Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16892547	16892547	+	Intron	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892547G>A	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CGAATTGGCCGGGTGACACAC	0.368													4	39	---	---	---	---	PASS
PLA2G2E	30814	broad.mit.edu	37	1	20249215	20249215	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20249215C>G	uc001bct.1	-	2	132	c.74G>C	c.(73-75)GGG>GCG	p.G25A		NM_014589	NP_055404	Q9NZK7	PA2GE_HUMAN	phospholipase A2, group IIE precursor	25					inflammatory response|lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|phospholipase A2 activity				0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|GBM - Glioblastoma multiforme(114;0.000146)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GATCATCACCCCAAACTGAAC	0.522													18	125	---	---	---	---	PASS
AGL	178	broad.mit.edu	37	1	100346221	100346221	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100346221G>C	uc001dsi.1	+	14	2169	c.1769G>C	c.(1768-1770)GGC>GCC	p.G590A	AGL_uc001dsj.1_Missense_Mutation_p.G590A|AGL_uc001dsk.1_Missense_Mutation_p.G590A|AGL_uc001dsl.1_Missense_Mutation_p.G590A|AGL_uc001dsm.1_Missense_Mutation_p.G574A|AGL_uc001dsn.1_Missense_Mutation_p.G573A	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	590	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		CATGAAGAGGGCAGATTAGTT	0.398													46	158	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214557127	214557127	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214557127G>C	uc001hkk.1	-	13	2342	c.2071C>G	c.(2071-2073)CAG>GAG	p.Q691E	PTPN14_uc010pty.1_Missense_Mutation_p.Q592E	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	691					lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TGGTGATACTGAGGGAGCTGG	0.632													18	73	---	---	---	---	PASS
RAB4A	5867	broad.mit.edu	37	1	229434748	229434748	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229434748C>T	uc001hth.2	+	6	678	c.470C>T	c.(469-471)GCG>GTG	p.A157V	RAB4A_uc001hti.2_RNA|RAB4A_uc001htj.2_RNA	NM_004578	NP_004569	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	152	GTP.						GDP binding|GTP binding|GTPase activity			ovary(1)	1	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				GAAACAAGTGCGCTCACAGGG	0.353													16	111	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242451818	242451818	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242451818T>C	uc001hzn.1	-	3	468	c.341A>G	c.(340-342)GAA>GGA	p.E114G	PLD5_uc001hzl.3_Missense_Mutation_p.E52G|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Missense_Mutation_p.E22G			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	114						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AGGAATATTTTCCACCAGGGC	0.343													4	38	---	---	---	---	PASS
TPO	7173	broad.mit.edu	37	2	1491581	1491581	+	Intron	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1491581G>T	uc002qww.2	+						TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Intron|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Intron|TPO_uc002qwy.1_Intron|TPO_uc002qwz.2_Intron	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a						cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CCTTGTGCATGGTATTTTCCA	0.383													14	80	---	---	---	---	PASS
HS1BP3	64342	broad.mit.edu	37	2	20840770	20840770	+	Silent	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20840770G>A	uc002rdw.1	-	3	410	c.369C>T	c.(367-369)GCC>GCT	p.A123A	HS1BP3_uc002rdx.2_Silent_p.A123A|HS1BP3_uc002rdy.2_Silent_p.A123A	NM_022460	NP_071905	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	123	PX.				cell communication		phosphatidylinositol binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCCAACTCGGCATCCTTGG	0.617													47	266	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25965491	25965491	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25965491C>G	uc002rgs.2	-	12	3936	c.3715G>C	c.(3715-3717)GAG>CAG	p.E1239Q	ASXL2_uc002rgt.1_Missense_Mutation_p.E722Q	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1239					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGGTTTGCTCATTCAATGGT	0.438													9	78	---	---	---	---	PASS
SLC30A6	55676	broad.mit.edu	37	2	32396399	32396399	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32396399G>T	uc002roe.1	+	2	84	c.47G>T	c.(46-48)GGC>GTC	p.G16V	SLC30A6_uc002rof.1_Missense_Mutation_p.G16V|SLC30A6_uc010ymw.1_Intron|SLC30A6_uc010ezr.1_Missense_Mutation_p.G16V|SLC30A6_uc002rog.1_5'UTR|SLC30A6_uc010ezs.1_Intron|SLC30A6_uc002roh.1_5'UTR	NM_017964	NP_060434	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter),	16	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TCCTTTTTTGGCAAGTTGTTA	0.338													10	102	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33518261	33518261	+	Silent	SNP	A	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33518261A>T	uc002ros.2	+	20	3150	c.3150A>T	c.(3148-3150)GCA>GCT	p.A1050A	LTBP1_uc002rot.2_Silent_p.A724A|LTBP1_uc002rou.2_Silent_p.A723A|LTBP1_uc002rov.2_Silent_p.A670A|LTBP1_uc010ymz.1_Silent_p.A723A|LTBP1_uc010yna.1_Silent_p.A670A|LTBP1_uc010ynb.1_5'UTR	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1049	EGF-like 8; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ACGTCTGCGCAAATGGTGATT	0.428													13	65	---	---	---	---	PASS
DYNC2LI1	51626	broad.mit.edu	37	2	44031784	44031784	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44031784C>A	uc002rtk.2	+	11	902	c.806C>A	c.(805-807)TCT>TAT	p.S269Y	DYNC2LI1_uc002rtj.2_Missense_Mutation_p.S269Y|DYNC2LI1_uc002rtl.2_Missense_Mutation_p.S270Y|DYNC2LI1_uc010ynz.1_Missense_Mutation_p.S143Y	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1	269						apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				ATTTTAGGATCTCCTCCTGTT	0.368													20	101	---	---	---	---	PASS
DYNC2LI1	51626	broad.mit.edu	37	2	44031889	44031889	+	Intron	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44031889C>G	uc002rtk.2	+						DYNC2LI1_uc002rtj.2_Intron|DYNC2LI1_uc002rtl.2_Intron|DYNC2LI1_uc010ynz.1_Intron	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GTACATATTTCTAATTTTTTT	0.343													12	75	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55571645	55571645	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55571645T>A	uc002ryv.2	-	11	1889	c.1047A>T	c.(1045-1047)TTA>TTT	p.L349F	CCDC88A_uc010yoz.1_Missense_Mutation_p.L349F|CCDC88A_uc010ypa.1_Missense_Mutation_p.L349F|CCDC88A_uc010ypb.1_Missense_Mutation_p.L251F	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	349	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						TGTCTTCTTTTAATTCCTATA	0.274													8	33	---	---	---	---	PASS
ETAA1	54465	broad.mit.edu	37	2	67637061	67637061	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67637061G>C	uc002sdz.1	+	6	2811	c.2672G>C	c.(2671-2673)AGA>ACA	p.R891T		NM_019002	NP_061875	Q9NY74	ETAA1_HUMAN	ETAA16 protein	891						cytoplasm|nucleus				ovary(3)|large_intestine(1)	4						GAGAAAAATAGAAAGTGTTCT	0.338													26	162	---	---	---	---	PASS
ETAA1	54465	broad.mit.edu	37	2	67637099	67637099	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67637099G>C	uc002sdz.1	+	6	2849	c.2710G>C	c.(2710-2712)GAA>CAA	p.E904Q		NM_019002	NP_061875	Q9NY74	ETAA1_HUMAN	ETAA16 protein	904						cytoplasm|nucleus				ovary(3)|large_intestine(1)	4						AAAAAGACAAGAAGCACTGGT	0.353													31	155	---	---	---	---	PASS
INO80B	83444	broad.mit.edu	37	2	74684855	74684855	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74684855C>G	uc002slg.2	+	5	980	c.935C>G	c.(934-936)CCC>CGC	p.P312R	INO80B_uc002slf.1_3'UTR|INO80B_uc010yrr.1_Missense_Mutation_p.P284R|WBP1_uc002slh.1_Intron|INO80B_uc002sli.1_RNA|INO80B_uc010yrs.1_Missense_Mutation_p.P330R|WBP1_uc002slj.1_5'Flank|WBP1_uc002slk.1_5'Flank|WBP1_uc002sll.1_5'Flank	NM_031288	NP_112578	Q9C086	IN80B_HUMAN	high mobility group AT-hook 1-like 4	312	HIT-type.				DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|nucleolus	metal ion binding|protein binding			pancreas(1)	1						TGCTCTGTCCCCGGCTGTCCC	0.701													4	38	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79386542	79386542	+	5'UTR	SNP	A	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79386542A>C	uc002sod.1	-	1					REG3A_uc002soe.1_5'UTR|REG3A_uc002sof.1_5'UTR	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor						acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						AGTGTCTGCGACTTGAGGAGG	0.522													7	73	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90229383	90229383	+	Intron	SNP	T	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90229383T>A	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		TCCCCTAAGCTCTTCCTCTAT	0.498													15	75	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141816564	141816564	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141816564A>T	uc002tvj.1	-	9	2268	c.1296T>A	c.(1294-1296)GAT>GAA	p.D432E	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	432	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TATTGTAGTTATCAGAATTGG	0.289										TSP Lung(27;0.18)			20	86	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210889937	210889937	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210889937C>G	uc002vds.2	-	13	2663	c.2455G>C	c.(2455-2457)GAA>CAA	p.E819Q	C2orf67_uc002vdt.2_Missense_Mutation_p.E777Q	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	819										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		GAAAGATCTTCTATCTGGAAT	0.289													13	67	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	7721866	7721866	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7721866G>A	uc003bqm.2	+	9	2856	c.2582G>A	c.(2581-2583)CGA>CAA	p.R861Q	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.R861Q|GRM7_uc003bql.2_Missense_Mutation_p.R861Q|GRM7_uc003bqn.1_Missense_Mutation_p.R444Q	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	861	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	AAACGGAAGCGAAGCTTCAAG	0.517													5	98	---	---	---	---	PASS
