Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
C1orf127	148345	broad.mit.edu	37	1	11015252	11015252	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11015252G>A	uc010oao.1	-						C1orf127_uc001arr.1_Intron|C1orf127_uc001ars.1_Intron	NM_173507	NP_775778	B7ZLG7	B7ZLG7_HUMAN	hypothetical protein LOC148345											ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CACTGGAATGGGAAGGACACA	0.542													44	26	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12463963	12463963	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12463963A>T	uc001atv.2	+	63	12108	c.11967A>T	c.(11965-11967)AAA>AAT	p.K3989N	VPS13D_uc001atw.2_Missense_Mutation_p.K3964N|VPS13D_uc001atx.2_Missense_Mutation_p.K3176N|VPS13D_uc009vnl.2_RNA	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3988					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AAAATCTCAAAATCAGCATTC	0.388													46	24	---	---	---	---	PASS
PADI3	51702	broad.mit.edu	37	1	17603149	17603149	+	Silent	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17603149C>G	uc001bai.2	+	12	1483	c.1443C>G	c.(1441-1443)CCC>CCG	p.P481P		NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	481					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TCCCTGCCCCCGATGGGAAGG	0.597													59	22	---	---	---	---	PASS
USP48	84196	broad.mit.edu	37	1	22079070	22079070	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22079070C>T	uc001bfb.2	-	5	853	c.615G>A	c.(613-615)GTG>GTA	p.V205V	USP48_uc010odq.1_Silent_p.V205V|USP48_uc009vqc.2_Silent_p.V205V|USP48_uc001bfc.2_Silent_p.V205V|USP48_uc001bfe.1_Silent_p.V205V|USP48_uc001bff.2_Silent_p.V205V	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a	205					ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CAATATTGCGCACATCTGGAT	0.338													25	12	---	---	---	---	PASS
CELA3A	10136	broad.mit.edu	37	1	22329556	22329556	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22329556C>T	uc001bfl.2	+	2	123	c.104C>T	c.(103-105)GCG>GTG	p.A35V	CELA3B_uc009vqf.2_Intron	NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein	35	Peptidase S1.				cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						GGTGAGGATGCGGTCCCCTAC	0.612													4	96	---	---	---	---	PASS
MAN1C1	57134	broad.mit.edu	37	1	25944443	25944443	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25944443T>A	uc001bkm.2	+	1	485	c.155T>A	c.(154-156)CTC>CAC	p.L52H	MAN1C1_uc009vry.1_5'UTR	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	52	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CTCAAGCGCCTCTTCCTGGCC	0.662													10	38	---	---	---	---	PASS
KIAA1522	57648	broad.mit.edu	37	1	33237497	33237497	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33237497C>T	uc001bvv.2	+	6	2676	c.2540C>T	c.(2539-2541)TCG>TTG	p.S847L	KIAA1522_uc001bvu.1_Missense_Mutation_p.S906L|KIAA1522_uc010ohm.1_Missense_Mutation_p.S858L|KIAA1522_uc010ohn.1_Intron	NM_020888	NP_065939	Q9P206	K1522_HUMAN	hypothetical protein LOC57648	847	Pro-rich.										0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CTGGGGCCATCGGCCCCCCAG	0.721													16	10	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34033226	34033226	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34033226G>T	uc001bxn.1	-	54	8307	c.8278C>A	c.(8278-8280)CAT>AAT	p.H2760N	CSMD2_uc001bxm.1_Missense_Mutation_p.H2783N	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2760	Sushi 18.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GACCAGTGATGATCCTGCTGG	0.542													44	15	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36932199	36932199	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36932199C>T	uc001caw.1	-	17	2448	c.2270G>A	c.(2269-2271)GGC>GAC	p.G757D	MRPS15_uc001cas.2_5'Flank|CSF3R_uc001cat.1_Missense_Mutation_p.G319D|CSF3R_uc009vvc.1_Missense_Mutation_p.G286D|CSF3R_uc001cau.1_Missense_Mutation_p.G157D|CSF3R_uc001cav.1_Intron|CSF3R_uc001cax.1_Missense_Mutation_p.G784D|CSF3R_uc001cay.1_Missense_Mutation_p.A726T	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	757	Cytoplasmic (Potential).				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TGTGGGGCTGCCCAGCAGCTG	0.637													17	10	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62739203	62739203	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62739203C>A	uc001dah.3	-	3	1950	c.1573G>T	c.(1573-1575)GGC>TGC	p.G525C	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	525										ovary(3)|skin(2)|lung(1)	6						CTGTCGCTGCCCCACAGAAAG	0.602													41	19	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66075935	66075935	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66075935G>C	uc001dci.2	+	14	2153	c.1951G>C	c.(1951-1953)GGA>CGA	p.G651R	LEPR_uc001dcg.2_Missense_Mutation_p.G651R|LEPR_uc001dch.2_Missense_Mutation_p.G651R|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Missense_Mutation_p.G651R|LEPR_uc001dck.2_Missense_Mutation_p.G651R	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	651	Extracellular (Potential).|Fibronectin type-III 3.				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AATAATTAATGGAGATACTAT	0.269													32	17	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67147875	67147875	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67147875C>A	uc001dcr.2	+	15	1355	c.1138C>A	c.(1138-1140)CAG>AAG	p.Q380K	SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Missense_Mutation_p.Q147K	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	380	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						AGAAGAAGTCCAGAAGAAAGT	0.537													111	61	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76251971	76251971	+	Intron	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76251971T>C	uc001dgy.1	+						RABGGTB_uc009wbt.1_Intron|SNORD45C_uc001dgz.2_5'Flank|RABGGTB_uc001dha.1_5'Flank|SNORD45A_uc009wbu.1_5'Flank	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						TAAGTGTGAGTTTAGCGCTGC	0.567													41	21	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86203190	86203190	+	Splice_Site	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86203190T>A	uc001dlj.2	-	58	4715	c.4673_splice	c.e58-1	p.G1558_splice	COL24A1_uc001dli.2_Splice_Site_p.G673_splice|COL24A1_uc010osd.1_Splice_Site_p.G858_splice|COL24A1_uc001dlk.2_Splice_Site|COL24A1_uc010ose.1_Splice_Site|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		AGTATTTTCCTAATAATTTAT	0.274													4	6	---	---	---	---	PASS
GBP4	115361	broad.mit.edu	37	1	89652768	89652768	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89652768C>T	uc001dnb.2	-	9	1544	c.1428G>A	c.(1426-1428)CAG>CAA	p.Q476Q		NM_052941	NP_443173	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	476						cytoplasm	GTP binding|GTPase activity				0				all cancers(265;0.00723)|Epithelial(280;0.0291)		GCAGGAAGTTCTGGAGGACCT	0.502													57	24	---	---	---	---	PASS
GFI1	2672	broad.mit.edu	37	1	92946204	92946204	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92946204C>A	uc001dou.3	-	4	904	c.740G>T	c.(739-741)CGC>CTC	p.R247L	GFI1_uc001dov.3_Missense_Mutation_p.R247L|GFI1_uc001dow.3_Missense_Mutation_p.R247L	NM_001127215	NP_001120687	Q99684	GFI1_HUMAN	growth factor independent 1	247					negative regulation of calcidiol 1-monooxygenase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1/S phase of mitotic cell cycle|transcription, DNA-dependent|viral reproduction	nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)	1		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		CAGCAGCAGGCGGGTGCACAG	0.706													8	5	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103404590	103404590	+	Splice_Site	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103404590C>A	uc001dul.2	-	44	3756	c.3438_splice	c.e44+1	p.N1146_splice	COL11A1_uc001duk.2_Splice_Site_p.N342_splice|COL11A1_uc001dum.2_Splice_Site_p.N1158_splice|COL11A1_uc001dun.2_Splice_Site_p.N1107_splice|COL11A1_uc009weh.2_Splice_Site_p.N1030_splice	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGGAAACTCACATTTTCTCCC	0.343													52	34	---	---	---	---	PASS
ALX3	257	broad.mit.edu	37	1	110612956	110612956	+	Intron	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110612956A>G	uc001dzb.2	-							NM_006492	NP_006483	O95076	ALX3_HUMAN	aristaless-like homeobox 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.015)|all cancers(265;0.0706)|Epithelial(280;0.0758)|Colorectal(144;0.113)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCCGCGCGTTACCTTCCGCGG	0.711													14	6	---	---	---	---	PASS
RSBN1	54665	broad.mit.edu	37	1	114354958	114354958	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114354958C>T	uc001edq.2	-	1	113	c.77G>A	c.(76-78)CGG>CAG	p.R26Q	RSBN1_uc001edr.2_RNA	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	26						nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGCGCCGCCCGCGCACTGCC	0.652													34	9	---	---	---	---	PASS
HSD3B1	3283	broad.mit.edu	37	1	120050171	120050171	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120050171G>A	uc001ehv.1	+	2	217	c.72G>A	c.(70-72)GTG>GTA	p.V24V	HSD3B1_uc001ehw.2_Silent_p.V26V	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1	24					androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	GCCTCTTGGTGAAGGAGAAGG	0.522													60	29	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612002	120612002	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612002C>G	uc001eik.2	-	1	275	c.19G>C	c.(19-21)GCT>CCT	p.A7P	NOTCH2_uc001eil.2_Missense_Mutation_p.A7P|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	7					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACAGCAGAGCGGGGCGCAGG	0.667			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	15	---	---	---	---	PASS
FCGR1B	2210	broad.mit.edu	37	1	120927180	120927180	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120927180A>T	uc001eip.2	-	5	850	c.800T>A	c.(799-801)CTG>CAG	p.L267Q	FCGR1B_uc001eiq.2_Missense_Mutation_p.L175Q|FCGR1B_uc010oxl.1_RNA	NM_001017986	NP_001017986	Q92637	FCGRB_HUMAN	Fc fragment of IgG, high affinity Ib, receptor	267	Cytoplasmic (Potential).				interferon-gamma-mediated signaling pathway	integral to membrane|plasma membrane	IgG binding|immunoglobulin receptor activity				0	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		CCCTTCCTGCAGCTGTTCTTC	0.537													29	19	---	---	---	---	PASS
LCE2B	26239	broad.mit.edu	37	1	152659444	152659444	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152659444C>T	uc001fai.2	+	2	179	c.125C>T	c.(124-126)CCT>CTT	p.P42L		NM_014357	NP_055172	O14633	LCE2B_HUMAN	late cornified envelope 2B	42	Pro-rich.|Cys-rich.				keratinization					ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGTTCCCCTGCAGTCTCT	0.627													111	176	---	---	---	---	PASS
LCE4A	199834	broad.mit.edu	37	1	152681816	152681816	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152681816G>T	uc001fak.2	+	1	294	c.265G>T	c.(265-267)GGT>TGT	p.G89C		NM_178356	NP_848133	Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	89	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			GCAGTCTGGGGGTTCTGGCTG	0.597													25	47	---	---	---	---	PASS
NPR1	4881	broad.mit.edu	37	1	153661941	153661941	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153661941C>G	uc001fcs.3	+	18	3122	c.2701C>G	c.(2701-2703)CTC>GTC	p.L901V	NPR1_uc010pdz.1_Missense_Mutation_p.L647V|NPR1_uc010pea.1_Missense_Mutation_p.L379V	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	901	Guanylate cyclase.|Cytoplasmic (Potential).				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GGTGACCCTGCTCAATGACCT	0.537													55	137	---	---	---	---	PASS
AQP10	89872	broad.mit.edu	37	1	154296240	154296240	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154296240G>A	uc001feu.2	+	5	705	c.665G>A	c.(664-666)CGT>CAT	p.R222H	AQP10_uc001fev.2_Missense_Mutation_p.R222H|ATP8B2_uc001few.2_5'Flank	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	222	Extracellular (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTGGGCCCACGTCTCTTCACC	0.627													11	52	---	---	---	---	PASS
KCNN3	3782	broad.mit.edu	37	1	154841808	154841808	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154841808G>A	uc001ffp.2	-	1	947	c.633C>T	c.(631-633)TTC>TTT	p.F211F	KCNN3_uc009wox.1_Silent_p.F211F	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	216						integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			TGCTAGGGCTGAAAAGCTGGA	0.637													36	63	---	---	---	---	PASS
SEMA4A	64218	broad.mit.edu	37	1	156144709	156144709	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156144709A>G	uc001fnl.2	+	12	1516	c.1412A>G	c.(1411-1413)AAC>AGC	p.N471S	SEMA4A_uc009wrq.2_Missense_Mutation_p.N471S|SEMA4A_uc001fnm.2_Missense_Mutation_p.N471S|SEMA4A_uc001fnn.2_Missense_Mutation_p.N339S|SEMA4A_uc001fno.2_Missense_Mutation_p.N471S	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor	471	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					CCTGTTCGCAACCTGCAGCTG	0.622													29	73	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156616841	156616841	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156616841C>T	uc001fpp.2	+	3	676	c.340C>T	c.(340-342)CCA>TCA	p.P114S	BCAN_uc001fpo.2_Missense_Mutation_p.P114S	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	114	Ig-like V-type.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCCTGCGTACCCAGCGTCGCT	0.672													14	28	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157772365	157772365	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157772365C>A	uc001frg.2	-	4	522	c.409G>T	c.(409-411)GCT>TCT	p.A137S	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Missense_Mutation_p.A137S|FCRL1_uc001fri.2_Missense_Mutation_p.A137S|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	137	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GTGCCCATAGCAACTGAGCAG	0.542													40	57	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157803197	157803197	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157803197T>C	uc001frk.3	-	5	967	c.824A>G	c.(823-825)GAA>GGA	p.E275G		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	275	SRCR 3.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GTCCTCCTTTTCTCCCCAGTT	0.572													90	122	---	---	---	---	PASS
CD1B	910	broad.mit.edu	37	1	158298786	158298786	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158298786C>G	uc001frx.2	-	5	1013	c.905G>C	c.(904-906)GGC>GCC	p.G302A	CD1B_uc001frw.2_Missense_Mutation_p.G140A	NM_001764	NP_001755	P29016	CD1B_HUMAN	CD1B antigen precursor	302	Extracellular (Potential).				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding			ovary(2)	2	all_hematologic(112;0.0378)					AACAATTGAGCCAATGGAGGT	0.458													29	51	---	---	---	---	PASS
DCAF8	50717	broad.mit.edu	37	1	160207000	160207000	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160207000G>C	uc001fvo.2	-	6	1196	c.884C>G	c.(883-885)TCT>TGT	p.S295C	DCAF8_uc001fvn.2_Missense_Mutation_p.S295C|DCAF8_uc009wth.2_Missense_Mutation_p.S295C|DCAF8_uc010pjb.1_Missense_Mutation_p.S295C|DCAF8_uc010pjc.1_Missense_Mutation_p.S449C|uc010pjd.1_5'Flank	NM_015726	NP_056541	Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	295	WD 3.					CUL4 RING ubiquitin ligase complex	protein binding			skin(2)	2						CGTACAGGGAGAGTCTGGTTC	0.313													5	9	---	---	---	---	PASS
FCGR3B	2215	broad.mit.edu	37	1	161600845	161600845	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161600845C>T	uc009wul.2	-	1	314	c.40G>A	c.(40-42)GTT>ATT	p.V14I		NM_000570	NP_000561	O75015	FCG3B_HUMAN	low affinity immunoglobulin gamma Fc region	14					immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity				0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCTGACTTACCTAGAAGTAGC	0.532													23	45	---	---	---	---	PASS
TADA1	117143	broad.mit.edu	37	1	166829463	166829463	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166829463G>A	uc001gdw.2	-	6	836	c.652C>T	c.(652-654)CTG>TTG	p.L218L	TADA1_uc001gdv.2_Silent_p.L76L	NM_053053	NP_444281	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1-like	218					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(1)	1						CTATTCTTCAGGTATGGCTGC	0.373													23	51	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169562848	169562848	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169562848T>C	uc001ggi.3	-	14	2467	c.2402A>G	c.(2401-2403)CAA>CGA	p.Q801R	SELP_uc001ggh.2_Intron|SELP_uc009wvr.2_Missense_Mutation_p.Q800R	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	801	Cytoplasmic (Potential).				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	TTTACCTTTTTGTCTGAAACG	0.423													28	57	---	---	---	---	PASS
GAS5	60674	broad.mit.edu	37	1	173834799	173834799	+	Intron	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173834799C>A	uc001gji.2	-						GAS5_uc001gjj.2_Intron|GAS5_uc001gjk.2_Intron|SNORD81_uc009wwi.1_5'Flank|SNORD47_uc001gjl.2_5'Flank|SNORD80_uc009wwj.1_5'Flank|SNORD79_uc009wwk.1_5'Flank|SNORD78_uc009wwl.2_RNA|ZBTB37_uc001gjp.1_5'Flank|ZBTB37_uc001gjq.3_5'Flank|ZBTB37_uc009wwp.1_5'Flank|ZBTB37_uc001gjr.2_5'Flank					Homo sapiens mRNA; cDNA DKFZp564D0164 (from clone DKFZp564D0164).												0						CATTTCAGGTCAGACATTTGA	0.383													40	84	---	---	---	---	PASS
RABGAP1L	9910	broad.mit.edu	37	1	174274239	174274239	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174274239C>T	uc001gjx.2	+	11	1634	c.1439C>T	c.(1438-1440)TCA>TTA	p.S480L	RABGAP1L_uc009wwq.1_Missense_Mutation_p.S492L|RABGAP1L_uc001gjw.2_Missense_Mutation_p.S443L|RABGAP1L_uc001gjy.2_Missense_Mutation_p.S148L|RABGAP1L_uc001gjz.2_Missense_Mutation_p.S127L	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A	480					regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						GGTCCAATGTCACCCCAGGAT	0.468													39	29	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564578	176564578	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564578G>A	uc001gkz.2	+	3	3002	c.1838G>A	c.(1837-1839)CGC>CAC	p.R613H	PAPPA2_uc001gky.1_Missense_Mutation_p.R613H|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	613	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						GGTGACTGCCGCCTGCAGGGC	0.587													43	57	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176762746	176762746	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176762746C>A	uc001gkz.2	+	20	6235	c.5071C>A	c.(5071-5073)CTA>ATA	p.L1691I	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1691	Sushi 5.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CCCCGTGATGCTACCTGAGAA	0.483													63	100	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176857303	176857303	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176857303G>T	uc001glc.2	-	18	3190	c.2978C>A	c.(2977-2979)TCA>TAA	p.S993*	ASTN1_uc001glb.1_Nonsense_Mutation_p.S993*|ASTN1_uc001gld.1_Nonsense_Mutation_p.S993*	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	1001					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						TCCAGTCCCTGAGCACCAGAG	0.537													38	44	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176863691	176863691	+	Intron	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176863691C>T	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						AGTCCCAGGCCTCTTACCCTC	0.557													31	40	---	---	---	---	PASS
SOAT1	6646	broad.mit.edu	37	1	179306981	179306981	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179306981A>T	uc001gml.2	+	5	402	c.339A>T	c.(337-339)AGA>AGT	p.R113S	SOAT1_uc010pni.1_Missense_Mutation_p.R48S|SOAT1_uc001gmm.2_Missense_Mutation_p.R55S|SOAT1_uc010pnj.1_5'UTR|SOAT1_uc010pnk.1_Missense_Mutation_p.R48S	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	113					cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	GGGATTTGAGAGCACCTCCAG	0.303													30	33	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	180003020	180003020	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180003020C>G	uc001gnt.2	+	16	4132	c.3749C>G	c.(3748-3750)TCT>TGT	p.S1250C	CEP350_uc009wxl.2_Missense_Mutation_p.S1249C|CEP350_uc001gnu.2_Missense_Mutation_p.S1083C	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1250	Ser-rich.					centrosome|nucleus|spindle				ovary(4)	4						AAGGGAAGATCTCAGAAAACT	0.378													43	89	---	---	---	---	PASS
RGS21	431704	broad.mit.edu	37	1	192316463	192316463	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192316463C>A	uc001gsh.2	+	3	206	c.32C>A	c.(31-33)CCA>CAA	p.P11Q		NM_001039152	NP_001034241	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	11					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|skin(1)	2						TACAGGTCACCAACTGCGGAA	0.313													72	158	---	---	---	---	PASS
UCHL5	51377	broad.mit.edu	37	1	193028383	193028383	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193028383C>A	uc001gsm.2	-	1	139	c.8G>T	c.(7-9)GGC>GTC	p.G3V	UCHL5_uc001gsn.2_RNA|UCHL5_uc001gso.2_Missense_Mutation_p.G3V|UCHL5_uc010pov.1_RNA|UCHL5_uc001gsp.2_Missense_Mutation_p.G3V|UCHL5_uc001gsq.2_Missense_Mutation_p.G3V|UCHL5_uc010pow.1_Intron|UCHL5_uc010pox.1_5'UTR|UCHL5_uc001gsr.1_3'UTR|TROVE2_uc001gst.1_5'Flank|TROVE2_uc001gss.2_5'Flank|TROVE2_uc001gsu.1_5'Flank|TROVE2_uc001gsv.1_5'Flank|TROVE2_uc001gsw.2_5'Flank|TROVE2_uc009wyp.2_5'Flank|TROVE2_uc009wyq.2_5'Flank	NM_015984	NP_057068	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	3					DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|ovary(1)	3						CCCGGCATTGCCCGTCATGGC	0.672													10	32	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196642292	196642292	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196642292G>A	uc001gtj.3	+	2	483	c.243G>A	c.(241-243)CAG>CAA	p.Q81Q	CFH_uc001gti.3_Silent_p.Q81Q|CFH_uc009wyw.2_Silent_p.Q81Q|CFH_uc009wyx.2_Silent_p.Q81Q	NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	81	Sushi 1.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						GGAAATGTCAGAGTAAGTACT	0.318													24	52	---	---	---	---	PASS
RABIF	5877	broad.mit.edu	37	1	202850137	202850137	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202850137T>A	uc001gyl.2	-	2	378	c.341A>T	c.(340-342)TAT>TTT	p.Y114F		NM_002871	NP_002862	P47224	MSS4_HUMAN	RAB-interacting factor	114					cellular membrane fusion|protein transport|small GTPase mediated signal transduction		guanyl-nucleotide exchange factor activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(75;0.166)			CAAGGCCACATAGAAACTGTT	0.493													64	76	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204949567	204949567	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204949567C>T	uc001hbj.2	+	20	2574	c.2246C>T	c.(2245-2247)ACG>ATG	p.T749M	NFASC_uc010pra.1_Missense_Mutation_p.T745M|NFASC_uc001hbi.2_Missense_Mutation_p.T745M|NFASC_uc010prb.1_Missense_Mutation_p.T760M|NFASC_uc010prc.1_Missense_Mutation_p.T316M|NFASC_uc001hbk.1_Missense_Mutation_p.T555M|NFASC_uc001hbl.1_5'Flank	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	749	Extracellular (Potential).|Fibronectin type-III 2.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ATCACGTGGACGGTAAGAGGC	0.612													9	21	---	---	---	---	PASS
DSTYK	25778	broad.mit.edu	37	1	205116794	205116794	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205116794C>T	uc001hbw.2	-	13	2746	c.2682G>A	c.(2680-2682)TTG>TTA	p.L894L	DSTYK_uc001hbx.2_Silent_p.L849L	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	894	Protein kinase.					cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						GAGGCCTCTTCAAGGGGTCGC	0.537													85	156	---	---	---	---	PASS
DSTYK	25778	broad.mit.edu	37	1	205116822	205116822	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205116822A>G	uc001hbw.2	-	13	2718	c.2654T>C	c.(2653-2655)ATG>ACG	p.M885T	DSTYK_uc001hbx.2_Missense_Mutation_p.M840T	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	885	Protein kinase.					cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						ACAGGCTTCCATCAACTGCCA	0.552													69	152	---	---	---	---	PASS
CR2	1380	broad.mit.edu	37	1	207648284	207648284	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207648284C>T	uc001hfw.2	+	13	2356	c.2262C>T	c.(2260-2262)CTC>CTT	p.L754L	CR2_uc001hfv.2_Silent_p.L813L|CR2_uc009xch.2_Silent_p.L754L	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	754	Sushi 12.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						GATTCTATCTCCTGGGAGAGA	0.463													70	101	---	---	---	---	PASS
IRF6	3664	broad.mit.edu	37	1	209968732	209968732	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209968732C>A	uc001hhq.1	-	5	674	c.411G>T	c.(409-411)AAG>AAT	p.K137N	IRF6_uc010psm.1_Missense_Mutation_p.K42N|IRF6_uc009xct.1_Missense_Mutation_p.K137N	NM_006147	NP_006138	O14896	IRF6_HUMAN	interferon regulatory factor 6	137					cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CATCATTATCCTTCTCATCCC	0.542										HNSCC(57;0.16)			44	54	---	---	---	---	PASS
TRAF5	7188	broad.mit.edu	37	1	211533358	211533358	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211533358T>A	uc001hih.2	+	5	543	c.483T>A	c.(481-483)TGT>TGA	p.C161*	TRAF5_uc001hii.2_Nonsense_Mutation_p.C161*|TRAF5_uc010psx.1_Nonsense_Mutation_p.C172*|TRAF5_uc010psy.1_Intron|TRAF5_uc001hij.2_Nonsense_Mutation_p.C161*	NM_004619	NP_004610	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	161	TRAF-type 1.				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(2)|ovary(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		GTGCATCCTGTCAGTTTCGAA	0.423													47	73	---	---	---	---	PASS
LPGAT1	9926	broad.mit.edu	37	1	212002483	212002483	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212002483C>T	uc001hiu.2	-	2	969	c.156G>A	c.(154-156)AAG>AAA	p.K52K	LPGAT1_uc001hiv.2_Silent_p.K52K	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	52					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		ACCAGAACCGCTTACTGTCCA	0.438													58	90	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214811305	214811305	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214811305T>G	uc001hkm.2	+	11	1717	c.1543T>G	c.(1543-1545)TGT>GGT	p.C515G		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	515	Potential.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CATCAAACAGTGTTTAAATCA	0.408													49	72	---	---	---	---	PASS
KCTD3	51133	broad.mit.edu	37	1	215792322	215792322	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215792322C>T	uc001hks.2	+	16	1951	c.1657C>T	c.(1657-1659)CGC>TGC	p.R553C	KCTD3_uc001hkt.2_Missense_Mutation_p.R553C|KCTD3_uc010pub.1_Missense_Mutation_p.R451C|KCTD3_uc009xdn.2_Missense_Mutation_p.R277C	NM_016121	NP_057205	Q9Y597	KCTD3_HUMAN	potassium channel tetramerisation domain	553	WD 5.					voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		AAGACCAAGGCGCTACTTGTT	0.443													17	120	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216051223	216051223	+	Splice_Site	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216051223C>T	uc001hku.1	-	43	8946	c.8559_splice	c.e43-1	p.R2853_splice		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGCTCATATCTAAAGCAAAA	0.418										HNSCC(13;0.011)			43	92	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222791476	222791476	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222791476C>T	uc001hnl.2	+	1	33	c.24C>T	c.(22-24)CTC>CTT	p.L8L		NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	8					exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		CTGGGCTGCTCGTCTGGCTGC	0.667													6	9	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222803650	222803650	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222803650T>C	uc001hnl.2	+	4	3097	c.3088T>C	c.(3088-3090)TAC>CAC	p.Y1030H	MIA3_uc009xea.1_Missense_Mutation_p.Y866H	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1030	Extracellular (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		TTTTGTCAGGTACAAGCACTC	0.478													38	209	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227239592	227239592	+	Intron	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227239592T>A	uc001hqr.2	-						CDC42BPA_uc001hqq.2_Missense_Mutation_p.E264V|CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron|CDC42BPA_uc001hqp.2_Intron|CDC42BPA_uc001hqu.1_Missense_Mutation_p.E172V	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				CTTAACTGGCTCAGCTTCACT	0.463													61	114	---	---	---	---	PASS
WNT3A	89780	broad.mit.edu	37	1	228238464	228238464	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228238464C>T	uc001hrq.1	+	3	499	c.421C>T	c.(421-423)CGC>TGC	p.R141C	WNT3A_uc001hrp.1_Missense_Mutation_p.R141C	NM_033131	NP_149122	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family,	141					axis specification|cell proliferation in forebrain|cell-cell signaling|cellular response to retinoic acid|convergent extension|dermatome development|dorsal/ventral neural tube patterning|embryonic pattern specification|extracellular matrix organization|hemopoietic stem cell proliferation|hippocampus development|inner ear morphogenesis|mammary gland development|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of neuron projection development|notochord development|palate development|paraxial mesodermal cell fate commitment|positive regulation of catenin import into nucleus|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of receptor internalization|positive regulation of transcription from RNA polymerase II promoter|signalosome assembly|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuroblast division|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled-2 binding|receptor agonist activity|signal transducer activity|transcription coactivator activity			ovary(1)	1		Prostate(94;0.0405)				CTGCAGCAGCCGCCACCAGGG	0.652													33	102	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230845930	230845930	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230845930A>G	uc001hty.3	-	2	1175	c.667T>C	c.(667-669)TTT>CTT	p.F223L	AGT_uc009xfe.2_Missense_Mutation_p.F223L|AGT_uc009xff.2_Missense_Mutation_p.F195L	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	223					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	CCCTGCACAAACGGCTGCTTC	0.612													31	87	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235377193	235377193	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235377193G>A	uc001hwq.2	-	17	2230	c.1732C>T	c.(1732-1734)CGG>TGG	p.R578W	ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwt.3_Missense_Mutation_p.R259W	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	578					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CGTCCATACCGCACTTGGACT	0.343													7	324	---	---	---	---	PASS
TBCE	6905	broad.mit.edu	37	1	235602204	235602204	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235602204A>T	uc001hwz.1	+	13	1360	c.1237A>T	c.(1237-1239)ACA>TCA	p.T413S	TBCE_uc001hxa.1_Missense_Mutation_p.T413S|TBCE_uc010pxr.1_Missense_Mutation_p.T464S|TBCE_uc001hxb.1_Missense_Mutation_p.T300S	NM_003193	NP_003184	Q15813	TBCE_HUMAN	beta-tubulin cofactor E	413					'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			AGAATTCCTCACAGCCCATCC	0.488													101	76	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237580424	237580424	+	Splice_Site	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237580424G>A	uc001hyl.1	+	11	968	c.848_splice	c.e11+1	p.A283_splice		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAAGAGTTGCGTAAGTAGAAC	0.448													53	34	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237777346	237777346	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777346G>T	uc001hyl.1	+	37	5038	c.4918G>T	c.(4918-4920)GAC>TAC	p.D1640Y		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1640	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGATCTGTTGACATCTTAGA	0.428													26	78	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237796898	237796898	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237796898G>T	uc001hyl.1	+	43	6696	c.6576G>T	c.(6574-6576)ATG>ATT	p.M2192I		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2192	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCCCAAGATGGTGGCCAACT	0.388													103	337	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240978014	240978014	+	Splice_Site	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240978014A>T	uc001hyv.2	-	12	1175	c.845_splice	c.e12+1	p.S282_splice	RGS7_uc010pyh.1_Splice_Site_p.S256_splice|RGS7_uc010pyj.1_Splice_Site_p.S198_splice|RGS7_uc001hyu.2_Splice_Site_p.S282_splice|RGS7_uc009xgn.1_Splice_Site_p.S229_splice|RGS7_uc001hyw.2_Splice_Site_p.S282_splice|RGS7_uc001hyt.2_Splice_Site_p.S114_splice	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TGAAATACTCACCTGTCAGCG	0.323													32	114	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247588866	247588866	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247588866C>A	uc001icr.2	+	5	2259	c.2121C>A	c.(2119-2121)GTC>GTA	p.V707V	NLRP3_uc001ics.2_Silent_p.V707V|NLRP3_uc001icu.2_Silent_p.V707V|NLRP3_uc001icw.2_Silent_p.V707V|NLRP3_uc001icv.2_Silent_p.V707V|NLRP3_uc010pyw.1_Silent_p.V705V|NLRP3_uc001ict.1_Silent_p.V705V	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	707					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TGCAGTGTGTCCTCCCAAGCT	0.562													63	43	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	247901948	247901948	+	IGR	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247901948T>A								OR6F1 (25891 upstream) : OR1C1 (18818 downstream)																							ATGGAATTCTTGCTTGTGAGA	0.383													42	110	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004713	248004713	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004713C>T	uc001idn.1	-	1	486	c.486G>A	c.(484-486)ATG>ATA	p.M162I		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	162	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACCTGGAAATCATCAGGGAAG	0.557													58	131	---	---	---	---	PASS
