Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VPS13D	55187	broad.mit.edu	37	1	12408985	12408985	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12408985G>A	uc001atv.2	+	45	9316	c.9175G>A	c.(9175-9177)GAG>AAG	p.E3059K	VPS13D_uc001atw.2_Missense_Mutation_p.E3034K|VPS13D_uc001atx.2_Missense_Mutation_p.E2246K	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3058					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GAACAGACTTGAGACACCAAT	0.398													31	53	---	---	---	---	PASS
PADI3	51702	broad.mit.edu	37	1	17609393	17609393	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17609393C>G	uc001bai.2	+	16	1854	c.1814C>G	c.(1813-1815)CCC>CGC	p.P605R		NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	605					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CCCTTTGGGCCCATCATCAAT	0.607													6	22	---	---	---	---	PASS
TMEM57	55219	broad.mit.edu	37	1	25783128	25783128	+	Intron	SNP	A	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25783128A>G	uc001bkk.2	+						TMEM57_uc009vru.2_Intron|TMEM57_uc009vrv.2_Intron|TMEM57_uc009vrt.2_RNA	NM_018202	NP_060672	Q8N5G2	MACOI_HUMAN	transmembrane protein 57							axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGGCTGGATTGTCTTCTT	0.358													5	56	---	---	---	---	PASS
C1orf135	79000	broad.mit.edu	37	1	26162026	26162026	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26162026C>T	uc001bkw.1	-	3	532	c.532G>A	c.(532-534)GAC>AAC	p.D178N		NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein	178											0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		CTTTCCAAGTCCTCGGTGAAG	0.443													85	187	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34180251	34180251	+	Silent	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34180251G>A	uc001bxn.1	-	21	3251	c.3222C>T	c.(3220-3222)ACC>ACT	p.T1074T	CSMD2_uc001bxm.1_Silent_p.T1114T	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1074	Sushi 6.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGATGCGGGCGGTGCCCTCCA	0.627													98	155	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43918042	43918042	+	3'UTR	SNP	T	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43918042T>G	uc001cjk.1	+	57					KIAA0467_uc001cjl.1_3'UTR|HYI_uc001cjm.2_Intron|HYI_uc001cjn.2_Intron|HYI_uc001cjo.2_Intron|HYI_uc001cjp.2_Intron	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TCTCTGCACCTCTTCCAGGAT	0.607													7	4	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507410	74507410	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507410C>T	uc001dfy.3	-	7	1397	c.1205G>A	c.(1204-1206)CGG>CAG	p.R402Q	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	402										ovary(2)	2						TTTCATACTCCGCTCCAATCG	0.353													32	103	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	110251197	110251197	+	IGR	SNP	A	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110251197A>C								GSTM1 (14831 upstream) : GSTM5 (3667 downstream)																							gagaacgaataagccttcatc	0.005													3	5	---	---	---	---	PASS
LCE1E	353135	broad.mit.edu	37	1	152759771	152759771	+	5'UTR	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152759771C>A	uc001fan.2	+	2						NM_178353	NP_848130	Q5T753	LCE1E_HUMAN	late cornified envelope 1E						keratinization						0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTACCTACTGCCGAGATGTCC	0.463													98	188	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204971726	204971726	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204971726A>T	uc001hbj.2	+	27	3467	c.3139A>T	c.(3139-3141)AAC>TAC	p.N1047Y	NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc010prb.1_Intron|NFASC_uc010prc.1_Intron|NFASC_uc001hbl.1_Intron|NFASC_uc001hbm.1_Missense_Mutation_p.N70Y|NFASC_uc009xbh.1_Intron	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	1154	Extracellular (Potential).|Fibronectin type-III 5.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TTCCCCAGGCAACCATACGAA	0.537													4	16	---	---	---	---	PASS
ERO1LB	56605	broad.mit.edu	37	1	236399492	236399492	+	Intron	SNP	G	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236399492G>C	uc001hxt.2	-						ERO1LB_uc010pxt.1_3'UTR	NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			ctcccaaagtgctgggattac	0.174													17	41	---	---	---	---	PASS
RAD51AP2	729475	broad.mit.edu	37	2	17696802	17696802	+	Missense_Mutation	SNP	C	G	G	rs140673266	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17696802C>G	uc002rcl.1	-	1	2905	c.2881G>C	c.(2881-2883)GAT>CAT	p.D961H	RAD51AP2_uc010exn.1_Missense_Mutation_p.D952H	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	961										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATCTCAAAATCTTTTACTATT	0.323													21	27	---	---	---	---	PASS
YIPF4	84272	broad.mit.edu	37	2	32526479	32526479	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32526479T>C	uc002rok.2	+	5	779	c.512T>C	c.(511-513)ATA>ACA	p.I171T		NM_032312	NP_115688	Q9BSR8	YIPF4_HUMAN	Yip1 domain family, member 4	171	Helical; (Potential).					endoplasmic reticulum|integral to membrane	protein binding				0	Acute lymphoblastic leukemia(172;0.155)					CTTGGAGTTATAGGATATTCA	0.318													41	79	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179403617	179403617	+	Intron	SNP	A	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179403617A>C	uc010zfg.1	-						uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTGAAATAAAAGGACCAAA	0.368													24	50	---	---	---	---	PASS
TTLL4	9654	broad.mit.edu	37	2	219609908	219609908	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219609908T>A	uc002viy.2	+	6	2108	c.1738T>A	c.(1738-1740)TTT>ATT	p.F580I	TTLL4_uc010zkl.1_Missense_Mutation_p.F415I|TTLL4_uc010fvx.2_Missense_Mutation_p.F580I|TTLL4_uc010zkm.1_5'Flank	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	580					protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		CTACAGTCTCTTTCCCAACGT	0.498													50	113	---	---	---	---	PASS
DIS3L2	129563	broad.mit.edu	37	2	233198659	233198659	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233198659C>T	uc010fxz.2	+	17	2396	c.2120C>T	c.(2119-2121)GCC>GTC	p.A707V	DIS3L2_uc002vsm.3_RNA|DIS3L2_uc002vso.2_RNA|DIS3L2_uc002vsp.1_5'Flank	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	707							exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CGCCGCTTTGCCGACGTCCTG	0.677													4	102	---	---	---	---	PASS
SLC22A13	9390	broad.mit.edu	37	3	38307442	38307442	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38307442C>A	uc003chz.3	+	1	145	c.91C>A	c.(91-93)CTG>ATG	p.L31M	SLC22A13_uc011aym.1_RNA|SLC22A13_uc011ayn.1_Missense_Mutation_p.L31M	NM_004256	NP_004247	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion	31	Helical; (Potential).					integral to plasma membrane	organic cation transmembrane transporter activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		TCTCAACTTCCTGTCTCCCTT	0.498													21	34	---	---	---	---	PASS
