2	---	---	---	---	
CEP152	22995	broad.mit.edu	37	15	49090459	49090459	+	Intron	DEL	T	-	-	rs149160840		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49090459delT	uc001zwy.2	-						CEP152_uc001zwz.2_Intron|CEP152_uc001zxa.1_Intron	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa						centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		ATCAGAAGGCTTTTTTTTTTT	0.294													5	3	---	---	---	---	
ZNF609	23060	broad.mit.edu	37	15	64776162	64776162	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64776162delT	uc010bgy.2	+									O15014	ZN609_HUMAN	SubName: Full=ZNF609 protein;							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						tggttttgtgtttttttttcc	0.085													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75253866	75253866	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75253866delA								RPP25 (4091 upstream) : SCAMP5 (34035 downstream)																							acaaacaaacaaaaaaaaaCC	0.040													4	2	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78331349	78331350	+	Intron	DEL	AC	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78331349_78331350delAC	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						CACTGCAGAAACACACACACAC	0.510													4	2	---	---	---	---	
MTHFS	10588	broad.mit.edu	37	15	80165898	80165898	+	Intron	DEL	A	-	-	rs74972590		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80165898delA	uc002bex.3	-							NM_006441	NP_006432	P49914	MTHFS_HUMAN	5,10-methenyltetrahydrofolate synthetase						folic acid-containing compound biosynthetic process|formate metabolic process|tetrahydrofolate metabolic process	cytosol|Golgi apparatus|plasma membrane	5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|folic acid binding				0				all cancers(203;0.00467)		ATCCTCTCTGAAAAAAAAAAT	0.398													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5844513	5844514	+	IGR	DEL	GT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5844513_5844514delGT								FAM86A (696724 upstream) : A2BP1 (224618 downstream)																							GCCAGCgtgcgtgtgtgtgtgt	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32819286	32819286	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32819286delT								TP53TG3B (130408 upstream) : SLC6A10P (69511 downstream)																							tcatttcatatcatttcctca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33583381	33583382	+	IGR	DEL	CT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33583381_33583382delCT								SLC6A10P (686918 upstream) : MIR1826 (382126 downstream)																							ATTAATTTACCTCTGATTCTTC	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33979164	33979164	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33979164delA								MIR1826 (13572 upstream) : UBE2MP1 (424638 downstream)																							atcttcacataaaaactagac	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33982957	33982957	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33982957delT								MIR1826 (17365 upstream) : UBE2MP1 (420845 downstream)																							ttgagatccctttttggccta	0.000													4	2	---	---	---	---	
SHCBP1	79801	broad.mit.edu	37	16	46649040	46649040	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46649040delA	uc002eec.3	-							NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1											ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				acttccacttaatgagtagta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	49346493	49346493	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49346493delC								CBLN1 (30778 upstream) : C16orf78 (61315 downstream)																							GAAACAAGCACCCCCCACCCT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54250739	54250740	+	IGR	INS	-	GGA	GGA	rs138984556	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54250739_54250740insGGA								FTO (102361 upstream) : IRX3 (66472 downstream)																							TAGTAGAAATTGGAGTTCAGTT	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	61324471	61324471	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61324471delG								None (None upstream) : CDH8 (362764 downstream)																							AATTACACCTGGAACCATAAC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66045706	66045706	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66045706delC								LOC283867 (435503 upstream) : CDH5 (354819 downstream)																							ggaatccttgcccactccaac	0.040													4	2	---	---	---	---	
CA7	766	broad.mit.edu	37	16	66886489	66886490	+	Intron	INS	-	A	A	rs111695989		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66886489_66886490insA	uc002eqi.2	+						uc002eqh.2_Intron|CA7_uc002eqj.2_Intron	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1						one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		gaaaagaaaagaaaaaaaaaag	0.139													5	3	---	---	---	---	