OR2L2	26246	broad.mit.edu	37	1	248201836	248201836	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248201836G>T	uc001idw.2	+	1	363	c.267G>T	c.(265-267)AAG>AAT	p.K89N	OR2L13_uc001ids.2_Intron	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L,	89	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			atggaaacaagtctatctcct	0.303													78	259	---	---	---	---	PASS
OR2M3	127062	broad.mit.edu	37	1	248367125	248367125	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248367125T>A	uc010pzg.1	+	1	756	c.756T>A	c.(754-756)TAT>TAA	p.Y252*		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	252	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GAATGTACTATGGAGCAGCTT	0.493													234	162	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248550956	248550956	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248550956G>C	uc001iei.1	+	1	47	c.47G>C	c.(46-48)GGG>GCG	p.G16A		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCCTCATGGGGCTCTTCACT	0.423													27	117	---	---	---	---	PASS
OR2T11	127077	broad.mit.edu	37	1	248790217	248790217	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248790217G>T	uc001ier.1	-	1	213	c.213C>A	c.(211-213)ATC>ATA	p.I71I		NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T,	71	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGTGGTACAGATGAAAAGGG	0.473													64	55	---	---	---	---	PASS
OR14I1	401994	broad.mit.edu	37	1	248845215	248845215	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248845215T>C	uc001ieu.1	-	1	391	c.391A>G	c.(391-393)AGA>GGA	p.R131G		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATCACGGCTCTGTATTGGAGG	0.512													28	65	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1639256	1639256	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1639256C>G	uc002qxa.2	-	22	4308	c.4244G>C	c.(4243-4245)TGC>TCC	p.C1415S		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1415	VWFC.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGCATCCACGCACTCTGTGGT	0.468													9	15	---	---	---	---	PASS
COLEC11	78989	broad.mit.edu	37	2	3691114	3691114	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3691114A>T	uc002qya.2	+	6	557	c.409A>T	c.(409-411)AAG>TAG	p.K137*	COLEC11_uc002qxz.2_Nonsense_Mutation_p.K134*|COLEC11_uc002qyb.2_Nonsense_Mutation_p.K113*|COLEC11_uc002qyc.2_Nonsense_Mutation_p.K113*|COLEC11_uc010ewo.2_Nonsense_Mutation_p.K89*|COLEC11_uc010ewp.2_Nonsense_Mutation_p.K111*|COLEC11_uc010ewq.2_Nonsense_Mutation_p.K87*|COLEC11_uc010ewr.2_Nonsense_Mutation_p.K87*|COLEC11_uc010ews.2_Nonsense_Mutation_p.K63*	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a	137	Potential.					collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		CAGCGAGCTCAAGTTCATCAA	0.682													19	77	---	---	---	---	PASS
LPIN1	23175	broad.mit.edu	37	2	11925077	11925077	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11925077C>T	uc010yjn.1	+	10	1590	c.1316C>T	c.(1315-1317)CCG>CTG	p.P439L	LPIN1_uc010yjm.1_Missense_Mutation_p.P524L|LPIN1_uc002rbt.2_Missense_Mutation_p.P439L|LPIN1_uc010yjo.1_5'Flank	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	439					fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		AACCAGTCCCCGCAGTCGGTG	0.667											OREG0014445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	34	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20180551	20180551	+	Intron	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20180551C>T	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAACCTAGAACATTATAAAAC	0.303													14	87	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228501	21228501	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228501G>C	uc002red.2	-	26	11367	c.11239C>G	c.(11239-11241)CCT>GCT	p.P3747A		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3747					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGGAACGTAGGCATGACAAGA	0.383													29	130	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26703889	26703889	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26703889G>A	uc002rhk.2	-						OTOF_uc002rhh.2_5'Flank|OTOF_uc002rhi.2_5'Flank|OTOF_uc002rhj.2_5'Flank	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a						cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGGCAGTGGGAACAAAAAT	0.602													13	18	---	---	---	---	PASS
NLRC4	58484	broad.mit.edu	37	2	32475784	32475784	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32475784T>C	uc002roi.2	-	4	1395	c.1149A>G	c.(1147-1149)GCA>GCG	p.A383A	NLRC4_uc002roj.1_Silent_p.A383A|NLRC4_uc010ezt.1_Intron	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12	383	NACHT.				activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TGAAGTCACTTGCAGCCACAC	0.468													22	55	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33335712	33335712	+	Silent	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33335712C>G	uc002ros.2	+	4	927	c.927C>G	c.(925-927)CTC>CTG	p.L309L		NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	309					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AATACGTGCTCAAGCCCAAGT	0.463													57	116	---	---	---	---	PASS
RASGRP3	25780	broad.mit.edu	37	2	33749499	33749499	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33749499A>T	uc002rox.2	+	10	1318	c.691A>T	c.(691-693)AAG>TAG	p.K231*	RASGRP3_uc010ync.1_Nonsense_Mutation_p.K231*|RASGRP3_uc002roy.2_Nonsense_Mutation_p.K231*	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	231	Ras-GEF.				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					TTTATTGCAGAAGCTCCTTCA	0.353													4	18	---	---	---	---	PASS
ATL2	64225	broad.mit.edu	37	2	38536655	38536655	+	Intron	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38536655A>C	uc002rqq.2	-						ATL2_uc010ynm.1_Intron|ATL2_uc010ynn.1_Intron|ATL2_uc010yno.1_Intron|ATL2_uc002rqs.2_Intron|ATL2_uc002rqr.2_Intron	NM_001135673	NP_001129145	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2 isoform 2						endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			ovary(1)|kidney(1)|skin(1)	3						ATATCTAGAAAACAAAAAATT	0.318													17	71	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656664	40656664	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656664C>T	uc002rrx.2	-	1	781	c.757G>A	c.(757-759)GAT>AAT	p.D253N	SLC8A1_uc002rry.2_Missense_Mutation_p.D253N|SLC8A1_uc002rrz.2_Missense_Mutation_p.D253N|SLC8A1_uc002rsa.2_Missense_Mutation_p.D253N|SLC8A1_uc002rsd.3_Missense_Mutation_p.D253N|SLC8A1_uc002rsb.1_Missense_Mutation_p.D253N|SLC8A1_uc010fan.1_Missense_Mutation_p.D253N|SLC8A1_uc002rsc.1_Missense_Mutation_p.D253N	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	253	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AGTCTCCTATCCGCTACCCAA	0.443													17	119	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43732779	43732779	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43732779T>C	uc002rsw.3	-	24	3955	c.3603A>G	c.(3601-3603)ATA>ATG	p.I1201M	THADA_uc010far.2_Missense_Mutation_p.I470M|THADA_uc002rsx.3_Missense_Mutation_p.I1201M|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Missense_Mutation_p.I910M|THADA_uc010fat.1_Missense_Mutation_p.I348M|THADA_uc002rta.2_Missense_Mutation_p.I911M	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1201							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CTGTACTCTGTATGTCATCTG	0.323													7	12	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43968112	43968112	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43968112G>C	uc010yny.1	+	21	3234	c.3151G>C	c.(3151-3153)GGG>CGG	p.G1051R	PLEKHH2_uc002rtf.3_Missense_Mutation_p.G1050R	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	1051	MyTH4.|Helical; (Potential).					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACTCTGCGTTGGGCTCTTCCT	0.542													20	107	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50149181	50149181	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50149181T>C	uc010fbp.2	-	6	2037	c.1230A>G	c.(1228-1230)TCA>TCG	p.S410S	NRXN1_uc002rxb.3_Silent_p.S1144S|NRXN1_uc010fbq.2_Silent_p.S1515S|NRXN1_uc002rxe.3_Silent_p.S1445S|NRXN1_uc010yon.1_Silent_p.S110S|NRXN1_uc002rxa.3_Silent_p.S107S	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	410	Cytoplasmic (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGGACTGTGCTGAGTTACTGA	0.438													23	117	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54853176	54853176	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54853176C>T	uc002rxu.2	+	12	1698	c.1449C>T	c.(1447-1449)GCC>GCT	p.A483A	SPTBN1_uc002rxv.1_Silent_p.A483A|SPTBN1_uc002rxx.2_Silent_p.A470A	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	483	Spectrin 2.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			CTGTGGTAGCCGTGGCCAGGG	0.567													56	90	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54870116	54870116	+	Intron	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54870116G>T	uc002rxu.2	+						SPTBN1_uc002rxx.2_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			TGATCTTTCTGTAGCTGTCTC	0.428													21	150	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56599616	56599616	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56599616G>A	uc002rzn.2	+							NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CTCTCCCGGTGAGTGAAGATG	0.517													10	14	---	---	---	---	PASS
GKN2	200504	broad.mit.edu	37	2	69173521	69173521	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69173521G>T	uc002sfa.2	-	5	496	c.387C>A	c.(385-387)GAC>GAA	p.D129E	GKN2_uc002sfb.3_Missense_Mutation_p.D129E	NM_182536	NP_872342	Q86XP6	GKN2_HUMAN	trefoil factor interactions(z) 1 precursor	129	BRICHOS.					extracellular region					0						ACCAATCCACGTCTTTGATCA	0.448													110	173	---	---	---	---	PASS
EXOC6B	23233	broad.mit.edu	37	2	72968430	72968430	+	Intron	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72968430T>C	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						AGAGCCTTCTTACTTTGAGTT	0.388													42	221	---	---	---	---	PASS
REG3G	130120	broad.mit.edu	37	2	79254998	79254998	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79254998G>A	uc002snw.2	+	5	484	c.399G>A	c.(397-399)TGG>TGA	p.W133*	REG3G_uc002snx.2_Nonsense_Mutation_p.W133*|REG3G_uc010ffu.2_Nonsense_Mutation_p.W87*	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor	133	C-type lectin.				acute-phase response	extracellular region	sugar binding				0						ACTTTGCATGGGAGAAAAATC	0.498													128	99	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80529841	80529841	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80529841C>G	uc002sok.1	-	2	1374	c.1104G>C	c.(1102-1104)GAG>GAC	p.E368D	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	368	Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						CGCTGGTGGGCTCGGCCCCAT	0.716										HNSCC(69;0.2)			11	10	---	---	---	---	PASS
LRRTM1	347730	broad.mit.edu	37	2	80530675	80530675	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530675C>T	uc002sok.1	-	2	540	c.270G>A	c.(268-270)CAG>CAA	p.Q90Q	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	90	LRR 1.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						GCCACGTGAGCTGCATTAACC	0.612										HNSCC(69;0.2)			30	117	---	---	---	---	PASS
FAHD2A	51011	broad.mit.edu	37	2	96071537	96071537	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96071537C>T	uc002sur.2	+	2	410	c.231C>T	c.(229-231)CTC>CTT	p.L77L	FAHD2A_uc002sus.2_Silent_p.L77L	NM_016044	NP_057128	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing	77							hydrolase activity|metal ion binding			ovary(1)	1						AGGCCACCCTCTCAGTGGCAA	0.597													10	11	---	---	---	---	PASS
MITD1	129531	broad.mit.edu	37	2	99787034	99787034	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99787034G>C	uc002szs.1	-	5	607	c.559C>G	c.(559-561)CAA>GAA	p.Q187E	MRPL30_uc002szl.1_Intron|MRPL30_uc002szr.2_Intron	NM_138798	NP_620153	Q8WV92	MITD1_HUMAN	MIT, microtubule interacting and transport,	187					protein transport	late endosome membrane				large_intestine(1)|ovary(1)	2						GAAGAGTATTGAACTTCCAAC	0.328													83	241	---	---	---	---	PASS
MRPS9	64965	broad.mit.edu	37	2	105687796	105687796	+	Missense_Mutation	SNP	G	A	A	rs147264055	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105687796G>A	uc002tcn.3	+	3	409	c.341G>A	c.(340-342)AGT>AAT	p.S114N		NM_182640	NP_872578	P82933	RT09_HUMAN	mitochondrial ribosomal protein S9 precursor	114					DNA damage response, detection of DNA damage|translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						CTTTTCCCAAGTGGTTTGTTT	0.219													32	26	---	---	---	---	PASS
SEPT10	151011	broad.mit.edu	37	2	110325422	110325422	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110325422G>T	uc002tew.2	-	6	1111	c.732C>A	c.(730-732)GAC>GAA	p.D244E	SEPT10_uc010ywu.1_Missense_Mutation_p.D77E|SEPT10_uc002tex.2_Missense_Mutation_p.D221E|SEPT10_uc002tey.2_Missense_Mutation_p.D244E|SEPT10_uc010ywv.1_Missense_Mutation_p.D110E|SEPT10_uc002tev.1_Missense_Mutation_p.D51E|SEPT10_uc010fjo.2_RNA|SEPT10_uc002tez.1_Missense_Mutation_p.D19E	NM_144710	NP_653311	Q9P0V9	SEP10_HUMAN	septin 10 isoform 1	244					cell cycle|cell division	septin complex	GTP binding				0						TAGCAATAGTGTCATCATCCG	0.368													22	88	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128886667	128886667	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128886667G>T	uc002tps.2	+	13	1469	c.1291G>T	c.(1291-1293)GGC>TGC	p.G431C	UGGT1_uc010fme.1_Missense_Mutation_p.G306C|UGGT1_uc002tpr.2_Missense_Mutation_p.G407C	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	431					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						GGGAATAGAAGGCCTTTCTCT	0.438													30	95	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132020950	132020950	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132020950A>C	uc002tsn.2	+	15	1974	c.1922A>C	c.(1921-1923)GAA>GCA	p.E641A	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.E241A|POTEE_uc002tsl.2_Missense_Mutation_p.E223A|POTEE_uc010fmy.1_Missense_Mutation_p.E105A	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	641							ATP binding				0						TGTAAGAAAGAAAAAGACGTC	0.348													29	18	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133540003	133540003	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133540003C>A	uc002ttp.2	-	14	4755	c.4381G>T	c.(4381-4383)GCT>TCT	p.A1461S	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1461							protein binding				0						GAACTCACAGCATCAGTCGCG	0.502													10	53	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138421125	138421125	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138421125C>A	uc002tva.1	+	25	4544	c.4544C>A	c.(4543-4545)TCT>TAT	p.S1515Y	THSD7B_uc010zbj.1_RNA	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AAAGGATGGTCTCTTCAACCA	0.358													7	8	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	159954259	159954259	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159954259A>G	uc002uag.2	+	4	446	c.172A>G	c.(172-174)AAA>GAA	p.K58E	TANC1_uc010fol.1_Missense_Mutation_p.K58E|TANC1_uc010zcm.1_Missense_Mutation_p.K58E|TANC1_uc010fom.1_Missense_Mutation_p.K58E	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	58						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						GAGCTTGGCCAAAGGTGTCTC	0.522													102	100	---	---	---	---	PASS
LY75	4065	broad.mit.edu	37	2	160746900	160746900	+	Intron	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160746900G>C	uc002ubc.3	-						LY75_uc002ubb.3_Intron|LY75_uc010fos.2_Intron|LY75_uc010fot.1_Intron	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		TGTTGATAAAGACACGTTAGT	0.318													15	49	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162735758	162735758	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162735758G>A	uc002ubx.3	+	9	1250	c.1066G>A	c.(1066-1068)GTA>ATA	p.V356I	SLC4A10_uc010fpa.1_Missense_Mutation_p.V368I|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.V326I|SLC4A10_uc010zcs.1_Missense_Mutation_p.V337I	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	356	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GTCTCCAGCTGTATTGCTTCA	0.413													77	76	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162760591	162760591	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162760591T>A	uc002ubx.3	+	13	1704	c.1520T>A	c.(1519-1521)CTG>CAG	p.L507Q	SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.L477Q|SLC4A10_uc010zcs.1_Missense_Mutation_p.L488Q	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	507	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GCTTTCAGCCTGCAGTGCTTA	0.443													4	18	---	---	---	---	PASS
GCG	2641	broad.mit.edu	37	2	163003945	163003945	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163003945A>C	uc002ucc.2	-	3	271	c.172T>G	c.(172-174)TTC>GTC	p.F58V		NM_002054	NP_002045	P01275	GLUC_HUMAN	glucagon preproprotein	58					cell proliferation|cellular response to glucagon stimulus|energy reserve metabolic process|feeding behavior|regulation of insulin secretion	plasma membrane|soluble fraction	hormone activity				0					Exenatide(DB01276)|Phentolamine(DB00692)	TCACTGGTGAATGTGCCCTGT	0.498													142	156	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163051246	163051246	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163051246G>A	uc002ucd.2	-	17	1623	c.1415C>T	c.(1414-1416)CCC>CTC	p.P472L	FAP_uc010fpc.2_Missense_Mutation_p.P21L|FAP_uc010zct.1_Missense_Mutation_p.P447L|FAP_uc010fpd.2_5'UTR	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	472	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						GGTGGAAATGGGGATGCCTGG	0.443													17	47	---	---	---	---	PASS
GCA	25801	broad.mit.edu	37	2	163216741	163216741	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163216741T>C	uc002ucg.2	+	8	818	c.642T>C	c.(640-642)ACT>ACC	p.T214T	GCA_uc010zcu.1_Silent_p.T195T	NM_012198	NP_036330	P28676	GRAN_HUMAN	grancalcin, EF-hand calcium binding protein	214					cellular membrane fusion	cytoplasm|plasma membrane	calcium ion binding|protein homodimerization activity				0						TGCAGGGCACTATGGCAATTT	0.274													32	43	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	166020188	166020188	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166020188C>T	uc002ucx.2	-	7	1126	c.634G>A	c.(634-636)GTC>ATC	p.V212I	SCN3A_uc002ucy.2_Missense_Mutation_p.V212I|SCN3A_uc002ucz.2_Intron|SCN3A_uc002uda.1_Missense_Mutation_p.V81I|SCN3A_uc002udb.1_Intron	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	212						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	AACGCTGAGACATTGCCCAGG	0.418													16	63	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166172106	166172106	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166172106C>G	uc002udc.2	+	11	1799	c.1509C>G	c.(1507-1509)AAC>AAG	p.N503K	SCN2A_uc002udd.2_Missense_Mutation_p.N503K|SCN2A_uc002ude.2_Missense_Mutation_p.N503K	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	503					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	AGCTGAaaaacagaagaaaga	0.299													14	63	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166848358	166848358	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166848358A>G	uc010zcz.1	-	26	5412	c.5394T>C	c.(5392-5394)TAT>TAC	p.Y1798Y		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1809	IV.		Missing (in SMEI).			voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	CCCAAACCTCATAGAACATCT	0.458													34	118	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170042516	170042516	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170042516G>A	uc002ues.2	-	50	9555	c.9342C>T	c.(9340-9342)TGC>TGT	p.C3114C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3114	EGF-like 11.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AAGGGTCATGGCATTCATTAA	0.408													35	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179500826	179500826	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179500826G>T	uc010zfg.1	-	175	33992	c.33768C>A	c.(33766-33768)GGC>GGA	p.G11256G	TTN_uc010zfh.1_Silent_p.G4951G|TTN_uc010zfi.1_Silent_p.G4884G|TTN_uc010zfj.1_Silent_p.G4759G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12183							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACAATTCGGCCAGGTTTCT	0.512													16	63	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179577326	179577326	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179577326G>A	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGGGCTAAAGTGACCAAATT	0.373													9	33	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179600527	179600527	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179600527C>G	uc010zfg.1	-	47	11138	c.10914G>C	c.(10912-10914)TTG>TTC	p.L3638F	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.L299F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4565							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAATGATGATCAACTCTGCTT	0.398													19	45	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179605786	179605786	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179605786C>T	uc010zfh.1	-	46	11885	c.11661G>A	c.(11659-11661)AAG>AAA	p.K3887K	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Silent_p.K3820K|TTN_uc010zfj.1_Silent_p.K3695K|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	3827							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCGGGACCCTTTAAGGGTG	0.463													71	234	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179635938	179635938	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179635938C>A	uc010zfg.1	-	34	8340	c.8116G>T	c.(8116-8118)GCT>TCT	p.A2706S	TTN_uc010zfh.1_Missense_Mutation_p.A2660S|TTN_uc010zfi.1_Missense_Mutation_p.A2660S|TTN_uc010zfj.1_Missense_Mutation_p.A2660S|TTN_uc002unb.2_Missense_Mutation_p.A2706S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2706							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTACTTGCCTTCAACTTTG	0.358													10	49	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179648829	179648829	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179648829G>C	uc010zfg.1	-	16	2967	c.2743C>G	c.(2743-2745)CGC>GGC	p.R915G	TTN_uc010zfh.1_Missense_Mutation_p.R869G|TTN_uc010zfi.1_Missense_Mutation_p.R869G|TTN_uc010zfj.1_Missense_Mutation_p.R869G|TTN_uc002unb.2_Missense_Mutation_p.R915G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	915							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTCAAAGCGCTCTTCACGG	0.552													47	64	---	---	---	---	PASS
DUSP19	142679	broad.mit.edu	37	2	183943829	183943829	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183943829T>C	uc002upd.2	+	1	543	c.168T>C	c.(166-168)TAT>TAC	p.Y56Y	DUSP19_uc010frp.2_Silent_p.Y56Y|DUSP19_uc010zfr.1_RNA|DUSP19_uc002upe.2_Silent_p.Y56Y	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19 isoform 1	56					JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity			ovary(4)|pancreas(1)	5						GTTGTGGTTATGTGCAGGACC	0.453													46	50	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185803426	185803426	+	Silent	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185803426T>A	uc002uph.2	+	4	3897	c.3303T>A	c.(3301-3303)ACT>ACA	p.T1101T		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1101						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						TCCATCACACTGTTTtgcagc	0.373													25	88	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198950611	198950611	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198950611G>C	uc010fsp.2	+	2	2661	c.2370G>C	c.(2368-2370)GAG>GAC	p.E790D	PLCL1_uc002uuv.3_Missense_Mutation_p.E711D	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	790	C2.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	ACCTACCTGAGCTGGCCATGA	0.393													69	67	---	---	---	---	PASS
CLK1	1195	broad.mit.edu	37	2	201722523	201722523	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201722523G>C	uc002uwe.2	-	7	931	c.750C>G	c.(748-750)GAC>GAG	p.D250E	CLK1_uc002uwd.2_Missense_Mutation_p.D73E|CLK1_uc010zhi.1_Missense_Mutation_p.D292E|CLK1_uc002uwf.2_Missense_Mutation_p.D24E|CLK1_uc002uwg.2_Missense_Mutation_p.D99E|CLK1_uc010fsv.2_RNA	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1	250	Protein kinase.				cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						CTTTAATGAAGTCGTAAGTAC	0.368													21	48	---	---	---	---	PASS
MPP4	58538	broad.mit.edu	37	2	202550668	202550668	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202550668A>T	uc002uyk.3	-	6	674	c.466T>A	c.(466-468)TGT>AGT	p.C156S	MPP4_uc010ftj.2_Missense_Mutation_p.C156S|MPP4_uc010zhq.1_Missense_Mutation_p.C156S|MPP4_uc010zhr.1_Missense_Mutation_p.C156S|MPP4_uc010zhs.1_Intron|MPP4_uc002uyj.3_Intron|MPP4_uc010zht.1_Missense_Mutation_p.C129S|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Missense_Mutation_p.C156S|MPP4_uc002uym.1_Intron|MPP4_uc002uyn.2_Intron	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4	156	PDZ.					cytoplasm	protein binding				0						TTCACTAAACAAACAATCCTC	0.413													34	114	---	---	---	---	PASS
NOP58	51602	broad.mit.edu	37	2	203167649	203167649	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203167649G>A	uc002uzb.2	+	14	1558	c.1408G>A	c.(1408-1410)GAA>AAA	p.E470K		NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog	470	Lys-rich.				cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						TTCAGTTgaagaagaggaaga	0.244													49	51	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204066306	204066306	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204066306G>C	uc002uzt.3	+	49	7525	c.7192G>C	c.(7192-7194)GAG>CAG	p.E2398Q	NBEAL1_uc002uzs.3_Missense_Mutation_p.E1039Q	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	2398							binding			ovary(1)|skin(1)	2						TCCCGGGCTAGAGATCACTTC	0.383													34	108	---	---	---	---	PASS
C2orf80	389073	broad.mit.edu	37	2	209045987	209045987	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209045987T>C	uc002vcr.2	-	5	421	c.249A>G	c.(247-249)AGA>AGG	p.R83R		NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073	83										skin(1)	1						CTTCTCGTTCTCTACGATTTG	0.353													20	71	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212426717	212426717	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212426717G>A	uc002veg.1	-	20	2496	c.2398C>T	c.(2398-2400)CCC>TCC	p.P800S	ERBB4_uc002veh.1_Missense_Mutation_p.P800S|ERBB4_uc010zji.1_Missense_Mutation_p.P790S|ERBB4_uc010zjj.1_Missense_Mutation_p.P790S|ERBB4_uc010fut.1_Missense_Mutation_p.P800S	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	800	Protein kinase.|Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CAGCCATGGGGCATAAGTTGA	0.507										TSP Lung(8;0.080)			45	70	---	---	---	---	PASS
SPAG16	79582	broad.mit.edu	37	2	215274882	215274882	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215274882C>A	uc002veq.2	+	16	1831	c.1739C>A	c.(1738-1740)GCA>GAA	p.A580E	SPAG16_uc002ver.2_Missense_Mutation_p.A526E|SPAG16_uc010zjk.1_Missense_Mutation_p.A486E|VWC2L_uc002vet.2_5'Flank|VWC2L_uc010zjl.1_5'Flank	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1	580	WD 6.				cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TTAGCTCAGGCAAGTGGCAAT	0.423													17	55	---	---	---	---	PASS
VWC2L	402117	broad.mit.edu	37	2	215440412	215440412	+	Silent	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215440412A>T	uc002vet.2	+	4	667	c.537A>T	c.(535-537)GCA>GCT	p.A179A	VWC2L_uc010zjl.1_Missense_Mutation_p.Q136L	NM_001080500	NP_001073969	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain-containing	179						extracellular region					0						ACTGCTTTGCAGGAACGACGA	0.478													40	91	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216289835	216289835	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216289835C>T	uc002vfa.2	-	7	1284	c.1018G>A	c.(1018-1020)GTC>ATC	p.V340I	FN1_uc002vfb.2_Missense_Mutation_p.V340I|FN1_uc002vfc.2_Missense_Mutation_p.V340I|FN1_uc002vfd.2_Missense_Mutation_p.V340I|FN1_uc002vfe.2_Missense_Mutation_p.V340I|FN1_uc002vff.2_Missense_Mutation_p.V340I|FN1_uc002vfg.2_Missense_Mutation_p.V340I|FN1_uc002vfh.2_Missense_Mutation_p.V340I|FN1_uc002vfi.2_Missense_Mutation_p.V340I|FN1_uc002vfj.2_Missense_Mutation_p.V340I|FN1_uc002vfl.2_Missense_Mutation_p.V340I	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	340	Fibronectin type-I 6.|Collagen-binding.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGCAGCTGACTCCGTTGCCC	0.423													79	154	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225717649	225717649	+	Intron	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225717649T>C	uc010fwz.1	-						DOCK10_uc002vob.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ACTTATATCATACCTTGTTGA	0.328													21	45	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228115904	228115904	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228115904C>A	uc002vom.1	+	10	757	c.595C>A	c.(595-597)CCT>ACT	p.P199T	COL4A3_uc002von.1_Missense_Mutation_p.P199T|COL4A3_uc002voo.1_Missense_Mutation_p.P199T|COL4A3_uc002vop.1_Missense_Mutation_p.P199T|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	199	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		CCCACCTGGTCCTCCGGGATT	0.358													23	60	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241534701	241534701	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241534701G>T	uc002vzk.1	+	7	1442	c.1258G>T	c.(1258-1260)GTG>TTG	p.V420L	CAPN10_uc010zoh.1_Missense_Mutation_p.V420L|CAPN10_uc002vzl.1_Missense_Mutation_p.V420L|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Missense_Mutation_p.V292L|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	420	Domain III 1.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		CTACCAGGCTGTGGGTCTGCA	0.662													8	18	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242396180	242396180	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242396180C>A	uc002wbi.1	+	14	1547	c.1430C>A	c.(1429-1431)CCT>CAT	p.P477H	FARP2_uc010zoq.1_Missense_Mutation_p.P477H|FARP2_uc010zor.1_Missense_Mutation_p.P477H	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	477	Pro-rich.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ACGAAGAGTCCTCAGCCTTCT	0.597													4	129	---	---	---	---	PASS
NGLY1	55768	broad.mit.edu	37	3	25792627	25792627	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25792627G>A	uc003cdl.2	-	4	728	c.620C>T	c.(619-621)TCA>TTA	p.S207L	NGLY1_uc010hfg.2_Missense_Mutation_p.S207L|NGLY1_uc003cdm.2_Missense_Mutation_p.S207L|NGLY1_uc011awo.1_Missense_Mutation_p.S165L|NGLY1_uc003cdk.2_RNA	NM_018297	NP_060767	Q96IV0	NGLY1_HUMAN	N-glycanase 1 isoform 1	207					glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1						CTTTTCTTGTGATTTCCTTTT	0.348													21	8	---	---	---	---	PASS
CMTM7	112616	broad.mit.edu	37	3	32483427	32483427	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32483427G>C	uc003cey.1	+	2	491	c.255G>C	c.(253-255)TTG>TTC	p.L85F	CMTM7_uc003cez.1_Missense_Mutation_p.L85F	NM_138410	NP_612419	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing	85	Helical; (Potential).|MARVEL.				chemotaxis	extracellular space|integral to membrane	cytokine activity				0						TTTGCGACTTGATAATGATCC	0.562													65	40	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38601752	38601752	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38601752G>T	uc003cio.2	-	23	4325	c.4131C>A	c.(4129-4131)ATC>ATA	p.I1377I	SCN5A_uc003cin.2_Silent_p.I1376I|SCN5A_uc003cil.3_Silent_p.I1377I|SCN5A_uc010hhi.2_Silent_p.I1377I|SCN5A_uc010hhk.2_Silent_p.I1376I|SCN5A_uc011ayr.1_Silent_p.I1323I|SCN5A_uc010hhj.1_Silent_p.I987I	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1377					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	TGTTGTTCACGATGGTGTAGT	0.522													19	12	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38888607	38888607	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38888607C>T	uc011ays.1	-	26	5153	c.4954G>A	c.(4954-4956)GCC>ACC	p.A1652T		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1652					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	TCAGGCAAGGCATCAGCAAAG	0.418													50	26	---	---	---	---	PASS