HRH1	3269	broad.mit.edu	37	3	11301122	11301122	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11301122C>T	uc010hdr.2	+	2	741	c.399C>T	c.(397-399)CTC>CTT	p.L133L	HRH1_uc010hds.2_Silent_p.L133L|HRH1_uc010hdt.2_Silent_p.L133L|HRH1_uc003bwb.3_Silent_p.L133L	NM_001098213	NP_001091683	P35367	HRH1_HUMAN	histamine receptor H1	133	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|inflammatory response	cytoplasm|integral to plasma membrane|nucleus	histamine receptor activity			large_intestine(1)|ovary(1)	2					Aceprometazine(DB01615)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzquinamide(DB00767)|Bepotastine(DB04890)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlophedianol(DB04837)|Chlorpheniramine(DB01114)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clemastine(DB00283)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Maprotiline(DB00934)|Meclizine(DB00737)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nedocromil(DB00716)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Pemirolast(DB00885)|Phenindamine(DB01619)|Pheniramine(DB01620)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Terfenadine(DB00342)|Thiethylperazine(DB00372)|Trazodone(DB00656)|Trimeprazine(DB01246)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	AGCAGCCCCTCAGGTACCTTA	0.532													32	157	---	---	---	---	PASS
SEMA3G	56920	broad.mit.edu	37	3	52476317	52476317	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52476317C>A	uc003dea.1	-	4	343	c.343G>T	c.(343-345)GAG>TAG	p.E115*		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	115	Sema.				multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		TTGGCGCACTCTGTCTGCGGG	0.662													23	74	---	---	---	---	PASS
CLRN1	7401	broad.mit.edu	37	3	150659416	150659416	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150659416T>C	uc003eyk.1	-	2	677	c.386A>G	c.(385-387)GAA>GGA	p.E129G	CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Missense_Mutation_p.E53G|CLRN1_uc010hvj.1_RNA	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a	129					equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATGCAGAGTTTCAAAAGGTTT	0.408													12	70	---	---	---	---	PASS
C3orf70	285382	broad.mit.edu	37	3	184801052	184801052	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184801052C>A	uc003fpd.2	-	2	687	c.496G>T	c.(496-498)GAT>TAT	p.D166Y		NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382	166											0						ATTAAGGCATCGTGTGCAGAG	0.458													12	142	---	---	---	---	PASS
FETUB	26998	broad.mit.edu	37	3	186358473	186358473	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186358473G>T	uc010hyq.2	+	2	485	c.224G>T	c.(223-225)CGG>CTG	p.R75L	FETUB_uc011brz.1_Intron|FETUB_uc003fqn.2_Missense_Mutation_p.R75L|FETUB_uc003fqo.2_5'UTR|FETUB_uc010hyr.2_Missense_Mutation_p.R75L|FETUB_uc010hys.2_5'UTR|FETUB_uc003fqp.3_Missense_Mutation_p.R75L	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	75	Cystatin fetuin-B-type 1.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		GAATACAGACGGGCAAGTAGG	0.567													41	203	---	---	---	---	PASS
OSTalpha	200931	broad.mit.edu	37	3	195954570	195954570	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195954570C>T	uc003fwd.2	+	4	525	c.324C>T	c.(322-324)ATC>ATT	p.I108I	OSTalpha_uc010iac.1_5'UTR|OSTalpha_uc003fwe.2_5'Flank	NM_152672	NP_689885	Q86UW1	OSTA_HUMAN	organic solute transporter alpha	108	Helical; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(1)	1	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;8.83e-25)|all cancers(36;8.38e-23)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;7.51e-07)|Lung(62;1.06e-06)	GBM - Glioblastoma multiforme(46;0.00202)		GTCTCTGGATCCCTCGTTCCC	0.642													15	107	---	---	---	---	PASS
DSPP	1834	broad.mit.edu	37	4	88534399	88534399	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88534399G>A	uc003hqu.2	+	4	1181	c.1061G>A	c.(1060-1062)CGC>CAC	p.R354H		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	354					biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GAAAGCAAACGCGTAGAAAAT	0.418													21	37	---	---	---	---	PASS
LRRC14B	389257	broad.mit.edu	37	5	195433	195433	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:195433G>C	uc003jal.1	+	2	1538	c.1510G>C	c.(1510-1512)GAA>CAA	p.E504Q		NM_001080478	NP_001073947	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	504										skin(1)	1						AACTGCTCTAGAAAACTTCTC	0.478													5	100	---	---	---	---	PASS
C5orf22	55322	broad.mit.edu	37	5	31538616	31538616	+	Silent	SNP	G	A	A	rs145324653	byFrequency	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31538616G>A	uc003jhj.3	+	4	754	c.627G>A	c.(625-627)CAG>CAA	p.Q209Q	C5orf22_uc011cnw.1_RNA|C5orf22_uc003jhk.3_5'UTR	NM_018356	NP_060826	Q49AR2	CE022_HUMAN	hypothetical protein LOC55322	209										ovary(2)	2						CAGCAACACAGAGAAGTGACC	0.453													12	76	---	---	---	---	PASS
SLC45A2	51151	broad.mit.edu	37	5	33963987	33963987	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33963987G>A	uc003jid.2	-	3	789	c.697C>T	c.(697-699)CAT>TAT	p.H233Y	SLC45A2_uc003jie.2_Missense_Mutation_p.H233Y|SLC45A2_uc003jif.3_Intron|SLC45A2_uc011coe.1_Intron	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN	membrane-associated transporter protein isoform	233	Helical; Name=6; (Potential).				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						CTGCACAGATGAACAGTAAAA	0.488													24	142	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35957443	35957443	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35957443G>C	uc003jjv.1	-	5	1079	c.922C>G	c.(922-924)CAG>GAG	p.Q308E	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.Q308E|UGT3A1_uc011cor.1_Missense_Mutation_p.Q274E	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	308	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCCTGGGACTGATGGGTGTTC	0.488													8	96	---	---	---	---	PASS
DAB2	1601	broad.mit.edu	37	5	39383250	39383250	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39383250G>A	uc003jlx.2	-	10	1342	c.811C>T	c.(811-813)CAG>TAG	p.Q271*	DAB2_uc003jlw.2_Nonsense_Mutation_p.Q250*	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	271					cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)			AAGGATGCCTGAGGCGTTGGT	0.453													44	184	---	---	---	---	PASS
SEPP1	6414	broad.mit.edu	37	5	42807125	42807125	+	RNA	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42807125G>C	uc011cps.1	-	4		c.477C>G			SEPP1_uc011cpt.1_RNA|SEPP1_uc011cpu.1_RNA|SEPP1_uc011cpv.1_RNA|SEPP1_uc003jna.2_RNA			P49908	SEPP1_HUMAN	Homo sapiens cDNA FLJ37321 fis, clone BRAMY2018122.						response to oxidative stress	extracellular region	selenium binding				0						TATTTTAATCGAGAAGAGATT	0.308													11	118	---	---	---	---	PASS
PAM	5066	broad.mit.edu	37	5	102309957	102309957	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102309957G>C	uc003knw.2	+	14	1673	c.1300G>C	c.(1300-1302)GAT>CAT	p.D434H	PAM_uc003kns.2_Intron|PAM_uc003knt.2_Missense_Mutation_p.D434H|PAM_uc003knu.2_Missense_Mutation_p.D434H|PAM_uc003knv.2_Missense_Mutation_p.D434H|PAM_uc011cuz.1_Missense_Mutation_p.D337H|PAM_uc003knx.1_Intron|PAM_uc003kny.1_RNA	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	434	Peptidylglycine alpha-hydroxylating monooxygenase (By similarity).|Intragranular (Potential).				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	CCAAAAAAAGGATCTTGGTCG	0.418													20	87	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139905808	139905808	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139905808G>A	uc003lfs.1	+	26	4844	c.4720G>A	c.(4720-4722)GAT>AAT	p.D1574N	ANKHD1_uc003lfr.2_Missense_Mutation_p.D1574N|ANKHD1_uc003lfu.1_Missense_Mutation_p.D1054N|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.D313N|ANKHD1_uc003lfw.2_Missense_Mutation_p.D212N|ANKHD1_uc010jfl.2_Missense_Mutation_p.D9N|ANKHD1-EIF4EBP3_uc003lfx.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1574						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAAAAGGCAGATAAAAATAA	0.393													29	158	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140558690	140558690	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558690G>C	uc011dai.1	+	1	1261	c.1075G>C	c.(1075-1077)GAG>CAG	p.E359Q	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	359	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCAATACCTGAGAATGCGCC	0.448													21	555	---	---	---	---	PASS
AFAP1L1	134265	broad.mit.edu	37	5	148680751	148680751	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148680751A>C	uc003lqh.2	+	4	416	c.285A>C	c.(283-285)AAA>AAC	p.K95N	AFAP1L1_uc003lqg.3_Missense_Mutation_p.K95N|AFAP1L1_uc010jgy.2_Missense_Mutation_p.K95N	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	95							protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCCAGCAAAGGAGCCAGCC	0.587													20	86	---	---	---	---	PASS
IL12B	3593	broad.mit.edu	37	5	158750298	158750298	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158750298C>G	uc003lxr.1	-	3	170	c.128G>C	c.(127-129)GGA>GCA	p.G43A		NM_002187	NP_002178	P29460	IL12B_HUMAN	interleukin 12B precursor	43	Ig-like C2-type.				cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CACCATTTCTCCAGGGGCATC	0.413													8	51	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12161695	12161695	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12161695G>C	uc003nac.2	+	8	6690	c.6511G>C	c.(6511-6513)GAG>CAG	p.E2171Q	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2171					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATTCAGTTATGAGCGATCTGG	0.383													25	140	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17781126	17781126	+	Silent	SNP	T	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17781126T>A	uc003ncg.3	-	31	3786	c.3681A>T	c.(3679-3681)ACA>ACT	p.T1227T	KIF13A_uc003ncf.2_Silent_p.T1214T|KIF13A_uc003nch.3_Silent_p.T1227T|KIF13A_uc003nci.3_Silent_p.T1214T|KIF13A_uc003nce.1_5'Flank	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1227					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CCCAAGAGGCTGTGGCTGAAA	0.408													12	78	---	---	---	---	PASS
KDM1B	221656	broad.mit.edu	37	6	18207729	18207729	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18207729C>T	uc003nco.1	+	9	1226	c.1151C>T	c.(1150-1152)GCA>GTA	p.A384V	KDM1B_uc003ncn.1_Missense_Mutation_p.A355V	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1	587					multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding			skin(1)	1						GAAAAACTGGCAGAAGGGCTT	0.517													10	81	---	---	---	---	PASS