CDH1	999	broad.mit.edu	37	16	68863252	68863253	+	Intron	INS	-	GA	GA			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68863252_68863253insGA	uc002ewg.1	+						CDH1_uc010vlj.1_Intron|CDH1_uc010cfg.1_Intron	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CACAAGCTGGGGTTGGGAGGGA	0.262			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85848160	85848160	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85848160delT								COX4I1 (7555 upstream) : IRF8 (84614 downstream)																							CCttcttttctttttttttga	0.194													4	2	---	---	---	---	
RHBDL3	162494	broad.mit.edu	37	17	30591496	30591496	+	5'Flank	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30591496delG	uc002hhe.1	+						RHBDL3_uc010csw.1_5'Flank|RHBDL3_uc010csx.1_5'Flank|RHBDL3_uc010csy.1_5'Flank	NM_138328	NP_612201	P58872	RHBL3_HUMAN	rhomboid protease 3						proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)				CCTGGGATGCGGGAGGCAGCG	0.562													4	2	---	---	---	---	
RPL19	6143	broad.mit.edu	37	17	37357199	37357199	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37357199delC	uc002hrq.1	+						RPL19_uc002hrr.1_Intron	NM_000981	NP_000972	P84098	RL19_HUMAN	ribosomal protein L19						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0						AATGGCATAACCCCCCTATTC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	54220283	54220284	+	IGR	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54220283_54220284insT								PCTP (365536 upstream) : ANKFN1 (10552 downstream)																							CACTCCCACCATTTTTTCTATT	0.460													4	2	---	---	---	---	
RGS9	8787	broad.mit.edu	37	17	63214759	63214760	+	Intron	DEL	CT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63214759_63214760delCT	uc002jfe.2	+						RGS9_uc010dem.2_Intron|RGS9_uc002jfd.2_Intron|RGS9_uc002jff.2_Intron|RGS9_uc002jfg.2_Intron	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1						intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						TCAGAAATAGctctctctctct	0.213													4	2	---	---	---	---	
ABCA10	10349	broad.mit.edu	37	17	67197934	67197935	+	Intron	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67197934_67197935insT	uc010dfa.1	-						ABCA10_uc010wqt.1_Intron|ABCA10_uc010dfb.1_Intron|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TATATTTATAAttttttttttt	0.134													3	3	---	---	---	---	
CCDC40	55036	broad.mit.edu	37	17	78058910	78058910	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78058910delT	uc010dht.2	+						CCDC40_uc002jxm.3_Intron|CCDC40_uc002jxn.3_Intron	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CCTCTTTCCCTACCTGCTTTA	0.438													4	2	---	---	---	---	
CCDC137	339230	broad.mit.edu	37	17	79637023	79637024	+	Intron	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79637023_79637024insT	uc002kbc.3	+						CCDC137_uc002kbd.2_Intron	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137											central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ttctgctttcctttttcagctg	0.342													4	2	---	---	---	---	
FN3KRP	79672	broad.mit.edu	37	17	80675598	80675598	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80675598delA	uc002kfu.2	+						FN3KRP_uc010wvr.1_Intron	NM_024619	NP_078895	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein								kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			actccgtctcaaaaaaaaaag	0.249													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	4551718	4551718	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4551718delA								DLGAP1 (96452 upstream) : LOC642597 (591954 downstream)																							tgaattaattataaattCACA	0.184													4	2	---	---	---	---	
LAMA1	284217	broad.mit.edu	37	18	7031887	7031888	+	Intron	INS	-	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7031887_7031888insC	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCAAAAAAAAAACAAAAAAAAA	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15223131	15223131	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15223131delT								ANKRD30B (370394 upstream) : LOC644669 (90424 downstream)																							CTACATAGTGTTTCCTGTCTA	0.234													5	4	---	---	---	---	
KIAA1012	22878	broad.mit.edu	37	18	29493091	29493091	+	Intron	DEL	A	-	-	rs79506184		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29493091delA	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron|KIAA1012_uc002kxe.2_Intron	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0						actctgtctcaaaaaaaaaaa	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41154055	41154055	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41154055delC								SYT4 (296440 upstream) : None (None downstream)																							tcatgttattccctctgatgc	0.000													4	2	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46279248	46279248	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46279248delC	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						TTGGTTGACTCCCTCATGAGG	0.502													4	2	