ZNF619	285267	broad.mit.edu	37	3	40529090	40529090	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40529090G>T	uc011azb.1	+	6	1487	c.1209G>T	c.(1207-1209)CAG>CAT	p.Q403H	ZNF619_uc010hhz.2_Missense_Mutation_p.Q354H|ZNF619_uc003ckj.2_Missense_Mutation_p.Q347H|ZNF619_uc011azc.1_Missense_Mutation_p.Q363H|ZNF619_uc011azd.1_Missense_Mutation_p.Q319H|ZNF619_uc011aza.1_Missense_Mutation_p.Q305H	NM_001145082	NP_001138554	E9PCD9	E9PCD9_HUMAN	zinc finger protein 619 isoform 1	403					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TTCAGCATCAGAGAATCCACA	0.468													27	23	---	---	---	---	PASS
SMARCC1	6599	broad.mit.edu	37	3	47704056	47704056	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47704056C>G	uc003crq.2	-	20	2044	c.1926G>C	c.(1924-1926)TGG>TGC	p.W642C	SMARCC1_uc011bbc.1_RNA|SMARCC1_uc011bbd.1_Missense_Mutation_p.W533C	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated	642	SANT.				chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		ACACTTTGTTCCAATCATCCT	0.398													43	14	---	---	---	---	PASS
ATRIP	84126	broad.mit.edu	37	3	48501837	48501837	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48501837A>G	uc003ctf.1	+	8	1416	c.1384A>G	c.(1384-1386)ACC>GCC	p.T462A	ATRIP_uc011bbj.1_Missense_Mutation_p.T335A|ATRIP_uc003ctg.1_Missense_Mutation_p.T462A|TREX1_uc010hjy.2_Intron	NM_130384	NP_569055	Q8WXE1	ATRIP_HUMAN	ATR interacting protein isoform 1	462					DNA damage checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding|protein serine/threonine kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGGGTAGAGACCAACCCTGA	0.587								Other_conserved_DNA_damage_response_genes					41	22	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48678785	48678785	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48678785A>G	uc003cul.2	-	33	9278	c.8997T>C	c.(8995-8997)TCT>TCC	p.S2999S	CELSR3_uc003cuf.1_Silent_p.S3097S|CELSR3_uc010hkf.2_Silent_p.S289S|CELSR3_uc010hkg.2_Silent_p.S982S	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2999	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCCGGCCCAGAGAAGTCTCAT	0.647													65	33	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48696418	48696418	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48696418T>A	uc003cul.2	-	1	3931	c.3650A>T	c.(3649-3651)CAG>CTG	p.Q1217L	CELSR3_uc003cuf.1_Missense_Mutation_p.Q1287L	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	1217	Extracellular (Potential).|Cadherin 9.				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TACCAGCAGCTGCAGCTCATT	0.572													25	9	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53752342	53752342	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53752342A>T	uc003dgv.3	+	10	1568	c.1405A>T	c.(1405-1407)AGC>TGC	p.S469C	CACNA1D_uc003dgu.3_Missense_Mutation_p.S469C|CACNA1D_uc003dgy.3_Missense_Mutation_p.S469C|CACNA1D_uc003dgw.3_Missense_Mutation_p.S116C	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	469	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	CATGCCCACCAGCGAGACTGA	0.627													43	20	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64627625	64627625	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64627625G>A	uc003dmg.2	-	12	1787	c.1755C>T	c.(1753-1755)CCC>CCT	p.P585P	ADAMTS9_uc011bfo.1_Silent_p.P557P|ADAMTS9_uc003dmh.1_Silent_p.P414P|ADAMTS9_uc003dmk.1_Silent_p.P585P	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	585	Disintegrin.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CATCTGTCACGGGGACATCCA	0.493													90	33	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74344369	74344369	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74344369G>T	uc003dpm.1	-	18	2500	c.2420C>A	c.(2419-2421)TCT>TAT	p.S807Y		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	807	Fibronectin type-III 3.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AGAGACTTGAGATGGGGCCAC	0.368													34	26	---	---	---	---	PASS
CADM2	253559	broad.mit.edu	37	3	85961688	85961688	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85961688T>C	uc003dqj.2	+	5	1294	c.668T>C	c.(667-669)ATA>ACA	p.I223T	CADM2_uc003dqk.2_Missense_Mutation_p.I232T|CADM2_uc003dql.2_Missense_Mutation_p.I225T	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	223	Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		GTGCTAGAAATACACTGTAAG	0.458													28	18	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89498461	89498461	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89498461G>T	uc003dqy.2	+	14	2658	c.2433G>T	c.(2431-2433)GGG>GGT	p.G811G	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	811	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GGAGTTATGGGATTGTTCTCT	0.448										TSP Lung(6;0.00050)			61	35	---	---	---	---	PASS
TBC1D23	55773	broad.mit.edu	37	3	100018091	100018091	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100018091C>T	uc003dtt.2	+	10	1185	c.1008C>T	c.(1006-1008)GTC>GTT	p.V336V	TBC1D23_uc003dts.2_Silent_p.V336V	NM_018309	NP_060779	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	336	Rhodanese.					intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2						AGGAAGGAGTCCGGTTCTTTG	0.398													33	33	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105439079	105439079	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105439079C>A	uc003dwc.2	-	10	1541	c.1219G>T	c.(1219-1221)GGC>TGC	p.G407C	CBLB_uc011bhi.1_Missense_Mutation_p.G429C|CBLB_uc003dwd.1_Missense_Mutation_p.G407C|CBLB_uc003dwe.1_Missense_Mutation_p.G407C|CBLB_uc011bhj.1_RNA	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	407	RING-type.				cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						AAAGGGCAGCCCTGACCATCC	0.408			Mis S		AML								18	16	---	---	---	---	PASS
RETNLB	84666	broad.mit.edu	37	3	108475364	108475364	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108475364A>T	uc003dxh.2	-	2	297	c.199T>A	c.(199-201)TGC>AGC	p.C67S		NM_032579	NP_115968	Q9BQ08	RETNB_HUMAN	resistin like beta precursor	67					cell proliferation	extracellular region	hormone activity			skin(1)	1						CCAGCAGGGCAGGAGGACGGT	0.547													13	60	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109049497	109049497	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109049497G>T	uc003dxq.3	-	5	608	c.553C>A	c.(553-555)CTC>ATC	p.L185I	DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Missense_Mutation_p.L185I	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	185						nucleus	protein binding			upper_aerodigestive_tract(1)	1						CCCTCAAGGAGAGCAGTGGAA	0.572													29	90	---	---	---	---	PASS
KTELC1	56983	broad.mit.edu	37	3	119198946	119198946	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119198946G>A	uc003ecm.2	+	5	589	c.505G>A	c.(505-507)GGG>AGG	p.G169R	KTELC1_uc011biz.1_RNA|KTELC1_uc011bja.1_Missense_Mutation_p.G10R	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor	169						endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)		ATTTTGGGAAGGGGGACCTGC	0.433													39	49	---	---	---	---	PASS
HGD	3081	broad.mit.edu	37	3	120363167	120363167	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120363167T>A	uc003edw.2	-	10	1143	c.773A>T	c.(772-774)CAG>CTG	p.Q258L	HGD_uc003edv.2_Missense_Mutation_p.Q117L	NM_000187	NP_000178	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	258					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	homogentisate 1,2-dioxygenase activity|metal ion binding				0				GBM - Glioblastoma multiforme(114;0.158)		TTACTTTACCTGTTTGGCAGC	0.338													58	171	---	---	---	---	PASS
FBXO40	51725	broad.mit.edu	37	3	121341801	121341801	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121341801C>A	uc003eeg.2	+	3	1735	c.1525C>A	c.(1525-1527)CAT>AAT	p.H509N		NM_016298	NP_057382	Q9UH90	FBX40_HUMAN	F-box protein 40	509					muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(114;0.189)		CTGGTTCCAGCATCGATGCCC	0.483													19	25	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130290070	130290070	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130290070G>C	uc010htl.2	+	6	2841	c.2810G>C	c.(2809-2811)CGG>CCG	p.R937P		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	937	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						AAGGCCTTGCGGGACAAAGGC	0.557													38	34	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132241716	132241716	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132241716T>C	uc003eor.2	+	49	5783	c.5718T>C	c.(5716-5718)GAT>GAC	p.D1906D		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1906							heat shock protein binding			ovary(1)|breast(1)	2						TTTTCATGGATGCTATGAGAG	0.348													26	30	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134825429	134825429	+	Silent	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134825429A>T	uc003eqt.2	+	4	1165	c.945A>T	c.(943-945)CCA>CCT	p.P315P	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Missense_Mutation_p.Q204L|EPHB1_uc003equ.2_5'UTR	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	315	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TTGACCCTCCAGAAGTGGCAT	0.587													27	33	---	---	---	---	PASS
CPA3	1359	broad.mit.edu	37	3	148597673	148597673	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148597673T>C	uc003ewm.2	+	6	625	c.573T>C	c.(571-573)TAT>TAC	p.Y191Y		NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor	191					proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GGTTTGTCTATCAGGTAAGTG	0.453													41	82	---	---	---	---	PASS
TSC22D2	9819	broad.mit.edu	37	3	150128173	150128173	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150128173G>A	uc003exv.2	+	1	1386	c.1036G>A	c.(1036-1038)GTG>ATG	p.V346M	TSC22D2_uc003exw.2_RNA|TSC22D2_uc003exx.2_Missense_Mutation_p.V346M	NM_014779	NP_055594	O75157	T22D2_HUMAN	TSC22 domain family, member 2	346							sequence-specific DNA binding transcription factor activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GGGCCCTGCAGTGGGCGCCCC	0.721													5	19	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151075017	151075017	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151075017G>T	uc003eyp.2	+	18	2611	c.2573G>T	c.(2572-2574)AGT>ATT	p.S858I	MED12L_uc011bnz.1_Missense_Mutation_p.S718I|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Missense_Mutation_p.S22I	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	858					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AATGAACTGAGTGTTGTGGAA	0.398													16	73	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154866431	154866431	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154866431G>T	uc010hvr.1	+	16	1801	c.1590G>T	c.(1588-1590)GTG>GTT	p.V530V	MME_uc003fab.1_Silent_p.V530V|MME_uc003fac.1_Silent_p.V530V|MME_uc003fad.1_Silent_p.V530V|MME_uc003fae.1_Silent_p.V530V	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	530	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	GAGAAAAGGTGGACAAAGATG	0.358													30	192	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	157098948	157098948	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157098948C>G	uc003fbj.1	-	7	1441	c.1124G>C	c.(1123-1125)GGC>GCC	p.G375A	VEPH1_uc003fbk.1_Missense_Mutation_p.G375A|VEPH1_uc010hvu.1_Missense_Mutation_p.G375A	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	375						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TGCTCACCTGCCACTTCCAGC	0.517													34	159	---	---	---	---	PASS
RSRC1	51319	broad.mit.edu	37	3	157839991	157839991	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157839991G>T	uc003fbt.2	+	2	209	c.98G>T	c.(97-99)AGA>ATA	p.R33I	RSRC1_uc011bou.1_Missense_Mutation_p.R33I|RSRC1_uc003fbu.1_Missense_Mutation_p.R33I|RSRC1_uc003fbv.2_Missense_Mutation_p.R33I	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	33	Arg/Ser-rich.				nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			TCAGATAGTAGAACATACAGC	0.433													10	48	---	---	---	---	PASS
GFM1	85476	broad.mit.edu	37	3	158408930	158408930	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158408930C>T	uc003fce.2	+	17	2180	c.2073C>T	c.(2071-2073)GTC>GTT	p.V691V	GFM1_uc003fcf.2_RNA|GFM1_uc003fcg.2_Silent_p.V622V	NM_024996	NP_079272	Q96RP9	EFGM_HUMAN	G elongation factor, mitochondrial 1 precursor	691					mitochondrial translational elongation	mitochondrion	GTP binding|GTPase activity|translation elongation factor activity			ovary(3)|central_nervous_system(1)	4			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GTTTTCAGGTCCCTCTAAATG	0.338													12	86	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164700133	164700133	+	Silent	SNP	G	T	T	rs147742320		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164700133G>T	uc003fei.2	-	47	5375	c.5313C>A	c.(5311-5313)TCC>TCA	p.S1771S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1771	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	p.S1771S(1)		ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	ATACATGAAGGGATCCAAGCC	0.348										HNSCC(35;0.089)			27	65	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164700156	164700156	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164700156T>A	uc003fei.2	-	47	5352	c.5290A>T	c.(5290-5292)AAA>TAA	p.K1764*		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1764	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	GTTTCACTTTTATTTATGTAA	0.338										HNSCC(35;0.089)			21	52	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164792437	164792437	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164792437G>A	uc003fei.2	-	3	199	c.137C>T	c.(136-138)TCA>TTA	p.S46L		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	46	Ser/Thr-rich.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	AGCTGGAGTTGAAGTAGAATC	0.318										HNSCC(35;0.089)			25	179	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167031801	167031801	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167031801G>T	uc003fep.2	-	16	1701	c.1378C>A	c.(1378-1380)CTG>ATG	p.L460M	ZBBX_uc011bpc.1_Missense_Mutation_p.L460M|ZBBX_uc003feq.2_Missense_Mutation_p.L431M	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	460						intracellular	zinc ion binding			ovary(2)	2						CTGTTTCTCAGACAAAGATTT	0.313													116	103	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169890469	169890469	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169890469C>T	uc010hws.1	-	3	240	c.176G>A	c.(175-177)AGC>AAC	p.S59N	PHC3_uc003fgl.2_Missense_Mutation_p.S71N|PHC3_uc011bpq.1_Missense_Mutation_p.S71N|PHC3_uc011bpr.1_Missense_Mutation_p.S71N|PHC3_uc003fgm.2_Missense_Mutation_p.S71N|PHC3_uc003fgo.1_Missense_Mutation_p.S55N|PHC3_uc003fgp.3_Missense_Mutation_p.S67N|PHC3_uc003fgq.3_Missense_Mutation_p.S71N	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	59					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AGCAGCTGAGCTGGGGGGCCG	0.448													67	198	---	---	---	---	PASS
MFN1	55669	broad.mit.edu	37	3	179096536	179096536	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179096536A>G	uc003fjs.2	+	14	1722	c.1596A>G	c.(1594-1596)GTA>GTG	p.V532V	MFN1_uc010hxb.2_RNA|MFN1_uc003fjt.2_Silent_p.V560V|MFN1_uc010hxc.2_Intron	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	532	Cytoplasmic (Potential).				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			CTTCCCTTGTACATCGATTTT	0.373													32	273	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	183014925	183014925	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183014925G>T	uc003fli.1	-	12	1426	c.1336C>A	c.(1336-1338)CTC>ATC	p.L446I	MCF2L2_uc003flj.1_Missense_Mutation_p.L446I|MCF2L2_uc011bqr.1_Intron|uc003fln.1_RNA|uc003flo.2_5'Flank	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	446					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GAAGCCAAGAGGTAGATTCCT	0.532													40	296	---	---	---	---	PASS
ABCC5	10057	broad.mit.edu	37	3	183667579	183667579	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183667579G>A	uc003fmg.2	-	22	3354	c.3189C>T	c.(3187-3189)ACC>ACT	p.T1063T	ABCC5_uc011bqt.1_Silent_p.T591T|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	1063	ABC transmembrane type-1 2.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AGGCGTGGATGGTGGCAAGGC	0.552													123	199	---	---	---	---	PASS
ABCC5	10057	broad.mit.edu	37	3	183669786	183669786	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183669786G>A	uc003fmg.2	-	19	2838	c.2673C>T	c.(2671-2673)ACC>ACT	p.T891T	ABCC5_uc011bqt.1_Silent_p.T419T|ABCC5_uc010hxl.2_Silent_p.T891T	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	891	ABC transmembrane type-1 2.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GAGTCACAGTGGTGTTCTGTT	0.547													126	222	---	---	---	---	PASS
ATP8A1	10396	broad.mit.edu	37	4	42592907	42592907	+	Intron	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42592907C>T	uc003gwr.2	-						ATP8A1_uc003gws.2_Intron|ATP8A1_uc011byz.1_Intron	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),						ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	GCCACCTACACGTCCCAGTAT	0.378													18	22	---	---	---	---	PASS
GABRA2	2555	broad.mit.edu	37	4	46307694	46307694	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46307694C>A	uc003gxc.3	-	6	1267	c.594G>T	c.(592-594)TGG>TGT	p.W198C	GABRA2_uc010igc.2_Missense_Mutation_p.W198C|GABRA2_uc011bzc.1_Missense_Mutation_p.W143C|GABRA2_uc003gxe.2_Missense_Mutation_p.W198C	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	198	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CATTGTAAGTCCAAATATAAG	0.358													13	16	---	---	---	---	PASS
GABRA2	2555	broad.mit.edu	37	4	46307695	46307695	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46307695C>A	uc003gxc.3	-	6	1266	c.593G>T	c.(592-594)TGG>TTG	p.W198L	GABRA2_uc010igc.2_Missense_Mutation_p.W198L|GABRA2_uc011bzc.1_Missense_Mutation_p.W143L|GABRA2_uc003gxe.2_Missense_Mutation_p.W198L	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	198	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATTGTAAGTCCAAATATAAGT	0.363													13	16	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52864046	52864046	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52864046G>A	uc003gzi.2	-	3	737	c.724C>T	c.(724-726)CTA>TTA	p.L242L		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	242						integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						GGAAATTCTAGAGCTATGATC	0.393													89	78	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57181005	57181005	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57181005A>G	uc003hbk.2	+	8	1728	c.1337A>G	c.(1336-1338)GAG>GGG	p.E446G	KIAA1211_uc010iha.2_Missense_Mutation_p.E439G|KIAA1211_uc011bzz.1_Missense_Mutation_p.E356G|KIAA1211_uc003hbm.1_Missense_Mutation_p.E332G	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	446	Glu-rich.									ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					GAACACTCCGAGGAGCCAGGT	0.617													7	33	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66280001	66280001	+	Splice_Site	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66280001C>G	uc003hcy.2	-	7	1880	c.1687_splice	c.e7+1	p.F563_splice	EPHA5_uc003hcx.2_Splice_Site_p.S494_splice|EPHA5_uc003hcz.2_Splice_Site_p.F563_splice|EPHA5_uc011cah.1_Splice_Site_p.S563_splice|EPHA5_uc011cai.1_Splice_Site_p.S563_splice|EPHA5_uc003hda.2_Splice_Site_p.S563_splice	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						AAATGACTTACACACTGGGGT	0.443										TSP Lung(17;0.13)			26	30	---	---	---	---	PASS
UGT2B4	7363	broad.mit.edu	37	4	70355265	70355265	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70355265G>T	uc003hek.3	-	3	941	c.894C>A	c.(892-894)AGC>AGA	p.S298R	UGT2B4_uc011cap.1_Missense_Mutation_p.S162R|UGT2B4_uc003hel.3_Missense_Mutation_p.S298R	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	298					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						TTTCTCCAGAGCTCTGGACAA	0.398													77	83	---	---	---	---	PASS
UGT2B4	7363	broad.mit.edu	37	4	70361031	70361031	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70361031A>G	uc003hek.3	-	1	596	c.549T>C	c.(547-549)CAT>CAC	p.H183H	UGT2B4_uc011cap.1_Silent_p.H47H|UGT2B4_uc003hel.3_Silent_p.H183H	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	183					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						GTCCTCCACTATGCTTTTCAA	0.443													18	61	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73156630	73156630	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73156630C>G	uc003hgk.1	-	20	2910	c.2873G>C	c.(2872-2874)CGC>CCC	p.R958P		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	958	TSP type-1 3.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ACAGGGCCGGCGGCTCTCGGG	0.567													19	39	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73987360	73987360	+	Silent	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73987360T>G	uc003hgp.2	-	19	3726	c.3609A>C	c.(3607-3609)CTA>CTC	p.L1203L	ANKRD17_uc003hgo.2_Silent_p.L1090L|ANKRD17_uc003hgq.2_Silent_p.L952L|ANKRD17_uc003hgr.2_Silent_p.L1202L|ANKRD17_uc011cbd.1_Silent_p.L768L	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1203	ANK 19.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTCCTGCATTTAGTAATATTT	0.383													49	54	---	---	---	---	PASS
AFM	173	broad.mit.edu	37	4	74364930	74364930	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74364930G>T	uc003hhb.2	+	11	1420	c.1389G>T	c.(1387-1389)ACG>ACT	p.T463T		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	463	Albumin 3.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTTGCTGTACGCTAAGTGAAG	0.408													14	41	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77290576	77290576	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77290576G>A	uc003hkb.3	-							NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6						TGCAGGCACTGACCTGCCGCT	0.507													22	18	---	---	---	---	PASS
THAP9	79725	broad.mit.edu	37	4	83839358	83839358	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83839358C>T	uc003hnt.2	+	5	2112	c.1993C>T	c.(1993-1995)CGA>TGA	p.R665*	THAP9_uc003hns.1_Nonsense_Mutation_p.R521*|THAP9_uc003hnu.1_RNA|THAP9_uc003hnv.2_Nonsense_Mutation_p.R382*	NM_024672	NP_078948	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	665							DNA binding|metal ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5		Hepatocellular(203;0.114)				TTCAATTGCTCGAAGGAAAGA	0.398													17	75	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84376793	84376793	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84376793G>A	uc003hom.2	-	1	233	c.54C>T	c.(52-54)AAC>AAT	p.N18N	HELQ_uc010ikb.2_Silent_p.N18N|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA|HELQ_uc003hon.1_5'UTR|HELQ_uc003hoo.1_Silent_p.N18N|HELQ_uc003hop.1_5'UTR|HELQ_uc003hoq.1_Silent_p.N18N|MRPS18C_uc003hor.3_5'Flank|MRPS18C_uc011ccu.1_5'Flank	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	18							ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						AGCTTGGACGGTTCCTTTTGG	0.602								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function			OREG0016254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	41	139	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85598396	85598396	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85598396T>G	uc003hpd.2	-	67	10821	c.10413A>C	c.(10411-10413)GAA>GAC	p.E3471D	WDFY3_uc003hpc.2_Missense_Mutation_p.E226D	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	3471	FYVE-type.					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGTGTCGTCTTTCTGTGAGTG	0.473													14	72	---	---	---	---	PASS
HSD17B13	345275	broad.mit.edu	37	4	88235003	88235003	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88235003T>A	uc003hqo.2	-	5	730	c.667A>T	c.(667-669)ACT>TCT	p.T223S	HSD17B13_uc010ikk.2_Missense_Mutation_p.T187S	NM_178135	NP_835236	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	223						extracellular region	binding|oxidoreductase activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		GTGAACCCAGTATTCACAAAA	0.388													21	39	---	---	---	---	PASS
PKD2	5311	broad.mit.edu	37	4	88989126	88989126	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88989126C>T	uc003hre.2	+	13	2501	c.2435C>T	c.(2434-2436)TCT>TTT	p.S812F	PKD2_uc011cdf.1_Missense_Mutation_p.S230F|PKD2_uc011cdg.1_Missense_Mutation_p.S138F|PKD2_uc011cdh.1_Missense_Mutation_p.S35F	NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2	812	Linker.|Cytoplasmic (Potential).					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		CTGGATGACTCTGAGGAGGAT	0.488													11	50	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90874208	90874208	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90874208A>G	uc003hst.2	+	8	3397	c.3326A>G	c.(3325-3327)TAT>TGT	p.Y1109C	MMRN1_uc010iku.2_Missense_Mutation_p.Y412C|MMRN1_uc011cds.1_Missense_Mutation_p.Y851C	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	1109	C1q.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TCTCATACGTATGGAATGACT	0.353													28	86	---	---	---	---	PASS
NDST3	9348	broad.mit.edu	37	4	118975630	118975630	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118975630G>A	uc003ibx.2	+	2	968	c.565G>A	c.(565-567)GCA>ACA	p.A189T	NDST3_uc011cgf.1_Missense_Mutation_p.A189T|NDST3_uc003ibw.2_Missense_Mutation_p.A189T	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	189	Lumenal (Potential).|Heparan sulfate N-deacetylase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						TGGAAATCTTGCAGTAAAAGA	0.378													22	87	---	---	---	---	PASS
PDE5A	8654	broad.mit.edu	37	4	120528376	120528376	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120528376C>T	uc003idh.2	-	2	384	c.229G>A	c.(229-231)GAA>AAA	p.E77K	PDE5A_uc003idf.2_Missense_Mutation_p.E35K|PDE5A_uc003idg.2_Missense_Mutation_p.E25K	NM_001083	NP_001074	O76074	PDE5A_HUMAN	phosphodiesterase 5A isoform 1	77					platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)	GAGCAAGATTCGGTGTGGCCT	0.517													14	52	---	---	---	---	PASS
BBS7	55212	broad.mit.edu	37	4	122774121	122774121	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122774121C>A	uc003ied.2	-	8	1013	c.839G>T	c.(838-840)CGA>CTA	p.R280L	BBS7_uc003iee.1_Missense_Mutation_p.R280L	NM_176824	NP_789794	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7 protein isoform a	280					cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding			ovary(1)	1						CTGATCAAATCGTAGAACAGG	0.308									Bardet-Biedl_syndrome				15	19	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123178522	123178522	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123178522G>C	uc003ieh.2	+	39	6536	c.6491G>C	c.(6490-6492)AGA>ACA	p.R2164T	KIAA1109_uc003iel.1_Missense_Mutation_p.R99T|KIAA1109_uc003iek.2_Missense_Mutation_p.R783T	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2164					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AGCTTACATAGACCAGCTCAG	0.448													60	80	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126389770	126389770	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126389770A>G	uc003ifj.3	+	11	12003	c.12003A>G	c.(12001-12003)AAA>AAG	p.K4001K	FAT4_uc011cgp.1_Silent_p.K2264K|FAT4_uc003ifi.1_Silent_p.K1479K	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4001	Laminin G-like 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TTTATGTCAAATTTGCCACGA	0.403													24	33	---	---	---	---	PASS
PHF17	79960	broad.mit.edu	37	4	129776951	129776951	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129776951A>C	uc003igk.2	+	7	1143	c.863A>C	c.(862-864)GAG>GCG	p.E288A	PHF17_uc003igj.2_Missense_Mutation_p.E288A|PHF17_uc003igl.2_Missense_Mutation_p.E276A|PHF17_uc011cgy.1_Missense_Mutation_p.E288A|PHF17_uc003igm.2_Missense_Mutation_p.E288A	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	288					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0						TGGATCCCTGAGGTACGTGTG	0.318													15	25	---	---	---	---	PASS
MAP9	79884	broad.mit.edu	37	4	156289766	156289766	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156289766T>A	uc003ios.2	-	5	944	c.680A>T	c.(679-681)AAA>ATA	p.K227I	MAP9_uc011cin.1_Missense_Mutation_p.K226I|MAP9_uc010iqa.1_RNA|MAP9_uc003iot.1_Missense_Mutation_p.K226I|MAP9_uc010iqb.1_Missense_Mutation_p.K154I	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein	227					cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		AGAGAATGCTTTTTTCTCAGC	0.373													23	77	---	---	---	---	PASS
GUCY1B3	2983	broad.mit.edu	37	4	156715238	156715238	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156715238G>T	uc003ipc.2	+	6	893	c.726G>T	c.(724-726)CAG>CAT	p.Q242H	GUCY1B3_uc011cio.1_Missense_Mutation_p.Q264H|GUCY1B3_uc011cip.1_Missense_Mutation_p.Q222H|GUCY1B3_uc003ipd.2_Missense_Mutation_p.Q170H|GUCY1B3_uc010iqf.2_Missense_Mutation_p.Q242H|GUCY1B3_uc010iqg.2_Missense_Mutation_p.Q170H|GUCY1B3_uc011ciq.1_Missense_Mutation_p.Q170H	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	242					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		TTCTCCCCCAGGTAAAATGAC	0.423													16	16	---	---	---	---	PASS
NPY5R	4889	broad.mit.edu	37	4	164271902	164271902	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164271902G>C	uc003iqn.2	+	4	659	c.477G>C	c.(475-477)CTG>CTC	p.L159L		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	159	Helical; Name=4; (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				GCTACTTTCTGATAGCTACTG	0.368													58	159	---	---	---	---	PASS
TKTL2	84076	broad.mit.edu	37	4	164393427	164393427	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164393427G>C	uc003iqp.3	-	1	1621	c.1460C>G	c.(1459-1461)CCA>CGA	p.P487R		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	487						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ATTTTCTTGTGGGGTATAAAT	0.463													44	113	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169158919	169158919	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169158919G>A	uc003irp.2	-	31	4484	c.4192C>T	c.(4192-4194)CTG>TTG	p.L1398L		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1398							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TTGAAGGACAGCAATGAATGC	0.348													42	41	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177100702	177100702	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177100702G>T	uc003iuj.2	+	31	4097	c.3941G>T	c.(3940-3942)GGG>GTG	p.G1314V	WDR17_uc003iuk.2_Missense_Mutation_p.G1290V|WDR17_uc003ium.3_Missense_Mutation_p.G1275V|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.G525V	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	1314										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TCACCTTTAGGGACTGGAATA	0.388													40	61	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189020207	189020207	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189020207G>A	uc003izl.2	-	4	489	c.453C>T	c.(451-453)GGC>GGT	p.G151G	TRIML2_uc003izj.1_5'UTR|TRIML2_uc003izk.1_5'UTR|TRIML2_uc011cle.1_Silent_p.G201G|TRIML2_uc011clf.1_Silent_p.G201G	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	151							ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		ATGCCAAGGTGCCTTCCCCAC	0.458													18	62	---	---	---	---	PASS
SLC9A3	6550	broad.mit.edu	37	5	482234	482234	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:482234C>A	uc003jbe.2	-	8	1507	c.1395G>T	c.(1393-1395)GTG>GTT	p.V465V	SLC9A3_uc011clx.1_Silent_p.V456V	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	465	Cytoplasmic (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CGCTCCTCTTCACCTTCAGCC	0.706													6	15	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7520856	7520856	+	Silent	SNP	G	T	T	rs139006667		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7520856G>T	uc003jdz.1	+	3	481	c.414G>T	c.(412-414)TCG>TCT	p.S138S		NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	138	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CGTAGGTATCGTTCTTCCTCT	0.498													9	45	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7743796	7743796	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7743796C>A	uc003jdz.1	+	15	1954	c.1887C>A	c.(1885-1887)GGC>GGA	p.G629G	ADCY2_uc011cmo.1_Silent_p.G449G	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	629	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CCGTCCTGGGCATCTCCTTTG	0.488													102	190	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13770908	13770908	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13770908A>T	uc003jfd.2	-	56	9597	c.9555T>A	c.(9553-9555)TAT>TAA	p.Y3185*	DNAH5_uc003jfc.2_5'Flank	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3185	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ATATGAACTTATAGCCCTGAA	0.423									Kartagener_syndrome				18	41	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23509588	23509588	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23509588G>T	uc003jgo.2	+	3	261	c.79G>T	c.(79-81)GCC>TCC	p.A27S		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	27	KRAB-related.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GGTCAAAGATGCCTTCAAAGA	0.438										HNSCC(3;0.000094)			30	138	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33937291	33937291	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937291C>A	uc003jic.1	+	1	803	c.446C>A	c.(445-447)CCC>CAC	p.P149H		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	149	Extracellular (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						TTCAAATGGCCCTTCGGCAAG	0.547													31	81	---	---	---	---	PASS