DCDC2	51473	broad.mit.edu	37	6	24205305	24205305	+	Silent	SNP	T	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24205305T>A	uc003ndx.2	-	8	1250	c.948A>T	c.(946-948)GCA>GCT	p.A316A	DCDC2_uc003ndy.2_Silent_p.A316A|DCDC2_uc003ndw.2_Silent_p.A67A	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	316					cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				CAGACCTCTCTGCTCCAGCTT	0.423													39	217	---	---	---	---	PASS
BAT1	7919	broad.mit.edu	37	6	31500697	31500697	+	Intron	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31500697G>T	uc003ntt.2	-						BAT1_uc003ntq.2_5'Flank|BAT1_uc003ntr.2_Missense_Mutation_p.P50T|BAT1_uc003nts.2_Intron|BAT1_uc011dnn.1_Intron|BAT1_uc003ntu.2_Intron|BAT1_uc003ntv.2_Intron	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1						intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						GGCTgggggggaggaaggggg	0.403													10	25	---	---	---	---	PASS
BAT5	7920	broad.mit.edu	37	6	31658388	31658388	+	Intron	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31658388G>C	uc003nvy.1	-						BAT5_uc003nvx.1_Intron|BAT5_uc011dny.1_Intron|BAT5_uc003nvz.1_Intron|BAT5_uc011dnz.1_Intron|BAT5_uc010jtc.1_Intron	NM_021160	NP_066983	O95870	ABHGA_HUMAN	HLA-B associated transcript 5							integral to membrane	hydrolase activity|protein binding				0						ACCTAGGAAGGAGGCAGGAAG	0.587													20	108	---	---	---	---	PASS
MSH5	4439	broad.mit.edu	37	6	31729633	31729633	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31729633C>G	uc003nwv.1	+	23	2299	c.2220C>G	c.(2218-2220)TTC>TTG	p.F740L	MSH5_uc003nwt.1_Missense_Mutation_p.F757L|MSH5_uc003nwu.1_Missense_Mutation_p.F741L|MSH5_uc003nww.1_Missense_Mutation_p.F740L|MSH5_uc003nwx.1_Missense_Mutation_p.F758L|MSH5_uc011dof.1_Missense_Mutation_p.F439L|MSH5_uc003nwy.1_Missense_Mutation_p.F414L|MSH5_uc003nwz.3_RNA|C6orf26_uc003nxa.3_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	740					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						ATCTTGTCTTCTTCTATCAGG	0.522								Direct_reversal_of_damage|MMR					51	246	---	---	---	---	PASS
ZNF318	24149	broad.mit.edu	37	6	43316086	43316086	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43316086C>T	uc003oux.2	-	6	3126	c.3048G>A	c.(3046-3048)TCG>TCA	p.S1016S	ZNF318_uc003ouw.2_RNA	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1016					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			AGTTTGAGAACGATGACACTT	0.378													48	241	---	---	---	---	PASS
GPR116	221395	broad.mit.edu	37	6	46874386	46874386	+	Intron	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46874386G>C	uc003oyo.3	-						GPR116_uc003oyp.3_Intron|GPR116_uc003oyq.3_Intron|GPR116_uc003oyr.2_Intron|uc003oys.2_Intron	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			AGCAGATATGGATATAACTCA	0.348													14	111	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56470378	56470378	+	Intron	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56470378C>G	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.L2479F	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CAGAGGCTATCAATGACAAAT	0.368													56	318	---	---	---	---	PASS
L3MBTL3	84456	broad.mit.edu	37	6	130415488	130415488	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130415488G>C	uc003qbt.2	+	18	1882	c.1712G>C	c.(1711-1713)AGA>ACA	p.R571T	L3MBTL3_uc003qbu.2_Missense_Mutation_p.R546T	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a	571					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		CATTTCAAGAGAGCGAGACAT	0.418													15	61	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146625736	146625736	+	Intron	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146625736G>T	uc010khw.1	+						GRM1_uc010khv.1_Intron|GRM1_uc003qll.2_Intron|GRM1_uc011edz.1_Intron|GRM1_uc011eea.1_Intron	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CCCAATCCCTGCATTTTTTAG	0.428													4	32	---	---	---	---	PASS
JAZF1	221895	broad.mit.edu	37	7	27872493	27872493	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27872493G>C	uc003szn.2	-	5	899	c.658C>G	c.(658-660)CAG>GAG	p.Q220E	JAZF1_uc003szm.2_Missense_Mutation_p.Q156E	NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1	220	C2H2-type 3; degenerate.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						CGCAGGCCCTGAGCTGTCTTG	0.483			T	SUZ12	endometrial stromal tumours								18	125	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91718793	91718793	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91718793G>T	uc003ulg.2	+	38	9533	c.9308G>T	c.(9307-9309)GGT>GTT	p.G3103V	AKAP9_uc003ulf.2_Missense_Mutation_p.G3095V|AKAP9_uc003uli.2_Missense_Mutation_p.G2726V|AKAP9_uc003ulj.2_Missense_Mutation_p.G873V|AKAP9_uc003ulk.2_Missense_Mutation_p.G378V|AKAP9_uc003ull.2_5'Flank	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3107					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CAAATGAATGGTAGGAAAATT	0.388			T	BRAF	papillary thyroid								22	644	---	---	---	---	PASS
SAMD9	54809	broad.mit.edu	37	7	92731423	92731423	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92731423C>G	uc003umf.2	-	3	4244	c.3988G>C	c.(3988-3990)GAG>CAG	p.E1330Q	SAMD9_uc003umg.2_Missense_Mutation_p.E1330Q	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1330						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CTGCATCTCTCTACTTGAAGT	0.363													43	860	---	---	---	---	PASS
MLL5	55904	broad.mit.edu	37	7	104747986	104747986	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104747986G>C	uc003vcm.2	+	22	3616	c.3082G>C	c.(3082-3084)GAT>CAT	p.D1028H	MLL5_uc010ljc.2_Missense_Mutation_p.D1028H|MLL5_uc010lje.1_RNA|MLL5_uc010ljf.1_RNA|MLL5_uc010ljg.2_5'UTR|MLL5_uc010ljh.1_5'Flank	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5	1028					cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						GCTAGGACTCGATGCAGTTGA	0.522													18	93	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122755608	122755608	+	Silent	SNP	C	A	A	rs150844958		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122755608C>A	uc003vkm.2	-	15	1777	c.1752G>T	c.(1750-1752)TCG>TCT	p.S584S	SLC13A1_uc010lks.2_Silent_p.S460S	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	584						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	CAGGAGCCCACGAAGGGTAAG	0.403													19	96	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124387341	124387341	+	Silent	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124387341G>A	uc003vli.2	-	2	1731	c.1080C>T	c.(1078-1080)TTC>TTT	p.F360F		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	360	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TGGCAGCACGGAAGCGGTCTA	0.488													12	68	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126882877	126882877	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126882877C>G	uc003vlr.2	-	1	693	c.382G>C	c.(382-384)GCT>CCT	p.A128P	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.A128P|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	128	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	ACATCCGAAGCATCTTTCTCT	0.502										HNSCC(24;0.065)			19	81	---	---	---	---	PASS
SLC4A2	6522	broad.mit.edu	37	7	150767109	150767109	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150767109C>G	uc003wit.3	+	9	1479	c.1223C>G	c.(1222-1224)TCT>TGT	p.S408C	SLC4A2_uc011kve.1_Missense_Mutation_p.S399C|SLC4A2_uc003wiu.3_Missense_Mutation_p.S394C|SLC4A2_uc003wiv.3_5'Flank	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	408	Cytoplasmic (Potential).				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATGGTCATCTCTGACCAGATC	0.622													22	102	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2092716	2092716	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2092716G>C	uc003wpx.3	+	37	4347	c.4209G>C	c.(4207-4209)ATG>ATC	p.M1403I	MYOM2_uc011kwi.1_Missense_Mutation_p.M828I	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	1403	Ig-like C2-type 5.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ACGTCAGCATGACCATCAAAG	0.537													25	112	---	---	---	---	PASS
BLK	640	broad.mit.edu	37	8	11412926	11412926	+	Silent	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11412926G>A	uc003wty.2	+	8	1286	c.705G>A	c.(703-705)GAG>GAA	p.E235E	BLK_uc003wtz.2_Silent_p.E164E	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	235					intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		ATGAATGGGAGATCCCCCGGC	0.612													27	141	---	---	---	---	PASS
PIWIL2	55124	broad.mit.edu	37	8	22172591	22172591	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22172591C>T	uc003xbn.2	+	18	2289	c.2141C>T	c.(2140-2142)GCC>GTC	p.A714V	PIWIL2_uc011kzf.1_Missense_Mutation_p.A714V|PIWIL2_uc010ltv.2_Missense_Mutation_p.A714V	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	714	Piwi.				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		CGGAGTGTGGCCCAGAAGATT	0.483													31	110	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52366145	52366145	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52366145G>C	uc003xqu.3	-	10	1284	c.1183C>G	c.(1183-1185)CGA>GGA	p.R395G		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	395	Ig-like C2-type 2.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CAGGTAAATCGACCATGATCC	0.483													19	100	---	---	---	---	PASS
DPY19L4	286148	broad.mit.edu	37	8	95780703	95780703	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95780703C>T	uc003ygx.2	+	12	1380	c.1256C>T	c.(1255-1257)TCT>TTT	p.S419F		NM_181787	NP_861452	Q7Z388	D19L4_HUMAN	dpy-19-like 4	419						integral to membrane				ovary(2)	2	Breast(36;3.85e-06)					TTGACACAGTCTTCTTTATTA	0.323													11	72	---	---	---	---	PASS
GPAA1	8733	broad.mit.edu	37	8	145138051	145138051	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145138051C>G	uc003zax.2	+	2	209	c.99C>G	c.(97-99)ATC>ATG	p.I33M	GPAA1_uc003zav.1_Translation_Start_Site|GPAA1_uc003zaw.1_Intron	NM_003801	NP_003792	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment	33	Helical; (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|protein complex assembly|protein retention in ER lumen	GPI-anchor transamidase complex	tubulin binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGGCGGGCATCGCCTGGTTCT	0.672													11	57	---	---	---	---	PASS
APBA1	320	broad.mit.edu	37	9	72131759	72131759	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72131759C>A	uc004ahh.2	-	2	644	c.368G>T	c.(367-369)CGG>CTG	p.R123L		NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,	123					axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1						GGCCTCGGGCCGGTACTGCAC	0.731													4	37	---	---	---	---	PASS