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	56058215	56058216	+	Intron	DEL	TT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56058215_56058216delTT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_Intron|NEDD4L_uc002lhd.2_Intron|NEDD4L_uc002lhb.2_Intron|NEDD4L_uc002lhe.2_Intron|NEDD4L_uc002lhf.2_Intron|NEDD4L_uc002lhg.2_Intron|NEDD4L_uc002lhh.2_Intron|NEDD4L_uc010dpn.2_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						AAGGCTGCTCTTTTTTTTTTTT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	64419268	64419269	+	IGR	INS	-	T	T	rs74173422		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64419268_64419269insT								CDH19 (148052 upstream) : DSEL (754550 downstream)																							cattaacatgatttttttTTTT	0.149													4	2	---	---	---	---	
ZNF236	7776	broad.mit.edu	37	18	74582335	74582335	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74582335delT	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron|ZNF236_uc002lmk.1_Intron	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CTCATGAGGCTTTAATGCAGG	0.378													4	2	---	---	---	---	
MLLT1	4298	broad.mit.edu	37	19	6227942	6227942	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6227942delA	uc002mek.2	-							NM_005934	NP_005925	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|protein binding			skin(1)	1						AATACACTTCAAAAAAAAAGT	0.463			T	MLL	AL								4	2	---	---	---	---	
OLFM2	93145	broad.mit.edu	37	19	10023659	10023659	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10023659delC	uc002mmp.2	-							NM_058164	NP_477512	O95897	NOE2_HUMAN	olfactomedin 2 precursor							extracellular region				large_intestine(1)|skin(1)	2						gagactcagacagaACTACTC	0.279													1	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10413921	10413921	+	IGR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10413921delT								ICAM5 (6469 upstream) : ZGLP1 (1559 downstream)																							gtgtcagccatggggagatgt	0.050													4	2	---	---	---	---	
ZNF44	51710	broad.mit.edu	37	19	12404871	12404872	+	Intron	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12404871_12404872insT	uc010xmj.1	-						ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_Intron|ZNF44_uc002mtn.3_Intron|ZNF44_uc010dys.2_Intron|ZNF44_uc002mto.2_Intron	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN	zinc finger protein 44 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		cttccccattggcctggggata	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	12670276	12670276	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12670276delA								ZNF709 (7920 upstream) : ZNF490 (16644 downstream)																							ctccatctccaaaaaaaaaaa	0.254													9	4	---	---	---	---	
SLC27A1	376497	broad.mit.edu	37	19	17594226	17594227	+	Intron	DEL	GT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17594226_17594227delGT	uc002ngu.1	+						SLC27A1_uc002ngt.1_Intron|SLC27A1_uc010xpp.1_Intron	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1						cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						CTGTGAGTGGGTGTGTGTGTGG	0.569													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24618812	24618812	+	IGR	DEL	G	-	-	rs144645608	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24618812delG								LOC100101266 (272563 upstream) : None (None downstream)																							aagcattctcggaaacttctt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29233249	29233250	+	IGR	DEL	AA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29233249_29233250delAA								LOC148189 (948401 upstream) : LOC148145 (222790 downstream)																							attttatcttaaaggtctcaaa	0.000													4	2	---	---	---	---	
PEPD	5184	broad.mit.edu	37	19	33878071	33878072	+	3'UTR	INS	-	TAAT	TAAT	rs141718354	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33878071_33878072insTAAT	uc002nur.3	-	15					PEPD_uc010xrr.1_3'UTR|PEPD_uc010xrs.1_3'UTR|PEPD_uc002nuq.3_3'UTR	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1						cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					CTGCAAAAGGGTAATTAAAAAA	0.411													3	4	---	---	---	---	
ZNF585A	199704	broad.mit.edu	37	19	37641929	37641929	+	3'UTR	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37641929delT	uc002ofo.1	-	5					ZNF585A_uc002ofm.1_3'UTR|ZNF585A_uc002ofn.1_3'UTR	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGTTTTTTCTTTTTTTTTTT	0.388													5	3	---	---	---	---	
C19orf69	100170765	broad.mit.edu	37	19	41950319	41950320	+	3'UTR	INS	-	T	T			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41950319_41950320insT	uc010xwc.1	+	2					CYP2F1_uc010xvw.1_Intron	NM_001130514	NP_001123986	A6NGS2	CS069_HUMAN	hypothetical protein LOC100170765												0						GATGACATGAGGATGTGTTTGG	0.475													4	4	---	---	---	---	