OSMR	9180	broad.mit.edu	37	5	38881806	38881806	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38881806G>A	uc003jln.1	+	4	725	c.358G>A	c.(358-360)GAT>AAT	p.D120N	OSMR_uc003jlm.1_Missense_Mutation_p.D120N	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor	120	Extracellular (Potential).				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					TTTGGTGGACGATGCCAAGTT	0.473													41	72	---	---	---	---	PASS
NNT	23530	broad.mit.edu	37	5	43659318	43659318	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43659318G>T	uc003joe.2	+	17	2755	c.2500G>T	c.(2500-2502)GTT>TTT	p.V834F	NNT_uc003jof.2_Missense_Mutation_p.V834F	NM_012343	NP_036475	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	834	Helical; (Potential).				tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)	CATGCCCGTCGTTATCACTGT	0.473													70	107	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262680	45262680	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262680G>T	uc003jok.2	-	8	2041	c.2016C>A	c.(2014-2016)AGC>AGA	p.S672R		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	672	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TGTGAGACAGGCTGGTCGCTG	0.587													17	34	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45461983	45461983	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45461983G>T	uc003jok.2	-	3	1001	c.976C>A	c.(976-978)CCA>ACA	p.P326T		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	326	Extracellular (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CAATCTGGTGGGAAGTCCTGC	0.408													6	24	---	---	---	---	PASS
KIF2A	3796	broad.mit.edu	37	5	61648442	61648442	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61648442G>T	uc003jsy.3	+	5	673	c.362G>T	c.(361-363)AGT>ATT	p.S121I	KIF2A_uc003jsz.3_Missense_Mutation_p.S121I|KIF2A_uc010iwp.2_Missense_Mutation_p.S121I|KIF2A_uc003jsx.3_Missense_Mutation_p.S101I|KIF2A_uc010iwq.2_5'UTR	NM_004520	NP_004511	O00139	KIF2A_HUMAN	kinesin heavy chain member 2 isoform 1	121	Globular (Potential).				blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		GCACGGCCCAGTCAATTTCCT	0.378													7	13	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63256827	63256827	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63256827G>A	uc011cqt.1	-	1	720	c.720C>T	c.(718-720)ACC>ACT	p.T240T		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	240	Cytoplasmic (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	CTCCATGGCGGGTGTCCGCTC	0.632													30	45	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66460076	66460076	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66460076G>T	uc003jut.1	+	28	4570	c.4502G>T	c.(4501-4503)CGA>CTA	p.R1501L	MAST4_uc003juw.2_Missense_Mutation_p.R1429L|MAST4_uc003jux.2_5'Flank	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	1693						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GATTACCTCCGAAAGAAAATG	0.547													9	11	---	---	---	---	PASS
TAF9	6880	broad.mit.edu	37	5	68661401	68661401	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68661401T>G	uc003jwc.1	-	2	496	c.164A>C	c.(163-165)AAA>ACA	p.K55T	TAF9_uc003jwa.2_Intron|TAF9_uc003jwb.2_Intron|TAF9_uc003jwd.1_Missense_Mutation_p.K55T|TAF9_uc003jwe.1_Missense_Mutation_p.K55T|TAF9_uc003jwf.1_Missense_Mutation_p.K55T	NM_003187	NP_003178	Q16594	TAF9_HUMAN	TAF9 RNA polymerase II, TATA box binding	55					histone H3 acetylation|negative regulation of apoptosis|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of cell growth|positive regulation of response to cytokine stimulus|positive regulation of transcription from RNA polymerase II promoter|response to interleukin-1|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	MLL1 complex|PCAF complex|pre-snoRNP complex|STAGA complex|transcription factor TFIID complex|transcription factor TFTC complex	activating transcription factor binding|C2H2 zinc finger domain binding|p53 binding|transcription coactivator activity|transcription regulatory region DNA binding				0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.1e-56)|Epithelial(20;9.54e-53)|all cancers(19;2.2e-48)|Lung(70;0.0176)		TGAATAAATTTTTGCATCATC	0.428													30	64	---	---	---	---	PASS
RAD17	5884	broad.mit.edu	37	5	68666993	68666993	+	5'Flank	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68666993C>G	uc003jwo.2	+						RAD17_uc003jwg.2_5'UTR|RAD17_uc003jwh.2_5'UTR|RAD17_uc003jwi.2_5'UTR|RAD17_uc003jwj.2_Intron|RAD17_uc003jwk.2_5'UTR|RAD17_uc003jwl.2_5'UTR|RAD17_uc003jwm.2_5'UTR|RAD17_uc003jwn.2_5'UTR|TAF9_uc003jwa.2_5'Flank|TAF9_uc003jwb.2_5'Flank|TAF9_uc003jwd.1_5'Flank|TAF9_uc003jwe.1_5'Flank|TAF9_uc003jwf.1_5'Flank	NM_133339	NP_579917	O75943	RAD17_HUMAN	RAD17 homolog isoform 2						cell cycle|DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint|mitotic cell cycle checkpoint|negative regulation of DNA replication|regulation of phosphorylation	nucleoplasm	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		ATTTTAATGACAAAAGGTAAG	0.269								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					11	57	---	---	---	---	PASS
ZFYVE16	9765	broad.mit.edu	37	5	79743890	79743890	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79743890C>T	uc003kgr.3	+	8	3072	c.2770C>T	c.(2770-2772)CCA>TCA	p.P924S	ZFYVE16_uc003kgp.2_Missense_Mutation_p.P924S|ZFYVE16_uc003kgq.3_Missense_Mutation_p.P924S|ZFYVE16_uc003kgs.3_Missense_Mutation_p.P924S|ZFYVE16_uc003kgt.3_Intron	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	924					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		AGTGGAAAAGCCAAACAATGA	0.328													7	26	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82833026	82833026	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82833026G>A	uc003kii.3	+	8	4560	c.4204G>A	c.(4204-4206)GTG>ATG	p.V1402M	VCAN_uc003kij.3_Missense_Mutation_p.V415M|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.V66M	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	1402	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		TGCTACTGATGTGACAACCAC	0.408													13	25	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82836960	82836960	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82836960C>T	uc003kii.3	+	8	8494	c.8138C>T	c.(8137-8139)GCA>GTA	p.A2713V	VCAN_uc003kij.3_Missense_Mutation_p.A1726V|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.A1377V	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	2713	GAG-beta.			IKAEA -> EFREV (in Ref. 7; AAA36437).	cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		AAAGCTGAAGCAAAAGCCCTG	0.418													23	27	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82841364	82841364	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82841364C>A	uc003kii.3	+	9	9630	c.9274C>A	c.(9274-9276)CGC>AGC	p.R3092S	VCAN_uc003kij.3_Missense_Mutation_p.R2105S|VCAN_uc010jau.2_Missense_Mutation_p.R1338S|VCAN_uc003kik.3_Missense_Mutation_p.R351S|VCAN_uc003kil.3_Missense_Mutation_p.R1756S	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3092	EGF-like 1.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		AGGACCTGATCGCTGCAAAAT	0.458													41	138	---	---	---	---	PASS
MEF2C	4208	broad.mit.edu	37	5	88047822	88047822	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88047822G>A	uc003kjj.2	-	5	1114	c.441C>T	c.(439-441)ATC>ATT	p.I147I	MEF2C_uc003kji.2_Silent_p.I147I|MEF2C_uc003kjk.2_Silent_p.I147I|MEF2C_uc003kjm.2_Silent_p.I145I|MEF2C_uc003kjl.2_Silent_p.I165I	NM_002397	NP_002388	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C isoform 1	147	Ser-rich.				apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TGGACACTGGGATGGAGACTG	0.478										HNSCC(66;0.2)			20	58	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101582983	101582983	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101582983C>G	uc003knm.2	-	10	2071	c.1784G>C	c.(1783-1785)GGT>GCT	p.G595A		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	595	Helical; Name=10; (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TATAGGAGTACCGGCCATAAA	0.378													15	45	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101627153	101627153	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101627153C>T	uc003knm.2	-	2	800	c.513G>A	c.(511-513)AAG>AAA	p.K171K		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	171	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		GCCATCTCGGCTTATGTCCTC	0.388													10	33	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113740526	113740526	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113740526C>G	uc003kqo.2	+	3	1431	c.974C>G	c.(973-975)GCC>GGC	p.A325G		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	325	Helical; Name=Segment S5; (Potential).					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		TGGATAATTGCCGCATGGACT	0.323													44	82	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114462205	114462205	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114462205T>C	uc003kqs.2	-	10	2691	c.2182A>G	c.(2182-2184)ATG>GTG	p.M728V	TRIM36_uc011cwc.1_Missense_Mutation_p.M716V|TRIM36_uc003kqt.2_Missense_Mutation_p.M573V	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	728						acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TTCAACTACATGTCCTCTTGG	0.398													14	19	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118479539	118479539	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118479539T>A	uc003ksd.2	+	14	2561	c.2380T>A	c.(2380-2382)TAT>AAT	p.Y794N	DMXL1_uc010jcl.1_Missense_Mutation_p.Y794N	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	794										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		aaaaCAGAAATATGTTGGTGA	0.264													41	71	---	---	---	---	PASS
PRR16	51334	broad.mit.edu	37	5	120021726	120021726	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120021726G>T	uc003ksq.2	+	2	400	c.237G>T	c.(235-237)ACG>ACT	p.T79T	PRR16_uc003ksp.2_Silent_p.T56T|PRR16_uc003ksr.2_Silent_p.T9T	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	79										pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		AAACGGACACGCTGAATAGTA	0.507													23	61	---	---	---	---	PASS
UBE2D2	7322	broad.mit.edu	37	5	138994297	138994297	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138994297C>G	uc003ler.2	+	4	762	c.136C>G	c.(136-138)CAG>GAG	p.Q46E	UBE2D2_uc003leq.2_Missense_Mutation_p.Q17E	NM_003339	NP_003330	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2 isoform 1	46					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|protein binding|ubiquitin-protein ligase activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CAGTCCCTATCAGGGTGGAGT	0.338													28	57	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140215250	140215250	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140215250C>T	uc003lhq.2	+	1	1282	c.1282C>T	c.(1282-1284)CGG>TGG	p.R428W	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.R428W	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	428	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTACCGCGCGGGACGGGGG	0.617													47	88	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140216091	140216091	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140216091C>G	uc003lhq.2	+	1	2123	c.2123C>G	c.(2122-2124)TCC>TGC	p.S708C	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.S708C	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	708	Helical; (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGCGGTGTCCAGTCTGTTG	0.612													17	46	---	---	---	---	PASS
PCDHA11	56138	broad.mit.edu	37	5	140250819	140250819	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140250819G>C	uc003lia.2	+	1	2989	c.2131G>C	c.(2131-2133)GTA>CTA	p.V711L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Missense_Mutation_p.V711L	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	711	Helical; (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCTCCTGGTACTCACGCT	0.682													14	27	---	---	---	---	PASS
PCDHAC2	56134	broad.mit.edu	37	5	140346559	140346559	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140346559C>A	uc003lii.2	+	1	448	c.208C>A	c.(208-210)CGG>AGG	p.R70R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lih.2_Intron|PCDHAC2_uc011dag.1_Silent_p.R70R	NM_018899	NP_061722	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2 isoform 1	70	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTGAGCTGCGGCGCTTGGG	0.692													5	11	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140530565	140530565	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140530565C>G	uc003lir.2	+	1	727	c.727C>G	c.(727-729)CAG>GAG	p.Q243E	PCDHB6_uc011dah.1_Missense_Mutation_p.Q107E	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	243	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAGTTTGCTCAGGAGCTCTA	0.552													7	17	---	---	---	---	PASS
PCDHB8	56128	broad.mit.edu	37	5	140559017	140559017	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559017G>A	uc011dai.1	+	1	1588	c.1402G>A	c.(1402-1404)GCC>ACC	p.A468T	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	468	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAACAGCCCCGCCCTGCACAT	0.637													34	241	---	---	---	---	PASS
PCDHB11	56125	broad.mit.edu	37	5	140581299	140581299	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140581299C>T	uc003liy.2	+	1	1952	c.1952C>T	c.(1951-1953)CCG>CTG	p.P651L	PCDHB11_uc011daj.1_Missense_Mutation_p.P286L	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	651	Extracellular (Potential).|Cadherin 6.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGAGCCTCCGCGCTCGGCC	0.721													7	36	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140736526	140736526	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140736526C>T	uc003ljq.1	+	1	1759	c.1759C>T	c.(1759-1761)CTG>TTG	p.L587L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.L587L	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	587	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCGGCTACCTGGTGACCAA	0.592													41	82	---	---	---	---	PASS
PCDHGA5	56110	broad.mit.edu	37	5	140745690	140745690	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140745690C>T	uc003lju.1	+	1	1793	c.1793C>T	c.(1792-1794)TCA>TTA	p.S598L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.S598L	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	598	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACAAAGATTCAGGCCAGAAC	0.672													30	51	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140772974	140772974	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140772974C>T	uc003lkd.1	+	1	1492	c.594C>T	c.(592-594)CGC>CGT	p.R198R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Silent_p.R198R	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	198	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGAGCGCGCCCTGGACA	0.632													14	36	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140774332	140774332	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140774332A>T	uc003lkd.1	+	1	2850	c.1952A>T	c.(1951-1953)CAG>CTG	p.Q651L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.Q651L	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	651	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCATGGCCAGCCCCCTCTC	0.677													6	29	---	---	---	---	PASS
DPYSL3	1809	broad.mit.edu	37	5	146795384	146795384	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146795384T>G	uc003lon.1	-	4	476	c.366A>C	c.(364-366)AAA>AAC	p.K122N	DPYSL3_uc003loo.2_Missense_Mutation_p.K236N	NM_001387	NP_001378	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	122					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCTCTCCATTTCTCATAGG	0.537													41	105	---	---	---	---	PASS
ZNF300	91975	broad.mit.edu	37	5	150275503	150275503	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150275503C>A	uc003lsy.1	-	6	1565	c.1298G>T	c.(1297-1299)GGT>GTT	p.G433V	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	433					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGTTTCTCACCAGTGTGAAT	0.433													13	42	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150911198	150911198	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150911198C>A	uc003lue.3	-	13	9774	c.9761G>T	c.(9760-9762)CGC>CTC	p.R3254L	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_5'UTR	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	3254	Extracellular (Potential).|Cadherin 29.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCTGACCACGCGGTAGCCGGT	0.672													8	18	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154396295	154396295	+	Missense_Mutation	SNP	T	C	C	rs148448511	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154396295T>C	uc010jih.1	+	1	3036	c.2876T>C	c.(2875-2877)CTG>CCG	p.L959P		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	959	Interaction with PRC1 (By similarity).|Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAACAACAGCTGGTGAGCACA	0.473													14	51	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	155935659	155935659	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155935659G>A	uc003lwd.3	+	3	714	c.238G>A	c.(238-240)GGA>AGA	p.G80R	SGCD_uc003lwa.1_Missense_Mutation_p.G81R|SGCD_uc003lwb.2_Missense_Mutation_p.G81R|SGCD_uc003lwc.3_Missense_Mutation_p.G81R	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	80	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAAGCTAGAAGGAGACTCTGA	0.403													18	25	---	---	---	---	PASS
HAVCR1	26762	broad.mit.edu	37	5	156456809	156456809	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156456809C>A	uc010jij.1	-	9	1215	c.1030G>T	c.(1030-1032)GTT>TTT	p.V344F	HAVCR1_uc011ddl.1_Missense_Mutation_p.Q163H|HAVCR1_uc003lwi.2_Missense_Mutation_p.V344F	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	339	Cytoplasmic (Potential).				interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCTTTTCAACTGCATTTTGC	0.388													11	25	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161576271	161576271	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161576271C>T	uc003lyz.3	+	8	1438	c.1080C>T	c.(1078-1080)GTC>GTT	p.V360V	GABRG2_uc010jjc.2_Silent_p.V400V|GABRG2_uc003lyy.3_Silent_p.V360V|GABRG2_uc011dej.1_Silent_p.V265V	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	360	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		ATTATTTTGTCAGCAACCGGA	0.393													23	52	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169127139	169127139	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169127139G>T	uc003maf.2	+	13	1334	c.1254G>T	c.(1252-1254)ATG>ATT	p.M418I	DOCK2_uc011der.1_RNA|DOCK2_uc010jjl.1_5'Flank	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	418					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGATCATCATGCCAGGTGAGA	0.517													37	89	---	---	---	---	PASS
C5orf25	375484	broad.mit.edu	37	5	175749343	175749343	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175749343C>A	uc003mds.3	+	8	2307	c.1900C>A	c.(1900-1902)CAA>AAA	p.Q634K	C5orf25_uc003mdt.3_Missense_Mutation_p.Q219K|C5orf25_uc003mdr.3_RNA|C5orf25_uc003mdv.2_Missense_Mutation_p.Q95K			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;	634											0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		AAATGGAAATCAAACGTCTTC	0.458													5	10	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176638020	176638020	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176638020G>T	uc003mfr.3	+	5	2758	c.2620G>T	c.(2620-2622)GAG>TAG	p.E874*	NSD1_uc003mft.3_Nonsense_Mutation_p.E605*|NSD1_uc003mfs.1_Nonsense_Mutation_p.E771*|NSD1_uc011dfx.1_Nonsense_Mutation_p.E522*	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	874					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ATCCTTAGGTGAGGATGTCAG	0.393			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			59	22	---	---	---	---	PASS
ZNF354C	30832	broad.mit.edu	37	5	178504173	178504173	+	Intron	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178504173T>C	uc003mju.2	+							NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TCTAGGTAAGTGAGAGGCTGG	0.453													15	30	---	---	---	---	PASS
MGAT4B	11282	broad.mit.edu	37	5	179227526	179227526	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179227526G>C	uc003mks.2	-	6	1046	c.677C>G	c.(676-678)TCC>TGC	p.S226C	MGAT4B_uc003mkp.2_Missense_Mutation_p.S81C|MGAT4B_uc003mkq.2_Missense_Mutation_p.S81C|MGAT4B_uc003mkr.2_Missense_Mutation_p.S241C|MIR1229_hsa-mir-1229|MI0006319_5'Flank	NM_014275	NP_055090	Q9UQ53	MGT4B_HUMAN	alpha-1,3-mannosyl-glycoprotein	226	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding				0	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCGGAGGCGGGAGAAGTCAGG	0.607													5	21	---	---	---	---	PASS
MGAT1	4245	broad.mit.edu	37	5	180219177	180219177	+	Silent	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180219177A>T	uc003mmg.3	-	2	1290	c.795T>A	c.(793-795)CCT>CCA	p.P265P	MGAT1_uc010jlf.2_Silent_p.P265P|MGAT1_uc010jlg.2_Silent_p.P265P|MGAT1_uc003mmh.3_Silent_p.P265P|MGAT1_uc010jlh.2_Silent_p.P265P|MGAT1_uc003mmi.3_Silent_p.P265P	NM_002406	NP_002397	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein	265	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(1)	1	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCCCAGGCCAGGGAAAAAGT	0.667													13	39	---	---	---	---	PASS
JARID2	3720	broad.mit.edu	37	6	15507459	15507459	+	Silent	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15507459A>C	uc003nbj.2	+	10	2878	c.2634A>C	c.(2632-2634)CCA>CCC	p.P878P	JARID2_uc011div.1_Silent_p.P706P|JARID2_uc011diw.1_Silent_p.P840P	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	878	GSGFP motif.				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GTGGATTCCCAGTAGGAAAAT	0.552													11	39	---	---	---	---	PASS
JARID2	3720	broad.mit.edu	37	6	15517446	15517446	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15517446G>C	uc003nbj.2	+	17	3749	c.3505G>C	c.(3505-3507)GTG>CTG	p.V1169L	JARID2_uc011div.1_Missense_Mutation_p.V997L	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	1169					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TCTGCGCCACGTGGAGAAACA	0.607													45	49	---	---	---	---	PASS
SCGN	10590	broad.mit.edu	37	6	25665165	25665165	+	Intron	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25665165C>G	uc003nfb.2	+						SCGN_uc010jpz.2_Intron	NM_006998	NP_008929	O76038	SEGN_HUMAN	secretagogin precursor							extracellular region|transport vesicle membrane	calcium ion binding			ovary(2)|pancreas(1)	3						CTTTCTGTTCCTTCAGCTTGC	0.498													23	34	---	---	---	---	PASS
HFE	3077	broad.mit.edu	37	6	26091106	26091106	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26091106A>G	uc003nfx.1	+	2	274	c.114A>G	c.(112-114)TCA>TCG	p.S38S	HFE_uc003nfy.1_Intron|HFE_uc010jqe.1_Silent_p.S38S|HFE_uc003nfz.1_Intron|HFE_uc003ngd.1_Intron|HFE_uc003nga.1_Silent_p.S38S|HFE_uc003ngb.1_Silent_p.S38S|HFE_uc003ngc.1_Silent_p.S38S|HFE_uc003nge.1_Intron|HFE_uc003ngf.1_Intron	NM_000410	NP_000401	Q30201	HFE_HUMAN	hemochromatosis protein isoform 1 precursor	38	Extracellular (Potential).|Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I|cellular iron ion homeostasis|immune response|iron ion transport|protein complex assembly|receptor-mediated endocytosis	apical part of cell|basal part of cell|cytoplasmic vesicle|early endosome|integral to plasma membrane|MHC class I protein complex|perinuclear region of cytoplasm|recycling endosome	protein binding				0						TGGGTGCCTCAGAGCAGGACC	0.537									Hemochromatosis				101	81	---	---	---	---	PASS
HIST1H2AE	3012	broad.mit.edu	37	6	26217562	26217562	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26217562G>C	uc003nha.1	+	1	415	c.360G>C	c.(358-360)AAG>AAC	p.K120N	HIST1H2BG_uc003ngz.2_5'Flank	NM_021052	NP_066390	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	120					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|skin(1)	2		all_hematologic(11;0.196)				TGCCTAAGAAGACGGAGAGCC	0.542													12	49	---	---	---	---	PASS
ZNF391	346157	broad.mit.edu	37	6	27368147	27368147	+	5'UTR	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27368147G>T	uc003njf.1	+	3						NM_001076781	NP_001070249	Q9UJN7	ZN391_HUMAN	zinc finger protein 391						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(2)|skin(1)	3						TTCTGGGTCAGCAATGGAAAG	0.413													32	48	---	---	---	---	PASS
HIST1H3I	8354	broad.mit.edu	37	6	27839675	27839675	+	3'UTR	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27839675A>G	uc003njy.2	-	1						NM_003533	NP_003524	P68431	H31_HUMAN	histone cluster 1, H3i						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						TTGGGCTGATAGGAATATTTA	0.507													48	212	---	---	---	---	PASS
OR2B2	81697	broad.mit.edu	37	6	27879955	27879955	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27879955A>T	uc011dkw.1	-	1	143	c.143T>A	c.(142-144)GTG>GAG	p.V48E		NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B,	48	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CACATGTGACACAAGAATTAT	0.388													14	47	---	---	---	---	PASS
OR2B6	26212	broad.mit.edu	37	6	27925692	27925692	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27925692T>C	uc011dkx.1	+	1	674	c.674T>C	c.(673-675)GTA>GCA	p.V225A		NM_012367	NP_036499	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GTCCGAGCAGTATTGAGGATA	0.423													36	133	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28294095	28294095	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28294095C>A	uc003nla.2	-	4	1469	c.1069G>T	c.(1069-1071)GGC>TGC	p.G357C	ZNF323_uc003nld.2_Missense_Mutation_p.G357C|ZNF323_uc010jra.2_Missense_Mutation_p.G357C|ZNF323_uc003nlb.2_Missense_Mutation_p.G198C|ZNF323_uc010jrb.2_Missense_Mutation_p.G198C|ZNF323_uc003nlc.2_Missense_Mutation_p.G357C	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	357	C2H2-type 5.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						AAGGCTTTGCCACACTCACGA	0.488													49	172	---	---	---	---	PASS
BAT2	7916	broad.mit.edu	37	6	31598561	31598561	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31598561G>A	uc003nvb.3	+	15	2697	c.2448G>A	c.(2446-2448)GAG>GAA	p.E816E	BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Silent_p.E816E	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	816	4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						CTGCGGATGAGGATGACAAGG	0.562													23	19	---	---	---	---	PASS
C6orf25	80739	broad.mit.edu	37	6	31692838	31692838	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31692838C>T	uc011doc.1	+	6	713	c.713C>T	c.(712-714)GCA>GTA	p.A238V	C6orf25_uc003nwk.2_3'UTR|C6orf25_uc011dod.1_Missense_Mutation_p.A194V|C6orf25_uc011doe.1_Missense_Mutation_p.A214V|C6orf25_uc003nwo.2_3'UTR|C6orf25_uc003nwn.2_3'UTR	NM_138272	NP_612116	O95866	G6B_HUMAN	G6B protein isoform G6b-B precursor	238	Cytoplasmic (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	heparin binding|receptor activity				0						ACCATCTATGCAGTTGTAGTT	0.592													25	35	---	---	---	---	PASS
DAXX	1616	broad.mit.edu	37	6	33288803	33288803	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33288803C>T	uc003oec.2	-	3	953	c.749G>A	c.(748-750)GGC>GAC	p.G250D	DAXX_uc011drd.1_Missense_Mutation_p.G175D|DAXX_uc011dre.1_Missense_Mutation_p.G262D|DAXX_uc003oed.2_Missense_Mutation_p.G250D|DAXX_uc010juw.2_Missense_Mutation_p.G175D	NM_001350	NP_001341	Q9UER7	DAXX_HUMAN	death-domain associated protein isoform a	250					activation of JUN kinase activity|androgen receptor signaling pathway|apoptosis|induction of apoptosis via death domain receptors|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|regulation of protein ubiquitination|transcription, DNA-dependent	chromosome, centromeric region|cytosol|nucleolus|PML body	androgen receptor binding|heat shock protein binding|p53 binding|protein homodimerization activity|protein N-terminus binding|receptor signaling protein activity|transcription factor binding|ubiquitin protein ligase binding			pancreas(18)|ovary(2)|skin(2)|prostate(1)	23						TATGACACGGCCGGTCAGTGA	0.587			Mis|F|N		Pancreatic neuroendocrine tumors								47	53	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34008008	34008008	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34008008C>T	uc003oir.3	-	7	1623	c.1453G>A	c.(1453-1455)GAT>AAT	p.D485N	GRM4_uc011dsn.1_Missense_Mutation_p.D438N|GRM4_uc010jvh.2_Missense_Mutation_p.D485N|GRM4_uc010jvi.2_Missense_Mutation_p.D177N|GRM4_uc003oio.2_Missense_Mutation_p.D177N|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.D345N|GRM4_uc003oiq.2_Missense_Mutation_p.D352N|GRM4_uc011dsm.1_Missense_Mutation_p.D316N	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	485	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	TCGGCAGAATCGTTGCGCAGC	0.577													43	134	---	---	---	---	PASS
MTCH1	23787	broad.mit.edu	37	6	36937894	36937894	+	Intron	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36937894C>A	uc003ond.1	-						MTCH1_uc003onc.1_Intron|MTCH1_uc010jwo.1_Intron|MTCH1_uc003one.3_Intron|MTCH1_uc011dtt.1_Intron	NM_014341	NP_055156	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier homolog 1						activation of caspase activity|neuronal ion channel clustering|positive regulation of apoptosis|regulation of signal transduction|transport	integral to membrane|mitochondrial inner membrane	protein binding				0						TTGCAGCCTGCCGGAGAAGGA	0.572													9	20	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51611545	51611545	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51611545C>A	uc003pah.1	-	59	10248	c.9972G>T	c.(9970-9972)AAG>AAT	p.K3324N	PKHD1_uc010jzn.1_Missense_Mutation_p.K1307N|PKHD1_uc003pai.2_Missense_Mutation_p.K3324N	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3324	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GAAAGTAGAACTTGTTTTTAT	0.343													8	60	---	---	---	---	PASS
IL17F	112744	broad.mit.edu	37	6	52103568	52103568	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52103568G>A	uc003pam.1	-	2	285	c.214C>T	c.(214-216)CGT>TGT	p.R72C	IL17F_uc003pal.1_Missense_Mutation_p.R18C	NM_052872	NP_443104	Q96PD4	IL17F_HUMAN	interleukin 17F precursor	72					cartilage development|inflammatory response|lymphotoxin A biosynthetic process|negative regulation of angiogenesis|proteoglycan metabolic process|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|regulation of interleukin-2 biosynthetic process|regulation of interleukin-6 biosynthetic process|regulation of interleukin-8 biosynthetic process|regulation of transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|cytokine binding|protein homodimerization activity			ovary(1)	1	Lung NSC(77;0.116)					TCGATGTTACGTGACATGGAA	0.433													33	46	---	---	---	---	PASS
LRRC1	55227	broad.mit.edu	37	6	53778682	53778682	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53778682T>C	uc003pcd.1	+	11	1298	c.1021T>C	c.(1021-1023)TGT>CGT	p.C341R		NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	341	LRR 15.					cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CACTGTGTTCTGTGTACGTGA	0.483													29	68	---	---	---	---	PASS