MUC20	200958	broad.mit.edu	37	3	195453061	195453061	+	Silent	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195453061C>A	uc010hzo.2	+	3	1200	c.1074C>A	c.(1072-1074)CCC>CCA	p.P358P	MUC20_uc010hzp.2_Silent_p.P323P|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	529	Involved in oligomerization.		Missing.		protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		GCAGGAATCCCCTTGAAGAAA	0.567													10	21	---	---	---	---	PASS
WHSC1	7468	broad.mit.edu	37	4	1980470	1980470	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1980470C>T	uc003gdz.3	+	22	4108	c.3932C>T	c.(3931-3933)ACA>ATA	p.T1311I	WHSC1_uc003geb.3_Missense_Mutation_p.T1311I|WHSC1_uc003gec.3_Missense_Mutation_p.T1311I|WHSC1_uc003ged.3_Missense_Mutation_p.T1311I|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_Missense_Mutation_p.T530I|WHSC1_uc011bvh.1_Missense_Mutation_p.T372I|WHSC1_uc010icf.2_Missense_Mutation_p.T659I	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	1311					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CAGGACGGGACAGCCTTCAGC	0.582			T	IGH@	MM								19	46	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47694991	47694991	+	Silent	SNP	A	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47694991A>G	uc003gxm.2	-	6	1002	c.909T>C	c.(907-909)CAT>CAC	p.H303H	CORIN_uc011bzf.1_Silent_p.H164H|CORIN_uc011bzg.1_Silent_p.H236H|CORIN_uc011bzh.1_Silent_p.H303H|CORIN_uc011bzi.1_Silent_p.H303H|CORIN_uc003gxn.3_Silent_p.H303H	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	303	Extracellular (Potential).|LDL-receptor class A 1.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						ACATACTGCAATGAGCCTCGT	0.473													9	126	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89577067	89577067	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89577067A>G	uc003hrw.1	+	9	1116	c.950A>G	c.(949-951)TAT>TGT	p.Y317C	HERC3_uc003hrv.2_Missense_Mutation_p.Y317C|HERC3_uc011cdn.1_Missense_Mutation_p.Y199C|HERC3_uc011cdo.1_5'Flank	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3	317	RCC1 7.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GGACTCATCTATGCATTTGGT	0.448													53	98	---	---	---	---	PASS
SLC10A7	84068	broad.mit.edu	37	4	147438224	147438224	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147438224A>G	uc010ioz.2	-	2	403	c.149T>C	c.(148-150)ATA>ACA	p.I50T	SLC10A7_uc003ikr.2_Missense_Mutation_p.I50T|SLC10A7_uc010ipa.2_Missense_Mutation_p.I50T|SLC10A7_uc003iks.2_RNA|SLC10A7_uc003ikt.2_Missense_Mutation_p.I50T|SLC10A7_uc003iku.3_RNA	NM_001029998	NP_001025169	Q0GE19	NTCP7_HUMAN	solute carrier family 10 (sodium/bile acid	50	Helical; (Potential).					integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)					GTTAAAGAATATTGTTGCAAC	0.318													95	296	---	---	---	---	PASS
FAM169A	26049	broad.mit.edu	37	5	74097435	74097435	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74097435G>A	uc003kdm.2	-	9	975	c.932C>T	c.(931-933)GCC>GTC	p.A311V	FAM169A_uc010izm.2_Missense_Mutation_p.A251V|FAM169A_uc003kdl.2_Missense_Mutation_p.A129V	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049	311											0						GCTTGCAAAGGCATCTTTTAG	0.284													16	80	---	---	---	---	PASS
FAM169A	26049	broad.mit.edu	37	5	74097436	74097436	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74097436C>T	uc003kdm.2	-	9	974	c.931G>A	c.(931-933)GCC>ACC	p.A311T	FAM169A_uc010izm.2_Missense_Mutation_p.A251T|FAM169A_uc003kdl.2_Missense_Mutation_p.A129T	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049	311											0						CTTGCAAAGGCATCTTTTAGA	0.284													16	78	---	---	---	---	PASS
PDLIM4	8572	broad.mit.edu	37	5	131606692	131606692	+	Missense_Mutation	SNP	G	C	C	rs141857035	byFrequency	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131606692G>C	uc003kwn.2	+	4	489	c.412G>C	c.(412-414)GGA>CGA	p.G138R	uc003kwm.3_Intron|PDLIM4_uc003kwp.2_Missense_Mutation_p.G138R|PDLIM4_uc003kwo.2_Missense_Mutation_p.G138R	NM_003687	NP_003678	P50479	PDLI4_HUMAN	PDZ and LIM domain 4 isoform 1	138							protein binding|zinc ion binding	p.G138E(1)		ovary(1)|central_nervous_system(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATCTCCATATGGACAACCCCC	0.632													61	202	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140712348	140712348	+	Silent	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712348G>A	uc003lji.1	+	1	2097	c.2097G>A	c.(2095-2097)GCG>GCA	p.A699A	PCDHGA1_uc011dan.1_Silent_p.A699A	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	699	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCGGCCGCGGTCTCCTGCG	0.662													39	135	---	---	---	---	PASS
HLA-DRB1	3123	broad.mit.edu	37	6	32547997	32547997	+	Intron	SNP	T	G	G	rs41287241	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32547997T>G	uc003obp.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc011dqb.1_Intron|HLA-DRB1_uc011dqc.1_3'UTR	NM_002124	NP_002115	P01911	2B1F_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex				skin(1)	1						CTGTGTCTGTTTCTAAAAGAG	0.219									Rheumatoid_Arthritis|Sj_gren_syndrome	Multiple Myeloma(14;0.17)			3	19	---	---	---	---	PASS
PMS2	5395	broad.mit.edu	37	7	6048687	6048687	+	5'UTR	SNP	G	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6048687G>C	uc003spl.2	-	1					PMS2_uc003spk.2_5'UTR|PMS2_uc011jwl.1_5'UTR|PMS2_uc010ktg.2_5'UTR|PMS2_uc010kte.2_5'UTR|PMS2_uc010ktf.1_5'UTR|AIMP2_uc003spo.2_5'Flank	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform						mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GACTGGGAAAGTTCCCTCCAG	0.647			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				19	35	---	---	---	---	PASS
LRRC17	10234	broad.mit.edu	37	7	102585103	102585103	+	3'UTR	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102585103G>A	uc003vau.2	+	4					FBXL13_uc010liq.1_Intron|FBXL13_uc003vaq.2_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron|LRRC17_uc003vat.2_3'UTR	NM_001031692	NP_001026862	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17 isoform 1						bone marrow development|negative regulation of osteoclast differentiation|ossification	extracellular space				ovary(1)	1						CTATACTGGTGTTAGAAAACA	0.303													9	22	---	---	---	---	PASS
ANKRD7	56311	broad.mit.edu	37	7	117864901	117864901	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117864901G>A	uc003vji.2	+	1	190	c.17G>A	c.(16-18)AGC>AAC	p.S6N		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	6					male gonad development						0						AAGCTTTTCAGCTTCTGGAAG	0.532													56	68	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134891906	134891906	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134891906T>A	uc003vsp.2	-	4	622	c.560A>T	c.(559-561)CAG>CTG	p.Q187L	WDR91_uc010lmq.2_5'UTR|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	187	Potential.									breast(2)|ovary(1)|skin(1)	4						TTCTTGAACCTGGTTAGTCCT	0.448													34	85	---	---	---	---	PASS