CEACAM1	634	broad.mit.edu	37	19	43016836	43016836	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43016836delT	uc002otv.2	-						uc010eif.1_Intron|uc002ott.1_Intron|uc010eig.1_Intron|uc010eih.1_Intron|CEACAM1_uc010eii.2_Intron|CEACAM1_uc002otw.2_Intron|CEACAM1_uc010eij.2_Intron|CEACAM1_uc002otx.2_Intron|CEACAM1_uc002oty.2_Intron|CEACAM1_uc002otz.2_Intron|CEACAM1_uc010eik.2_Intron	NM_001712	NP_001703	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion						angiogenesis|cell migration|homophilic cell adhesion|integrin-mediated signaling pathway	extracellular region|integral to plasma membrane|membrane fraction				ovary(1)|central_nervous_system(1)	2		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	ttttcttttcttttttttttt	0.154													4	2	---	---	---	---	
SLC8A2	6543	broad.mit.edu	37	19	47972376	47972377	+	Intron	INS	-	GT	GT	rs73940853		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47972376_47972377insGT	uc002pgx.2	-						SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		TGCCtgtgtgcgtgtgtgtgtg	0.490													6	3	---	---	---	---	
EHD2	30846	broad.mit.edu	37	19	48239457	48239457	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48239457delA	uc002phj.3	+						EHD2_uc010xyu.1_Intron|EHD2_uc010xyv.1_Intron	NM_014601	NP_055416	Q9NZN4	EHD2_HUMAN	EH-domain containing 2						blood coagulation|endocytic recycling	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding			ovary(1)|skin(1)	2		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		cgtctcaaagaaaaaaaaaga	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50995035	50995036	+	IGR	INS	-	GA	GA			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50995035_50995036insGA								C19orf63 (8428 upstream) : JOSD2 (14223 downstream)																							agagggagaccgagagagagag	0.000													3	3	---	---	---	---	
SIGLEC6	946	broad.mit.edu	37	19	52035065	52035069	+	Splice_Site	DEL	AGAGA	-	-	rs12609762	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52035065_52035069delAGAGA	uc002pwy.2	-	1	1	c.-161_splice	c.e1-1		SIGLEC6_uc002pwz.2_Splice_Site|SIGLEC6_uc002pxa.2_Splice_Site|SIGLEC6_uc010ydb.1_Splice_Site|SIGLEC6_uc010ydc.1_Splice_Site|SIGLEC6_uc010eoz.1_Splice_Site|SIGLEC6_uc010epb.1_Splice_Site|SIGLEC6_uc010epa.1_Splice_Site	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1						cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TTTGAGACCCAGAGACCTGCCCAAA	0.620													4	2	---	---	---	---	
TMC4	147798	broad.mit.edu	37	19	54675410	54675410	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54675410delC	uc010erf.2	-						TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GACGGCAAATCCCAGAGAGAA	0.478													4	2	---	---	---	---	
ZIM3	114026	broad.mit.edu	37	19	57649655	57649656	+	Intron	DEL	GA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57649655_57649656delGA	uc002qnz.1	-							NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		tgccgaccctgagaatgggggc	0.094													4	2	---	---	---	---	
DDRGK1	65992	broad.mit.edu	37	20	3172245	3172245	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3172245delA	uc002wic.2	-						DDRGK1_uc010gaw.2_Intron	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1 precursor							endoplasmic reticulum	protein binding				0						TTCGTCCATTAAAAATGCAGG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11819330	11819330	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11819330delA								None (None upstream) : BTBD3 (52147 downstream)																							AATCAACACTAAAAAATGTAC	0.308													4	2	---	---	---	---	
SNX5	27131	broad.mit.edu	37	20	17931250	17931250	+	Intron	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17931250delG	uc002wqc.2	-						SNX5_uc002wqb.2_Intron|SNX5_uc002wqd.2_Intron|SNX5_uc002wqe.2_Intron|SNX5_uc010zrt.1_Intron	NM_014426	NP_055241	Q9Y5X3	SNX5_HUMAN	sorting nexin 5						cell communication|pinocytosis|protein transport	cytoplasmic vesicle membrane|early endosome membrane|extrinsic to endosome membrane|extrinsic to internal side of plasma membrane|macropinocytic cup|phagocytic cup|ruffle	phosphatidylinositol binding			large_intestine(1)	1						AATGTCTACAGAAGAATCACT	0.408													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19765919	19765920	+	IGR	INS	-	AC	AC	rs139155675	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19765919_19765920insAC								SLC24A3 (62379 upstream) : RIN2 (104290 downstream)																							CCCCTCTacatacacacacaca	0.223													1	5	---	---	---	---	
RIN2	54453	broad.mit.edu	37	20	19918791	19918791	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19918791delC	uc002wro.1	+						RIN2_uc010gcu.1_Intron|RIN2_uc010gcv.1_Intron	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						ttctttatctccctgaactcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26082949	26082950	+	IGR	DEL	AT	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26082949_26082950delAT								FAM182A (15397 upstream) : C20orf191 (1103 downstream)																							taaacaaaacatagtatactca	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31201158	31201159	+	IGR	INS	-	TGGG	TGGG			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31201158_31201159insTGGG								C20orf112 (76958 upstream) : C20orf203 (19503 downstream)																							ggatggatggatggatggatgg	0.000													4	2	---	---	---	---	