HCRTR2	3062	broad.mit.edu	37	6	55128572	55128572	+	Silent	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55128572C>G	uc003pcl.2	+	4	1029	c.714C>G	c.(712-714)CTC>CTG	p.L238L	HCRTR2_uc010jzv.2_RNA|HCRTR2_uc010jzw.1_Silent_p.L173L	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	238	Helical; Name=5; (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CACTGTGTCTCATGGTGTTGG	0.383													10	45	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55196607	55196607	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55196607A>T	uc003pcm.1	+	2	203	c.117A>T	c.(115-117)AAA>AAT	p.K39N		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	39	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ATGGATGTAAACATGCTTGGA	0.338													14	24	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	55929424	55929424	+	Intron	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55929424T>C	uc003pcs.2	-						COL21A1_uc010jzz.2_Intron|COL21A1_uc011dxg.1_Intron|COL21A1_uc011dxh.1_Intron|COL21A1_uc003pcr.2_Intron	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTTGACCCTTTAAAATAAAAA	0.323													10	4	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69703760	69703760	+	Missense_Mutation	SNP	A	C	C	rs142372047		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69703760A>C	uc003pev.3	+	11	2283	c.1835A>C	c.(1834-1836)TAT>TCT	p.Y612S	BAI3_uc010kak.2_Missense_Mutation_p.Y612S	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	612	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				AAAAATTTCTATGCAGGCGAT	0.458													103	48	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70610162	70610162	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70610162A>G	uc003pfc.1	+	4	315	c.198A>G	c.(196-198)AGA>AGG	p.R66R		NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	66	TSP N-terminal.				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						TTTCTCTAAGACGTGCATTTT	0.269													10	50	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70778330	70778330	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70778330C>T	uc003pfc.1	+	15	1303	c.1186C>T	c.(1186-1188)CAA>TAA	p.Q396*	COL19A1_uc010kam.1_Nonsense_Mutation_p.Q292*	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	396	Triple-helical region 2 (COL2).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						CCTGGGGATACAAGGCCCCCA	0.423													12	59	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70978539	70978539	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70978539G>C	uc003pfg.3	-	17	1414	c.1255C>G	c.(1255-1257)CGC>GGC	p.R419G	COL9A1_uc003pfe.3_5'UTR|COL9A1_uc003pff.3_Missense_Mutation_p.R176G	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	419	Triple-helical region (COL2).				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						TATCCTGAGCGACCTGGTGGA	0.458													9	66	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109854575	109854575	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109854575T>A	uc003ptn.2	-	28	3526	c.3449A>T	c.(3448-3450)CAA>CTA	p.Q1150L	AKD1_uc011eat.1_Missense_Mutation_p.Q229L	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	1150					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						ATCATCAACTTGTATAAAAAC	0.373													45	20	---	---	---	---	PASS
KIAA1919	91749	broad.mit.edu	37	6	111583574	111583574	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111583574G>T	uc003puv.3	+	2	564	c.142G>T	c.(142-144)GGC>TGC	p.G48C		NM_153369	NP_699200	Q5TF39	NAGT1_HUMAN	sodium-dependent glucose transporter 1	48	Helical; (Potential).				carbohydrate transport|sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(3)	3		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		ATATTTGAGTGGCTCTGTGAT	0.373													113	51	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151859392	151859392	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151859392C>A	uc003qol.2	+	3	488	c.399C>A	c.(397-399)AAC>AAA	p.N133K		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	133	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		TCAAGGAGAACCAGGAATTAA	0.358													28	9	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152706908	152706908	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152706908C>G	uc010kiw.2	-	55	9155	c.8553G>C	c.(8551-8553)GAG>GAC	p.E2851D	SYNE1_uc003qot.3_Missense_Mutation_p.E2858D|SYNE1_uc003qou.3_Missense_Mutation_p.E2851D|SYNE1_uc010kjb.1_Missense_Mutation_p.E2834D	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2851	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATCTGTGAACTCGTGGACCG	0.393										HNSCC(10;0.0054)			69	53	---	---	---	---	PASS
SLC22A1	6580	broad.mit.edu	37	6	160551239	160551239	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160551239G>T	uc003qtc.2	+	2	620	c.515G>T	c.(514-516)AGG>ATG	p.R172M	SLC22A1_uc003qtd.2_Missense_Mutation_p.R172M	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	172	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TTTGCAGACAGGTATGTAAAG	0.353													74	30	---	---	---	---	PASS
ADAP1	11033	broad.mit.edu	37	7	943784	943784	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:943784G>A	uc003sjo.3	-	6	803	c.627C>T	c.(625-627)TTC>TTT	p.F209F	ADAP1_uc003sjm.3_Silent_p.F35F|ADAP1_uc011jvs.1_Silent_p.F114F|ADAP1_uc003sjn.3_Silent_p.F137F|ADAP1_uc010ksc.2_Silent_p.F137F	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1	209	PH 1.				cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						CATGGTAGATGAAGATGTTAC	0.662													92	16	---	---	---	---	PASS
SCIN	85477	broad.mit.edu	37	7	12684270	12684270	+	Silent	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12684270C>G	uc003ssn.3	+	13	2031	c.1821C>G	c.(1819-1821)ACC>ACG	p.T607T	SCIN_uc010ktt.2_RNA|SCIN_uc003sso.3_Silent_p.T360T	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1	607	Ca(2+)-dependent actin binding.				actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TACTGGAAACCCAGGCTGAAG	0.428													28	5	---	---	---	---	PASS
PRPS1L1	221823	broad.mit.edu	37	7	18067020	18067020	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18067020A>G	uc003stz.2	-	1	467	c.386T>C	c.(385-387)CTA>CCA	p.L129P		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	129					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					AGAAGCATGTAGGTCCATGGT	0.463													86	101	---	---	---	---	PASS
FERD3L	222894	broad.mit.edu	37	7	19184887	19184887	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184887G>A	uc003suo.1	-	1	158	c.99C>T	c.(97-99)TTC>TTT	p.F33F	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	33					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						CCCCGGGTGCGAAGTCGCAGA	0.582													97	16	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21784505	21784505	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21784505G>A	uc003svc.2	+	52	8386	c.8355G>A	c.(8353-8355)ATG>ATA	p.M2785I		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2785					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ATAGTCACATGCTGCTTCAAC	0.478									Kartagener_syndrome				24	6	---	---	---	---	PASS
EVX1	2128	broad.mit.edu	37	7	27283085	27283085	+	Intron	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27283085C>T	uc003szd.1	+						EVX1_uc011jzn.1_Intron|EVX1_uc010kuy.1_Intron	NM_001989	NP_001980	P49640	EVX1_HUMAN	even-skipped homeobox 1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						AGGTAGCCACCGTGCCCCTCC	0.662													4	46	---	---	---	---	PASS
NOD1	10392	broad.mit.edu	37	7	30492415	30492415	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30492415C>T	uc003tav.2	-	6	1141	c.618G>A	c.(616-618)GTG>GTA	p.V206V	NOD1_uc010kvs.2_Intron	NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	206	NACHT.|ATP (Potential).				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						TGGACTTGCCCACCCCAGCAT	0.622													49	101	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	35051053	35051053	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35051053C>A	uc003tem.3	-	5	485	c.340G>T	c.(340-342)GCC>TCC	p.A114S		NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	114						integral to membrane					0						TACCAACTGGCCAAAATTACC	0.323													25	32	---	---	---	---	PASS
WBSCR22	114049	broad.mit.edu	37	7	73105283	73105283	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73105283A>T	uc003tyt.2	+	6	458	c.400A>T	c.(400-402)AAG>TAG	p.K134*	WBSCR22_uc010lbi.1_Intron|WBSCR22_uc003tyu.2_Nonsense_Mutation_p.K134*|WBSCR22_uc003tyv.2_Nonsense_Mutation_p.K96*|WBSCR22_uc003tyw.1_Intron	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	134						nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				TGCTAACAAGAAGTCTGAAAA	0.478													66	125	---	---	---	---	PASS
CLIP2	7461	broad.mit.edu	37	7	73790773	73790773	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73790773A>G	uc003uam.2	+	10	2369	c.2042A>G	c.(2041-2043)GAG>GGG	p.E681G	CLIP2_uc003uan.2_Missense_Mutation_p.E646G|CLIP2_uc003uao.2_Missense_Mutation_p.E75G	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	681	Potential.					microtubule associated complex				skin(3)	3						CACGTGAAGGAGAAGGAGGCC	0.647													32	33	---	---	---	---	PASS
GNAI1	2770	broad.mit.edu	37	7	79846737	79846737	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79846737T>A	uc003uhb.1	+	8	1330	c.993T>A	c.(991-993)AAT>AAA	p.N331K	GNAI1_uc011kgt.1_Missense_Mutation_p.N279K	NM_002069	NP_002060	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein),	331					cell cycle|cell division|inhibition of adenylate cyclase activity by G-protein signaling pathway|platelet activation|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody|nucleus	G-protein beta/gamma-subunit complex binding|GTP binding|metabotropic serotonin receptor binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						ATACTAAGAATGTGCAGTTTG	0.338													31	39	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	83029392	83029392	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83029392G>T	uc003uhy.1	-	11	1784	c.1318C>A	c.(1318-1320)CGA>AGA	p.R440R		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	440	Sema.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				GCTTCCACTCGATCTACTGCT	0.368													61	144	---	---	---	---	PASS
DBF4	10926	broad.mit.edu	37	7	87537254	87537254	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87537254G>C	uc003ujf.1	+	12	2305	c.1801G>C	c.(1801-1803)GAA>CAA	p.E601Q	DBF4_uc003ujh.1_Missense_Mutation_p.E341Q|DBF4_uc003ujg.1_Missense_Mutation_p.E377Q|DBF4_uc011khf.1_Missense_Mutation_p.E368Q	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN	activator of S phase kinase	601					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding			lung(2)	2	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				TAAAAGAACTGAATTTATTAC	0.303													34	68	---	---	---	---	PASS
STEAP1	26872	broad.mit.edu	37	7	89791272	89791272	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89791272G>A	uc003ujx.2	+	4	842	c.642G>A	c.(640-642)TGG>TGA	p.W214*	STEAP1_uc010lem.2_Nonsense_Mutation_p.W214*	NM_012449	NP_036581	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the	214	Ferric oxidoreductase.				electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	all_hematologic(106;0.112)					ATGATGTTTGGAGAATGGAGA	0.398													43	80	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92763529	92763529	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92763529T>C	uc003umh.1	-	5	2972	c.1756A>G	c.(1756-1758)ATT>GTT	p.I586V	SAMD9L_uc003umj.1_Missense_Mutation_p.I586V|SAMD9L_uc003umi.1_Missense_Mutation_p.I586V|SAMD9L_uc010lfb.1_Missense_Mutation_p.I586V|SAMD9L_uc003umk.1_Missense_Mutation_p.I586V|SAMD9L_uc010lfc.1_Missense_Mutation_p.I586V|SAMD9L_uc010lfd.1_Missense_Mutation_p.I586V|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	586										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CGTTGATAAATATGTGAGTTT	0.358													61	89	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93073056	93073056	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93073056A>G	uc003umv.1	-	10	1025	c.764T>C	c.(763-765)ATT>ACT	p.I255T	CALCR_uc011kia.1_Missense_Mutation_p.I35T|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.I221T|CALCR_uc003umw.2_Missense_Mutation_p.I221T	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	237	Helical; Name=3; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	AAAATGCAAAATCTTGCAGCT	0.433													39	58	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93106913	93106913	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93106913G>T	uc003umv.1	-	5	588	c.327C>A	c.(325-327)TCC>TCA	p.S109S	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Silent_p.S91S|CALCR_uc003umw.2_Silent_p.S91S	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	91	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	AGAACTGATAGGACAATACTC	0.423													18	38	---	---	---	---	PASS
SLC25A13	10165	broad.mit.edu	37	7	95750514	95750514	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95750514C>A	uc003uof.3	-	18	2208	c.2017G>T	c.(2017-2019)GGA>TGA	p.G673*	SLC25A13_uc003uog.3_Nonsense_Mutation_p.G674*|SLC25A13_uc011kik.1_Nonsense_Mutation_p.G565*	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2	673					ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	TATGGGCCTCCACCAATAGCC	0.453													52	85	---	---	---	---	PASS
TECPR1	25851	broad.mit.edu	37	7	97860328	97860328	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97860328T>C	uc003upg.2	-	15	2432	c.2227A>G	c.(2227-2229)AGC>GGC	p.S743G	TECPR1_uc003uph.1_Missense_Mutation_p.S673G	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	743	TECPR 5.					integral to membrane	protein binding			pancreas(1)	1						CTGGGCTCGCTCACGAAGATG	0.697													21	41	---	---	---	---	PASS
TRIM4	89122	broad.mit.edu	37	7	99489826	99489826	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99489826A>T	uc003usd.2	-	7	1593	c.1463T>A	c.(1462-1464)TTA>TAA	p.L488*	TRIM4_uc003use.2_Nonsense_Mutation_p.L462*|TRIM4_uc011kjc.1_Nonsense_Mutation_p.L318*	NM_033017	NP_148977	Q9C037	TRIM4_HUMAN	tripartite motif protein TRIM4 isoform alpha	488	B30.2/SPRY.				protein trimerization	cytoplasm|plasma membrane	zinc ion binding			ovary(1)|kidney(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				TAAAGATGCTAATGGACTCAA	0.502													32	48	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100389666	100389666	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100389666G>A	uc003uwj.2	+	42	7773	c.7608G>A	c.(7606-7608)CCG>CCA	p.P2536P	ZAN_uc003uwk.2_Silent_p.P2536P|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Missense_Mutation_p.R529Q	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2536	VWFD 4.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AATGTAGCCCGGAGCAGCTGG	0.682													29	32	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100679504	100679504	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100679504C>G	uc003uxp.1	+	3	4860	c.4807C>G	c.(4807-4809)CAG>GAG	p.Q1603E	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1603	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|25.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CTCCAAAACTCAGGTGACCGC	0.468													126	200	---	---	---	---	PASS
AP1S1	1174	broad.mit.edu	37	7	100800704	100800704	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100800704G>C	uc003uxv.3	+	3	339	c.229G>C	c.(229-231)GAG>CAG	p.E77Q		NM_001283	NP_001274	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1	77					intracellular protein transport|post-Golgi vesicle-mediated transport|receptor-mediated endocytosis|regulation of defense response to virus by virus|response to virus|viral reproduction	AP-1 adaptor complex|coated pit|cytosol|lysosomal membrane	protein binding|protein transporter activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)					CCAAGACAATGAGCTCATCAC	0.537													6	12	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508547	106508547	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508547G>T	uc003vdv.3	+	2	626	c.541G>T	c.(541-543)GTG>TTG	p.V181L	PIK3CG_uc003vdu.2_Missense_Mutation_p.V181L|PIK3CG_uc003vdw.2_Missense_Mutation_p.V181L	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	181					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CCGTGGCTTGGTGACCCCGCG	0.652													32	52	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124386619	124386619	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124386619C>G	uc003vli.2	-	2	2453	c.1802G>C	c.(1801-1803)CGT>CCT	p.R601P		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	601	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						GGACATTTCACGGCGTATGGT	0.438													91	120	---	---	---	---	PASS
FSCN3	29999	broad.mit.edu	37	7	127240279	127240279	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127240279C>T	uc003vmd.1	+	6	1542	c.1323C>T	c.(1321-1323)TCC>TCT	p.S441S	FSCN3_uc011koh.1_Missense_Mutation_p.L306F|FSCN3_uc010llc.1_Missense_Mutation_p.L440F	NM_020369	NP_065102	Q9NQT6	FSCN3_HUMAN	fascin 3	441						actin cytoskeleton|cytoplasm	actin filament binding|protein binding, bridging			ovary(1)	1						CAATAACATCCTTTGGCACCT	0.557													36	59	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128496854	128496854	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128496854C>A	uc003vnz.3	+	45	7649	c.7440C>A	c.(7438-7440)GTC>GTA	p.V2480V	FLNC_uc003voa.3_Silent_p.V2447V	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2480	Filamin 22.|Interaction with INPPL1.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						CCATCGATGTCAAGTTCAACG	0.597													30	53	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131895861	131895861	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131895861G>C	uc003vra.3	-	10	2368	c.2139C>G	c.(2137-2139)CCC>CCG	p.P713P		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	713	Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TCACCTCCACGGGCACCAGGA	0.617													5	8	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137076045	137076045	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137076045T>G	uc003vtt.2	-	34	3120	c.3119A>C	c.(3118-3120)GAC>GCC	p.D1040A	DGKI_uc003vtu.2_Missense_Mutation_p.D709A	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1040					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						CAAGTCTGGGTCCCCAGCCTG	0.473													22	117	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138601769	138601769	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138601769G>A	uc011kql.1	-	2	2652	c.2603C>T	c.(2602-2604)CCA>CTA	p.P868L	KIAA1549_uc003vuk.3_Missense_Mutation_p.P818L|KIAA1549_uc011kqj.1_Missense_Mutation_p.P868L	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	868						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						TGTGAGTGATGGGCCCACGAC	0.602			O	BRAF	pilocytic astrocytoma								7	25	---	---	---	---	PASS
UBN2	254048	broad.mit.edu	37	7	138964076	138964076	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138964076G>T	uc011kqr.1	+	13	2037	c.2037G>T	c.(2035-2037)AAG>AAT	p.K679N		NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2	679										ovary(1)|skin(1)	2						CAAAGAAAAAGGTGATTCCTG	0.284													36	79	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140449220	140449220	+	Splice_Site	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140449220T>C	uc003vwc.3	-	16	1922	c.1861_splice	c.e16-1	p.A621_splice		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TTCTGGTGCCTGTTAGAACAT	0.328		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				27	67	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142448151	142448151	+	Intron	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142448151T>C	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc011ksl.1_Missense_Mutation_p.L11P					SubName: Full=V_segment translation product; Flags: Fragment;																		CTCCTGGGACTAGGTATGAGC	0.478													9	12	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142574226	142574226	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142574226C>A	uc003wbx.1	-	6	913	c.697G>T	c.(697-699)GAC>TAC	p.D233Y	TRPV6_uc003wbw.1_Missense_Mutation_p.D19Y|TRPV6_uc010lou.1_Missense_Mutation_p.D104Y	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	233	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					GGCACGAGGTCCAGGGGCTGC	0.567													44	58	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142574227	142574227	+	Silent	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142574227C>G	uc003wbx.1	-	6	912	c.696G>C	c.(694-696)CTG>CTC	p.L232L	TRPV6_uc003wbw.1_Silent_p.L18L|TRPV6_uc010lou.1_Silent_p.L103L	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	232	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					GCACGAGGTCCAGGGGCTGCA	0.567													45	58	---	---	---	---	PASS
KEL	3792	broad.mit.edu	37	7	142643287	142643287	+	Intron	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142643287C>A	uc003wcb.2	-							NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GAAGAGCTCTCACATACAGCA	0.557													13	20	---	---	---	---	PASS
OR2A14	135941	broad.mit.edu	37	7	143826539	143826539	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143826539C>T	uc011kua.1	+	1	334	c.334C>T	c.(334-336)CTG>TTG	p.L112L		NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					CGTAGAGTGTCTGATTTTGGT	0.463													110	144	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146805352	146805352	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146805352G>C	uc003weu.1	+	5	1180	c.664G>C	c.(664-666)GAA>CAA	p.E222Q		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	222	Laminin G-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTCTGAAAGTGAAGGAGTAAT	0.398										HNSCC(39;0.1)			39	65	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147259265	147259265	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147259265C>A	uc003weu.1	+	12	2329	c.1813C>A	c.(1813-1815)CTA>ATA	p.L605I		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	605	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTACAAACACCTAGGACAGAC	0.438										HNSCC(39;0.1)			33	49	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147600754	147600754	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147600754C>A	uc003weu.1	+	14	2712	c.2196C>A	c.(2194-2196)ATC>ATA	p.I732I		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	732	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding	p.I732I(1)		ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCTGCGGCATCGAACGCAACT	0.572										HNSCC(39;0.1)			19	26	---	---	---	---	PASS
GIMAP8	155038	broad.mit.edu	37	7	150174193	150174193	+	Silent	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150174193T>A	uc003whj.2	+	5	1653	c.1323T>A	c.(1321-1323)ATT>ATA	p.I441I		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	441						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CCCTGAACATTGTCCTTGTGG	0.517													43	76	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151874731	151874731	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151874731T>A	uc003wla.2	-	38	8026	c.7807A>T	c.(7807-7809)AGA>TGA	p.R2603*	MLL3_uc003wkz.2_Nonsense_Mutation_p.R1664*|MLL3_uc003wky.2_Nonsense_Mutation_p.R112*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2603	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TCTGTGTGTCTAGGGCCCGGA	0.552			N		medulloblastoma								72	108	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151878026	151878026	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151878026T>A	uc003wla.2	-	36	7138	c.6919A>T	c.(6919-6921)AGA>TGA	p.R2307*	MLL3_uc003wkz.2_Nonsense_Mutation_p.R1368*|MLL3_uc003wky.2_5'Flank	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2307					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GACTGAGATCTTGGAGTCATT	0.517			N		medulloblastoma								49	82	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154379572	154379572	+	Intron	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154379572T>C	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Silent_p.P280P|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AAGGGGGACCTGTTTCAGATA	0.522													43	56	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154684082	154684082	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154684082C>A	uc003wlk.2	+	26	2619	c.2490C>A	c.(2488-2490)AGC>AGA	p.S830R	DPP6_uc003wli.2_Missense_Mutation_p.S766R|DPP6_uc003wlm.2_Missense_Mutation_p.S768R|DPP6_uc011kvq.1_Missense_Mutation_p.S723R	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	830	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CCAGCTCCAGCCTCAAACAGC	0.532													44	54	---	---	---	---	PASS
NOM1	64434	broad.mit.edu	37	7	156742848	156742848	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156742848G>T	uc003wmy.2	+	1	432	c.417G>T	c.(415-417)TCG>TCT	p.S139S		NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	139	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.				RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		GGGACCCCTCGCCTCCCAGGA	0.751													8	8	---	---	---	---	PASS
UBE3C	9690	broad.mit.edu	37	7	156976589	156976589	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156976589G>C	uc010lqs.2	+	9	1321	c.1009G>C	c.(1009-1011)GGG>CGG	p.G337R	UBE3C_uc003wnf.2_Missense_Mutation_p.G294R|UBE3C_uc003wng.2_Missense_Mutation_p.G337R	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	337					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CTCTGAGGAAGGGCTGCTGGT	0.468													103	145	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	157903597	157903597	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157903597G>A	uc003wno.2	-	10	1688	c.1567C>T	c.(1567-1569)CCC>TCC	p.P523S	PTPRN2_uc003wnp.2_Missense_Mutation_p.P506S|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Missense_Mutation_p.P485S|PTPRN2_uc011kwa.1_Missense_Mutation_p.P546S	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	523	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CCTTCCTCGGGGCGCAGGGGG	0.677													4	2	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2057233	2057233	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2057233C>A	uc003wpx.3	+	25	3229	c.3091C>A	c.(3091-3093)CGG>AGG	p.R1031R	MYOM2_uc011kwi.1_Silent_p.R456R	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	1031					muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TGATAAGGGGCGGGTTCGCTT	0.443													3	60	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2855586	2855586	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2855586C>A	uc011kwk.1	-	54	8717	c.8327G>T	c.(8326-8328)CGA>CTA	p.R2776L	CSMD1_uc011kwj.1_Missense_Mutation_p.R2105L|CSMD1_uc010lrg.2_Missense_Mutation_p.R786L	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2776	Extracellular (Potential).|Sushi 19.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACACTGGGCTCGAGACACGCC	0.552													26	17	---	---	---	---	PASS
AMAC1L2	83650	broad.mit.edu	37	8	11189423	11189423	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189423G>T	uc003wtp.1	+	1	929	c.808G>T	c.(808-810)GTG>TTG	p.V270L		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	270	Helical; (Potential).					integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		CTTCACATGTGTGGGCTATGC	0.587													92	77	---	---	---	---	PASS
INTS10	55174	broad.mit.edu	37	8	19700402	19700402	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19700402G>A	uc003wzj.2	+	14	1814	c.1683G>A	c.(1681-1683)ATG>ATA	p.M561I		NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	561					snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		AGGCTATCATGCCATACTGCC	0.353													55	40	---	---	---	---	PASS
SLC18A1	6570	broad.mit.edu	37	8	20008219	20008219	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20008219A>G	uc011kyq.1	-	12	1523	c.1052T>C	c.(1051-1053)ATT>ACT	p.I351T	SLC18A1_uc003wzl.2_Missense_Mutation_p.I138T|SLC18A1_uc003wzm.2_Missense_Mutation_p.I351T|SLC18A1_uc011kyr.1_Missense_Mutation_p.I351T|SLC18A1_uc003wzn.2_Missense_Mutation_p.I319T|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Missense_Mutation_p.I319T	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	351	Helical; (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		GTTGGTGCCAATGAGGTAGGA	0.498													54	35	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25766020	25766020	+	Silent	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25766020T>A	uc003xes.1	-	7	620	c.603A>T	c.(601-603)GCA>GCT	p.A201A	PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	201	Interaction with DNA (By similarity).				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTGGGTTTCCTGCTGTTTTCA	0.368													19	10	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	29053708	29053708	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29053708G>A	uc003xhh.3	-	3	217	c.158C>T	c.(157-159)CCG>CTG	p.P53L	KIF13B_uc003xhj.2_Intron|KIF13B_uc010lvf.1_5'UTR|KIF13B_uc003xhk.2_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	53	Kinesin-motor.				microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TCTTACCTTCGGCTGGCCCCT	0.318													3	6	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39495194	39495194	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39495194C>A	uc003xni.2	+	9	799	c.799C>A	c.(799-801)CGG>AGG	p.R267R	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Silent_p.R243R	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	267	Peptidase M12B.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TCTCATCCTACGGCCCCATGA	0.343													21	191	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39495196	39495196	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39495196G>A	uc003xni.2	+	9	801	c.801G>A	c.(799-801)CGG>CGA	p.R267R	ADAM18_uc010lww.2_RNA|ADAM18_uc010lwx.2_Silent_p.R243R	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18	267	Peptidase M12B.|Extracellular (Potential).				cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TCATCCTACGGCCCCATGACA	0.348													21	189	---	---	---	---	PASS
CHRNB3	1142	broad.mit.edu	37	8	42587211	42587211	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42587211T>A	uc003xpi.1	+	5	889	c.761T>A	c.(760-762)GTG>GAG	p.V254E		NM_000749	NP_000740	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta	254	Helical; (Potential).				synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)	1	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)			ACAGTTCTTGTGTTCTATTTA	0.428													23	134	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55534029	55534029	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55534029G>A	uc003xsd.1	+	2	651	c.503G>A	c.(502-504)CGT>CAT	p.R168H	RP1_uc011ldy.1_Missense_Mutation_p.R168H	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	168	Doublecortin 2.				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAGACGAGGCGTGCGGTTCTT	0.652													96	69	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55540535	55540535	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55540535G>T	uc003xsd.1	+	4	4241	c.4093G>T	c.(4093-4095)GGT>TGT	p.G1365C	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1365					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GTTAGAAAGAGGTGATGACAT	0.328													56	36	---	---	---	---	PASS
MOS	4342	broad.mit.edu	37	8	57025720	57025720	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57025720G>A	uc011leb.1	-	1	822	c.822C>T	c.(820-822)ACC>ACT	p.T274T		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	274	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)			GCGCCTGCTTGGTAGTCATTT	0.622													14	61	---	---	---	---	PASS
MOS	4342	broad.mit.edu	37	8	57025733	57025733	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57025733C>G	uc011leb.1	-	1	809	c.809G>C	c.(808-810)TGG>TCG	p.W270S		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	270	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)			AGTCATTTGCCAGAGAGTGAT	0.617													16	67	---	---	---	---	PASS
MOS	4342	broad.mit.edu	37	8	57026206	57026206	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57026206C>A	uc011leb.1	-	1	336	c.336G>T	c.(334-336)CTG>CTT	p.L112L		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	112	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)			TATCGTGGCGCAGCCTTGCTA	0.592													41	146	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59410832	59410832	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59410832T>A	uc003xtm.3	-	2	340	c.277A>T	c.(277-279)AAA>TAA	p.K93*		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	93					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TCAAAATATTTTCCGTGGCAC	0.343									Neonatal_Giant_Cell_Hepatitis				87	49	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59514042	59514042	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59514042G>C	uc003xtt.2	-	15	1392	c.1178C>G	c.(1177-1179)TCT>TGT	p.S393C	NSMAF_uc011lee.1_Missense_Mutation_p.S424C|NSMAF_uc003xtu.2_Missense_Mutation_p.S393C	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	393	BEACH.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				ACCCGGGGAAGAGTAGTGACT	0.343													10	43	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61757513	61757513	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61757513G>C	uc003xue.2	+	22	5418	c.4941G>C	c.(4939-4941)CTG>CTC	p.L1647L		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1647					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GAACCATCCTGGTGTACTGTC	0.488													44	153	---	---	---	---	PASS
TTPA	7274	broad.mit.edu	37	8	63978502	63978502	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63978502G>C	uc003xux.1	-	3	545	c.513C>G	c.(511-513)ATC>ATG	p.I171M		NM_000370	NP_000361	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	171	CRAL-TRIO.				lipid metabolic process		transporter activity|vitamin E binding				0	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	CGGATGGAGTGATTTGAAAAG	0.373													19	60	---	---	---	---	PASS
ARMC1	55156	broad.mit.edu	37	8	66539640	66539640	+	5'UTR	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66539640T>C	uc003xvl.2	-	2					ARMC1_uc011leo.1_5'UTR	NM_018120	NP_060590	Q9NVT9	ARMC1_HUMAN	armadillo repeat-containing protein						metal ion transport		metal ion binding			skin(1)	1			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			TCATCTTCTATGCCATGCACA	0.398													71	42	---	---	---	---	PASS