ADCK2	90956	broad.mit.edu	37	7	140373652	140373652	+	Silent	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140373652G>A	uc003vvy.1	+	1	700	c.522G>A	c.(520-522)GTG>GTA	p.V174V	ADCK2_uc003vvz.2_Silent_p.V174V	NM_052853	NP_443085	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	174						integral to membrane	ATP binding|protein serine/threonine kinase activity				0	Melanoma(164;0.00956)					ATGTCCGAGTGACGCCCCACC	0.597													33	65	---	---	---	---	PASS
CALB1	793	broad.mit.edu	37	8	91094983	91094983	+	5'UTR	SNP	G	A	A	rs3087750	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91094983G>A	uc003yel.1	-	1					CALB1_uc003yem.1_Intron|CALB1_uc011lge.1_5'Flank	NM_004929	NP_004920	P05937	CALB1_HUMAN	calbindin 1							nucleus	calcium ion binding|vitamin D binding			pancreas(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.00953)			GTCCGCGCGAGGGGGAGTGAG	0.642													3	36	---	---	---	---	PASS
NECAB1	64168	broad.mit.edu	37	8	91962067	91962067	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91962067G>A	uc011lgg.1	+	11	1087	c.893G>A	c.(892-894)CGC>CAC	p.R298H	NECAB1_uc003yer.2_Missense_Mutation_p.R47H	NM_022351	NP_071746	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	298	ABM.				antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity			central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.0499)			AATGAATCTCGCTACATGATC	0.348													6	6	---	---	---	---	PASS
PDCD1LG2	80380	broad.mit.edu	37	9	5570132	5570132	+	3'UTR	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5570132G>A	uc003zjg.3	+	7					C9orf46_uc003zjd.2_Intron|PDCD1LG2_uc011lmc.1_3'UTR|PDCD1LG2_uc011lmd.1_3'UTR	NM_025239	NP_079515	Q9BQ51	PD1L2_HUMAN	programmed cell death 1 ligand 2 precursor						immune response|T cell costimulation	endomembrane system|extracellular region|integral to membrane|plasma membrane	receptor activity				0	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000767)|Lung(218;0.112)		ACCTGGCCATGAAACTTGCCC	0.498													9	19	---	---	---	---	PASS
TLN1	7094	broad.mit.edu	37	9	35718904	35718904	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35718904G>T	uc003zxt.2	-	17	2254	c.1900C>A	c.(1900-1902)CGT>AGT	p.R634S		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	634					axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AGGTTCTGACGGGGCTGTGGA	0.597													3	13	---	---	---	---	PASS
C9orf5	23731	broad.mit.edu	37	9	111848284	111848284	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111848284T>G	uc004bdt.3	-	7	1369	c.1337A>C	c.(1336-1338)AAT>ACT	p.N446T	C9orf5_uc004bds.3_Intron|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401	Q9H330	CI005_HUMAN	hypothetical protein LOC23731	446						integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)		TACCTTCTTATTTAGCCAGTG	0.393													3	58	---	---	---	---	PASS
PKD2L1	9033	broad.mit.edu	37	10	102089625	102089625	+	Intron	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102089625C>T	uc001kqx.1	-						PKD2L1_uc009xwm.1_Intron	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1						signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding			ovary(4)	4		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CTATCTGGTACCTCTGATGCC	0.547													31	63	---	---	---	---	PASS
TRUB1	142940	broad.mit.edu	37	10	116698112	116698112	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116698112A>C	uc001lcd.2	+	1	161	c.100A>C	c.(100-102)ACC>CCC	p.T34P	TRUB1_uc010qsl.1_Intron	NM_139169	NP_631908	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase homolog 1	34					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding				0		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		AATGGCTGCGACCCCGTCAGC	0.637													5	6	---	---	---	---	PASS
CTR9	9646	broad.mit.edu	37	11	10785039	10785039	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10785039T>A	uc001mja.2	+	8	1060	c.911T>A	c.(910-912)ATG>AAG	p.M304K		NM_014633	NP_055448	Q6PD62	CTR9_HUMAN	SH2 domain binding protein 1	304					histone H2B ubiquitination|histone monoubiquitination	Cdc73/Paf1 complex|nuclear speck				ovary(2)	2				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTGGAAGCTATGCAAGCAGAG	0.358													11	45	---	---	---	---	PASS
CAT	847	broad.mit.edu	37	11	34478280	34478280	+	Silent	SNP	T	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34478280T>C	uc001mvm.2	+	8	1055	c.972T>C	c.(970-972)AAT>AAC	p.N324N	CAT_uc009ykc.1_RNA	NM_001752	NP_001743	P04040	CATA_HUMAN	catalase	324					hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	ATCCAGTTAATTACTTTGCTG	0.468													43	86	---	---	---	---	PASS
PRDM11	56981	broad.mit.edu	37	11	45245952	45245952	+	Silent	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45245952G>A	uc001myo.2	+	8	1278	c.1029G>A	c.(1027-1029)CTG>CTA	p.L343L		NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11	343										upper_aerodigestive_tract(1)	1						AGGATGTTCTGGAGGCCTCAC	0.517													90	164	---	---	---	---	PASS
PRDM11	56981	broad.mit.edu	37	11	45245953	45245953	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45245953G>A	uc001myo.2	+	8	1279	c.1030G>A	c.(1030-1032)GAG>AAG	p.E344K		NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11	344										upper_aerodigestive_tract(1)	1						GGATGTTCTGGAGGCCTCACT	0.522													91	161	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55418973	55418973	+	Silent	SNP	A	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55418973A>T	uc001nhs.1	+	1	594	c.594A>T	c.(592-594)ACA>ACT	p.T198T		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	198	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				TTGTTGTGACAGCCAACAGTG	0.453													13	250	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	113661349	113661349	+	RNA	SNP	A	G	G	rs1713675	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113661349A>G	uc001pof.1	+	1		c.1397A>G								Homo sapiens cDNA FLJ36034 fis, clone TESTI2017107, highly similar to CYCLIC-AMP-DEPENDENT TRANSCRIPTION FACTOR ATF-4.																		GGGTATAGATAACCTGGAAAC	0.478													5	163	---	---	---	---	PASS
OR10G4	390264	broad.mit.edu	37	11	123886863	123886863	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123886863C>A	uc010sac.1	+	1	582	c.582C>A	c.(580-582)AAC>AAA	p.N194K		NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CCTCAGCCAACGTGATGGTCA	0.537													40	110	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909127	123909127	+	Missense_Mutation	SNP	G	T	T	rs147011748	byFrequency	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909127G>T	uc001pzq.1	-	1	582	c.582C>A	c.(580-582)AAC>AAA	p.N194K		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TGACCATCTCGTTGGCTGAGG	0.537													13	250	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134079245	134079245	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134079245A>T	uc001qhd.1	-	5	1300	c.694T>A	c.(694-696)TTG>ATG	p.L232M	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	232					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TTTTCTTTCAAGGAAAACTTT	0.368													26	69	---	---	---	---	PASS