PHF2	5253	broad.mit.edu	37	9	96407915	96407915	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96407915G>A	uc004aub.2	+	4	451	c.304G>A	c.(304-306)GAA>AAA	p.E102K	PHF2_uc011lug.1_5'UTR	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	102					liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CTGCAGTGCTGAAGACGTGGT	0.647													18	132	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120470908	120470908	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120470908T>G	uc004bjz.2	+	2	452	c.161T>G	c.(160-162)TTC>TGC	p.F54C	TLR4_uc004bka.2_Missense_Mutation_p.F14C|TLR4_uc004bkb.2_Intron	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	54	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						AACCTCCCCTTCTCAACCAAG	0.438													32	128	---	---	---	---	PASS
MAPKAP1	79109	broad.mit.edu	37	9	128432143	128432143	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128432143G>C	uc004bpv.2	-	3	636	c.303C>G	c.(301-303)ATC>ATG	p.I101M	MAPKAP1_uc004bpw.2_Translation_Start_Site|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Missense_Mutation_p.I101M|MAPKAP1_uc004bpz.2_Missense_Mutation_p.I101M|MAPKAP1_uc010mxa.2_RNA|MAPKAP1_uc004bqa.2_Missense_Mutation_p.I101M	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated	101	Interaction with MAP3K2.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4						TTTTGCATTTGATCTGGTTTT	0.259													6	21	---	---	---	---	PASS
TPRN	286262	broad.mit.edu	37	9	140086755	140086755	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140086755C>G	uc004clt.2	-	3	1846	c.1846G>C	c.(1846-1848)GAG>CAG	p.E616Q	TPRN_uc004clu.2_Missense_Mutation_p.E616Q	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 2	677					sensory perception of sound	stereocilium					0						GGGGCCTGCTCCAGCGCCTGC	0.677													6	40	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34759074	34759074	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34759074G>C	uc010qej.1	-	4	521	c.521C>G	c.(520-522)TCA>TGA	p.S174*	PARD3_uc010qek.1_Nonsense_Mutation_p.S174*|PARD3_uc010qel.1_Nonsense_Mutation_p.S174*|PARD3_uc010qem.1_Nonsense_Mutation_p.S174*|PARD3_uc010qen.1_Nonsense_Mutation_p.S174*|PARD3_uc010qeo.1_Nonsense_Mutation_p.S174*|PARD3_uc010qep.1_Nonsense_Mutation_p.S174*|PARD3_uc010qeq.1_Nonsense_Mutation_p.S174*|PARD3_uc001ixp.1_Nonsense_Mutation_p.S39*|PARD3_uc001ixq.1_Nonsense_Mutation_p.S174*|PARD3_uc001ixr.1_Nonsense_Mutation_p.S174*|PARD3_uc001ixt.1_Nonsense_Mutation_p.S39*|PARD3_uc001ixu.1_Nonsense_Mutation_p.S174*	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	174					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				AGCTGTTGTTGACCAGCGTGT	0.507													30	128	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	96039545	96039545	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96039545C>T	uc001kjk.2	+	20	5306	c.4672C>T	c.(4672-4674)CAG>TAG	p.Q1558*	PLCE1_uc010qnx.1_Nonsense_Mutation_p.Q1542*|PLCE1_uc001kjm.2_Nonsense_Mutation_p.Q1250*|uc001kjo.1_RNA	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	1558					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				ACAGGCTCATCAGTTAGCATC	0.388											OREG0020383	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	76	---	---	---	---	PASS
OPALIN	93377	broad.mit.edu	37	10	98111124	98111124	+	Intron	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98111124G>A	uc001kmj.2	-						OPALIN_uc010qor.1_Intron|OPALIN_uc001kmi.2_Intron|OPALIN_uc001kmk.2_Intron|OPALIN_uc010qos.1_Intron	NM_033207	NP_149984	Q96PE5	OPALI_HUMAN	transmembrane protein 10 isoform a							Golgi apparatus|integral to membrane|plasma membrane					0						AAATTTAAGTGATATAGTTAC	0.328													13	63	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104176760	104176760	+	Silent	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104176760G>A	uc001kvg.1	-	2	563	c.36C>T	c.(34-36)GGC>GGT	p.G12G	PSD_uc001kvh.1_Intron|PSD_uc009xxd.1_Silent_p.G12G|PSD_uc001kvi.1_Silent_p.G12G|FBXL15_uc001kvj.1_5'Flank|FBXL15_uc001kvk.2_5'Flank	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	12					regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TGGCACAGTCGCCTTCCGAGC	0.721													4	21	---	---	---	---	PASS
OR51V1	283111	broad.mit.edu	37	11	5221326	5221326	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5221326C>G	uc010qyz.1	-	1	605	c.605G>C	c.(604-606)CGA>CCA	p.R202P		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	202	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTATTGAATCGGATGTCTGA	0.408													12	106	---	---	---	---	PASS
OR2D2	120776	broad.mit.edu	37	11	6913340	6913340	+	Missense_Mutation	SNP	C	T	T	rs143950338		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6913340C>T	uc010rau.1	-	1	392	c.392G>A	c.(391-393)CGT>CAT	p.R131H		NM_003700	NP_003691	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTTAGGGTAACGCAGAGGATT	0.498													16	141	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10820934	10820934	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10820934T>G	uc001mjc.2	-	20	2779	c.2362A>C	c.(2362-2364)AGC>CGC	p.S788R	EIF4G2_uc001mjb.2_Missense_Mutation_p.S582R|EIF4G2_uc009ygf.2_Missense_Mutation_p.S582R|EIF4G2_uc001mjd.2_Missense_Mutation_p.S750R	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	788	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTTTCATCGCTGGGGGGGTTT	0.408													14	98	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10820951	10820951	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10820951C>G	uc001mjc.2	-	20	2762	c.2345G>C	c.(2344-2346)AGT>ACT	p.S782T	EIF4G2_uc001mjb.2_Missense_Mutation_p.S576T|EIF4G2_uc009ygf.2_Missense_Mutation_p.S576T|EIF4G2_uc001mjd.2_Missense_Mutation_p.S744T	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	782	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GTTTACTTCACTAGAAATGTA	0.423													10	87	---	---	---	---	PASS
SPDYC	387778	broad.mit.edu	37	11	64940229	64940229	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64940229C>T	uc010rnz.1	+	6	591	c.591C>T	c.(589-591)GTC>GTT	p.V197V		NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN	speedy C	197					cell cycle	nucleus	protein kinase binding				0						TTCAGAGGGTCTGTCCACAGG	0.647													16	88	---	---	---	---	PASS
SPDYC	387778	broad.mit.edu	37	11	64940371	64940371	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64940371C>T	uc010rnz.1	+	6	733	c.733C>T	c.(733-735)CAT>TAT	p.H245Y		NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN	speedy C	245					cell cycle	nucleus	protein kinase binding				0						CTCTGAATGTCATCGCCCTCC	0.572													16	138	---	---	---	---	PASS
SF3B2	10992	broad.mit.edu	37	11	65835421	65835421	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65835421G>C	uc001ogy.1	+	20	2375	c.2335G>C	c.(2335-2337)GAG>CAG	p.E779Q	PACS1_uc001ogz.1_5'Flank|PACS1_uc001oha.1_5'Flank	NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2	779					interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						TCGCAGAAGTGAGACACCTCA	0.527											OREG0021094	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	141	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92534482	92534482	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92534482A>G	uc001pdj.3	+	9	8320	c.8303A>G	c.(8302-8304)GAC>GGC	p.D2768G		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2768	Extracellular (Potential).|Cadherin 25.				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATTAAGCTTGACAAACGCCTT	0.448										TCGA Ovarian(4;0.039)			8	36	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116730126	116730126	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116730126C>T	uc001ppy.2	-	19	2338	c.2302G>A	c.(2302-2304)GCA>ACA	p.A768T	SIK3_uc001ppz.2_Missense_Mutation_p.A667T|SIK3_uc001pqa.2_Missense_Mutation_p.A768T|SIK3_uc001ppw.2_Missense_Mutation_p.A185T|SIK3_uc001ppx.2_Missense_Mutation_p.A206T|SIK3_uc001pqb.2_Missense_Mutation_p.A71T	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	768	Gln-rich.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CTGGAGCCTGCAGCTGTGCCT	0.597											OREG0003491	type=REGULATORY REGION|Gene=AK022302|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	15	86	---	---	---	---	PASS
ABCD2	225	broad.mit.edu	37	12	40010967	40010967	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40010967C>G	uc001rmb.2	-	2	1369	c.943G>C	c.(943-945)GAA>CAA	p.E315Q		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	315	ABC transmembrane type-1.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						TGTTTCATTTCTACCTATAGA	0.299													7	73	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199520	86199520	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199520G>A	uc001taf.1	-	2	607	c.268C>T	c.(268-270)CTT>TTT	p.L90F		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	90	Ras-associating.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						AGTGGAGGAAGAACCCTTTCG	0.463													33	110	---	---	---	---	PASS
PRDM4	11108	broad.mit.edu	37	12	108145615	108145615	+	Silent	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108145615G>A	uc001tmp.2	-	5	1140	c.703C>T	c.(703-705)CTG>TTG	p.L235L	PRDM4_uc001tmq.2_RNA	NM_012406	NP_036538	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	235					cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						TCCACAGACAGAGGTTCATGA	0.532													14	85	---	---	---	---	PASS
KCTD10	83892	broad.mit.edu	37	12	109895804	109895804	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109895804G>T	uc001toi.1	-	4	555	c.467C>A	c.(466-468)TCA>TAA	p.S156*	KCTD10_uc001toh.1_RNA|KCTD10_uc009zvi.1_Nonsense_Mutation_p.S153*|KCTD10_uc001toj.1_Nonsense_Mutation_p.S165*|KCTD10_uc001tok.1_5'UTR	NM_031954	NP_114160	Q9H3F6	BACD3_HUMAN	potassium channel tetramerisation domain	156					proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0						TACCTTATTTGAAGTCGCTAT	0.373													17	76	---	---	---	---	PASS
STARD13	90627	broad.mit.edu	37	13	33704299	33704299	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33704299G>A	uc001uuw.2	-	5	641	c.515C>T	c.(514-516)CCG>CTG	p.P172L	STARD13_uc001uuu.2_Missense_Mutation_p.P164L|STARD13_uc001uuv.2_Missense_Mutation_p.P54L|STARD13_uc001uux.2_Missense_Mutation_p.P137L|STARD13_uc010tec.1_RNA|STARD13_uc010abh.1_Missense_Mutation_p.P157L	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	172					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CGTGCCTCCCGGTGACCCATT	0.577													13	34	---	---	---	---	PASS