C8orf34	116328	broad.mit.edu	37	8	69358584	69358584	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69358584G>T	uc010lyz.2	+	3	287	c.238G>T	c.(238-240)GAT>TAT	p.D80Y	C8orf34_uc010lyx.1_Missense_Mutation_p.D80Y|C8orf34_uc010lyy.1_Missense_Mutation_p.D80Y|C8orf34_uc003xyb.2_Missense_Mutation_p.D55Y	NM_052958	NP_443190	Q49A92	CH034_HUMAN	hypothetical protein LOC116328	80					signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			AACAAGAAGGGATTTCAGAAG	0.338													28	115	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70515555	70515555	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70515555G>T	uc010lza.1	+	11	1907	c.1190G>T	c.(1189-1191)AGG>ATG	p.R397M	SULF1_uc003xyd.2_Missense_Mutation_p.R397M|SULF1_uc003xye.2_Missense_Mutation_p.R397M|SULF1_uc003xyf.2_Missense_Mutation_p.R397M|SULF1_uc003xyg.2_Missense_Mutation_p.R397M|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	397					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CCAGGTAACAGGTGTGTCATT	0.562													20	121	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77767035	77767035	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77767035G>A	uc003yav.2	+	10	8130	c.7743G>A	c.(7741-7743)CTG>CTA	p.L2581L	ZFHX4_uc003yau.1_Silent_p.L2626L|ZFHX4_uc003yaw.1_Silent_p.L2581L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2581	Homeobox 3.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AATACTTGCTGGATTCCAATC	0.483										HNSCC(33;0.089)			34	26	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77767965	77767965	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77767965G>A	uc003yav.2	+	10	9060	c.8673G>A	c.(8671-8673)ATG>ATA	p.M2891I	ZFHX4_uc003yau.1_Missense_Mutation_p.M2936I|ZFHX4_uc003yaw.1_Missense_Mutation_p.M2891I	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2891	Homeobox 4.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GAACGCAAATGAGCAATCTTC	0.473										HNSCC(33;0.089)			10	66	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86050489	86050489	+	Intron	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86050489G>C	uc003ycw.2	+						LRRCC1_uc003ycx.2_Intron|LRRCC1_uc003ycy.2_Intron	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a						cell division|mitosis	centriole|nucleus					0						GTATTATATAGTACAGTATTT	0.294													13	40	---	---	---	---	PASS
PSKH2	85481	broad.mit.edu	37	8	87081736	87081736	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87081736G>C	uc011lfy.1	-	1	116	c.116C>G	c.(115-117)GCG>GGG	p.A39G		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	39							ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			CGCCTGGGCCGCCGCCTCGGG	0.701													8	26	---	---	---	---	PASS
SLC7A13	157724	broad.mit.edu	37	8	87226736	87226736	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87226736A>G	uc003ydq.1	-	4	1417	c.1319T>C	c.(1318-1320)ATA>ACA	p.I440T	SLC7A13_uc003ydr.1_3'UTR	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid	440	Helical; Name=12; (Potential).					integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1						TTTAAAATGTATTAAAGGTAT	0.358													12	41	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87591433	87591433	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87591433G>A	uc003ydx.2	-	16	1875	c.1829C>T	c.(1828-1830)GCC>GTC	p.A610V	CNGB3_uc010maj.2_Missense_Mutation_p.A467V	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	610	Cytoplasmic (Potential).|cGMP (By similarity).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						AAACCCGTGGGCCACCACATT	0.458													145	308	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	93017356	93017356	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93017356C>A	uc003yfd.2	-	5	812	c.728G>T	c.(727-729)CGA>CTA	p.R243L	RUNX1T1_uc003yfc.1_Missense_Mutation_p.R216L|RUNX1T1_uc003yfe.1_Missense_Mutation_p.R206L|RUNX1T1_uc010mao.2_Missense_Mutation_p.R216L|RUNX1T1_uc011lgi.1_Missense_Mutation_p.R254L|RUNX1T1_uc003yfb.1_Missense_Mutation_p.R206L|RUNX1T1_uc003yff.1_Missense_Mutation_p.R206L	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	243					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GTCTGGAGTTCGCCTCTTCCC	0.522													43	129	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95501056	95501056	+	Silent	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95501056T>G	uc003ygo.1	-	24	5330	c.5317A>C	c.(5317-5319)AGA>CGA	p.R1773R	KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	1773					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CCACGACCTCTAGAAGCACGG	0.468													30	67	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106456566	106456566	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106456566A>C	uc003ymd.2	+	3	281	c.258A>C	c.(256-258)AAA>AAC	p.K86N		NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	86					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGTCAGAGAAACCGGGGCAAC	0.443													16	6	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110498988	110498988	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110498988A>G	uc003yne.2	+	59	9922	c.9818A>G	c.(9817-9819)GAG>GGG	p.E3273G		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	3273	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGTTGGTCTGAGGACTCTTTT	0.418										HNSCC(38;0.096)			67	210	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113353710	113353710	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113353710G>C	uc003ynu.2	-	42	6807	c.6648C>G	c.(6646-6648)TAC>TAG	p.Y2216*	CSMD3_uc003yns.2_Nonsense_Mutation_p.Y1418*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.Y2176*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.Y2112*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2216	Extracellular (Potential).|CUB 12.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCTTACCTTGGTATACAATAT	0.294										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			32	15	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113562923	113562923	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113562923G>T	uc003ynu.2	-	27	4700	c.4541C>A	c.(4540-4542)TCT>TAT	p.S1514Y	CSMD3_uc003yns.2_Missense_Mutation_p.S786Y|CSMD3_uc003ynt.2_Missense_Mutation_p.S1474Y|CSMD3_uc011lhx.1_Missense_Mutation_p.S1410Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1514	Extracellular (Potential).|CUB 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGCAAATCCAGATTTGCTAAT	0.303										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			54	15	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121293237	121293237	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121293237A>T	uc003yox.2	+	31	4028	c.3763A>T	c.(3763-3765)ACC>TCC	p.T1255S	COL14A1_uc003yoz.2_Missense_Mutation_p.T220S	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	1255	Nonhelical region (NC4).|TSP N-terminal.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGAGCCTGGTACCTTCAATGT	0.358													19	66	---	---	---	---	PASS
TOP1MT	116447	broad.mit.edu	37	8	144406793	144406793	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144406793C>T	uc003yxz.2	-	6	697	c.678G>A	c.(676-678)TCG>TCA	p.S226S	TOP1MT_uc011lkd.1_Silent_p.S128S|TOP1MT_uc011lke.1_Silent_p.S128S|TOP1MT_uc010mfb.2_Silent_p.S128S|TOP1MT_uc011lkf.1_Silent_p.S21S|TOP1MT_uc010mfd.1_Silent_p.S21S	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor	226					DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	CGGGGATCTTCGAGTCCCTGC	0.587													40	230	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144994835	144994835	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144994835C>A	uc003zaf.1	-	32	9735	c.9565G>T	c.(9565-9567)GAC>TAC	p.D3189Y	PLEC_uc003zab.1_Missense_Mutation_p.D3052Y|PLEC_uc003zac.1_Missense_Mutation_p.D3056Y|PLEC_uc003zad.2_Missense_Mutation_p.D3052Y|PLEC_uc003zae.1_Missense_Mutation_p.D3020Y|PLEC_uc003zag.1_Missense_Mutation_p.D3030Y|PLEC_uc003zah.2_Missense_Mutation_p.D3038Y|PLEC_uc003zaj.2_Missense_Mutation_p.D3079Y	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3189	Globular 2.|Plectin 7.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						ACGGCCATGTCGGATGGCAGC	0.667													16	86	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144996841	144996841	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144996841C>A	uc003zaf.1	-	31	7837	c.7667G>T	c.(7666-7668)CGC>CTC	p.R2556L	PLEC_uc003zab.1_Missense_Mutation_p.R2419L|PLEC_uc003zac.1_Missense_Mutation_p.R2423L|PLEC_uc003zad.2_Missense_Mutation_p.R2419L|PLEC_uc003zae.1_Missense_Mutation_p.R2387L|PLEC_uc003zag.1_Missense_Mutation_p.R2397L|PLEC_uc003zah.2_Missense_Mutation_p.R2405L|PLEC_uc003zaj.2_Missense_Mutation_p.R2446L	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2556	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GAGCTCCGTGCGGTGCAGCTT	0.672													13	50	---	---	---	---	PASS
GPR172A	79581	broad.mit.edu	37	8	145584561	145584561	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145584561C>T	uc003zcc.1	+	5	1381	c.1224C>T	c.(1222-1224)GCC>GCT	p.A408A	FBXL6_uc003zbz.2_5'Flank|FBXL6_uc003zca.2_5'Flank|FBXL6_uc003zcb.2_5'Flank|FBXL6_uc010mfx.2_5'Flank|GPR172A_uc003zcd.1_Silent_p.A408A|GPR172A_uc003zce.1_Silent_p.A408A|GPR172A_uc010mfy.1_Silent_p.A408A|GPR172A_uc003zcf.1_Silent_p.A408A|GPR172A_uc011llc.1_Silent_p.A320A	NM_024531	NP_078807	Q9HAB3	RFT3_HUMAN	G protein-coupled receptor 172A precursor	408	Helical; (Potential).					integral to plasma membrane	receptor activity|riboflavin transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGCTGGCAGCCGGCGTGGCCA	0.642													29	114	---	---	---	---	PASS
KIAA2026	158358	broad.mit.edu	37	9	5920586	5920586	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5920586T>C	uc003zjq.3	-	8	5626	c.5410A>G	c.(5410-5412)AAT>GAT	p.N1804D	KIAA2026_uc010mht.2_Missense_Mutation_p.N979D	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	1804										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TGAGGTTTATTTGTGTTTACA	0.383													276	142	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14851542	14851542	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14851542C>T	uc003zlm.2	-	6	1482	c.892G>A	c.(892-894)GCA>ACA	p.A298T	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	298	CSPG 1.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		GCCATGAATGCAGCCTTTGGA	0.438													59	37	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971006	21971006	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971006C>G	uc003zpk.2	-	2	564	c.352G>C	c.(352-354)GCT>CCT	p.A118P	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.G173A	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	118	ANK 4.		A -> T (in CMM2).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(13)|p.A118fs*10(1)|p.A118V(1)|p.A118fs*27(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		AGCTCCTCAGCCAGGTCCACG	0.731		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			31	14	---	---	---	---	PASS
ANKRD20A3	441425	broad.mit.edu	37	9	67965177	67965177	+	Intron	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67965177A>G	uc004aeu.2	+						ANKRD20A3_uc010mnn.2_Intron	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3												0						AGGTAAGCCTATAGCAGTGTT	0.279													50	28	---	---	---	---	PASS
ANKRD20A4	728747	broad.mit.edu	37	9	69420435	69420435	+	Intron	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69420435A>G	uc004afn.2	+							NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						AGGTAAGCCTATAGCAGTGTT	0.279													8	157	---	---	---	---	PASS
GNA14	9630	broad.mit.edu	37	9	80144079	80144079	+	Missense_Mutation	SNP	G	A	A	rs45466295	byFrequency	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80144079G>A	uc004aku.2	-	2	738	c.215C>T	c.(214-216)ACG>ATG	p.T72M		NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14	72					activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						AACCAGCTTCGTGAACCCCTT	0.448													97	207	---	---	---	---	PASS
GABBR2	9568	broad.mit.edu	37	9	101056152	101056152	+	Missense_Mutation	SNP	C	T	T	rs79773606		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101056152C>T	uc004ays.2	-	18	2731	c.2575G>A	c.(2575-2577)GAT>AAT	p.D859N		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	859	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GGATTTTGATCGAGGTGATTT	0.383													51	40	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117853048	117853048	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117853048T>A	uc004bjj.3	-	2	612	c.250A>T	c.(250-252)AGC>TGC	p.S84C	TNC_uc010mvf.2_Missense_Mutation_p.S84C	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	84					cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						AAGCTTTCGCTGGGCTCTGAA	0.582													129	81	---	---	---	---	PASS
PKN3	29941	broad.mit.edu	37	9	131479170	131479170	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131479170C>A	uc004bvw.2	+	16	2346	c.1953C>A	c.(1951-1953)ATC>ATA	p.I651I	PKN3_uc010myh.2_Silent_p.I651I|PKN3_uc011mbk.1_Silent_p.I201I	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta	651	Protein kinase.				signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						TGATGCAGATCCACGAGGATG	0.597													57	34	---	---	---	---	PASS
UBAC1	10422	broad.mit.edu	37	9	138830184	138830184	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138830184C>T	uc004cgt.2	-	9	1204	c.986G>A	c.(985-987)CGG>CAG	p.R329Q	UBAC1_uc004cgs.1_Missense_Mutation_p.R329Q|UBAC1_uc004cgu.2_RNA	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1	329						Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		AGAGGGCTTCCGGTCCCCCAG	0.622													23	9	---	---	---	---	PASS
PMPCA	23203	broad.mit.edu	37	9	139311657	139311657	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139311657G>A	uc004chl.2	+	7	893	c.888G>A	c.(886-888)GGG>GGA	p.G296G	PMPCA_uc010nbl.2_Silent_p.G196G|PMPCA_uc011mdz.1_Silent_p.G165G|PMPCA_uc004chm.1_Silent_p.G46G|PMPCA_uc004chn.1_5'Flank	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	296					proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		ACACTGGGGGGATTGCCAAGG	0.612													24	10	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25887462	25887462	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25887462G>A	uc001isj.2	+	11	2967	c.2907G>A	c.(2905-2907)AAG>AAA	p.K969K	GPR158_uc001isk.2_Silent_p.K344K	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	969	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						AGCCAAGAAAGCCTCAGAAAT	0.453													86	30	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43316033	43316033	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43316033G>T	uc001jaj.2	+	17	3205	c.2847G>T	c.(2845-2847)AGG>AGT	p.R949S		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	949					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						TAGGGTGGAGGAGGTTTCAGA	0.458													19	57	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50856650	50856650	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50856650A>T	uc001jhz.2	+	9	1532	c.1379A>T	c.(1378-1380)CAC>CTC	p.H460L	CHAT_uc001jhv.1_Missense_Mutation_p.H342L|CHAT_uc001jhx.1_Missense_Mutation_p.H342L|CHAT_uc001jhy.1_Missense_Mutation_p.H342L|CHAT_uc001jia.2_Missense_Mutation_p.H342L|CHAT_uc010qgs.1_Missense_Mutation_p.H342L	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	460					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	CTGCTCAAGCACGTGTGAGTC	0.577													17	6	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50947856	50947856	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50947856G>T	uc001jie.2	-	17	2312	c.2170C>A	c.(2170-2172)CCC>ACC	p.P724T	OGDHL_uc009xog.2_Missense_Mutation_p.P751T|OGDHL_uc010qgt.1_Missense_Mutation_p.P667T|OGDHL_uc010qgu.1_Missense_Mutation_p.P515T	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	724					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						AGGGCATTGGGGCTGGCCATG	0.572													22	34	---	---	---	---	PASS
DKK1	22943	broad.mit.edu	37	10	54074370	54074370	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54074370C>A	uc001jjr.2	+	1	330	c.176C>A	c.(175-177)GCA>GAA	p.A59E	uc001jjq.1_5'Flank|uc009xox.1_5'Flank	NM_012242	NP_036374	O94907	DKK1_HUMAN	dickkopf homolog 1 precursor	59					negative regulation of peptidyl-serine phosphorylation|negative regulation of protein complex assembly|negative regulation of transcription from RNA polymerase II promoter|positive regulation of heart induction by negative regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization	extracellular space|plasma membrane	growth factor activity|low-density lipoprotein particle receptor binding|receptor antagonist activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						CCAGGCTCTGCAGTCAGCGCC	0.632											OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	50	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55568769	55568769	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55568769G>T	uc010qhs.1	-	37	5451	c.5056C>A	c.(5056-5058)CCA>ACA	p.P1686T	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qht.1_Missense_Mutation_p.P1679T|PCDH15_uc010qhu.1_3'UTR	NM_001142769	NP_001136241	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-1 precursor	Error:Variant_position_missing_in_Q96QU1_after_alignment					equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				tcttcttgtggctcctcttTC	0.328										HNSCC(58;0.16)			5	4	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55892724	55892724	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55892724T>A	uc001jju.1	-	15	2223	c.1828A>T	c.(1828-1830)AAT>TAT	p.N610Y	PCDH15_uc010qhq.1_Missense_Mutation_p.N615Y|PCDH15_uc010qhr.1_Missense_Mutation_p.N610Y|PCDH15_uc010qhs.1_Missense_Mutation_p.N622Y|PCDH15_uc010qht.1_Missense_Mutation_p.N617Y|PCDH15_uc010qhu.1_Missense_Mutation_p.N610Y|PCDH15_uc001jjv.1_Missense_Mutation_p.N588Y|PCDH15_uc010qhv.1_Missense_Mutation_p.N610Y|PCDH15_uc010qhw.1_Missense_Mutation_p.N573Y|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Missense_Mutation_p.N615Y|PCDH15_uc010qhz.1_Missense_Mutation_p.N610Y|PCDH15_uc010qia.1_Missense_Mutation_p.N588Y|PCDH15_uc010qib.1_Missense_Mutation_p.N588Y|PCDH15_uc001jjw.2_Missense_Mutation_p.N610Y	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	610	Cadherin 5.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				GGGCTTTGATTATTTGGTGGA	0.408										HNSCC(58;0.16)			18	43	---	---	---	---	PASS
FAM13C	220965	broad.mit.edu	37	10	61012727	61012727	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61012727G>A	uc001jkn.2	-	13	1498	c.1364C>T	c.(1363-1365)CCA>CTA	p.P455L	FAM13C_uc001jko.2_Missense_Mutation_p.P357L|FAM13C_uc010qid.1_Missense_Mutation_p.P371L|FAM13C_uc010qie.1_Missense_Mutation_p.P372L|FAM13C_uc010qif.1_Missense_Mutation_p.P477L	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1	455										ovary(2)	2						GCTTCCCTGTGGACGGTCTTC	0.483													27	100	---	---	---	---	PASS
RHOBTB1	9886	broad.mit.edu	37	10	62648181	62648181	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62648181G>C	uc001jli.2	-	7	1683	c.1245C>G	c.(1243-1245)CTC>CTG	p.L415L	RHOBTB1_uc001jlh.2_Silent_p.L415L|RHOBTB1_uc001jlj.2_Silent_p.L415L|RHOBTB1_uc001jlk.2_Silent_p.L415L|RHOBTB1_uc009xpe.1_Silent_p.L353L|RHOBTB1_uc001jll.2_Silent_p.L165L	NM_014836	NP_055651	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	415	BTB 1.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			upper_aerodigestive_tract(1)	1	Prostate(12;0.0112)					AAAGAAACTGGAGCAGGGTCC	0.527													28	57	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64960338	64960338	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64960338C>A	uc001jmn.2	-	11	5474	c.5174G>T	c.(5173-5175)GGG>GTG	p.G1725V	JMJD1C_uc001jml.2_Missense_Mutation_p.G1506V|JMJD1C_uc001jmm.2_Missense_Mutation_p.G1437V|JMJD1C_uc010qiq.1_Missense_Mutation_p.G1543V|JMJD1C_uc009xpi.2_Missense_Mutation_p.G1543V|JMJD1C_uc009xpj.1_Intron|JMJD1C_uc009xpk.1_Intron	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	1725					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					TAAATTAGGCCCTATCTCACA	0.403													23	27	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	69407234	69407234	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69407234G>T	uc009xpn.1	-	2	161	c.38C>A	c.(37-39)CCT>CAT	p.P13H	CTNNA3_uc001jmw.2_Missense_Mutation_p.P13H|CTNNA3_uc001jmx.3_Missense_Mutation_p.P13H|CTNNA3_uc009xpo.1_5'UTR|CTNNA3_uc001jna.2_Missense_Mutation_p.P25H	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	13					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						CAGATCCTGAGGATCGATATT	0.383													43	145	---	---	---	---	PASS
NODAL	4838	broad.mit.edu	37	10	72195571	72195571	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72195571G>T	uc001jrc.2	-	2	404	c.362C>A	c.(361-363)ACA>AAA	p.T121K		NM_018055	NP_060525	Q96S42	NODAL_HUMAN	nodal precursor	121					growth	extracellular space	cytokine activity|growth factor activity			large_intestine(1)|kidney(1)	2						AGCCTGCTCTGTGTCGGGCTT	0.567													37	47	---	---	---	---	PASS
AP3M1	26985	broad.mit.edu	37	10	75886051	75886051	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75886051C>A	uc001jwf.2	-	7	1296	c.866G>T	c.(865-867)GGC>GTC	p.G289V	AP3M1_uc001jwg.2_Missense_Mutation_p.G289V|AP3M1_uc001jwh.2_Missense_Mutation_p.G289V|AP3M1_uc010qla.1_Missense_Mutation_p.G235V	NM_207012	NP_996895	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	289	MHD.				protein targeting to lysosome|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus|lysosome	protein binding				0	Prostate(51;0.0112)					ATCAAATCTGCCGCAAGAACT	0.373													11	53	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91465176	91465176	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91465176C>T	uc001kgs.1	+	2	197	c.125C>T	c.(124-126)TCC>TTC	p.S42F	KIF20B_uc001kgr.1_Missense_Mutation_p.S42F	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	42					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						CATGAATTTTCCTTAGTTGCT	0.323													43	42	---	---	---	---	PASS
PCGF5	84333	broad.mit.edu	37	10	93008287	93008287	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93008287A>G	uc001khh.2	+	4	482	c.235A>G	c.(235-237)ATA>GTA	p.I79V	PCGF5_uc010qnk.1_Missense_Mutation_p.I79V|PCGF5_uc001khi.2_Missense_Mutation_p.I79V	NM_032373	NP_115749	Q86SE9	PCGF5_HUMAN	polycomb group ring finger 5	79					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|PcG protein complex	zinc ion binding			lung(1)	1						AGAGGAAATTATATTTAAGCT	0.358													78	76	---	---	---	---	PASS
CYP26C1	340665	broad.mit.edu	37	10	94824182	94824182	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94824182C>T	uc010qns.1	+	4	750	c.750C>T	c.(748-750)GCC>GCT	p.A250A	CYP26C1_uc009xud.2_Intron	NM_183374	NP_899230	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C,	250					anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			central_nervous_system(1)	1		Colorectal(252;0.122)				TGGAGGGGGCCATTTCTGAGA	0.612													28	40	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95790939	95790939	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95790939C>A	uc001kjk.2	+	2	770	c.136C>A	c.(136-138)CGA>AGA	p.R46R	PLCE1_uc010qnx.1_Silent_p.R46R	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	46					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				TACTGTCAGACGAAGTGGGGA	0.433													28	32	---	---	---	---	PASS
POLL	27343	broad.mit.edu	37	10	103339394	103339394	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103339394G>C	uc001ktg.1	-	8	2310	c.1544C>G	c.(1543-1545)TCC>TGC	p.S515C	DPCD_uc010qpz.1_Intron|POLL_uc001ktd.1_Missense_Mutation_p.S188C|POLL_uc001kte.1_Missense_Mutation_p.S207C|POLL_uc001kth.1_Missense_Mutation_p.S240C|POLL_uc001kti.1_Missense_Mutation_p.S515C|POLL_uc001ktj.1_Missense_Mutation_p.S515C|POLL_uc001ktf.2_Missense_Mutation_p.S423C|POLL_uc001ktk.1_Missense_Mutation_p.S254C|POLL_uc010qqa.1_Missense_Mutation_p.S254C|POLL_uc010qqb.1_RNA|POLL_uc001ktm.2_Missense_Mutation_p.S515C|POLL_uc001ktl.2_Missense_Mutation_p.S427C|POLL_uc010qqc.1_Missense_Mutation_p.S207C	NM_013274	NP_037406	Q9UGP5	DPOLL_HUMAN	DNA-directed DNA polymerase lambda	515					DNA replication|nucleotide-excision repair|somatic hypermutation of immunoglobulin genes	nucleus	DNA binding|DNA-directed DNA polymerase activity|lyase activity|metal ion binding				0		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		GGCTCGCATGGAGCGGTTGAA	0.632								DNA_polymerases_(catalytic_subunits)					49	65	---	---	---	---	PASS
SFXN2	118980	broad.mit.edu	37	10	104486565	104486565	+	Intron	SNP	G	A	A	rs3839933		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104486565G>A	uc001kwb.2	+						SFXN2_uc001kwc.2_Intron|SFXN2_uc001kwd.2_Intron	NM_178858	NP_849189	Q96NB2	SFXN2_HUMAN	sideroflexin 2						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity				0		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		GTGAGGGGTCGGGGAAGGGGC	0.572													11	38	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115389450	115389450	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115389450A>G	uc001laj.2	-	19	2101	c.1937T>C	c.(1936-1938)CTC>CCC	p.L646P	NRAP_uc009xyb.2_5'Flank|NRAP_uc001lak.2_Missense_Mutation_p.L611P|NRAP_uc001lal.3_Missense_Mutation_p.L646P	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	646	Nebulin 15.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GTCACTGGCGAGAGTTTGGGC	0.483													22	80	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118318738	118318738	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118318738A>G	uc001lcm.2	+	10	1046	c.1003A>G	c.(1003-1005)ACA>GCA	p.T335A		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	335					lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	TCCTGGGAAAACAAATGATGT	0.378													25	37	---	---	---	---	PASS
HMX3	340784	broad.mit.edu	37	10	124896747	124896747	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124896747G>A	uc010quc.1	+	2	574	c.574G>A	c.(574-576)GCG>ACG	p.A192T		NM_001105574	NP_001099044	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	192					cell differentiation	nucleus	sequence-specific DNA binding transcription factor activity				0		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		AGGCGAAGCGGCGCCAGGCGC	0.662													7	4	---	---	---	---	PASS
STK32C	282974	broad.mit.edu	37	10	134121179	134121179	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134121179C>A	uc001lle.1	-	1	299	c.159G>T	c.(157-159)TCG>TCT	p.S53S	STK32C_uc001lld.1_5'Flank|STK32C_uc010quu.1_Intron|STK32C_uc009ybc.1_Intron|STK32C_uc009ybd.1_Intron	NM_173575	NP_775846	Q86UX6	ST32C_HUMAN	serine/threonine kinase 32C	53							ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GGCGCGGCTGCGAGCGGACAT	0.398													31	45	---	---	---	---	PASS
C10orf91	170393	broad.mit.edu	37	10	134258757	134258757	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134258757T>A	uc001llm.2	+	1	44	c.4T>A	c.(4-6)TGG>AGG	p.W2R		NM_173541	NP_775812	Q5T1B1	CJ091_HUMAN	hypothetical protein LOC170393	2										ovary(1)	1		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)		AGCTGAAATGTGGAGTTTCCT	0.622													3	6	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1082714	1082714	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1082714A>T	uc001lsx.1	+	15	1990	c.1963A>T	c.(1963-1965)AAC>TAC	p.N655Y		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	655						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCATGTCTGCAGTGAGTGCCG	0.697													15	15	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1281295	1281295	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1281295C>G	uc009ycr.1	+	68	18040	c.17914C>G	c.(17914-17916)CCA>GCA	p.P5972A	MUC5B_uc001ltb.2_Missense_Mutation_p.P5638A	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	5635					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGCATCCTGCCCAGATGTGTC	0.617													34	10	---	---	---	---	PASS
DUSP8	1850	broad.mit.edu	37	11	1578659	1578659	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1578659G>C	uc001lts.2	-	7	1095	c.967C>G	c.(967-969)CCT>GCT	p.P323A		NM_004420	NP_004411	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	323	Tyrosine-protein phosphatase.|Pro-rich.				inactivation of MAPK activity	cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		CCGGCGGCAGGACTGGGCGGA	0.711													12	8	---	---	---	---	PASS
OR51F2	119694	broad.mit.edu	37	11	4843409	4843409	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4843409T>G	uc010qyn.1	+	1	794	c.794T>G	c.(793-795)TTC>TGC	p.F265C		NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F,	265	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTTTCCATCTTCTACCTCCCT	0.478													46	35	---	---	---	---	PASS
OR51T1	401665	broad.mit.edu	37	11	4903564	4903564	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4903564G>A	uc010qyp.1	+	1	516	c.516G>A	c.(514-516)GTG>GTA	p.V172V		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGTCCTGGTGATAGGGCTGG	0.507													93	51	---	---	---	---	PASS
OR51L1	119682	broad.mit.edu	37	11	5020636	5020636	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5020636G>T	uc010qyu.1	+	1	424	c.424G>T	c.(424-426)GTA>TTA	p.V142L		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	142	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACCAACAGTGTAATTGGCAA	0.493													126	65	---	---	---	---	PASS
OR51M1	390059	broad.mit.edu	37	11	5411314	5411314	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5411314C>A	uc010qzc.1	+	1	686	c.686C>A	c.(685-687)TCC>TAC	p.S229Y	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	229						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCGCACTGTCCTATGGACTC	0.537													41	24	---	---	---	---	PASS
UBQLN3	50613	broad.mit.edu	37	11	5530345	5530345	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5530345A>G	uc001may.1	-	2	530	c.444T>C	c.(442-444)CGT>CGC	p.R148R	HBG2_uc001mak.1_Intron	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	148										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGGGAAGCCACGATAGGCCA	0.582													29	17	---	---	---	---	PASS
UBQLNL	143630	broad.mit.edu	37	11	5537581	5537581	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5537581T>A	uc001maz.3	-	1	376	c.91A>T	c.(91-93)ACT>TCT	p.T31S	HBG2_uc001mak.1_Intron	NM_145053	NP_659490	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	31	Ubiquitin-like.									large_intestine(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		ATCACTCGAGTGGCACTTGAA	0.483													50	30	---	---	---	---	PASS
OR10A6	390093	broad.mit.edu	37	11	7950101	7950101	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7950101C>A	uc010rbh.1	-	1	109	c.109G>T	c.(109-111)GTG>TTG	p.V37L		NM_001004461	NP_001004461	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A,	37	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATCAGGGTCACCAGATAAATA	0.458													55	44	---	---	---	---	PASS
C11orf16	56673	broad.mit.edu	37	11	8948685	8948685	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8948685C>G	uc001mhb.3	-	4	485	c.361G>C	c.(361-363)GCT>CCT	p.A121P	C11orf16_uc001mhc.3_Missense_Mutation_p.A121P	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673	121										upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		ACAAGAGGAGCCTCGAATTCC	0.522													12	14	---	---	---	---	PASS
GAS2	2620	broad.mit.edu	37	11	22747905	22747905	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22747905A>G	uc009yie.2	+	4	641	c.335A>G	c.(334-336)AAT>AGT	p.N112S	GAS2_uc001mqm.2_Missense_Mutation_p.N112S|GAS2_uc001mqn.2_RNA|GAS2_uc001mqo.2_Missense_Mutation_p.N112S	NM_001143830	NP_001137302	O43903	GAS2_HUMAN	growth arrest-specific 2	112	CH.				cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2						GCCAGAGACAATACAGCAAAT	0.398													46	36	---	---	---	---	PASS
GAS2	2620	broad.mit.edu	37	11	22770666	22770666	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22770666G>T	uc009yie.2	+	6	780	c.474G>T	c.(472-474)AGG>AGT	p.R158S	GAS2_uc001mqm.2_Missense_Mutation_p.R158S|GAS2_uc001mqn.2_RNA|GAS2_uc001mqo.2_Missense_Mutation_p.R158S	NM_001143830	NP_001137302	O43903	GAS2_HUMAN	growth arrest-specific 2	158					cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2						CTTTTTAAAGGTATGGTGTGG	0.383													21	16	---	---	---	---	PASS
LUZP2	338645	broad.mit.edu	37	11	25004678	25004678	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25004678C>T	uc001mqs.2	+	9	838	c.604C>T	c.(604-606)CAG>TAG	p.Q202*	LUZP2_uc009yif.2_Nonsense_Mutation_p.Q116*|LUZP2_uc009yig.2_Nonsense_Mutation_p.Q160*	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor	202	Potential.					extracellular region				ovary(1)|skin(1)	2						GTAGGAGTCACAGATGAAAGC	0.418													67	40	---	---	---	---	PASS
ACCSL	390110	broad.mit.edu	37	11	44081390	44081390	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44081390A>G	uc001mxw.1	+	14	1683	c.1627A>G	c.(1627-1629)ATG>GTG	p.M543V	ACCSL_uc009ykr.2_Missense_Mutation_p.M362V	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase	543							1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5						CCCTCTAGCTATGCGTCGGTT	0.512													218	147	---	---	---	---	PASS