RERG	85004	broad.mit.edu	37	12	15262351	15262351	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15262351A>C	uc001rcs.2	-	4	433	c.293T>G	c.(292-294)CTT>CGT	p.L98R	RERG_uc001rct.2_Missense_Mutation_p.L98R|RERG_uc010shu.1_Missense_Mutation_p.L79R	NM_032918	NP_116307	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	98					negative regulation of cell growth|negative regulation of cell proliferation|response to hormone stimulus|small GTPase mediated signal transduction	cytosol|membrane|nucleus	estrogen receptor binding|GDP binding|GTP binding|GTPase activity			lung(1)	1						GATGTTCTTAAGTGGCAGCAC	0.488													129	332	---	---	---	---	PASS
SOX5	6660	broad.mit.edu	37	12	23818447	23818447	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23818447G>A	uc001rfw.2	-	7	964	c.862C>T	c.(862-864)CGG>TGG	p.R288W	SOX5_uc001rfx.2_Missense_Mutation_p.R275W|SOX5_uc001rfy.2_Missense_Mutation_p.R275W|SOX5_uc010siv.1_Missense_Mutation_p.R275W|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Missense_Mutation_p.R240W	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	288					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						GCCAGTGTCCGTTGATCAGGA	0.498													82	135	---	---	---	---	PASS
OR6C6	283365	broad.mit.edu	37	12	55688731	55688731	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55688731C>T	uc010sph.1	-	1	286	c.286G>A	c.(286-288)GCA>ACA	p.A96T		NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C,	96	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|skin(1)	2						AATTGAGTTGCACAATTATTA	0.373													22	40	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56647514	56647514	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56647514A>T	uc001skm.3	-	9	1067	c.977T>A	c.(976-978)ATC>AAC	p.I326N		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	326	ANK 10.						protein binding			ovary(2)	2						ACCATTCTGGATGAGGATCTG	0.498													25	41	---	---	---	---	PASS
BTBD11	121551	broad.mit.edu	37	12	107713793	107713793	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107713793C>T	uc001tmk.1	+	1	1597	c.1076C>T	c.(1075-1077)TCG>TTG	p.S359L	BTBD11_uc009zut.1_Missense_Mutation_p.S359L|BTBD11_uc001tmj.2_Missense_Mutation_p.S359L	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	359						integral to membrane	DNA binding			skin(2)|ovary(1)	3						AACAACGACTCGGAGATCTGG	0.512													9	31	---	---	---	---	PASS
DTX1	1840	broad.mit.edu	37	12	113515329	113515329	+	Silent	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113515329C>A	uc001tuk.1	+	2	696	c.360C>A	c.(358-360)GCC>GCA	p.A120A		NM_004416	NP_004407	Q86Y01	DTX1_HUMAN	deltex homolog 1	120	WWE 2.				negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4						CATGGACGGCCTACGATATGG	0.627													8	67	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133351815	133351815	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133351815T>A	uc001ukz.1	-	22	4614	c.4055A>T	c.(4054-4056)AAA>ATA	p.K1352I	GOLGA3_uc001ula.1_Missense_Mutation_p.K1352I	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	1352	Potential.|Gln-rich.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CTCCGACACTTTTGCCTGGAG	0.532													40	63	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19415644	19415644	+	RNA	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19415644C>A	uc010tcj.1	-	1		c.30466G>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						aaaaaaaaaacccaaacaaaa	0.169													5	44	---	---	---	---	PASS
LOC647288	647288	broad.mit.edu	37	13	75814354	75814354	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75814354C>G	uc010ths.1	-	1	164	c.123G>C	c.(121-123)TGG>TGC	p.W41C		NR_027466				Homo sapiens mRNA; cDNA DKFZp434F0327 (from clone DKFZp434F0327).												0						CCACCAGTTCCCATGGAAAAC	0.488													3	63	---	---	---	---	PASS
SLITRK6	84189	broad.mit.edu	37	13	86368002	86368002	+	3'UTR	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86368002G>A	uc001vll.1	-	2					SLITRK6_uc010afe.1_3'UTR	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor							integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TTTCCCCATAGTTTACTGCTG	0.383													16	23	---	---	---	---	PASS
ATP11A	23250	broad.mit.edu	37	13	113508719	113508719	+	Silent	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113508719G>A	uc001vsi.3	+	19	2206	c.2118G>A	c.(2116-2118)AGG>AGA	p.R706R	ATP11A_uc001vsj.3_Silent_p.R706R|ATP11A_uc001vsm.1_Silent_p.R582R|ATP11A_uc010ago.2_RNA	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	706	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TCTTCCGCAGGAACACGCAGC	0.637													29	46	---	---	---	---	PASS
ADAM21	8747	broad.mit.edu	37	14	70924412	70924412	+	Missense_Mutation	SNP	C	T	T	rs149756061		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70924412C>T	uc001xmd.2	+	1	196	c.196C>T	c.(196-198)CGG>TGG	p.R66W		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	66					proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CTATAGTCTGCGGTTTGGGGG	0.537													6	181	---	---	---	---	PASS
C14orf79	122616	broad.mit.edu	37	14	105461138	105461138	+	3'UTR	SNP	T	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105461138T>A	uc001ypy.1	+	5					C14orf79_uc001ypz.1_RNA|C14orf79_uc010tym.1_RNA	NM_174891	NP_777551	Q96F83	CN079_HUMAN	hypothetical protein LOC122616												0		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00326)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0181)			TTTTTCATTTTCTTCCTGGCT	0.473													23	29	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107099378	107099378	+	RNA	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107099378G>A	uc010tyt.1	-	96		c.4385C>T								Parts of antibodies, mostly variable regions.												0						AGAGTCTCAGGGACCCCCCAG	0.567													3	68	---	---	---	---	PASS
BBS4	585	broad.mit.edu	37	15	73029249	73029249	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73029249T>G	uc002avb.2	+	15	1438	c.1395T>G	c.(1393-1395)AAT>AAG	p.N465K	BBS4_uc010ukv.1_Missense_Mutation_p.N453K|BBS4_uc002avc.2_Missense_Mutation_p.N293K|BBS4_uc002avd.2_Missense_Mutation_p.N473K	NM_033028	NP_149017	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4	465	Required for localization to centrosomes.				adult behavior|brain morphogenesis|cell cycle cytokinesis|centrosome organization|cerebral cortex development|convergent extension involved in gastrulation|dendrite development|fat cell differentiation|heart looping|hippocampus development|intracellular transport|maintenance of protein location in nucleus|melanosome transport|microtubule anchoring at centrosome|neural tube closure|nonmotile primary cilium assembly|photoreceptor cell maintenance|pigment granule aggregation in cell center|positive regulation of flagellum assembly|regulation of cilium beat frequency involved in ciliary motility|regulation of cytokinesis|regulation of lipid metabolic process|retina homeostasis|retinal rod cell development|sensory perception of smell|sensory processing|spermatid development|striatum development	BBSome|centriolar satellite|centriole|cilium membrane|microtubule basal body|motile cilium|nonmotile primary cilium|nucleus|pericentriolar material	alpha-tubulin binding|beta-tubulin binding|dynactin binding|microtubule motor activity				0						TGGGCTCTAATCAAGCTCTAG	0.527									Bardet-Biedl_syndrome				76	188	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83349316	83349316	+	Silent	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83349316C>T	uc010uoh.1	-	8	1140	c.963G>A	c.(961-963)GTG>GTA	p.V321V	AP3B2_uc010uoi.1_Silent_p.V321V|AP3B2_uc010uoj.1_Silent_p.V289V|AP3B2_uc010uog.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	321					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			CCACCGCCATCACCACCGCGG	0.701													9	8	---	---	---	---	PASS