SIX4	51804	broad.mit.edu	37	14	61190296	61190296	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61190296T>C	uc001xfc.2	-	1	497	c.497A>G	c.(496-498)TAC>TGC	p.Y166C	SIX4_uc010app.1_Missense_Mutation_p.Y158C	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	166						nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GAGGATGCTGTAGAGCTCGGG	0.682													4	43	---	---	---	---	PASS
SNAPC1	6617	broad.mit.edu	37	14	62249063	62249063	+	Missense_Mutation	SNP	G	C	C	rs145109867		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62249063G>C	uc001xft.2	+	8	1028	c.924G>C	c.(922-924)GAG>GAC	p.E308D		NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,	308					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		GGAAAAAAGAGAAGAAAGAAA	0.393													5	70	---	---	---	---	PASS
SNAPC1	6617	broad.mit.edu	37	14	62249095	62249095	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62249095A>C	uc001xft.2	+	8	1060	c.956A>C	c.(955-957)AAG>ACG	p.K319T		NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,	319					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		GCAGGAAGGAAGATGTCTCTC	0.368													4	48	---	---	---	---	PASS
GALNTL1	57452	broad.mit.edu	37	14	69792679	69792679	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69792679C>T	uc010aqu.1	+	5	596	c.503C>T	c.(502-504)CCG>CTG	p.P168L	GALNTL1_uc001xla.1_Missense_Mutation_p.P168L|GALNTL1_uc001xlb.1_Missense_Mutation_p.P168L	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	168	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		GCATCCTCAGCGGAAGACTGT	0.562													11	100	---	---	---	---	PASS
C14orf68	283600	broad.mit.edu	37	14	100793708	100793708	+	Splice_Site	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100793708G>A	uc001yhc.2	+	4	400	c.327_splice	c.e4+1	p.R109_splice	C14orf68_uc001yhd.2_Splice_Site	NM_207117	NP_997000	Q6Q0C1	S2547_HUMAN	chromosome 14 open reading frame 68						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0		Melanoma(154;0.152)				CCTCGTCCGCGTGAGTAGGGG	0.662													8	67	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102552590	102552590	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102552590C>G	uc001yku.3	-	2	316	c.126G>C	c.(124-126)GAG>GAC	p.E42D	HSP90AA1_uc001ykv.3_Missense_Mutation_p.E164D|HSP90AA1_uc001ykw.1_5'UTR|HSP90AA1_uc001ykx.1_Missense_Mutation_p.E31D	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	42					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	TCAGAAAGATCTCTTTGTTCG	0.428													7	72	---	---	---	---	PASS
HSP90AA1	3320	broad.mit.edu	37	14	102552599	102552599	+	Silent	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102552599C>G	uc001yku.3	-	2	307	c.117G>C	c.(115-117)TCG>TCC	p.S39S	HSP90AA1_uc001ykv.3_Silent_p.S161S|HSP90AA1_uc001ykw.1_5'UTR|HSP90AA1_uc001ykx.1_Silent_p.S28S	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	39					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)	TCTCTTTGTTCGAGTAGAAAG	0.428													8	69	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35202438	35202438	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35202438C>T	uc001ziv.2	-	17	1742	c.1561G>A	c.(1561-1563)GAA>AAA	p.E521K		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	521						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TTGGCCACTTCAACGACAGTG	0.468													26	170	---	---	---	---	PASS
PYGO1	26108	broad.mit.edu	37	15	55838974	55838974	+	Silent	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55838974G>A	uc010bfl.1	-	3	563	c.507C>T	c.(505-507)GTC>GTT	p.V169V	PYGO1_uc002adf.1_Silent_p.V169V	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	169	Asn-rich.				Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		TAGGCATGTTGACATTCTGAC	0.378													26	152	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72338533	72338533	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72338533C>T	uc002atl.3	-	2	845	c.372G>A	c.(370-372)TGG>TGA	p.W124*	MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Nonsense_Mutation_p.W124*|MYO9A_uc002atn.1_Nonsense_Mutation_p.W124*	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	124					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TTACCCGTAGCCATGACTGCA	0.448													35	132	---	---	---	---	PASS
PDE8A	5151	broad.mit.edu	37	15	85664067	85664067	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85664067G>A	uc002blh.2	+	18	1963	c.1774G>A	c.(1774-1776)GCA>ACA	p.A592T	PDE8A_uc002bli.2_Missense_Mutation_p.A546T|PDE8A_uc010bnc.2_Missense_Mutation_p.A345T|PDE8A_uc010bnd.2_Missense_Mutation_p.A345T|PDE8A_uc002blj.2_Missense_Mutation_p.A212T|PDE8A_uc002blk.2_Missense_Mutation_p.A212T|PDE8A_uc002bll.2_5'UTR	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	592	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			TGCACTCATCGCAGCCACCAT	0.468													34	95	---	---	---	---	PASS
HAGHL	84264	broad.mit.edu	37	16	777524	777524	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:777524C>T	uc002cjl.1	+	2	296	c.15C>T	c.(13-15)GTC>GTT	p.V5V	CCDC78_uc002cjf.2_5'Flank|CCDC78_uc002cji.3_5'Flank|CCDC78_uc002cjg.2_5'Flank|CCDC78_uc002cjj.3_5'Flank|CCDC78_uc002cjh.2_5'Flank|CCDC78_uc010uuo.1_5'Flank|CCDC78_uc002cjk.2_5'Flank|HAGHL_uc002cjm.1_Silent_p.V5V|HAGHL_uc002cjn.1_Silent_p.V5V|HAGHL_uc002cjo.1_Silent_p.V5V|HAGHL_uc010uup.1_Silent_p.V5V	NM_207112	NP_996995	Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like isoform 1	5							hydrolase activity|metal ion binding				0		Hepatocellular(780;0.00335)				AGGTCAAGGTCATCCCCGTGC	0.672													7	23	---	---	---	---	PASS
VASN	114990	broad.mit.edu	37	16	4431778	4431778	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4431778C>T	uc002cwj.1	+	2	1055	c.900C>T	c.(898-900)TTC>TTT	p.F300F	CORO7_uc002cwe.2_Intron|CORO7_uc002cwf.2_Intron|CORO7_uc002cwg.3_Intron|CORO7_uc002cwh.3_Intron|CORO7_uc010uxh.1_Intron|CORO7_uc010uxi.1_Intron|CORO7_uc002cwi.1_Intron|CORO7_uc010uxj.1_Intron|CORO7_uc010btp.1_Intron	NM_138440	NP_612449	Q6EMK4	VASN_HUMAN	slit-like 2 precursor	300	Extracellular (Potential).|LRRCT.					extracellular region|integral to membrane					0						GCAACCCCTTCAACTGCGTGT	0.687													6	34	---	---	---	---	PASS
ANKS4B	257629	broad.mit.edu	37	16	21262054	21262054	+	Silent	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21262054G>A	uc010bwp.1	+	2	1210	c.1167G>A	c.(1165-1167)CTG>CTA	p.L389L	CRYM_uc010bwq.1_Intron	NM_145865	NP_665872	Q8N8V4	ANS4B_HUMAN	harmonin-interacting ankyrin-repeat containing	389	SAM.									ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0565)		AAATGCAGCTGGGTCCCAGGA	0.507													36	156	---	---	---	---	PASS
SCNN1B	6338	broad.mit.edu	37	16	23391734	23391734	+	Intron	SNP	C	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23391734C>A	uc002dln.2	+							NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GCTCCCTGTTCCCCACAGATC	0.597													19	108	---	---	---	---	PASS
SCNN1B	6338	broad.mit.edu	37	16	23391849	23391849	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23391849C>T	uc002dln.2	+	13	1826	c.1650C>T	c.(1648-1650)ATC>ATT	p.I550I		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	550	Cytoplasmic (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	TTGTGTGGATCACCATCATCA	0.627													43	298	---	---	---	---	PASS
PRSS36	146547	broad.mit.edu	37	16	31150455	31150455	+	3'UTR	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31150455C>T	uc002ebd.2	-	15					PRSS36_uc010vff.1_3'UTR|PRSS36_uc010vfg.1_3'UTR|PRSS36_uc010vfh.1_3'UTR	NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36 precursor						proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1						GGGACCCTAGCCCCTCAGCTC	0.647													13	86	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46694409	46694409	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46694409G>T	uc002eef.3	-	17	2465	c.2366C>A	c.(2365-2367)CCA>CAA	p.P789Q	VPS35_uc002eed.2_3'UTR|VPS35_uc002eee.2_Missense_Mutation_p.P750Q	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	789					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TTCATAAATTGGCCCCTCGGA	0.423													16	109	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51175080	51175080	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51175080C>T	uc010vgs.1	-	2	1084	c.1053G>A	c.(1051-1053)CCG>CCA	p.P351P	SALL1_uc010vgr.1_Silent_p.P254P|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	351					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TTTCAGAGGACGGGGTGGTAA	0.507													20	59	---	---	---	---	PASS
PDPR	55066	broad.mit.edu	37	16	70166157	70166157	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70166157G>C	uc002eyf.1	+	9	1908	c.951G>C	c.(949-951)AAG>AAC	p.K317N	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.K217N|PDPR_uc002eyg.1_Missense_Mutation_p.K45N	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory	317					glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CTGAGGGCAAGAACCAGCTGG	0.428													8	110	---	---	---	---	PASS