CD82	3732	broad.mit.edu	37	11	44639800	44639800	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44639800G>T	uc001myc.2	+	8	775	c.527G>T	c.(526-528)TGC>TTC	p.C176F	CD82_uc001myd.2_Missense_Mutation_p.C151F	NM_002231	NP_002222	P27701	CD82_HUMAN	CD82 antigen isoform 1	176	Extracellular (Potential).					integral to plasma membrane	protein binding			ovary(1)	1						CCCTGTTCCTGCGAAGTCAAG	0.602													11	25	---	---	---	---	PASS
CD82	3732	broad.mit.edu	37	11	44639801	44639801	+	Silent	SNP	C	T	T	rs139816598	byFrequency	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44639801C>T	uc001myc.2	+	8	776	c.528C>T	c.(526-528)TGC>TGT	p.C176C	CD82_uc001myd.2_Silent_p.C151C	NM_002231	NP_002222	P27701	CD82_HUMAN	CD82 antigen isoform 1	176	Extracellular (Potential).					integral to plasma membrane	protein binding			ovary(1)	1						CCTGTTCCTGCGAAGTCAAGG	0.607													11	25	---	---	---	---	PASS
CD82	3732	broad.mit.edu	37	11	44639802	44639802	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44639802G>T	uc001myc.2	+	8	777	c.529G>T	c.(529-531)GAA>TAA	p.E177*	CD82_uc001myd.2_Nonsense_Mutation_p.E152*	NM_002231	NP_002222	P27701	CD82_HUMAN	CD82 antigen isoform 1	177	Extracellular (Potential).					integral to plasma membrane	protein binding			ovary(1)	1						CTGTTCCTGCGAAGTCAAGGG	0.607													14	25	---	---	---	---	PASS
RAPSN	5913	broad.mit.edu	37	11	47463443	47463443	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47463443C>T	uc001nfi.1	-	4	935	c.721G>A	c.(721-723)GAC>AAC	p.D241N	RAPSN_uc001nfj.1_Missense_Mutation_p.D241N|RAPSN_uc009yls.1_Missense_Mutation_p.D241N	NM_005055	NP_005046	Q13702	RAPSN_HUMAN	43 kD receptor-associated protein of the synapse	241					synaptic transmission, cholinergic	cell junction|cytoskeleton|postsynaptic membrane	acetylcholine receptor binding|zinc ion binding			ovary(1)	1						AGTGGCCGGTCCCCGTGCTGC	0.672													9	9	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974079	49974079	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974079C>G	uc010rhz.1	+	1	105	c.105C>G	c.(103-105)AAC>AAG	p.N35K		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	35	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						TCTACATCAACGCCATGATAG	0.408													118	60	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55418726	55418726	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55418726T>A	uc001nhs.1	+	1	347	c.347T>A	c.(346-348)ATG>AAG	p.M116K		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				CTTACTGTAATGGCCTATGAT	0.423													105	27	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587917	55587917	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587917C>A	uc010rin.1	+	1	812	c.812C>A	c.(811-813)ACA>AAA	p.T271K		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	271	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				TCCAGGCACACAGTCAAAGTG	0.507													42	82	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606495	55606495	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606495G>T	uc010rio.1	+	1	268	c.268G>T	c.(268-270)GAA>TAA	p.E90*		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				CCTGGTTGTAGAAGATAGAAC	0.408													95	214	---	---	---	---	PASS
OR4D10	390197	broad.mit.edu	37	11	59245336	59245336	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59245336C>T	uc001nnz.1	+	1	434	c.434C>T	c.(433-435)ACA>ATA	p.T145I		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						ATTGGGCTCACAGTGGCTGCC	0.517													55	106	---	---	---	---	PASS
MS4A3	932	broad.mit.edu	37	11	59828660	59828660	+	Silent	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59828660A>T	uc001nom.2	+	2	155	c.27A>T	c.(25-27)GCA>GCT	p.A9A	MS4A3_uc001non.2_Silent_p.A9A|MS4A3_uc001noo.2_Intron	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	9	Cytoplasmic (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				TTGATAATGCAGAGCTGGGGT	0.493													63	72	---	---	---	---	PASS
MS4A2	2206	broad.mit.edu	37	11	59857232	59857232	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59857232G>A	uc001nop.2	+	2	226	c.124G>A	c.(124-126)GCC>ACC	p.A42T	MS4A2_uc009ymu.2_Missense_Mutation_p.A42T	NM_000139	NP_000130	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member	42	Cytoplasmic (Potential).				cell proliferation|humoral immune response	integral to plasma membrane	calcium channel activity			ovary(1)	1		all_epithelial(135;0.245)			Omalizumab(DB00043)	ATTGAAGTCGGCCTCATCCCC	0.458													68	59	---	---	---	---	PASS
MS4A4A	51338	broad.mit.edu	37	11	60059718	60059718	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60059718C>A	uc001noz.2	+	2	72	c.62C>A	c.(61-63)ACA>AAA	p.T21K	MS4A4A_uc001npa.2_Missense_Mutation_p.T2K|MS4A4A_uc001npb.2_Missense_Mutation_p.T2K|MS4A4A_uc001npc.2_Missense_Mutation_p.T2K	NM_148975	NP_683876	Q96JQ5	M4A4A_HUMAN	membrane-spanning 4-domains, subfamily A, member	21	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						GCTGCCATGACAACCATGCAA	0.493													59	86	---	---	---	---	PASS
BSCL2	26580	broad.mit.edu	37	11	62472874	62472874	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62472874G>A	uc001nuo.1	-	2	535	c.111C>T	c.(109-111)ACC>ACT	p.T37T	BSCL2_uc009yoc.1_Silent_p.T37T|BSCL2_uc001nup.2_Silent_p.T37T|BSCL2_uc001nuq.1_Silent_p.T37T|BSCL2_uc001nur.3_Silent_p.T101T|BSCL2_uc009yod.2_Silent_p.T101T|BSCL2_uc001nut.3_Silent_p.T101T|HNRNPUL2_uc001nuu.1_RNA|GNG3_uc001nuv.2_5'Flank	NM_032667	NP_116056	Q96G97	BSCL2_HUMAN	seipin isoform 2	37	Helical; (Potential).				cell death	integral to endoplasmic reticulum membrane					0						AAAGGAGGATGGTGCAGAAGA	0.572													30	61	---	---	---	---	PASS
CAPN1	823	broad.mit.edu	37	11	64972338	64972338	+	Intron	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64972338G>C	uc009yqd.1	+						CAPN1_uc001odf.1_Intron|CAPN1_uc001odg.1_Intron|CAPN1_uc010roa.1_Intron	NM_005186	NP_005177	P07384	CAN1_HUMAN	calpain 1, large subunit						positive regulation of cell proliferation|proteolysis	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		AGGTCAGGAGGGTGGATCACC	0.682											OREG0021073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	43	---	---	---	---	PASS
EFEMP2	30008	broad.mit.edu	37	11	65635425	65635425	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65635425G>T	uc001ofy.3	-	10	1271	c.1077C>A	c.(1075-1077)GAC>GAA	p.D359E	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.D359E	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	359					blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)		TCTGGAACACGTCAGCGGGCA	0.587													55	134	---	---	---	---	PASS
EFEMP2	30008	broad.mit.edu	37	11	65635437	65635437	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65635437G>C	uc001ofy.3	-	10	1259	c.1065C>G	c.(1063-1065)AGC>AGG	p.S355R	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.S355R	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	355				RSV -> AER (in Ref. 2; AAC62108).|S -> R (in Ref. 3; AAF65188).	blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)		CAGCGGGCACGCTCCGCTCCG	0.602													86	81	---	---	---	---	PASS
C11orf80	79703	broad.mit.edu	37	11	66568167	66568167	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66568167G>C	uc001ojf.2	+	7	780	c.773G>C	c.(772-774)GGG>GCG	p.G258A	C11orf80_uc001ojg.2_Missense_Mutation_p.G24A|C11orf80_uc001ojh.2_Missense_Mutation_p.G24A|C11orf80_uc001oji.2_Missense_Mutation_p.G24A|C11orf80_uc010rpk.1_Missense_Mutation_p.G92A	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703	103											0						GAGATCTTTGGGTAAGTTCTT	0.363													8	27	---	---	---	---	PASS
PC	5091	broad.mit.edu	37	11	66618314	66618314	+	Silent	SNP	C	A	A	rs61731787		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66618314C>A	uc001ojn.1	-	16	2353	c.2304G>T	c.(2302-2304)CTG>CTT	p.L768L	PC_uc001ojo.1_Silent_p.L768L|PC_uc001ojp.1_Silent_p.L768L|PC_uc001ojm.1_5'Flank	NM_022172	NP_071504	P11498	PYC_HUMAN	pyruvate carboxylase precursor	768	Carboxyltransferase.				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	TGTGGATGTGCAGTGGGAGGT	0.662													20	61	---	---	---	---	PASS
NDUFV1	4723	broad.mit.edu	37	11	67379393	67379393	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67379393G>A	uc001omj.2	+	8	1259	c.1106G>A	c.(1105-1107)CGC>CAC	p.R369H	NDUFV1_uc010rpv.1_Missense_Mutation_p.R268H|NDUFV1_uc001oml.2_Missense_Mutation_p.R362H|NDUFV1_uc001omk.3_Missense_Mutation_p.R360H|NDUFV1_uc009yrz.1_Silent_p.P228P|NDUFV1_uc010rpw.1_Missense_Mutation_p.R78H	NM_007103	NP_009034	P49821	NDUV1_HUMAN	NADH dehydrogenase ubiquinone flavoprotein 1	369					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|FMN binding|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	GCCATCGCCCGCCTCATTGAG	0.617													49	104	---	---	---	---	PASS
ACY3	91703	broad.mit.edu	37	11	67413302	67413302	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67413302T>A	uc001omq.2	-	4	464	c.293A>T	c.(292-294)CAG>CTG	p.Q98L		NM_080658	NP_542389	Q96HD9	ACY3_HUMAN	aspartoacylase 3	98					interspecies interaction between organisms	apical plasma membrane|cytoplasm	hydrolase activity, acting on ester bonds|metal ion binding				0					L-Aspartic Acid(DB00128)	CCCCAGCAGCTGGTTCAGCTC	0.607													78	158	---	---	---	---	PASS
NADSYN1	55191	broad.mit.edu	37	11	71209527	71209527	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71209527C>G	uc001oqn.2	+	20	2149	c.2023C>G	c.(2023-2025)CTG>GTG	p.L675V	NADSYN1_uc001oqo.2_Missense_Mutation_p.L415V|NADSYN1_uc001oqp.2_Missense_Mutation_p.L304V	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1	675	Ligase (By similarity).				NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GCGACCATTTCTGTACAACAC	0.478													34	141	---	---	---	---	PASS
RSF1	51773	broad.mit.edu	37	11	77386218	77386218	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77386218T>C	uc001oyn.2	-	14	3545	c.3425A>G	c.(3424-3426)GAC>GGC	p.D1142G	RSF1_uc001oym.2_Missense_Mutation_p.D890G	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1142					CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			GCTACAAAAGTCAGTGTCACT	0.453													43	49	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92568145	92568145	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92568145C>A	uc001pdj.3	+	14	9998	c.9981C>A	c.(9979-9981)GTC>GTA	p.V3327V		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3327	Cadherin 30.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGGCCACTGTCAACATCAACC	0.507										TCGA Ovarian(4;0.039)			29	32	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106810751	106810751	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106810751A>C	uc001pjg.1	-	4	1031	c.641T>G	c.(640-642)TTT>TGT	p.F214C	GUCY1A2_uc010rvo.1_Missense_Mutation_p.F214C|GUCY1A2_uc009yxn.1_Missense_Mutation_p.F214C	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	214					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		CTGTTTTCCAAAAGAAGTTCT	0.463													78	111	---	---	---	---	PASS
PPP2R1B	5519	broad.mit.edu	37	11	111637063	111637063	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111637063C>A	uc001plx.1	-	1	107	c.23G>T	c.(22-24)GGG>GTG	p.G8V	PPP2R1B_uc001plw.1_Missense_Mutation_p.G8V|PPP2R1B_uc010rwi.1_Missense_Mutation_p.G8V|PPP2R1B_uc010rwj.1_5'UTR|PPP2R1B_uc010rwk.1_Missense_Mutation_p.G8V|PPP2R1B_uc010rwl.1_Missense_Mutation_p.G8V	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	8			G -> R (in a lung cancer patient).				protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		TGGGCCGGTCCCGAGCTCTGA	0.507													19	17	---	---	---	---	PASS
FAM55D	54827	broad.mit.edu	37	11	114453646	114453646	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114453646A>T	uc001ppc.2	-	3	375	c.194T>A	c.(193-195)CTA>CAA	p.L65Q	FAM55D_uc001ppd.2_5'UTR	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	65						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		AGTCTCTGTTAGTGGCTTTAA	0.448													84	136	---	---	---	---	PASS
PDZD3	79849	broad.mit.edu	37	11	119058019	119058019	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119058019T>G	uc001pwb.2	+	3	1093	c.569T>G	c.(568-570)CTG>CGG	p.L190R	PDZD3_uc001pvy.2_Missense_Mutation_p.L124R|PDZD3_uc001pvz.2_Missense_Mutation_p.L124R|PDZD3_uc010rzd.1_Missense_Mutation_p.L111R|PDZD3_uc001pwa.2_5'UTR			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	190	PDZ 1.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CGGGTGTTGCTGACAGTATTG	0.672													8	10	---	---	---	---	PASS
MFRP	83552	broad.mit.edu	37	11	119216232	119216232	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119216232T>A	uc001pwj.2	-	5	699	c.539A>T	c.(538-540)CAT>CTT	p.H180L	MFRP_uc010rzf.1_RNA|MFRP_uc010rzg.1_Missense_Mutation_p.H180L	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	Error:Variant_position_missing_in_Q9BXJ0_after_alignment						collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		CTGTATTGCATGGTCTGTGGC	0.582													34	53	---	---	---	---	PASS
OR6M1	390261	broad.mit.edu	37	11	123676282	123676282	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123676282G>T	uc010rzz.1	-	1	776	c.776C>A	c.(775-777)CCC>CAC	p.P259H		NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M,	259	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GTTCTGATTGGGTCTCACATA	0.512													13	47	---	---	---	---	PASS
OR6M1	390261	broad.mit.edu	37	11	123676283	123676283	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123676283G>T	uc010rzz.1	-	1	775	c.775C>A	c.(775-777)CCC>ACC	p.P259T		NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M,	259	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		TTCTGATTGGGTCTCACATAC	0.512													13	45	---	---	---	---	PASS
OR8D4	338662	broad.mit.edu	37	11	123777210	123777210	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123777210G>T	uc010saa.1	+	1	72	c.72G>T	c.(70-72)CAG>CAT	p.Q24H		NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		CAGAGCTTCAGCTGCCCCTCT	0.428													37	88	---	---	---	---	PASS
OR4D5	219875	broad.mit.edu	37	11	123810488	123810488	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123810488G>T	uc001pzk.1	+	1	165	c.165G>T	c.(163-165)CTG>CTT	p.L55L		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	55	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ACCCACACCTGCACACAACCA	0.448													76	95	---	---	---	---	PASS
OR10G4	390264	broad.mit.edu	37	11	123887041	123887041	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123887041T>G	uc010sac.1	+	1	760	c.760T>G	c.(760-762)TGT>GGT	p.C254G		NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G,	254	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CTTTGTTCCCTGTGTTGTCAT	0.537													23	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124134923	124134923	+	IGR	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124134923G>C								OR8G2 (38613 upstream) : OR8D1 (44814 downstream)																							TCGTCTTCCTGGGAATCTATG	0.483													22	70	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294301	124294301	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294301A>T	uc010sak.1	-	1	467	c.467T>A	c.(466-468)ATG>AAG	p.M156K		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGTGTGGGCCATGGCCCCAGC	0.552													13	19	---	---	---	---	PASS
ETS1	2113	broad.mit.edu	37	11	128359270	128359270	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128359270G>A	uc010sbs.1	-	3	634	c.318C>T	c.(316-318)TGC>TGT	p.C106C	ETS1_uc001qej.2_Silent_p.C150C|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Silent_p.C106C	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	106	PNT.				cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		TACCCAGGGCGCAGAGGGCTG	0.493													90	96	---	---	---	---	PASS
PRDM10	56980	broad.mit.edu	37	11	129784610	129784610	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129784610G>A	uc001qfm.2	-	18	3074	c.2842C>T	c.(2842-2844)CAA>TAA	p.Q948*	PRDM10_uc001qfj.2_Nonsense_Mutation_p.Q862*|PRDM10_uc001qfk.2_Nonsense_Mutation_p.Q858*|PRDM10_uc001qfl.2_Nonsense_Mutation_p.Q862*|PRDM10_uc010sbx.1_Nonsense_Mutation_p.Q858*|PRDM10_uc001qfn.2_Nonsense_Mutation_p.Q944*|PRDM10_uc009zcs.1_Nonsense_Mutation_p.Q131*	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN	PR domain containing 10 isoform 1	948	Gln-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GAGGCCACTTGAACCACTTGC	0.552													6	143	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133792072	133792072	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133792072G>A	uc001qgx.3	-	17	2558	c.2327C>T	c.(2326-2328)CCC>CTC	p.P776L		NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	776	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		AGACACTTACGGAGACTCCAG	0.577													8	32	---	---	---	---	PASS
IQSEC3	440073	broad.mit.edu	37	12	248089	248089	+	Silent	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:248089A>T	uc001qhw.1	+	1	657	c.651A>T	c.(649-651)GCA>GCT	p.A217A	IQSEC3_uc001qhu.1_Silent_p.A217A|IQSEC3_uc001qht.1_Silent_p.A302A|uc001qhv.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	520					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		AGGCCCCCGCAGAGCCCGCGG	0.716													8	19	---	---	---	---	PASS
ITFG2	55846	broad.mit.edu	37	12	2930910	2930910	+	Silent	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2930910A>C	uc001qlb.1	+	9	964	c.900A>C	c.(898-900)TCA>TCC	p.S300S	ITFG2_uc010seb.1_Silent_p.S123S|ITFG2_uc010sec.1_RNA	NM_018463	NP_060933	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	300											0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGCTGTGGTCAGTGCAGGTGG	0.567													87	112	---	---	---	---	PASS
NTF3	4908	broad.mit.edu	37	12	5603648	5603648	+	Missense_Mutation	SNP	A	G	G	rs145358554		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5603648A>G	uc001qnl.3	+	1	351	c.268A>G	c.(268-270)ACC>GCC	p.T90A	NTF3_uc001qnk.3_Missense_Mutation_p.T103A	NM_002527	NP_002518	P20783	NTF3_HUMAN	neurotrophin 3 isoform 2 preproprotein	90					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						TGCAATGGACACCGAACTGCT	0.617													38	80	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9000180	9000180	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9000180A>G	uc001quz.3	+	15	1817	c.1719A>G	c.(1717-1719)CCA>CCG	p.P573P	A2ML1_uc001qva.1_Silent_p.P153P|A2ML1_uc010sgm.1_Silent_p.P73P	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	417						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						AGCAGCTTCCAGGAGCAGAAG	0.577													111	139	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13768452	13768452	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13768452C>T	uc001rbt.2	-	6	1654	c.1475G>A	c.(1474-1476)GGA>GAA	p.G492E		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	492	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	ATTCCAGGTTCCATTGATTTT	0.373													92	191	---	---	---	---	PASS
ERP27	121506	broad.mit.edu	37	12	15073866	15073866	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15073866C>T	uc001rco.2	-	4	471	c.450G>A	c.(448-450)GTG>GTA	p.V150V		NM_152321	NP_689534	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27 kDa precursor	150	Thioredoxin.					endoplasmic reticulum lumen				breast(1)	1						TATTGTTTACCACAGGGTTGT	0.458													73	118	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21008009	21008009	+	Silent	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21008009T>A	uc001rek.2	+	3	258	c.132T>A	c.(130-132)GGT>GGA	p.G44G	SLCO1B3_uc001rel.2_Silent_p.G44G|SLCO1B3_uc010sil.1_Silent_p.G44G|LST-3TM12_uc010sim.1_Silent_p.G44G	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	44	Helical; Name=1; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					AAGCACTAGGTGGAATCATTA	0.318													26	41	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21172204	21172204	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21172204T>C	uc010sin.1	+	2	108	c.108T>C	c.(106-108)TTT>TTC	p.F36F	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Intron	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	36						membrane	transporter activity				0						TGATTGTATTTGTAAGTTACT	0.328													24	34	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21200140	21200140	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21200140A>G	uc010sin.1	+	7	983	c.983A>G	c.(982-984)AAC>AGC	p.N328S	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.N375S	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	328						membrane	transporter activity				0						TCTAAGACTAACTTTTTGTTG	0.318													4	17	---	---	---	---	PASS
OVCH1	341350	broad.mit.edu	37	12	29631788	29631788	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29631788G>C	uc001rix.1	-	9	1049	c.1049C>G	c.(1048-1050)TCA>TGA	p.S350*		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	350	CUB 1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TCCACTGCTTGATCGTAAAGA	0.294													17	37	---	---	---	---	PASS
DENND5B	160518	broad.mit.edu	37	12	31542367	31542367	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31542367G>T	uc001rki.1	-	20	3718	c.3532C>A	c.(3532-3534)CAG>AAG	p.Q1178K	DENND5B_uc001rkh.1_Missense_Mutation_p.Q1213K|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1178	RUN 2.					integral to membrane				ovary(1)|central_nervous_system(1)	2						GATGATTTCTGAATAAGGACA	0.368													11	22	---	---	---	---	PASS
YARS2	51067	broad.mit.edu	37	12	32902909	32902909	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32902909A>G	uc001rli.2	-	4	1302	c.1236T>C	c.(1234-1236)ACT>ACC	p.T412T		NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	412					tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	CTTTGCGGCAAGTATCTAGGA	0.373													27	156	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39695313	39695313	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39695313C>G	uc001rly.2	-	37	5046	c.4900G>C	c.(4900-4902)GTT>CTT	p.V1634L	KIF21A_uc001rlv.2_Missense_Mutation_p.V579L|KIF21A_uc001rlw.2_Missense_Mutation_p.V904L|KIF21A_uc001rlx.2_Missense_Mutation_p.V1621L|KIF21A_uc001rlz.2_Missense_Mutation_p.V1581L|KIF21A_uc010skl.1_Missense_Mutation_p.V1597L|KIF21A_uc001rlt.2_Missense_Mutation_p.V254L|KIF21A_uc001rlu.2_Missense_Mutation_p.V254L	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1634	WD 7.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				GTGGAATTAACACATATGGCA	0.373													77	94	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39734805	39734805	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39734805C>A	uc001rly.2	-	15	2159	c.2013G>T	c.(2011-2013)CTG>CTT	p.L671L	KIF21A_uc001rlw.2_5'UTR|KIF21A_uc001rlx.2_Silent_p.L658L|KIF21A_uc001rlz.2_Silent_p.L658L|KIF21A_uc010skl.1_Silent_p.L658L	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	671					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TCAGAGTCTGCAGTCTTTTCT	0.368													23	35	---	---	---	---	PASS
C12orf40	283461	broad.mit.edu	37	12	40076501	40076501	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40076501T>A	uc001rmc.2	+	8	942	c.775T>A	c.(775-777)TAC>AAC	p.Y259N	C12orf40_uc009zjv.1_RNA	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	259										ovary(6)	6						ACAGTCAGACTACATTACTGA	0.353													42	87	---	---	---	---	PASS
PDZRN4	29951	broad.mit.edu	37	12	41966418	41966418	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41966418G>C	uc010skn.1	+	10	1308	c.1240G>C	c.(1240-1242)GAC>CAC	p.D414H	PDZRN4_uc001rmq.3_Missense_Mutation_p.D355H|PDZRN4_uc009zjz.2_Missense_Mutation_p.D353H|PDZRN4_uc001rmr.2_Missense_Mutation_p.D240H	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	613							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TGAATACATTGACTCAGACTG	0.468													37	65	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46321729	46321729	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46321729T>C	uc001rox.2	-	11	2042	c.1755A>G	c.(1753-1755)ACA>ACG	p.T585T	SFRS2IP_uc001row.2_Silent_p.T270T|SFRS2IP_uc001roy.1_Silent_p.T659T	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	585					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		GGGAACTCTCTGTTATTTTTT	0.358													50	71	---	---	---	---	PASS
FAM113B	91523	broad.mit.edu	37	12	47629446	47629446	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47629446C>T	uc001rpn.2	+	4	1331	c.600C>T	c.(598-600)AGC>AGT	p.S200S	FAM113B_uc010slj.1_Silent_p.S80S|FAM113B_uc001rpq.2_Silent_p.S200S	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	200							hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					ACTTCCACAGCGCCACCGAGG	0.582													11	21	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48369843	48369843	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48369843C>A	uc001rqu.2	-	50	3681	c.3500G>T	c.(3499-3501)GGC>GTC	p.G1167V	COL2A1_uc001rqt.2_5'Flank|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.G1098V	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1167	Triple-helical region.		Missing (in SEDC).		axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	ACCGACGGGGCCAGGAGGACC	0.632													59	88	---	---	---	---	PASS
PFKM	5213	broad.mit.edu	37	12	48537939	48537939	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48537939A>T	uc001rrc.2	+	20	2161	c.1991A>T	c.(1990-1992)CAG>CTG	p.Q664L	PFKM_uc001rra.1_Missense_Mutation_p.Q349L|PFKM_uc001rrb.1_Missense_Mutation_p.Q735L|PFKM_uc001rrd.2_Missense_Mutation_p.Q349L|PFKM_uc001rre.1_Missense_Mutation_p.Q664L|PFKM_uc001rrg.1_Missense_Mutation_p.Q633L	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle	664					fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						CACATGCAGCAGGTAGGGAAG	0.517													44	67	---	---	---	---	PASS
CCNT1	904	broad.mit.edu	37	12	49110307	49110307	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49110307C>T	uc001rse.1	-	1	475	c.152G>A	c.(151-153)CGT>CAT	p.R51H	CCNT1_uc009zkz.1_5'UTR	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	51					cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6						CACGTTAAGACGCTGCCCCAT	0.587											OREG0021767	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	59	99	---	---	---	---	PASS
MMP19	4327	broad.mit.edu	37	12	56235003	56235003	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56235003G>C	uc001sib.2	-	3	312	c.191C>G	c.(190-192)TCT>TGT	p.S64C	MMP19_uc001sia.2_5'Flank|MMP19_uc001sid.2_Intron|MMP19_uc010spw.1_Missense_Mutation_p.S64C	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1	64					angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						TGGAAGTTCAGATGCTTCCTG	0.522													53	73	---	---	---	---	PASS
STAC3	246329	broad.mit.edu	37	12	57637584	57637584	+	3'UTR	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57637584C>A	uc001snp.2	-	12					STAC3_uc009zpl.2_Silent_p.A86A|STAC3_uc001snq.2_3'UTR|STAC3_uc010srm.1_3'UTR	NM_145064	NP_659501	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3						intracellular signal transduction		identical protein binding|metal ion binding			ovary(2)|skin(1)	3						CGCTTGCAGGCGCCCGCACGC	0.637											OREG0021942	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	30	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57966387	57966387	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57966387G>C	uc001sor.1	+	15	1802	c.1594G>C	c.(1594-1596)GAG>CAG	p.E532Q	KIF5A_uc010srr.1_Missense_Mutation_p.E443Q	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	532					blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						CCTGGAGTCTGAGTTGCAGCG	0.592													39	76	---	---	---	---	PASS
GEFT	115557	broad.mit.edu	37	12	58009617	58009617	+	Intron	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58009617C>G	uc001spb.2	+						GEFT_uc009zpy.2_Intron|GEFT_uc001spa.2_Intron|uc001spc.2_Intron|GEFT_uc001spd.2_Intron	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1						regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					TCTGCCAATTCAGGTGAGCTG	0.612													29	56	---	---	---	---	PASS
LRIG3	121227	broad.mit.edu	37	12	59276650	59276650	+	Splice_Site	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59276650C>A	uc001sqr.2	-	12	1726	c.1480_splice	c.e12+1	p.D494_splice	LRIG3_uc009zqh.2_Splice_Site_p.D434_splice|LRIG3_uc010ssh.1_Splice_Site	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			CTTATACTCACCACACACAAA	0.368													24	41	---	---	---	---	PASS
AVPR1A	552	broad.mit.edu	37	12	63544586	63544586	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63544586G>T	uc001sro.1	-	1	2005	c.31C>A	c.(31-33)CCC>ACC	p.P11T		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	11	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	TTGCCCGAGGGCCCCGCGTCG	0.731													21	24	---	---	---	---	PASS
FRS2	10818	broad.mit.edu	37	12	69968729	69968729	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69968729C>T	uc001suy.2	+	10	2031	c.1521C>T	c.(1519-1521)CCC>CCT	p.P507P	FRS2_uc001suz.2_Silent_p.P507P|FRS2_uc009zrj.2_Silent_p.P507P|FRS2_uc009zrk.2_Silent_p.P507P	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	507					activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity			prostate(1)|kidney(1)	2	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CTGATCTGCCCATGTGAGCCT	0.388													35	68	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78513299	78513299	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78513299C>A	uc001syp.2	+	15	3496	c.3323C>A	c.(3322-3324)GCA>GAA	p.A1108E	NAV3_uc001syo.2_Missense_Mutation_p.A1108E|NAV3_uc010sub.1_Missense_Mutation_p.A608E|NAV3_uc009zsf.2_Missense_Mutation_p.A116E	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1108	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAGTCAAATGCAGGGAGAAAA	0.488										HNSCC(70;0.22)			34	64	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78520960	78520960	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78520960A>G	uc001syp.2	+	17	4425	c.4252A>G	c.(4252-4254)AGA>GGA	p.R1418G	NAV3_uc001syo.2_Missense_Mutation_p.R1418G|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1418	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GCAGCTTGACAGAAATACACT	0.363										HNSCC(70;0.22)			34	43	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78582544	78582544	+	Silent	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78582544T>A	uc001syp.2	+	33	6215	c.6042T>A	c.(6040-6042)ACT>ACA	p.T2014T	NAV3_uc001syo.2_Silent_p.T1992T|NAV3_uc010sub.1_Silent_p.T1471T|NAV3_uc009zsf.2_Silent_p.T823T	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2014						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						ACATCATCACTGTGAACCTCA	0.398										HNSCC(70;0.22)			40	60	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81741318	81741318	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81741318C>A	uc001szo.1	-	18	2387	c.2226G>T	c.(2224-2226)ATG>ATT	p.M742I	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	668										ovary(3)|lung(2)|pancreas(1)	6						ATACCAGTGTCATGACTCCCA	0.418													87	113	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88482973	88482973	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88482973T>C	uc001tar.2	-	31	4209	c.3865A>G	c.(3865-3867)ACA>GCA	p.T1289A	CEP290_uc001taq.2_Missense_Mutation_p.T349A	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	1289	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						TGAATCATTGTTTTGGAGAAC	0.368													20	30	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100453045	100453045	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100453045T>G	uc001tgq.2	-	14	2239	c.2010A>C	c.(2008-2010)GAA>GAC	p.E670D	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.E320D	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	670										ovary(2)	2						CTTTATAAATTTCATGCATTT	0.343													36	78	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101555755	101555755	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101555755T>A	uc001thz.3	-	13	2017	c.1627A>T	c.(1627-1629)ACA>TCA	p.T543S		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	543	Cytoplasmic (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						TAGTTACCTGTTGATAAACTG	0.308													99	199	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105558084	105558084	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105558084A>T	uc001tld.2	+	31	3440	c.3353A>T	c.(3352-3354)CAG>CTG	p.Q1118L	KIAA1033_uc010swr.1_Missense_Mutation_p.Q1119L|KIAA1033_uc010sws.1_Missense_Mutation_p.Q930L	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	1118					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						GTCTATCTACAGGTAGAGAGG	0.403													30	57	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109577292	109577292	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109577292G>T	uc001tob.2	+	2	201	c.82G>T	c.(82-84)GAC>TAC	p.D28Y	ACACB_uc001toc.2_Missense_Mutation_p.D28Y	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	28					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	GAAAATGACGGACTCCAAGCC	0.468													50	81	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112499079	112499079	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112499079C>T	uc001ttm.2	-	12	1283	c.1263G>A	c.(1261-1263)ACG>ACA	p.T421T	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Silent_p.T393T|NAA25_uc009zwa.1_Silent_p.T421T	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	421						cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						CAAGTAACCTCGTCAGCTGCA	0.468													21	54	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112622317	112622317	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112622317C>G	uc009zwc.2	-	54	9205	c.9187G>C	c.(9187-9189)GCC>CCC	p.A3063P		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						GAGGCGGAGGCGCTGATGCTC	0.662													9	13	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120135581	120135581	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120135581G>C	uc001txi.1	-	45	5692	c.5639C>G	c.(5638-5640)TCA>TGA	p.S1880*	CIT_uc001txh.1_Nonsense_Mutation_p.S1399*|CIT_uc001txj.1_Nonsense_Mutation_p.S1922*	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1880	CNH.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		AATCGCTCCTGAGGAAATGGC	0.577													73	115	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122861929	122861929	+	Intron	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122861929T>A	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc010tae.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		AATGTTTCTCTACTCACCAAT	0.353													49	103	---	---	---	---	PASS