AXIN1	8312	broad.mit.edu	37	16	397045	397045	+	5'UTR	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:397045G>A	uc002cgp.1	-	2					AXIN1_uc002cgq.1_5'UTR	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a						activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CTGCGTCAAGGAACAATGAGC	0.493													29	47	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57255221	57255221	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57255221G>C	uc002elb.2	+	10	1333	c.1055G>C	c.(1054-1056)TGC>TCC	p.C352S	RSPRY1_uc002elc.2_Missense_Mutation_p.C352S|RSPRY1_uc002eld.2_Missense_Mutation_p.C352S	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	352	B30.2/SPRY.					extracellular region	zinc ion binding			ovary(1)	1						AGTGTGCGTTGCACCTTTTGT	0.488													65	116	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57255223	57255223	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57255223A>T	uc002elb.2	+	10	1335	c.1057A>T	c.(1057-1059)ACC>TCC	p.T353S	RSPRY1_uc002elc.2_Missense_Mutation_p.T353S|RSPRY1_uc002eld.2_Missense_Mutation_p.T353S	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	353	B30.2/SPRY.					extracellular region	zinc ion binding			ovary(1)	1						TGTGCGTTGCACCTTTTGTGT	0.483													65	117	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71683884	71683884	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71683884A>C	uc002fax.2	-	18	2887	c.2881T>G	c.(2881-2883)TGG>GGG	p.W961G	PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Missense_Mutation_p.W894G	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	961	PP2C-like.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						GGGAGGATCCAAGGGTAGAGG	0.493													22	54	---	---	---	---	PASS
SEZ6	124925	broad.mit.edu	37	17	27284413	27284413	+	Missense_Mutation	SNP	C	T	T	rs117736100	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27284413C>T	uc002hdp.2	-	12	2641	c.2447G>A	c.(2446-2448)CGC>CAC	p.R816H	SEZ6_uc010crx.1_Missense_Mutation_p.R11H|SEZ6_uc002hdm.2_RNA|SEZ6_uc010cry.1_Missense_Mutation_p.R816H|SEZ6_uc002hdq.1_Missense_Mutation_p.R691H	NM_178860	NP_849191	Q53EL9	SEZ6_HUMAN	seizure related 6 homolog isoform 1	816	Extracellular (Potential).|Sushi 4.					integral to membrane|plasma membrane				large_intestine(1)|central_nervous_system(1)	2	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			GCCAGCCTGGCGATCATGGCA	0.547													72	150	---	---	---	---	PASS
KRTAP4-11	653240	broad.mit.edu	37	17	39274150	39274150	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39274150T>A	uc002hvz.2	-	1	457	c.418A>T	c.(418-420)AGC>TGC	p.S140C		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	140	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ctggagatgctgcagctgggg	0.129													3	26	---	---	---	---	PASS
MED16	10025	broad.mit.edu	37	19	884992	884992	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:884992G>A	uc002lqd.1	-	6	1047	c.896C>T	c.(895-897)TCC>TTC	p.S299F	MED16_uc010drw.1_Missense_Mutation_p.S124F|MED16_uc002lqe.2_Missense_Mutation_p.S288F|MED16_uc002lqf.2_Missense_Mutation_p.S288F|MED16_uc010xfv.1_Intron|MED16_uc010xfw.1_Missense_Mutation_p.S288F|MED16_uc010xfx.1_Missense_Mutation_p.S144F|MED16_uc010xfy.1_Intron	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	299	WD 3.				androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCTGGCTGGACGCGCACAA	0.677													5	13	---	---	---	---	PASS
EMR4P	326342	broad.mit.edu	37	19	6990855	6990855	+	5'UTR	SNP	A	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6990855A>C	uc010xjk.1	-	1						NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0						GGACGTGGTCAGAATGCCTGG	0.473													32	71	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10246885	10246885	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10246885T>C	uc002mng.2	-	37	4700	c.4520A>G	c.(4519-4521)CAC>CGC	p.H1507R	DNMT1_uc002mne.2_RNA|DNMT1_uc002mnf.2_Missense_Mutation_p.H431R|DNMT1_uc010xlc.1_Missense_Mutation_p.H1523R|DNMT1_uc002mnh.2_Missense_Mutation_p.H1402R|DNMT1_uc010xld.1_Missense_Mutation_p.H1510R	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	1507	Catalytic.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	CCAGTGGTTGTGCCGGTTCCC	0.642													4	44	---	---	---	---	PASS
IL27RA	9466	broad.mit.edu	37	19	14157046	14157046	+	Silent	SNP	C	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14157046C>G	uc002mxx.2	+	7	1272	c.849C>G	c.(847-849)ACC>ACG	p.T283T		NM_004843	NP_004834	Q6UWB1	I27RA_HUMAN	class I cytokine receptor precursor	283	Extracellular (Potential).				cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity				0						AAGGAATTACCTGCTGCTGCT	0.582													83	209	---	---	---	---	PASS
KIAA1683	80726	broad.mit.edu	37	19	18377009	18377009	+	Silent	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18377009C>T	uc002nin.2	-	3	1557	c.1341G>A	c.(1339-1341)GGG>GGA	p.G447G	KIAA1683_uc010ebn.2_Silent_p.G447G|KIAA1683_uc010xqe.1_Silent_p.G401G	NM_025249	NP_079525	Q9H0B3	K1683_HUMAN	KIAA1683 isoform b	447						mitochondrion				ovary(2)	2						CCATCGCAGGCCCCGGGCATA	0.587													43	88	---	---	---	---	PASS
CEACAM5	1048	broad.mit.edu	37	19	42213711	42213711	+	Silent	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42213711C>A	uc002ork.2	+	2	298	c.177C>A	c.(175-177)CCC>CCA	p.P59P	CEACAM5_uc010ehz.1_Silent_p.P59P|CEACAM5_uc002orj.1_Silent_p.P59P|CEACAM5_uc002orl.2_Silent_p.P59P	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	59	Ig-like 1.					anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		ACAATCTGCCCCAGCATCTTT	0.507													47	100	---	---	---	---	PASS
GPR4	2828	broad.mit.edu	37	19	46094945	46094945	+	Silent	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46094945G>A	uc002pcm.2	-	2	1125	c.180C>T	c.(178-180)AGC>AGT	p.S60S	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	60	Helical; Name=2; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GGTCGGCGATGCTGAGGTTCA	0.642													31	63	---	---	---	---	PASS