AP1G1	164	broad.mit.edu	37	16	71803595	71803595	+	Silent	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71803595G>C	uc010cgg.2	-	6	887	c.573C>G	c.(571-573)CTC>CTG	p.L191L	AP1G1_uc002fba.2_Silent_p.L191L|AP1G1_uc002fbb.2_Silent_p.L214L|AP1G1_uc010vmg.1_RNA|AP1G1_uc010vmh.1_Silent_p.L273L	NM_001128	NP_001119	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1	191					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)				CAGATGTGTGGAGGACACCTG	0.418													15	136	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81934360	81934360	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81934360A>T	uc002fgt.2	+	14	1489	c.1337A>T	c.(1336-1338)CAG>CTG	p.Q446L	PLCG2_uc010chg.1_Missense_Mutation_p.Q446L	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	446	PI-PLC X-box.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TCGCCCAGCCAGCTGCGGGAG	0.632													16	58	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577127	7577127	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577127C>T	uc002gim.2	-	8	1005	c.811G>A	c.(811-813)GAG>AAG	p.E271K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E271K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E139K|TP53_uc010cng.1_Missense_Mutation_p.E139K|TP53_uc002gii.1_Missense_Mutation_p.E139K|TP53_uc010cnh.1_Missense_Mutation_p.E271K|TP53_uc010cni.1_Missense_Mutation_p.E271K|TP53_uc002gij.2_Missense_Mutation_p.E271K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	271	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> A (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E271K(22)|p.E271*(14)|p.0?(7)|p.E271V(5)|p.E271Q(3)|p.E271G(3)|p.E271D(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.E271E(2)|p.E271fs*73(1)|p.E258fs*71(1)|p.E271_R273delEVR(1)|p.F270fs*72(1)|p.S269fs*21(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.E271P(1)|p.E271del(1)|p.S269fs*34(1)|p.E271fs*34(1)|p.E271fs*35(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ACACGCACCTCAAAGCTGTTC	0.537		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			9	43	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7678646	7678646	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7678646G>C	uc002giu.1	+	29	4821	c.4807G>C	c.(4807-4809)GAA>CAA	p.E1603Q		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1603	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGTATTTTTAGAAGGCCCTGT	0.468													7	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	19091383	19091383	+	IGR	SNP	G	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19091383G>A								GRAPL (29235 upstream) : EPN2 (49307 downstream)																							aagtttctctgaacgtgtaga	0.129													21	273	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57093108	57093108	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57093108C>G	uc002iwy.3	-	21	2883	c.2439G>C	c.(2437-2439)TTG>TTC	p.L813F	TRIM37_uc002iwz.3_Missense_Mutation_p.L813F|TRIM37_uc002ixa.3_Missense_Mutation_p.L691F|TRIM37_uc010woc.1_Missense_Mutation_p.L779F	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	813						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TGCCATGTATCAAGGCTCGGG	0.428									Mulibrey_Nanism				32	88	---	---	---	---	PASS
RFNG	5986	broad.mit.edu	37	17	80008267	80008267	+	Intron	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80008267C>G	uc002kdj.2	-						RFNG_uc002kdh.2_5'UTR|GPS1_uc002kdk.1_5'Flank|GPS1_uc002kdl.1_5'Flank|GPS1_uc010dij.1_5'Flank|GPS1_uc002kdm.1_5'Flank|GPS1_uc002kdn.1_5'Flank|GPS1_uc002kdo.1_5'Flank|GPS1_uc010wvh.1_5'Flank	NM_002917	NP_002908	Q9Y644	RFNG_HUMAN	radical fringe						cell differentiation|nervous system development|organ morphogenesis|pattern specification process	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GGCGTCTGCTCCGACACTCAC	0.657													12	61	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7080394	7080394	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7080394C>G	uc002knm.2	-	2	218	c.124G>C	c.(124-126)GGC>CGC	p.G42R	LAMA1_uc010wzj.1_5'UTR	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	42	Laminin N-terminal.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CCCTTCTCGCCACAGGTGGCA	0.537													25	81	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22932013	22932013	+	5'UTR	SNP	T	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22932013T>C	uc002kvk.2	-	1					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_5'UTR|ZNF521_uc002kvl.2_5'UTR	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTCCACATAATAATGGAAAAT	0.483			T	PAX5	ALL								11	37	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7676774	7676774	+	Silent	SNP	C	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7676774C>A	uc002mgv.3	+	11	1496	c.1395C>A	c.(1393-1395)ATC>ATA	p.I465I	KIAA1543_uc002mgu.3_Silent_p.I492I|KIAA1543_uc002mgw.2_5'Flank	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	465	Pro-rich.				epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						CTCTGCAGATCATCCACAGTG	0.731													5	39	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9045652	9045652	+	Silent	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9045652G>T	uc002mkp.2	-	5	36183	c.35979C>A	c.(35977-35979)ACC>ACA	p.T11993T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11995	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTGTATTGAAGGTGGTTGTTG	0.478													9	57	---	---	---	---	PASS
PDE4C	5143	broad.mit.edu	37	19	18329162	18329162	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18329162C>T	uc010xqc.1	-	10	1692	c.1212G>A	c.(1210-1212)CTG>CTA	p.L404L	PDE4C_uc002nik.3_Silent_p.L404L|PDE4C_uc002nil.3_Silent_p.L404L|PDE4C_uc002nif.3_Silent_p.L173L|PDE4C_uc002nig.3_Intron|PDE4C_uc002nih.3_Silent_p.L174L|PDE4C_uc010ebk.2_Silent_p.L298L|PDE4C_uc002nii.3_Silent_p.L372L|PDE4C_uc010ebl.2_Silent_p.L118L|PDE4C_uc010xqd.1_Silent_p.L173L	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	404					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	CGGGCGTAGCCAGCAGCACAT	0.667													27	187	---	---	---	---	PASS
FXYD5	53827	broad.mit.edu	37	19	35649254	35649254	+	Silent	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35649254C>G	uc002nyg.1	+	4	236	c.150C>G	c.(148-150)GTC>GTG	p.V50V	FXYD5_uc010xsq.1_Silent_p.V50V|FXYD5_uc002nyh.1_Silent_p.V50V	NM_014164	NP_054883	Q96DB9	FXYD5_HUMAN	FXYD domain-containing ion transport regulator 5	50	Extracellular (Potential).				microvillus assembly|negative regulation of calcium-dependent cell-cell adhesion	integral to membrane	actin binding|cadherin binding|ion channel activity				0	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CAGATGCAGTCTACACAGAAC	0.547													13	110	---	---	---	---	PASS
ZFP14	57677	broad.mit.edu	37	19	36832035	36832035	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36832035C>G	uc002odx.1	-	4	786	c.693G>C	c.(691-693)AAG>AAC	p.K231N	ZFP14_uc010xtd.1_Missense_Mutation_p.K232N|ZFP14_uc010eex.1_Missense_Mutation_p.K231N	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	231	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					TCCCACACTCCTTACATTCAT	0.443													22	110	---	---	---	---	PASS
ZNF570	148268	broad.mit.edu	37	19	37966894	37966894	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37966894A>T	uc002ogk.1	+	3	674	c.145A>T	c.(145-147)ATC>TTC	p.I49F	ZNF570_uc010efl.1_Missense_Mutation_p.I105F|ZNF570_uc010xtr.1_5'UTR	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570	49	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAACTACAGGATCTTGGTATC	0.418													24	110	---	---	---	---	PASS
ZNF571	51276	broad.mit.edu	37	19	38055940	38055940	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38055940G>C	uc002ogt.2	-	4	1491	c.1390C>G	c.(1390-1392)CAA>GAA	p.Q464E	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Missense_Mutation_p.Q464E	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	464	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCTCATGTTGAGTAAGATAT	0.363													18	106	---	---	---	---	PASS
ZNF571	51276	broad.mit.edu	37	19	38056864	38056864	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38056864G>C	uc002ogt.2	-	4	567	c.466C>G	c.(466-468)CAA>GAA	p.Q156E	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Missense_Mutation_p.Q156E	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	156	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCCTCATGTTGAATAAGGCAT	0.343													20	82	---	---	---	---	PASS
ZNF780B	163131	broad.mit.edu	37	19	40541731	40541731	+	Silent	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40541731C>G	uc002omu.2	-	5	1100	c.1035G>C	c.(1033-1035)CTG>CTC	p.L345L	ZNF780B_uc002omv.2_Silent_p.L197L	NM_001005851	NP_001005851	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	345	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CAAGCTTTGTCAGAAGAGTAA	0.438													11	98	---	---	---	---	PASS
SERTAD1	29950	broad.mit.edu	37	19	40928838	40928838	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40928838C>T	uc002ont.3	-	2	775	c.616G>A	c.(616-618)GAA>AAA	p.E206K		NM_013376	NP_037508	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	206					positive regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCCGGAGCTTCCTCCTTGCCC	0.612													4	44	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	40993680	40993680	+	Silent	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40993680C>T	uc002ony.2	+	3	332	c.246C>T	c.(244-246)ATC>ATT	p.I82I	SPTBN4_uc002onx.2_Silent_p.I82I|SPTBN4_uc002onz.2_Silent_p.I82I	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	82	CH 1.|Actin-binding.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTGCCACATCGGGGACCTCT	0.657													17	76	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43420433	43420433	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43420433C>G	uc002ovj.1	-	2	323	c.271G>C	c.(271-273)GGG>CGG	p.G91R	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ovf.1_Missense_Mutation_p.G91R|PSG6_uc002ovg.1_Missense_Mutation_p.G91R	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	91	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				TAGGCAGGCCCATATATAATT	0.443													67	452	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33589814	33589814	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33589814G>C	uc002xbi.1	+	42	5958	c.5866G>C	c.(5866-5868)GAG>CAG	p.E1956Q		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	1914	Potential.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGATGATGCGGAGGAGCGGGC	0.667													19	87	---	---	---	---	PASS
EWSR1	2130	broad.mit.edu	37	22	29692264	29692264	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29692264C>G	uc003aet.2	+	12	1528	c.1200C>G	c.(1198-1200)ATC>ATG	p.I400M	EWSR1_uc003aev.2_Missense_Mutation_p.I405M|EWSR1_uc003aew.2_Missense_Mutation_p.I344M|EWSR1_uc003aex.2_Missense_Mutation_p.I399M|EWSR1_uc003aey.2_Missense_Mutation_p.I195M|EWSR1_uc003aez.2_Missense_Mutation_p.I61M	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2	400	RRM.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						TGATCCACATCTACCTGGACA	0.468			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								22	83	---	---	---	---	PASS
UBA1	7317	broad.mit.edu	37	X	47070251	47070251	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47070251C>T	uc004dhj.3	+	19	2361	c.2210C>T	c.(2209-2211)TCA>TTA	p.S737L	UBA1_uc004dhk.3_Missense_Mutation_p.S737L|UBA1_uc004dhm.2_Missense_Mutation_p.S185L	NM_153280	NP_695012	P22314	UBA1_HUMAN	ubiquitin-activating enzyme E1	737					cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity			ovary(1)	1						CTCACAAGCTCAGGAGCGCCG	0.542													9	13	---	---	---	---	PASS