C20orf152	140894	broad.mit.edu	37	20	34583248	34583248	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34583248delT	uc002xes.1	+						C20orf152_uc002xer.1_Intron|C20orf152_uc010gfp.1_Intron			Q96M20	CT152_HUMAN	SubName: Full=C20orf152 protein;												0	Breast(12;0.00631)					CTTTCCAGCCTTTTTTTTTTA	0.498											OREG0025897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47503029	47503029	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47503029delG								PREX1 (58609 upstream) : ARFGEF2 (35246 downstream)																							AGCTGGGTCTGGCCACCCAGA	0.557													4	2	---	---	---	---	
ARFGEF2	10564	broad.mit.edu	37	20	47590108	47590108	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47590108delT	uc002xtx.3	+							NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			gaaggtgacctttgagctgag	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	53316154	53316154	+	IGR	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53316154delC								DOK5 (48445 upstream) : None (None downstream)																							acctcaatgaccagacctgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58744653	58744654	+	Intron	INS	-	TT	TT	rs150710079	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58744653_58744654insTT	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		GCTCTGGAGACTATCTGCATTT	0.386													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9856378	9856380	+	IGR	DEL	CTC	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9856378_9856380delCTC								None (None upstream) : None (None downstream)																							CCTCTGCCTTCTCCTCCAGGGCA	0.581													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10764159	10764159	+	IGR	DEL	A	-	-	rs111339368		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10764159delA								None (None upstream) : TPTE (142584 downstream)																							caatcaaaagataggttcaac	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11074016	11074017	+	Intron	INS	-	AACT	AACT	rs142631439		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11074016_11074017insAACT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		catgtaagaacaacaaaccaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11164717	11164720	+	IGR	DEL	CCCA	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11164717_11164720delCCCA								BAGE (65780 upstream) : None (None downstream)																							TGAGTGACTCCCCAGAGTCACATG	0.564													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20229397	20229397	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20229397delG								TMPRSS15 (453427 upstream) : None (None downstream)																							ggttgacgctgggatattaac	0.055													4	2	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41910227	41910228	+	Intron	INS	-	A	A	rs148481369	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41910227_41910228insA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				AAGCTAACCCCGTGCACAGCAG	0.530													3	3	---	---	---	---	
DGCR2	9993	broad.mit.edu	37	22	19112377	19112377	+	5'Flank	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19112377delA	uc002zoq.1	-						DGCR2_uc002zor.1_5'Flank|DGCR2_uc011agr.1_5'Flank	NM_005137	NP_005128	P98153	IDD_HUMAN	integral membrane protein DGCR2 precursor						cell adhesion|organ morphogenesis	integral to membrane	receptor activity|sugar binding			large_intestine(1)	1	Colorectal(54;0.0993)					CCAGGGGCAGAAAAAAAACTA	0.582													4	2	---	---	---	---	
CDC45	8318	broad.mit.edu	37	22	19482091	19482091	+	Intron	DEL	C	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19482091delC	uc002zpr.2	+						CDC45_uc011agz.1_Intron|CDC45_uc011aha.1_Frame_Shift_Del_p.P202fs|CDC45_uc002zps.2_Intron|CDC45_uc002zpt.2_Intron	NM_003504	NP_003495	O75419	CDC45_HUMAN	CDC45-like						DNA replication checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	centrosome|nucleoplasm	protein binding			lung(1)	1						GTTCGCCGGTCCCATGAGTGA	0.498													8	4	---	---	---	---	
TOP3B	8940	broad.mit.edu	37	22	22326532	22326532	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22326532delA	uc002zvs.2	-						TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TTTTTGGACCAAAAAAAAAAG	0.289													6	3	---	---	---	---	