SIGLEC12	89858	broad.mit.edu	37	19	52004993	52004993	+	5'UTR	SNP	G	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52004993G>T	uc002pwx.1	-	1					SIGLEC12_uc002pww.1_5'Flank|SIGLEC12_uc010eoy.1_5'UTR	NM_053003	NP_443729	Q96PQ1	SIG12_HUMAN	sialic acid binding immunoglobulin-like						cell adhesion	integral to membrane	sugar binding			ovary(3)|skin(2)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		agcaTGTGTCGGGTTGGAGGT	0.443													3	27	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56363605	56363605	+	Silent	SNP	A	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56363605A>G	uc002qmd.3	+	2	581	c.159A>G	c.(157-159)GAA>GAG	p.E53E		NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	53	DAPIN.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CATCCCGGGAAGAACTTGCAA	0.403													39	72	---	---	---	---	PASS
GGT7	2686	broad.mit.edu	37	20	33447323	33447323	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33447323C>T	uc002xay.2	-	7	980	c.937G>A	c.(937-939)GTG>ATG	p.V313M	GGT7_uc002xaz.1_Missense_Mutation_p.V330M|GGT7_uc002xba.1_3'UTR	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	313	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1						ACATCCAGCACCTCAGCCAGG	0.657													14	17	---	---	---	---	PASS
NFS1	9054	broad.mit.edu	37	20	34257346	34257346	+	3'UTR	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34257346G>A	uc002xdw.1	-	13					CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|NFS1_uc002xdt.1_3'UTR|NFS1_uc002xdu.1_3'UTR|NFS1_uc002xdv.1_RNA|NFS1_uc010zvk.1_3'UTR|NFS1_uc010zvl.1_3'UTR	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor						cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	AGAAGAAATGGGGAGTGCTCC	0.468													5	4	---	---	---	---	PASS
C2CD2	25966	broad.mit.edu	37	21	43327923	43327923	+	Intron	SNP	C	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43327923C>A	uc002yzw.2	-						C2CD2_uc002yzt.2_5'UTR|C2CD2_uc002yzu.2_Intron|C2CD2_uc002yzv.2_Intron|C2CD2_uc002yzx.1_Intron	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1						GCAAGGGGTGCCGCTGATGTT	0.612													18	35	---	---	---	---	PASS
RANGAP1	5905	broad.mit.edu	37	22	41677171	41677171	+	5'UTR	SNP	A	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41677171A>T	uc003azs.2	-	1					RANGAP1_uc003azt.2_Intron|RANGAP1_uc003azu.2_Intron|RANGAP1_uc011aoz.1_5'Flank	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1						mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						CCATCTCAGGAGTCTGACCCT	0.532													3	1	---	---	---	---	PASS
LOC347376	347376	broad.mit.edu	37	X	50648823	50648823	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50648823G>A	uc010njs.2	+	1	392	c.386G>A	c.(385-387)CGC>CAC	p.R129H		NR_003933				RecName: Full=Histone H3; Flags: Fragment;												0						CAGCTAGCACGCCACATACGT	0.408													4	3	---	---	---	---	PASS
IL22RA1	58985	broad.mit.edu	37	1	24464006	24464007	+	Intron	INS	-	T	T	rs71575790		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24464006_24464007insT	uc001biq.1	-						IL22RA1_uc010oeg.1_5'Flank|IL22RA1_uc009vrb.1_Intron|IL22RA1_uc010oeh.1_Intron	NM_021258	NP_067081	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1 precursor							integral to membrane	interferon receptor activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		tccttcctttcttttttttttt	0.000													3	3	---	---	---	---	
S100A10	6281	broad.mit.edu	37	1	151955955	151955955	+	Intron	DEL	T	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151955955delT	uc001ezl.2	-							NM_002966	NP_002957	P60903	S10AA_HUMAN	S100 calcium binding protein A10						signal transduction		calcium ion binding|receptor binding				0	Melanoma(130;0.0648)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TCTAAATGTATTTTTTTTTTT	0.333													5	3	---	---	---	---	
BAT2L2	23215	broad.mit.edu	37	1	171519129	171519129	+	Intron	DEL	T	-	-	rs67131565		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171519129delT	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2								protein C-terminus binding				0						CTTTGGCTAGTTTTTTTTTTT	0.299													2	5	---	---	---	---	
CNST	163882	broad.mit.edu	37	1	246805434	246805435	+	Intron	DEL	GG	-	-	rs12748305	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246805434_246805435delGG	uc001ibp.2	+						CNST_uc001ibo.3_Intron	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0						CAAAGGATCTGGtttttttttt	0.322													4	3	---	---	---	---	
FLJ40330	645784	broad.mit.edu	37	2	89083951	89083951	+	Intron	DEL	A	-	-	rs111608027		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89083951delA	uc010fhf.2	+						FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						CTTTTTTTTCAGTGTATTTCT	0.348													8	4	---	---	---	---	
SCN2A	6326	broad.mit.edu	37	2	166243113	166243113	+	Intron	DEL	T	-	-	rs112640887		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166243113delT	uc002udc.2	+						SCN2A_uc002udd.2_Intron|SCN2A_uc002ude.2_Intron	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha						myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	ttgcaaggaattttttttttt	0.080													4	2	---	---	---	---	
NUP35	129401	broad.mit.edu	37	2	183993328	183993328	+	Intron	DEL	A	-	-	rs71407008		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183993328delA	uc002upf.2	+						NUP35_uc010zfs.1_Intron|NUP35_uc010zft.1_Intron|NUP35_uc002upg.2_Intron	NM_138285	NP_612142	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	intermediate filament cytoskeleton|nuclear membrane|nuclear pore|plasma membrane					0						ctgatgagctaaaaaaaaaaa	0.000													5	4	---	---	---	---	
HECW2	57520	broad.mit.edu	37	2	197187116	197187116	+	Intron	DEL	A	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197187116delA	uc002utm.1	-						HECW2_uc002utl.1_Intron	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						TATCAGTATGAAAAGTCCTAG	0.313													28	18	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52692236	52692236	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52692236delA	uc003des.2	-	5	636	c.624delT	c.(622-624)TTTfs	p.F208fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.F208fs|PBRM1_uc003der.2_Frame_Shift_Del_p.F208fs|PBRM1_uc003det.2_Frame_Shift_Del_p.F208fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.F208fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.F208fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.F208fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.F208fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.F208fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.F106fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	208	Bromo 2.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GCAGTTTCTGAAAAAGTTCGC	0.378			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								45	39	---	---	---	---	