PORCN	64840	broad.mit.edu	37	X	48378761	48378761	+	Splice_Site	SNP	A	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48378761A>T	uc010nie.1	+	15	1443	c.1285_splice	c.e15-2	p.G429_splice	PORCN_uc004djr.1_Splice_Site_p.G424_splice|PORCN_uc004djs.1_Splice_Site_p.G418_splice|PORCN_uc004djt.1_Splice_Site_p.G347_splice|PORCN_uc011mlx.1_Splice_Site_p.G347_splice|PORCN_uc004dju.1_Splice_Site_p.G287_splice|PORCN_uc004djv.1_Splice_Site_p.G429_splice|PORCN_uc004djw.1_Splice_Site_p.G423_splice|EBP_uc004djx.3_5'Flank|EBP_uc004djy.3_5'Flank|EBP_uc004djz.2_5'Flank	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D						Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						TCTCTCCCACAGGGCTACGGC	0.522													18	45	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73064048	73064048	+	RNA	SNP	A	G	G			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73064048A>G	uc004ebm.1	-	1		c.8541T>C				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						TATACTGCAAATGGAGGGTGA	0.408													49	106	---	---	---	---	PASS
SAGE1	55511	broad.mit.edu	37	X	134987410	134987410	+	Splice_Site	SNP	G	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134987410G>T	uc004ezh.2	+	5	481	c.314_splice	c.e5-1	p.D105_splice	SAGE1_uc010nry.1_Splice_Site_p.D74_splice|SAGE1_uc011mvv.1_Splice_Site_p.D105_splice	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1											ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TCGGTTTCCAGATGCTACCAT	0.438													25	59	---	---	---	---	PASS
MAGEA3	4102	broad.mit.edu	37	X	151935729	151935729	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151935729G>C	uc004fgp.2	-	3	647	c.438C>G	c.(436-438)TTC>TTG	p.F146L		NM_005362	NP_005353	P43357	MAGA3_HUMAN	melanoma antigen family A, 3	146	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					TCACAGGAAAGAAATACTGCC	0.517													45	103	---	---	---	---	PASS
USP9Y	8287	broad.mit.edu	37	Y	14922619	14922619	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14922619G>C	uc004fst.1	+	29	5050	c.4105G>C	c.(4105-4107)GAG>CAG	p.E1369Q	USP9Y_uc010nwu.1_RNA	NM_004654	NP_004645	O00507	USP9Y_HUMAN	ubiquitin specific protease 9, Y-linked	1369					BMP signaling pathway|protein deubiquitination|spermatogenesis|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						CACAGCAAGAGAGAAGGGTAA	0.318													3	23	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11077259	11077259	+	Intron	DEL	C	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11077259delC	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		TGTTACCtttctttttttttt	0.025													4	2	---	---	---	---	
APOB	338	broad.mit.edu	37	2	21266775	21266783	+	In_Frame_Del	DEL	GCAGCGCCA	-	-	rs17240441		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21266775_21266783delGCAGCGCCA	uc002red.2	-	1	163_171	c.35_43delTGGCGCTGC	c.(34-45)CTGGCGCTGCCT>CCT	p.LAL12del		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	12_14					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	agcagcgcaggcagcgccagcagcgccag	0.622													4	2	---	---	---	---	
KCNIP3	30818	broad.mit.edu	37	2	96048860	96048875	+	Intron	DEL	CCCACCCGCCCATCCA	-	-	rs58372613	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96048860_96048875delCCCACCCGCCCATCCA	uc002sup.2	+						KCNIP3_uc002suq.2_Intron	NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1						apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)		GTGGAGGGAGcccacccgcccatccacccacccgcc	0.477													3	3	---	---	---	---	
IL1RL2	8808	broad.mit.edu	37	2	102804538	102804539	+	Intron	INS	-	ACC	ACC	rs144678772	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102804538_102804539insACC	uc002tbs.2	+						IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor						cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						GGAAACAGAGAACCAGCTCCAC	0.624													7	7	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121555235	121555236	+	Intron	INS	-	CCA	CCA	rs139029553	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121555235_121555236insCCA	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				AAGAGGTCTGGCCACCCCAAGT	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133020743	133020744	+	IGR	INS	-	T	T	rs137914230		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133020743_133020744insT								NCRNA00164 (5201 upstream) : GPR39 (153403 downstream)																							TTAGATAGCTCTTTATTGTCAT	0.327													5	5	---	---	---	---	
WDR6	11180	broad.mit.edu	37	3	49048827	49048828	+	Intron	INS	-	T	T			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49048827_49048828insT	uc003cvj.2	+						WDR6_uc011bbx.1_Intron|WDR6_uc011bby.1_Intron|WDR6_uc010hkn.2_Intron|WDR6_uc011bbz.1_Intron	NM_018031	NP_060501	Q9NNW5	WDR6_HUMAN	WD repeat domain 6 protein						cell cycle arrest|negative regulation of cell proliferation	cytoplasm				central_nervous_system(1)	1				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		CAAGGATTTTCTTTTTTTTTTT	0.109													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49121582	49121582	+	IGR	DEL	C	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49121582delC								CWH43 (57489 upstream) : None (None downstream)																							gcattccattccattccactc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57554288	57554290	+	IGR	DEL	AGG	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57554288_57554290delAGG								HOPX (6416 upstream) : SPINK2 (121744 downstream)																							gaaggaaaaaaggagggagggag	0.000													4	2	---	---	---	---	
CEP72	55722	broad.mit.edu	37	5	634238	634239	+	Intron	INS	-	A	A	rs147154043	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:634238_634239insA	uc003jbf.2	+						CEP72_uc011clz.1_Intron	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			TACAGAGTTATAAATGAGAAAG	0.371													3	5	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32071763	32071763	+	Intron	DEL	T	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32071763delT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TGAACTACAGTTTGCAAAATA	0.393													1	5	---	---	---	---	
IRF1	3659	broad.mit.edu	37	5	131821520	131821521	+	Intron	INS	-	AC	AC	rs142244361	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131821520_131821521insAC	uc003kxa.2	-						C5orf56_uc010jds.1_Intron|IRF1_uc003kxd.2_Intron|IRF1_uc003kxb.2_Intron|IRF1_uc010jdt.1_Intron	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1						blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		CTGTCTCTCTGacacacacaca	0.520													13	9	---	---	---	---	
NOP16	51491	broad.mit.edu	37	5	175814066	175814069	+	Intron	DEL	TCTC	-	-	rs145796794		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175814066_175814069delTCTC	uc011dfl.1	-						NOP16_uc003med.2_Intron|NOP16_uc003mee.2_Intron|NOP16_uc011dfm.1_Intron|HIGD2A_uc003meg.2_5'Flank	NM_016391	NP_057475	Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein homolog							nucleolus				ovary(1)|central_nervous_system(1)	2						GGAGGCTTTTTCTCTCTCtctctc	0.245													5	4	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39546106	39546106	+	Intron	DEL	T	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39546106delT	uc003oot.2	-						KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						TAGTTCTAGAttttttttttt	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	160132356	160132373	+	IGR	DEL	CTCACACTGCTCTGACCT	-	-	rs79322534		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160132356_160132373delCTCACACTGCTCTGACCT								SOD2 (18003 upstream) : WTAP (15756 downstream)																							ataaccaccactcacactgctctgacctccataaccac	0.128													10	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65150816	65150816	+	Intron	DEL	A	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65150816delA	uc003tud.1	-						INTS4L2_uc003tue.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		TTCATCCCTCACCCCCCCCCC	0.463													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65888987	65888988	+	IGR	INS	-	T	T	rs77289928		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65888987_65888988insT								NCRNA00174 (23592 upstream) : LOC493754 (104458 downstream)																							Ctttttttttcttttttttttt	0.262													5	3	---	---	---	---	
TAF6	6878	broad.mit.edu	37	7	99708603	99708603	+	Intron	DEL	A	-	-	rs112139162		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99708603delA	uc003uti.2	-						TAF6_uc003utg.2_Intron|TAF6_uc003uth.2_Intron|TAF6_uc003utk.2_Intron|TAF6_uc011kji.1_Intron|TAF6_uc003utj.2_Intron|TAF6_uc003utl.2_Intron|TAF6_uc003utm.2_Intron|TAF6_uc003utn.1_Intron	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha						negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					actccatctcaaaaaaaaaaa	0.224													4	7	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12397630	12397631	+	Intron	INS	-	A	A	rs144512072	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12397630_12397631insA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						ATACTATTATTAATTTTGGGGG	0.208													5	3	---	---	---	---	
BAI1	575	broad.mit.edu	37	8	143583790	143583798	+	Intron	DEL	GTGGTGGTA	-	-	rs62513277		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143583790_143583798delGTGGTGGTA	uc003ywm.2	+							NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1						axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					gatggtggtggtggtggtagtggtggtga	0.043													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																							CTTCAGCCTGTTCTTCTTCAGTC	0.468													4	3	---	---	---	---	
DAPK1	1612	broad.mit.edu	37	9	90317793	90317794	+	Intron	INS	-	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90317793_90317794insA	uc004apc.2	+						DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						tctaaaaaaagaaaaaaaaACG	0.223									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				4	2	---	---	---	---	
C9orf102	375748	broad.mit.edu	37	9	98678837	98678838	+	Intron	INS	-	A	A	rs144815828	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98678837_98678838insA	uc004avt.3	+						C9orf102_uc010mrx.1_Intron|C9orf102_uc011lum.1_Intron|C9orf102_uc010mry.1_Intron|C9orf102_uc010mrz.2_Intron	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN	RAD26L hypothetical protein						DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				ATTCTGTATGGAAAAAATTGTT	0.297													6	3	---	---	---	---	