NF2	4771	broad.mit.edu	37	22	30064073	30064074	+	Intron	INS	-	GT	GT	rs149414018	by1000genomes	TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30064073_30064074insGT	uc003age.3	+						NF2_uc003afy.3_Intron|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Intron|NF2_uc003agb.3_Intron|NF2_uc003agc.3_Intron|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Intron|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Intron|NF2_uc010gvp.2_Intron	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						GACATGGTGAAGTGTCCTCCAG	0.342			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32782174	32782175	+	IGR	INS	-	G	G	rs72565574		TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32782174_32782175insG								RFPL3S (15111 upstream) : C22orf28 (1387 downstream)																							caATTCTACTTGAAGTGTCAGA	0.252													4	2	---	---	---	---	
CSF2RB	1439	broad.mit.edu	37	22	37321282	37321282	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37321282delT	uc003aqa.3	+						CSF2RB_uc003aqc.3_Intron	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta						respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	gctgccaaccttatctcaagc	0.000													4	2	---	---	---	---	
PARVB	29780	broad.mit.edu	37	22	44556992	44556993	+	Intron	DEL	TG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44556992_44556993delTG	uc003ben.2	+						PARVB_uc003bem.2_Intron|PARVB_uc010gzn.2_Intron|PARVB_uc003beo.2_Intron	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b						cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)				TCAAGCCTGTtgtgtgtgtgtg	0.327													4	2	---	---	---	---	
POLA1	5422	broad.mit.edu	37	X	24976905	24976905	+	Intron	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24976905delG	uc004dbl.2	+							NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	AATTGAGGCAGGGGGCAGCGT	0.149													4	2	---	---	---	---	
LANCL3	347404	broad.mit.edu	37	X	37511546	37511546	+	Intron	DEL	T	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37511546delT	uc011mkd.1	+						LANCL3_uc004ddp.1_Intron	NM_198511	NP_940913	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3								catalytic activity				0						TTTTATTGACTTTTTTTTTTC	0.284													4	2	---	---	---	---	
SUV39H1	6839	broad.mit.edu	37	X	48566794	48566794	+	3'UTR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48566794delG	uc004dkn.2	+	6					SUV39H1_uc011mmf.1_3'UTR|SUV39H1_uc011mmg.1_RNA	NM_003173	NP_003164	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1						cell cycle|cell differentiation|chromatin silencing at rDNA|interspecies interaction between organisms|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|chromosome, centromeric region|condensed nuclear chromosome|rDNA heterochromatin	chromatin binding|histone methyltransferase activity (H3-K9 specific)|protein N-terminus binding|zinc ion binding				0						ACTCAGAGCTGGAACCAAGAT	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48709206	48709207	+	IGR	INS	-	C	C			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48709206_48709207insC								PCSK1N (15246 upstream) : TIMM17B (41525 downstream)																							ttggaggtgggccccccccact	0.000													5	3	---	---	---	---	
SMC1A	8243	broad.mit.edu	37	X	53402443	53402443	+	3'UTR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53402443delA	uc004dsg.2	-	25					SMC1A_uc011moe.1_3'UTR	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A						cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						CTCTTGAGGTAGGAAAGAGGG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	69310542	69310542	+	IGR	DEL	G	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69310542delG								OTUD6A (26513 upstream) : IGBP1 (42757 downstream)																							aagggaatgtgggcctcttgt	0.060													4	2	---	---	---	---	
TAF1	6872	broad.mit.edu	37	X	70595402	70595402	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70595402delA	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				tagaatctttaaaaaaaaaaa	0.075													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	79754929	79754930	+	IGR	DEL	TG	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79754929_79754930delTG								FAM46D (54119 upstream) : BRWD3 (176753 downstream)																							ttttgaattttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
DACH2	117154	broad.mit.edu	37	X	86068450	86068450	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86068450delA	uc004eew.2	+						DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron|DACH2_uc011mra.1_Intron|DACH2_uc010nmr.2_Intron|DACH2_uc004eey.2_Intron|DACH2_uc004eez.2_Intron	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						ctaaaaatacaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	101216883	101216883	+	IGR	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101216883delA								ZMAT1 (29883 upstream) : TCEAL2 (163777 downstream)																							AGAGAAGGAGAAAAAGAAACT	0.299													4	2	---	---	---	---	
MCF2	4168	broad.mit.edu	37	X	138689632	138689632	+	Intron	DEL	A	-	-			TCGA-CJ-5677-01A-11D-1534-10	TCGA-CJ-5677-11A-01D-1534-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138689632delA	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					AGTCTGGGGTAAAAAAAAGAA	0.244													8	4	---	---	---	---	