CASR	846	broad.mit.edu	37	3	122000728	122000729	+	Intron	DEL	TG	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122000728_122000729delTG	uc003eev.3	+						CASR_uc003eew.3_Intron	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor						anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	tgcatgcacatgtgtgtgtgtg	0.302													6	3	---	---	---	---	
DNAJC13	23317	broad.mit.edu	37	3	132193659	132193659	+	Intron	DEL	C	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132193659delC	uc003eor.2	+							NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2						AAAATCTATTCCCCCCCCCCC	0.199													4	2	---	---	---	---	
BOD1L	259282	broad.mit.edu	37	4	13582681	13582681	+	Intron	DEL	A	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13582681delA	uc003gmz.1	-							NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division								DNA binding			ovary(5)|breast(1)	6						GTCGTCTTCTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39918635	39918636	+	Intron	INS	-	AA	AA	rs10001599	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39918635_39918636insAA	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						ACaaaaaaattaaaaaaaaaaa	0.307													4	2	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48608293	48608294	+	Intron	INS	-	A	A	rs78643963		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48608293_48608294insA	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						ctgtctcaaggaaaaaaaaaaa	0.109													4	2	---	---	---	---	
ADAMTS3	9508	broad.mit.edu	37	4	73174951	73174951	+	Intron	DEL	T	-	-	rs76753805		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73174951delT	uc003hgk.1	-						ADAMTS3_uc003hgl.2_Intron	NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAGTGATTTCTTTTTTTTTTT	0.254													4	2	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85626744	85626746	+	Intron	DEL	GAT	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85626744_85626746delGAT	uc003hpd.2	-						WDFY3_uc003hpe.1_Intron	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGCTGTTGTGGATGATGATGATT	0.360													45	20	---	---	---	---	
LRAT	9227	broad.mit.edu	37	4	155666158	155666164	+	Intron	DEL	CTTTTTT	-	-	rs66898606		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155666158_155666164delCTTTTTT	uc003iom.1	+						uc003iol.2_Intron|LRAT_uc003ion.1_Intron	NM_004744	NP_004735	O95237	LRAT_HUMAN	lecithin retinol acyltransferase						response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity			central_nervous_system(1)	1	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	tttctttttcctttttttttttttttt	0.232													5	3	---	---	---	---	
DDX4	54514	broad.mit.edu	37	5	55055879	55055879	+	Intron	DEL	T	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55055879delT	uc003jqg.3	+						DDX4_uc010ivz.2_Intron|DDX4_uc003jqh.3_Intron	NM_001136034	NP_001129506	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform						multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				CATGTAGCCATTTTTTTTTTT	0.318													12	6	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90489788	90489788	+	Intron	DEL	A	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90489788delA	uc003pnn.1	-						MDN1_uc003pno.1_Intron	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		acttcgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
HIBADH	11112	broad.mit.edu	37	7	27672200	27672202	+	Intron	DEL	AAA	-	-	rs143191859		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27672200_27672202delAAA	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_Intron	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	GCAAATGACCAAAAAAAAAAAAA	0.315													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61968770	61968770	+	IGR	DEL	G	-	-	rs61713499		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61968770delG								None (None upstream) : LOC643955 (782902 downstream)																							ttgaaacactgtttttgcgga	0.000													8	4	---	---	---	---	
KIAA1324L	222223	broad.mit.edu	37	7	86536850	86536850	+	Intron	DEL	A	-	-	rs72283133		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86536850delA	uc011kha.1	-						KIAA1324L_uc003uif.1_Intron|KIAA1324L_uc011kgz.1_Intron|KIAA1324L_uc003uie.2_Intron	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					CATTCCCTACAAAAAAAAAAA	0.323													5	4	---	---	---	---	
HNF4G	3174	broad.mit.edu	37	8	76463542	76463542	+	Intron	DEL	A	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76463542delA	uc003yaq.2	+						HNF4G_uc003yar.2_Intron	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			TTTTTTACTTAAAAAAAAAAC	0.303													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	127957480	127957481	+	IGR	INS	-	A	A	rs79479616		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127957480_127957481insA								PPP6C (5262 upstream) : RABEPK (5336 downstream)																							gcgtctcaaataaaaaaaaaaa	0.228													4	4	---	---	---	---	
DNM1	1759	broad.mit.edu	37	9	130986798	130986799	+	Intron	INS	-	C	C			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130986798_130986799insC	uc011mau.1	+						DNM1_uc010mxr.2_Intron|DNM1_uc011mat.1_Intron	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1						receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2						GGGGAGGCAGGCCACCACTGAA	0.673													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	96665807	96665808	+	IGR	INS	-	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96665807_96665808insA								CYP2C19 (53137 upstream) : CYP2C9 (32607 downstream)																							AGGACATGAGCAAATCCTTAAC	0.297													26	13	---	---	---	---	
VAX1	11023	broad.mit.edu	37	10	118897631	118897632	+	5'UTR	DEL	GC	-	-	rs71677026		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897631_118897632delGC	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		AGGGGGGGGGGCGGAGAAGGAA	0.441													7	8	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128836111	128836112	+	Intron	DEL	TC	-	-	rs145303636	by1000genomes	TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128836111_128836112delTC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ACTTTTTGGGTCtttttttttt	0.396													4	2	---	---	---	---	
KBTBD4	55709	broad.mit.edu	37	11	47597411	47597412	+	Intron	INS	-	T	T	rs35653820		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47597411_47597412insT	uc001nfx.2	-						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Intron|KBTBD4_uc001nfz.2_Intron|KBTBD4_uc001nfy.2_Intron	NM_016506	NP_057590	Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4											ovary(1)|central_nervous_system(1)	2						CCTAAAATTGCttttttttttt	0.173													4	3	---	---	---	---	
SLC22A11	55867	broad.mit.edu	37	11	64323893	64323893	+	Intron	DEL	C	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64323893delC	uc001oai.2	+						SLC22A11_uc001oah.1_Intron|SLC22A11_uc001oaj.2_Intron|SLC22A11_uc009ypq.2_Intron	NM_018484	NP_060954	Q9NSA0	S22AB_HUMAN	solute carrier family 22 member 11						urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)	CCACTCGAGTCCCGTCACCTT	0.642													19	12	---	---	---	---	