AGAP4	119016	broad.mit.edu	37	10	46342668	46342688	+	In_Frame_Del	DEL	GCTCCTGCCATCCTGTCCCCA	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46342668_46342688delGCTCCTGCCATCCTGTCCCCA	uc001jcx.3	-	1	234_254	c.108_128delTGGGGACAGGATGGCAGGAGC	c.(106-129)GCTGGGGACAGGATGGCAGGAGCG>GCG	p.36_43AGDRMAGA>A	AGAP4_uc010qfl.1_In_Frame_Del_p.36_43AGDRMAGA>A|AGAP4_uc001jcy.3_5'UTR	NM_133446	NP_597703	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	36_43					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			ovary(1)	1						AGCCATGGGCGCTCCTGCCATCCTGTCCCCAGCTCCTGCCT	0.588													4	3	---	---	---	---	
ECD	11319	broad.mit.edu	37	10	74920042	74920042	+	Intron	DEL	A	-	-	rs113122458		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74920042delA	uc001jtn.2	-						ECD_uc009xqx.2_Intron|ECD_uc009xqy.2_Intron|ECD_uc001jto.2_Intron	NM_007265	NP_009196	O95905	SGT1_HUMAN	suppressor of S. cerevisiae gcr2 isoform 1						regulation of glycolysis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	transcription coactivator activity			pancreas(1)	1	Prostate(51;0.0119)					agactgtctcaaaaaaaaaaa	0.124													6	3	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105159973	105159974	+	Intron	DEL	GG	-	-	rs146704197	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105159973_105159974delGG	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GAACATTGGCGGCCCCCCCCCT	0.485													3	4	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114724571	114724571	+	Intron	DEL	T	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114724571delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		gtggtggtggtggGGGGGGGT	0.239													4	2	---	---	---	---	
CDKN1C	1028	broad.mit.edu	37	11	2905204	2905205	+	Intron	INS	-	C	C	rs140121791	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2905204_2905205insC	uc001lws.3	-						CDKN1C_uc001lwu.3_Intron|CDKN1C_uc009ydr.2_Intron|CDKN1C_uc001lwt.3_Intron|CDKN1C_uc001lwr.3_Intron	NM_000076	NP_000067	P49918	CDN1C_HUMAN	cyclin-dependent kinase inhibitor 1C isoform a						cell cycle arrest|G1 phase of mitotic cell cycle|negative regulation of epithelial cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of cyclin-dependent protein kinase activity	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding			central_nervous_system(1)	1		all_epithelial(84;0.000187)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|Breast(177;0.00328)|all_neural(188;0.00681)|all_lung(207;0.157)|Lung NSC(207;0.216)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCCCTCCGCGCCCCCCCAGGT	0.733									Beckwith-Wiedemann_syndrome				6	3	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69949370	69949371	+	Intron	INS	-	A	A	rs142425384	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69949370_69949371insA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						CTGAGTTTTATAAAAAAAAAAC	0.545													4	10	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48253630	48253649	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCT	-	-	rs60761635		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253630_48253649delTTCCTTCCTTCCTTCCTTCT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tttcccttccttccttccttccttccttctttccttcctt	0.036													4	2	---	---	---	---	
GRIP1	23426	broad.mit.edu	37	12	66856976	66856979	+	Intron	DEL	AAAT	-	-	rs3830371		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66856976_66856979delAAAT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CATTTACTTAAAATAAAAGAAAAG	0.333													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124719601	124719603	+	IGR	DEL	CAT	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124719601_124719603delCAT								ZNF664 (219634 upstream) : FAM101A (54107 downstream)																							ccatcatcaccatcaccatcacc	0.000													5	3	---	---	---	---	
LCP1	3936	broad.mit.edu	37	13	46716269	46716269	+	Intron	DEL	A	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46716269delA	uc001vaz.3	-						LCP1_uc010ack.2_Intron|LCP1_uc001vay.3_Intron|LCP1_uc001vba.3_Intron	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin						regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		gataggactgaaaaaaaaaaA	0.134			T	BCL6	NHL 								7	4	---	---	---	---	
SNW1	22938	broad.mit.edu	37	14	78201080	78201080	+	Intron	DEL	A	-	-	rs5809849		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78201080delA	uc001xuf.2	-						SNW1_uc010tvm.1_Intron|SNW1_uc010asu.2_Intron|SNW1_uc010tvn.1_Intron	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein						negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		actccgtctcaaaaaaaaaaa	0.164													3	3	---	---	---	---	
PGPEP1L	145814	broad.mit.edu	37	15	99514424	99514431	+	Intron	DEL	GGGGGGGG	-	-	rs74852431		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99514424_99514431delGGGGGGGG	uc002bum.2	-						PGPEP1L_uc010bop.2_Intron|PGPEP1L_uc002bun.2_Intron	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein						proteolysis		cysteine-type peptidase activity				0						CTCAGTTGATGGGGGGGGGGGGGGGGTG	0.615													5	5	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	600733	600734	+	Intron	INS	-	T	T	rs145905062	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600733_600734insT	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				TGAGGGTCCCCGTCGGTGAGGG	0.738													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	27088694	27088695	+	IGR	INS	-	TCCTTCCT	TCCTTCCT	rs150155389		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088694_27088695insTCCTTCCT								C16orf82 (8208 upstream) : JMJD5 (126112 downstream)																							cggctcctttctccttccttcc	0.000													3	3	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36361540	36361541	+	Intron	INS	-	A	A			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36361540_36361541insA	uc010wdn.1	-									Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		aaaaAAGAAAGAAAAAGAGGCT	0.035													7	5	---	---	---	---	
UTP18	51096	broad.mit.edu	37	17	49350959	49350960	+	Intron	INS	-	T	T	rs71355748		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49350959_49350960insT	uc002its.2	+							NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component						rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			TTATGTTATTGTTTTTTTTTTT	0.238													4	2	---	---	---	---	
DUS3L	56931	broad.mit.edu	37	19	5789039	5789040	+	Intron	INS	-	ACCAGAGTGGG	ACCAGAGTGGG	rs140764504	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5789039_5789040insACCAGAGTGGG	uc002mdc.2	-						DUS3L_uc002mdd.2_Intron|DUS3L_uc010duk.2_Intron|DUS3L_uc010xiw.1_Intron	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1						tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						TTTCTGTCCCCACCTCCTGAGG	0.381													7	4	---	---	---	---	
C19orf66	55337	broad.mit.edu	37	19	10197480	10197480	+	Intron	DEL	G	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10197480delG	uc002mmu.3	+						C19orf66_uc002mmt.2_Intron|C19orf66_uc002mmv.3_Intron|C19orf66_uc002mmw.3_5'Flank	NM_018381	NP_060851	Q9NUL5	CS066_HUMAN	hypothetical protein LOC55337												0						GATGAAAGGCGGGGGGGGGGC	0.647													4	2	---	---	---	---	
SMARCA4	6597	broad.mit.edu	37	19	11137174	11137174	+	Intron	DEL	T	-	-	rs35017701		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11137174delT	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc002mqg.1_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron|SMARCA4_uc010dxt.1_Intron|SMARCA4_uc002mqh.3_Intron|SMARCA4_uc002mqi.1_Intron	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				AATACAAAtcttttttttttt	0.154			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				5	3	---	---	---	---	
ZNF675	171392	broad.mit.edu	37	19	23870081	23870095	+	5'Flank	DEL	CCTGACCCTTCAGGC	-	-	rs72223874		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23870081_23870095delCCTGACCCTTCAGGC	uc002nri.2	-							NM_138330	NP_612203	Q8TD23	ZN675_HUMAN	zinc finger protein 675						bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CGTTTAAGGTCCTGACCCTTCAGGCCCTGAGTGAC	0.577													4	3	---	---	---	---	
HKR1	284459	broad.mit.edu	37	19	37852826	37852827	+	Intron	DEL	AC	-	-	rs11344990		TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37852826_37852827delAC	uc002ogb.2	+						HKR1_uc002ofx.2_Intron|HKR1_uc002ofy.2_Intron|HKR1_uc002oga.2_Intron|HKR1_uc010xto.1_Intron|HKR1_uc002ogc.2_Intron|HKR1_uc010xtp.1_Intron|HKR1_uc002ogd.2_Intron	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			aaaaaaaaaaacaaaaaaacaa	0.144													3	4	---	---	---	---	
BBC3	27113	broad.mit.edu	37	19	47724912	47724913	+	3'UTR	INS	-	G	G	rs142745657	by1000genomes	TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47724912_47724913insG	uc002pgf.3	-	4					BBC3_uc010xyl.1_3'UTR|BBC3_uc010eky.2_3'UTR|BBC3_uc010ekz.2_3'UTR	NM_014417	NP_055232	Q9BXH1	BBC3_HUMAN	BCL2 binding component 3 isoform 4						activation of caspase activity|activation of pro-apoptotic gene products|cellular response to hypoxia|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of growth|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|positive regulation of thymocyte apoptosis|protein insertion into mitochondrial membrane involved in induction of apoptosis|reduction of endoplasmic reticulum calcium ion concentration|release of cytochrome c from mitochondria|release of sequestered calcium ion into cytosol	cytosol|mitochondrial outer membrane	protein binding|protein binding				0		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.000179)|OV - Ovarian serous cystadenocarcinoma(262;0.00029)|Epithelial(262;0.0103)|GBM - Glioblastoma multiforme(486;0.0234)		CTGGAGTGGCTGCCCCGGCCCG	0.693													3	3	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25554991	25554992	+	Intron	INS	-	TT	TT			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25554991_25554992insTT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CCACCACCGTCTTTTTTTTTTT	0.421													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	36507745	36507745	+	IGR	DEL	T	-	-			TCGA-22-1011-01A-01D-1521-08	TCGA-22-1011-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36507745delT								CXorf30 (104312 upstream) : FAM47C (518725 downstream)																							ttcttTCGGGttttttttttt	0.020													4	3	---	---	---	---	