GUCY1A2	2977	broad.mit.edu	37	11	106694626	106694627	+	Intron	INS	-	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106694626_106694627insT	uc001pjg.1	-						GUCY1A2_uc010rvo.1_Intron|GUCY1A2_uc009yxn.1_Intron	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		cctttgcccactttttttttct	0.059													4	2	---	---	---	---	
ACSM4	341392	broad.mit.edu	37	12	7476751	7476752	+	Intron	INS	-	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7476751_7476752insA	uc001qsx.1	+							NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						gactctgtctcaaaaaaaaaaa	0.168													4	5	---	---	---	---	
OS9	10956	broad.mit.edu	37	12	58110063	58110063	+	Intron	DEL	G	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58110063delG	uc001spj.2	+						OS9_uc010srx.1_Intron|OS9_uc001spk.2_Intron|OS9_uc001spl.2_Intron|OS9_uc001spm.2_Intron|OS9_uc001spn.2_Intron|OS9_uc010sry.1_Intron|OS9_uc010srz.1_Intron	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum						ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CTGGTGGGGTGGGGGGGGGTG	0.552													4	4	---	---	---	---	
FLT1	2321	broad.mit.edu	37	13	28932006	28932006	+	Intron	DEL	T	-	-	rs71816101		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28932006delT	uc001usb.3	-							NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	ttttctttccttttttttttt	0.418													4	2	---	---	---	---	
UCHL3	7347	broad.mit.edu	37	13	76123902	76123916	+	5'Flank	DEL	GGCGGCGGCGGCGAA	-	-	rs67763278		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76123902_76123916delGGCGGCGGCGGCGAA	uc001vjq.2	+							NM_006002	NP_005993	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3						ubiquitin-dependent protein catabolic process	cytoplasm	cysteine-type peptidase activity|ubiquitin binding|ubiquitin thiolesterase activity				0				GBM - Glioblastoma multiforme(99;0.0125)		GggcggaagcggcggcggcggcgaaggcggcggcT	0.581											OREG0022446	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	7	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111164629	111164630	+	3'UTR	DEL	AA	-	-	rs5806862		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111164629_111164630delAA	uc001vqx.2	+	48						NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TTTTTTTCTTAAAAAAAAAAAA	0.485													3	5	---	---	---	---	
HHIPL1	84439	broad.mit.edu	37	14	100123122	100123123	+	Intron	DEL	AG	-	-	rs72341366		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100123122_100123123delAG	uc010avs.2	+						HHIPL1_uc001ygl.1_Intron	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)				caaaaagaaaagaaaagaaaga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23265335	23265336	+	IGR	INS	-	G	G			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23265335_23265336insG								GOLGA9P (2592 upstream) : HERC2P2 (16929 downstream)																							AGGCAGGAAGAGGGGGCTCCCA	0.639													4	3	---	---	---	---	
EIF3J	8669	broad.mit.edu	37	15	44829349	44829350	+	5'UTR	INS	-	CT	CT			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44829349_44829350insCT	uc001ztv.2	+	1					uc001ztu.2_5'Flank|EIF3J_uc010ueg.1_5'UTR|EIF3J_uc001ztw.2_5'UTR	NM_003758	NP_003749	O75822	EIF3J_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity				0		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		CGTGCTAACTCCTCGCTAGCTC	0.584													23	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46429330	46429330	+	IGR	DEL	A	-	-	rs140295046		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46429330delA								None (None upstream) : ANKRD26P1 (73919 downstream)																							atctaatagcaacgaatggaa	0.025													4	2	---	---	---	---	
CIAPIN1	57019	broad.mit.edu	37	16	57464912	57464912	+	Intron	DEL	T	-	-			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57464912delT	uc002ell.1	-						CIAPIN1_uc002elk.1_Intron|CIAPIN1_uc002elm.1_Intron|CIAPIN1_uc002eln.1_Intron|CIAPIN1_uc010cda.1_Intron|CIAPIN1_uc002elo.1_Intron	NM_020313	NP_064709	Q6FI81	CPIN1_HUMAN	cytokine induced apoptosis inhibitor 1						anti-apoptosis|apoptosis	cytoplasm|nucleolus					0						gcctggctaattttttttttt	0.085													6	4	---	---	---	---	
ZNF286B	729288	broad.mit.edu	37	17	18581225	18581227	+	Intron	DEL	AAA	-	-	rs1071712		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18581225_18581227delAAA	uc010vyd.1	-							NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTGGAAAAGCaaaaaaaaaaaaa	0.315													3	3	---	---	---	---	
PSMB3	5691	broad.mit.edu	37	17	36909737	36909737	+	Intron	DEL	T	-	-	rs35484180		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36909737delT	uc002hqr.2	+							NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0						CTTCCCtttcttttttttttt	0.264													4	2	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78516455	78516456	+	5'Flank	INS	-	A	A	rs112348092		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78516455_78516456insA	uc002jyt.1	+						RPTOR_uc002jys.2_5'Flank|RPTOR_uc010wuf.1_5'Flank|RPTOR_uc010wug.1_5'Flank|RPTOR_uc002jyr.1_5'Flank	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						GTAAAAACTGCAAAAAAAaaaa	0.228													8	4	---	---	---	---	
REXO1	57455	broad.mit.edu	37	19	1819235	1819236	+	Intron	DEL	CT	-	-	rs113598561		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1819235_1819236delCT	uc002lua.3	-						REXO1_uc010dsq.2_Intron|REXO1_uc010xgs.1_Intron|MIR1909_hsa-mir-1909|MI0008330_5'Flank|REXO1_uc010dsp.1_Intron|uc002lub.1_5'Flank	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3							nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGCCTCAACTCCCCCTTTCT	0.673													6	6	---	---	---	---	
KLC3	147700	broad.mit.edu	37	19	45850598	45850599	+	Intron	INS	-	A	A			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45850598_45850599insA	uc002pbf.1	+						KLC3_uc002pbe.2_3'UTR|KLC3_uc010ejy.1_Intron|KLC3_uc002pbg.1_Intron	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		aactccgtctcaaaaaaaaaaa	0.233													9	4	---	---	---	---	
NLRP12	91662	broad.mit.edu	37	19	54304349	54304349	+	Intron	DEL	A	-	-	rs35326804		TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54304349delA	uc002qch.3	-						NLRP12_uc010eqw.2_Intron|NLRP12_uc002qci.3_Intron|NLRP12_uc002qcj.3_Intron|NLRP12_uc002qck.3_Intron|NLRP12_uc010eqx.2_Intron	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform						negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		tgggagtctCAAAAAAAAAAA	0.244													4	3	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3313105	3313106	+	Intron	INS	-	T	T			TCGA-CZ-5986-01A-11D-1669-08	TCGA-CZ-5986-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3313105_3313106insT	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron|C20orf194_uc010gay.1_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						AATAAAttttcttttttttttt	0.139													3	3	---	---	---	---	