RSRC2	65117	broad.mit.edu	37	12	122995669	122995669	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122995669T>C	uc001ucr.2	-	7	938	c.792A>G	c.(790-792)CAA>CAG	p.Q264Q	RSRC2_uc001uco.2_Silent_p.Q32Q|RSRC2_uc001ucp.2_Silent_p.Q205Q|RSRC2_uc001ucq.2_Silent_p.Q32Q|RSRC2_uc001ucs.2_Silent_p.Q32Q|RSRC2_uc001uct.2_Silent_p.Q216Q|RSRC2_uc001ucu.2_Silent_p.Q264Q	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a	264	Potential.									ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		CAGCTATTTCTTGTTGTTTTT	0.249													22	19	---	---	---	---	PASS
ZNF664	144348	broad.mit.edu	37	12	124497330	124497330	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124497330C>A	uc001ufz.2	+	6	2469	c.639C>A	c.(637-639)AGC>AGA	p.S213R	ZNF664_uc001uga.2_Missense_Mutation_p.S213R|ZNF664_uc001ugb.2_Missense_Mutation_p.S213R	NM_152437	NP_689650	Q8N3J9	ZN664_HUMAN	zinc finger protein 664	213	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)		AGAGTTCGAGCCTGTGCATCC	0.522													22	137	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133210913	133210913	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133210913C>T	uc001uks.1	-	43	5907	c.5863G>A	c.(5863-5865)GAT>AAT	p.D1955N	POLE_uc001ukq.1_Missense_Mutation_p.D165N|POLE_uc001ukr.1_Missense_Mutation_p.D759N|POLE_uc010tbq.1_RNA	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	1955					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		tcctcctcatcgtcctcattt	0.333								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					31	51	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19748255	19748255	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19748255G>T	uc009zzj.2	-	5	1150	c.1101C>A	c.(1099-1101)GAC>GAA	p.D367E		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	367					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCTTGGCCAGGTCTCCCCCAG	0.582													16	44	---	---	---	---	PASS
EFHA1	221154	broad.mit.edu	37	13	22084201	22084201	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22084201G>A	uc001uof.2	-	8	725	c.703C>T	c.(703-705)CAG>TAG	p.Q235*	EFHA1_uc010tct.1_Nonsense_Mutation_p.Q25*	NM_152726	NP_689939	Q8IYU8	EFHA1_HUMAN	EF-hand domain family, member A1	235	EF-hand 2.						calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)		AAACGCATCTGAAGAGTTGTG	0.234													24	52	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26156084	26156084	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26156084C>G	uc001uqk.2	+	23	2277	c.2135C>G	c.(2134-2136)GCG>GGG	p.A712G	ATP8A2_uc010tdi.1_Missense_Mutation_p.A672G|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.A222G	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	672	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CAAGAAACTGCGATTAATATA	0.328													9	38	---	---	---	---	PASS
CDX2	1045	broad.mit.edu	37	13	28537332	28537332	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28537332G>C	uc001urv.2	-	3	1036	c.862C>G	c.(862-864)CTG>GTG	p.L288V		NM_001265	NP_001256	Q99626	CDX2_HUMAN	caudal type homeobox 2	288					organ morphogenesis|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		GAGGCTTGCAGGGAAGACACC	0.647			T	ETV6	AML								12	41	---	---	---	---	PASS
FLT3	2322	broad.mit.edu	37	13	28611325	28611325	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28611325T>C	uc001urw.2	-	10	1388	c.1306A>G	c.(1306-1308)AGA>GGA	p.R436G	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.R436G	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	436	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	AACTTACTTCTTATATTCAGC	0.308			Mis|O		AML|ALL								17	49	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32911598	32911598	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32911598G>A	uc001uub.1	+	11	3333	c.3106G>A	c.(3106-3108)GAA>AAA	p.E1036K		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	1036	BRCA2 1.		E -> K (in BC; unknown pathological significance).		cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGATATTGAAGAACAATATCC	0.333			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			17	30	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38143436	38143436	+	Splice_Site	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38143436C>T	uc001uwo.3	-	21	2549	c.2431_splice	c.e21+1	p.D811_splice	POSTN_uc010tet.1_Splice_Site_p.D312_splice|POSTN_uc001uwp.3_Splice_Site_p.D754_splice|POSTN_uc001uwr.2_Intron|POSTN_uc001uwq.2_Intron|POSTN_uc010teu.1_Splice_Site_p.D784_splice|POSTN_uc010tev.1_Splice_Site_p.D724_splice|POSTN_uc010tew.1_Intron	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1						cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CTTTTACTAACCTCCCTGAAG	0.373													10	31	---	---	---	---	PASS
TRPC4	7223	broad.mit.edu	37	13	38237720	38237720	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38237720T>C	uc001uws.2	-	6	1756	c.1521A>G	c.(1519-1521)ATA>ATG	p.I507M	TRPC4_uc010abv.2_Missense_Mutation_p.I87M|TRPC4_uc001uwt.2_Missense_Mutation_p.I507M|TRPC4_uc010tey.1_Missense_Mutation_p.I507M|TRPC4_uc010abw.2_Missense_Mutation_p.I334M|TRPC4_uc010abx.2_Missense_Mutation_p.I507M|TRPC4_uc010aby.2_Missense_Mutation_p.I507M	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	507	Cytoplasmic (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTCCCAGAGATATTTGCAGAG	0.408													17	41	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39450500	39450500	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39450500T>A	uc001uwv.2	+	20	8834	c.8525T>A	c.(8524-8526)CTT>CAT	p.L2842H		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2842	Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACCTTTGACCTTGACATCCGA	0.438													12	47	---	---	---	---	PASS
OLFM4	10562	broad.mit.edu	37	13	53616220	53616220	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53616220G>T	uc001vhl.2	+	3	533	c.533G>T	c.(532-534)GGT>GTT	p.G178V	OLFM4_uc001vhk.1_Intron	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	178	Potential.				cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GAGAGTTTTGGTGGAAGCTCA	0.428													8	26	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58207244	58207244	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58207244C>A	uc001vhq.1	+	1	1456	c.564C>A	c.(562-564)GAC>GAA	p.D188E	PCDH17_uc010aec.1_Missense_Mutation_p.D188E	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	188	Extracellular (Potential).|Cadherin 2.|Cell attachment site (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CCCGCGGCGACGGCACCAAGT	0.642													4	16	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58207599	58207599	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58207599G>T	uc001vhq.1	+	1	1811	c.919G>T	c.(919-921)GGC>TGC	p.G307C	PCDH17_uc010aec.1_Missense_Mutation_p.G307C	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	307	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CCGTGTGAAGGGCAATCTGGA	0.577													11	27	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61986403	61986403	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61986403C>A	uc001vid.3	-	2	2193	c.1829G>T	c.(1828-1830)AGA>ATA	p.R610I	PCDH20_uc010thj.1_Missense_Mutation_p.R610I	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	583	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GTCAACAGCTCTGACAGTGTA	0.453													33	66	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67801278	67801278	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67801278G>T	uc001vik.2	-	2	1987	c.1295C>A	c.(1294-1296)ACC>AAC	p.T432N	PCDH9_uc001vil.2_Missense_Mutation_p.T432N|PCDH9_uc010thl.1_Missense_Mutation_p.T432N|PCDH9_uc001vin.3_Missense_Mutation_p.T432N	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	432	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GAATTCTTTGGTGCCCTCATA	0.403													18	36	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77657256	77657256	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77657256T>C	uc001vkf.2	-	64	10924	c.10833A>G	c.(10831-10833)TTA>TTG	p.L3611L	MYCBP2_uc010aev.2_Silent_p.L3015L|MYCBP2_uc001vke.2_Silent_p.L231L	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	3611					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGGTGTGTGGTAAAGGATGAG	0.458													32	70	---	---	---	---	PASS
HS6ST3	266722	broad.mit.edu	37	13	96743641	96743641	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96743641T>C	uc001vmw.2	+	1	549	c.525T>C	c.(523-525)TGT>TGC	p.C175C		NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	175	Lumenal (Potential).					integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					AGCAGCCTTGTAGCTGCAAAG	0.632													9	14	---	---	---	---	PASS
ZIC2	7546	broad.mit.edu	37	13	100635301	100635301	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100635301C>T	uc001von.2	+	1	983	c.983C>T	c.(982-984)ACA>ATA	p.T328I		NM_007129	NP_009060	O95409	ZIC2_HUMAN	zinc finger protein of the cerebellum 2	328					brain development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|visual perception	cytoplasm|nucleus	chromatin DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CGCGTGCACACAGGCGAGAAA	0.607													32	77	---	---	---	---	PASS
IRS2	8660	broad.mit.edu	37	13	110437489	110437489	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110437489A>T	uc001vqv.2	-	1	1426	c.912T>A	c.(910-912)AGT>AGA	p.S304R		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	304					fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			ATTGGCTCTTACTGCGCGGCC	0.692													5	8	---	---	---	---	PASS
PROZ	8858	broad.mit.edu	37	13	113826358	113826358	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113826358A>T	uc001vta.1	+	8	1149	c.1142A>T	c.(1141-1143)CAC>CTC	p.H381L	PROZ_uc010agr.1_Missense_Mutation_p.H403L	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma	381	Peptidase S1.				blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	GGGCAGGCTCACATGGTCCTT	0.532													9	23	---	---	---	---	PASS
OR4N5	390437	broad.mit.edu	37	14	20612101	20612101	+	Silent	SNP	G	T	T	rs111858769		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20612101G>T	uc010tla.1	+	1	207	c.207G>T	c.(205-207)CTG>CTT	p.L69L		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TGGCCTTACTGGATGCATCCT	0.468													87	234	---	---	---	---	PASS
RNASE10	338879	broad.mit.edu	37	14	20978871	20978871	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20978871C>A	uc010tlj.1	+	1	241	c.241C>A	c.(241-243)CCA>ACA	p.P81T	RNASE10_uc001vxp.2_Missense_Mutation_p.P109T	NM_001012975	NP_001012993	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	81						extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		ACCTGGCTGGCCAGAAGATCC	0.527													6	35	---	---	---	---	PASS
RNASE10	338879	broad.mit.edu	37	14	20978873	20978873	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20978873A>G	uc010tlj.1	+	1	243	c.243A>G	c.(241-243)CCA>CCG	p.P81P	RNASE10_uc001vxp.2_Silent_p.P109P	NM_001012975	NP_001012993	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	81						extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		CTGGCTGGCCAGAAGATCCCA	0.527													6	35	---	---	---	---	PASS
NDRG2	57447	broad.mit.edu	37	14	21526049	21526049	+	Intron	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21526049G>C	uc010tll.1	-						RNASE8_uc010tlm.1_5'Flank	NM_201541	NP_963835	Q9UN36	NDRG2_HUMAN	N-myc downstream-regulated gene 2 isoform b						cell differentiation|nervous system development	centrosome|cytosol|Golgi apparatus|nucleus|perinuclear region of cytoplasm				ovary(1)|breast(1)	2	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TCCCTTAAGAGAGATGGCACC	0.552													6	20	---	---	---	---	PASS
OR5AU1	390445	broad.mit.edu	37	14	21623325	21623325	+	Missense_Mutation	SNP	T	A	A	rs141477326	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21623325T>A	uc010tlp.1	-	1	860	c.860A>T	c.(859-861)AAG>ATG	p.K287M		NM_001004731	NP_001004731	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU,	287	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		GGAAAATGCCTTAAACCTGCC	0.507													17	42	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21899141	21899141	+	Intron	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21899141T>A	uc001was.1	-						CHD8_uc001war.1_5'UTR	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CAACACTGTATTACCAGAGAC	0.567													22	23	---	---	---	---	PASS
SALL2	6297	broad.mit.edu	37	14	21990366	21990366	+	3'UTR	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21990366C>A	uc001wbe.2	-	2					SALL2_uc010tly.1_3'UTR|SALL2_uc010tlz.1_Missense_Mutation_p.A833S|SALL2_uc001wbf.3_Missense_Mutation_p.G133V|SALL2_uc010tma.1_Missense_Mutation_p.A835S|SALL2_uc001wbg.1_Missense_Mutation_p.G135V	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2								DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GACAGGAATGCCACATACTGG	0.582													5	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22266031	22266031	+	Intron	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22266031C>T	uc010tmf.1	+						uc010air.1_Missense_Mutation_p.T105I					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TGGAGTGACACAGCTGAGTAC	0.473													11	81	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22476375	22476375	+	Intron	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22476375C>A	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wct.3_3'UTR|uc001wcu.3_Nonsense_Mutation_p.S104*					SubName: Full=Alpha-chain C region; Flags: Fragment;																		ATCACAGCCTCACAAGTCGTG	0.483													7	15	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22772226	22772226	+	Intron	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22772226A>C	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc010ajq.1_Missense_Mutation_p.Y40S					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TATACCATCTACTGCAATTAT	0.438													13	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22772228	22772228	+	Intron	SNP	T	G	G	rs141323448	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22772228T>G	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc010ajq.1_Missense_Mutation_p.C41G					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TACCATCTACTGCAATTATTC	0.433													12	10	---	---	---	---	PASS
JPH4	84502	broad.mit.edu	37	14	24040570	24040570	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24040570G>C	uc001wkq.2	-	6	2288	c.1370C>G	c.(1369-1371)TCC>TGC	p.S457C	JPH4_uc010tnr.1_Missense_Mutation_p.S122C|JPH4_uc001wkr.2_Missense_Mutation_p.S457C	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN	junctophilin 4	457	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane				ovary(1)|pancreas(1)	2	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		CAGTTCAGGGGATCCCTCTGA	0.677													9	43	---	---	---	---	PASS
NPAS3	64067	broad.mit.edu	37	14	33684439	33684439	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33684439G>A	uc001wru.2	+	3	256	c.192G>A	c.(190-192)CGG>CGA	p.R64R	NPAS3_uc001wrs.2_Silent_p.R34R|NPAS3_uc001wrt.2_Silent_p.R34R|NPAS3_uc001wrv.2_Silent_p.R34R|NPAS3_uc001wrw.2_5'UTR	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3	64	Basic motif.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GCTCCCGCCGGGGAAAAGAAA	0.458													63	51	---	---	---	---	PASS
KLHDC1	122773	broad.mit.edu	37	14	50177095	50177095	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50177095G>C	uc001www.2	+	4	428	c.400G>C	c.(400-402)GAC>CAC	p.D134H	SDCCAG1_uc010anj.1_Intron|KLHDC1_uc010tqg.1_Missense_Mutation_p.D89H|KLHDC1_uc010tqh.1_Missense_Mutation_p.D77H	NM_172193	NP_751943	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	134	Kelch 2.					cytoplasm				pancreas(1)	1	all_epithelial(31;0.00244)|Breast(41;0.00964)					GGTATATAAAGACAGGTAATG	0.363													50	47	---	---	---	---	PASS
GPR137C	283554	broad.mit.edu	37	14	53066842	53066842	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53066842A>G	uc001wzu.3	+	3	500	c.500A>G	c.(499-501)CAT>CGT	p.H167R	GPR137C_uc001wzt.3_Missense_Mutation_p.H167R	NM_001099652	NP_001093122	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	167	Cytoplasmic (Potential).					integral to membrane					0	Breast(41;0.0716)					ATTCTACTGCATTTGGGCTTT	0.338													79	74	---	---	---	---	PASS
C14orf105	55195	broad.mit.edu	37	14	57948311	57948311	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57948311A>G	uc001xcy.2	-	4	604	c.461T>C	c.(460-462)ATG>ACG	p.M154T	C14orf105_uc010trl.1_Missense_Mutation_p.M153T|C14orf105_uc010trm.1_Missense_Mutation_p.M65T|C14orf105_uc010trn.1_Missense_Mutation_p.M65T|C14orf105_uc001xcz.2_Missense_Mutation_p.M153T|C14orf105_uc010aox.1_RNA|C14orf105_uc010aoy.1_Missense_Mutation_p.M75T	NM_018168	NP_060638	Q9NVL8	CN105_HUMAN	hypothetical protein LOC55195	154											0						CAGCACTTGCATCTTATGCAA	0.368													22	82	---	---	---	---	PASS
SYT16	83851	broad.mit.edu	37	14	62536405	62536405	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62536405C>G	uc001xfu.1	+	2	805	c.608C>G	c.(607-609)TCC>TGC	p.S203C	SYT16_uc010tsd.1_Missense_Mutation_p.S203C	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	203										central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		ATTTCCGTGTCCCGGTCCCAG	0.478													65	103	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64568746	64568746	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64568746G>T	uc001xgm.2	+	64	12708	c.12478G>T	c.(12478-12480)GGA>TGA	p.G4160*	SYNE2_uc001xgl.2_Nonsense_Mutation_p.G4160*|SYNE2_uc010apy.2_Nonsense_Mutation_p.G545*|SYNE2_uc010apz.1_Nonsense_Mutation_p.G52*	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4160	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTCATCCTCTGGAACAATTGT	0.517													10	47	---	---	---	---	PASS
C14orf169	79697	broad.mit.edu	37	14	73958889	73958889	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73958889G>T	uc001xok.1	+	3	1247	c.1168G>T	c.(1168-1170)GTG>TTG	p.V390L	HEATR4_uc010tua.1_Intron	NM_024644	NP_078920	Q9H6W3	NO66_HUMAN	chromosome 14 open reading frame 169	390	JmjC.				negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K4 specific)|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.215)		GCTGCAGACCGTGCTGGAACC	0.577													54	70	---	---	---	---	PASS
ISCA2	122961	broad.mit.edu	37	14	74960508	74960508	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74960508G>C	uc001xpz.2	+	1	59	c.31G>C	c.(31-33)GCC>CCC	p.A11P	NPC2_uc001xpy.2_5'Flank|NPC2_uc010tus.1_5'Flank	NM_194279	NP_919255	Q86U28	ISCA2_HUMAN	iron-sulfur cluster assembly 2 precursor	11					iron-sulfur cluster assembly	mitochondrion	iron-sulfur cluster binding|metal ion binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00146)		GTCCCTAACGGCCGCGACGCA	0.652													10	3	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	75052587	75052587	+	Missense_Mutation	SNP	G	A	A	rs149952751	byFrequency	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75052587G>A	uc001xqa.2	-	3	1187	c.800C>T	c.(799-801)TCG>TTG	p.S267L		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	267					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGCGGGCGGCGACTGTGGTGC	0.662													13	71	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	79432644	79432644	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79432644C>T	uc001xun.2	+	9	2044	c.1553C>T	c.(1552-1554)ACC>ATC	p.T518I	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.T643I	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	891	Extracellular (Potential).|Laminin G-like 5.				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAGGCTTACACCTCCATGCAC	0.502													51	52	---	---	---	---	PASS
IFI27L1	122509	broad.mit.edu	37	14	94568333	94568333	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94568333G>A	uc001ycl.2	+						IFI27L1_uc001yck.2_Intron	NM_206949	NP_996832	Q96BM0	I27L1_HUMAN	interferon, alpha-inducible protein 27-like 1							integral to membrane					0						TGAGTGTTCTGGACAGGATGA	0.602													28	47	---	---	---	---	PASS
SERPINA6	866	broad.mit.edu	37	14	94772415	94772415	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94772415G>T	uc001ycv.2	-	4	1129	c.1025C>A	c.(1024-1026)TCA>TAA	p.S342*	SERPINA6_uc010auv.2_RNA	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	342					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	TACCTTTGATGACTTCAGCTG	0.458													16	71	---	---	---	---	PASS
SERPINA11	256394	broad.mit.edu	37	14	94914504	94914504	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94914504G>C	uc001ydd.1	-	2	668	c.608C>G	c.(607-609)ACG>AGG	p.T203R		NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1	203					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		AACCATGAACGTGTCCTGGCT	0.468													38	114	---	---	---	---	PASS
C14orf49	161176	broad.mit.edu	37	14	95905372	95905372	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95905372G>A	uc001yei.3	-	13	2389	c.2374C>T	c.(2374-2376)CGC>TGC	p.R792C	C14orf49_uc010avi.2_Missense_Mutation_p.R792C	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	792	Cytoplasmic (Potential).				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		AGACTCACGCGTCGACGATGC	0.567													55	155	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105419199	105419199	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105419199C>A	uc010axc.1	-	7	2709	c.2589G>T	c.(2587-2589)GTG>GTT	p.V863V	AHNAK2_uc001ypx.2_Silent_p.V763V	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	863						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGTCGGCCTCCACCTTCGGCG	0.612													170	171	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106641769	106641769	+	RNA	SNP	T	G	G	rs139305030	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106641769T>G	uc010tyt.1	-	1021		c.24232A>C								Parts of antibodies, mostly variable regions.												0						CCATAGCTGGTAAAGGTGTAA	0.552													70	162	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22466477	22466477	+	5'Flank	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22466477C>A	uc001yui.1	-											Homo sapiens clone IgA5728-2 immunoglobulin A heavy chain mRNA, partial cds.																		AAAGAGGATCCTCCAGGTCCA	0.562													18	98	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23932317	23932317	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23932317C>A	uc001ywk.2	-	1	134	c.48G>T	c.(46-48)GAG>GAT	p.E16D		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	16					negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		AGTTGGGGGCCTCGGCTGCAA	0.657									Prader-Willi_syndrome				33	31	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25307573	25307573	+	Intron	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25307573C>A	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-5_uc001yxo.2_RNA|SNORD116-2_uc001yxp.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						GAACTGAGGTCCAGCACGTTG	0.517													41	77	---	---	---	---	PASS
GABRA5	2558	broad.mit.edu	37	15	27193257	27193257	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27193257C>A	uc001zbd.1	+	12	1605	c.1266C>A	c.(1264-1266)ATC>ATA	p.I422I	GABRA5_uc001zbe.1_RNA	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	422	Cytoplasmic (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ACAACAGTATCAGCAAAATTG	0.438													9	28	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28211898	28211898	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28211898G>A	uc001zbh.3	-	15	1684	c.1574C>T	c.(1573-1575)CCG>CTG	p.P525L	OCA2_uc010ayv.2_Missense_Mutation_p.P501L	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	525	Helical; (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TCTGAGGAGCGGAAAGCAGAC	0.463									Oculocutaneous_Albinism				12	33	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28436333	28436333	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28436333C>A	uc001zbj.2	-	54	8615	c.8509G>T	c.(8509-8511)GTA>TTA	p.V2837L	HERC2_uc001zbk.1_Missense_Mutation_p.V372L	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2837	DOC.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCAGGATCTACGATCATTTTT	0.368													37	55	---	---	---	---	PASS
OTUD7A	161725	broad.mit.edu	37	15	31776442	31776442	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31776442C>A	uc001zfq.2	-	11	1929	c.1836G>T	c.(1834-1836)TGG>TGT	p.W612C	OTUD7A_uc001zfr.2_Missense_Mutation_p.W619C	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A	612						cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TGCTGTACTTCCAGGCGTCGC	0.697													11	14	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33988492	33988492	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33988492G>T	uc001zhi.2	+	39	6004	c.5934G>T	c.(5932-5934)CTG>CTT	p.L1978L	RYR3_uc010bar.2_Silent_p.L1978L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1978	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ATTCAGAGCTGGTCCGAATGA	0.557													40	50	---	---	---	---	PASS
LRRC57	255252	broad.mit.edu	37	15	42837280	42837280	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42837280C>G	uc001zqd.1	-	4	1041	c.673G>C	c.(673-675)GAT>CAT	p.D225H	LRRC57_uc001zqc.2_Missense_Mutation_p.D225H	NM_153260	NP_694992	Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	225											0		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		CATACCTTATCATAGCCTTCC	0.413													23	58	---	---	---	---	PASS
LRRC57	255252	broad.mit.edu	37	15	42837400	42837400	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42837400C>T	uc001zqd.1	-	4	921	c.553G>A	c.(553-555)GAG>AAG	p.E185K	LRRC57_uc001zqc.2_Missense_Mutation_p.E185K	NM_153260	NP_694992	Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	185	LRR 7.										0		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		AGACAATTCTCTTCCAGGCGA	0.403													40	58	---	---	---	---	PASS
CKMT1A	548596	broad.mit.edu	37	15	43990941	43990941	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43990941T>C	uc001zsn.2	+	9	1506	c.1114T>C	c.(1114-1116)TTG>CTG	p.L372L	CKMT1A_uc010uea.1_Silent_p.L403L|CKMT1A_uc001zso.3_Silent_p.L372L	NM_001015001	NP_001015001	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1A precursor	372	Phosphagen kinase C-terminal.				creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TATTTCTAATTTGGACCGACT	0.512													68	97	---	---	---	---	PASS
SLC28A2	9153	broad.mit.edu	37	15	45564584	45564584	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45564584T>A	uc001zva.2	+	16	1805	c.1740T>A	c.(1738-1740)TGT>TGA	p.C580*		NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled	580	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		TCAGTGCCTGTATGGCAGGTA	0.512													38	77	---	---	---	---	PASS
MYEF2	50804	broad.mit.edu	37	15	48450377	48450377	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48450377T>C	uc001zwi.3	-	8	1040	c.916A>G	c.(916-918)AAA>GAA	p.K306E	MYEF2_uc001zwj.3_Missense_Mutation_p.K306E|MYEF2_uc001zwl.2_Missense_Mutation_p.K146E	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	306	RRM 2.				transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		CTCACCATTTTCACATGCATA	0.343													23	55	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48807697	48807697	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48807697T>C	uc001zwx.1	-	12	1683	c.1355A>G	c.(1354-1356)TAC>TGC	p.Y452C		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	452	EGF-like 6.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CAACTGGCAGTAATCAGTAAC	0.443													17	103	---	---	---	---	PASS
ZNF280D	54816	broad.mit.edu	37	15	56968994	56968994	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56968994T>C	uc002adu.2	-	13	1501	c.1284A>G	c.(1282-1284)TCA>TCG	p.S428S	ZNF280D_uc002adv.2_Silent_p.S415S|ZNF280D_uc010bfq.2_Silent_p.S428S|ZNF280D_uc002adw.1_Silent_p.S456S|ZNF280D_uc010bfr.1_RNA|ZNF280D_uc010bfp.2_RNA	NM_017661	NP_060131	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 1	428	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		CAGAAAATGATGATGATCTAT	0.294													41	63	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	64027022	64027022	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64027022T>C	uc002amp.2	-	13	2695	c.2547A>G	c.(2545-2547)GGA>GGG	p.G849G	HERC1_uc010uil.1_Intron	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	849					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						GCATGGTTGCTCCCACTGATA	0.373													28	31	---	---	---	---	PASS
PDCD7	10081	broad.mit.edu	37	15	65425357	65425357	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65425357C>G	uc002aol.2	-	1	818	c.763G>C	c.(763-765)GAA>CAA	p.E255Q		NM_005707	NP_005698	Q8N8D1	PDCD7_HUMAN	programmed cell death 7	255	Arg/Glu-rich.|Potential.				apoptosis|induction of apoptosis|response to glucocorticoid stimulus	U12-type spliceosomal complex					0						GCCTCGCGTTCCCGGGCCCTC	0.716													11	17	---	---	---	---	PASS
IQCH	64799	broad.mit.edu	37	15	67687727	67687727	+	Missense_Mutation	SNP	C	A	A	rs148305719		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67687727C>A	uc002aqo.1	+	13	1778	c.1731C>A	c.(1729-1731)AGC>AGA	p.S577R	IQCH_uc002aqq.1_Intron|IQCH_uc002aqp.1_Intron	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1	577										skin(3)|ovary(1)	4				Colorectal(3;0.0856)		ACATCGTCAGCGGGCTCCTCC	0.473													86	140	---	---	---	---	PASS
MAP2K5	5607	broad.mit.edu	37	15	67835662	67835662	+	5'UTR	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67835662C>G	uc002aqu.2	+	1					MAP2K5_uc002aqt.1_5'UTR|MAP2K5_uc002aqv.2_5'UTR	NM_145160	NP_660143	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2						ATGTGAGCCTCTTTAACCTGT	0.473													43	69	---	---	---	---	PASS
PIAS1	8554	broad.mit.edu	37	15	68468068	68468068	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68468068A>T	uc002aqz.2	+	10	1359	c.1263A>T	c.(1261-1263)GAA>GAT	p.E421D	PIAS1_uc002ara.2_Missense_Mutation_p.E29D	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	421					androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						CAAAAAAGGAAGTACAGGAAG	0.408													11	27	---	---	---	---	PASS
SPESP1	246777	broad.mit.edu	37	15	69238585	69238585	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69238585C>T	uc002arn.1	+	2	840	c.712C>T	c.(712-714)CAA>TAA	p.Q238*	NOX5_uc002arp.1_Intron|NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002aro.2_Intron	NM_145658	NP_663633	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1 precursor	238					multicellular organismal development	acrosomal vesicle					0						TTCACAAGTGCAACAGGCACT	0.398													23	58	---	---	---	---	PASS
AGPHD1	123688	broad.mit.edu	37	15	78805758	78805758	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78805758G>T	uc010unc.1	+	2	441	c.328G>T	c.(328-330)GTG>TTG	p.V110L	AGPHD1_uc002bdt.2_Missense_Mutation_p.V110L|AGPHD1_uc010ble.2_Missense_Mutation_p.V110L	NM_001013619	NP_001013641	A2RU49	AGPD1_HUMAN	aminoglycoside phosphotransferase domain	110						cytoplasm	kinase activity				0						AGCTTCTCTCGTGTCTGTAGG	0.448													48	57	---	---	---	---	PASS
C15orf37	283687	broad.mit.edu	37	15	80215270	80215270	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80215270C>T	uc002bfb.2	+	1	158	c.155C>T	c.(154-156)CCA>CTA	p.P52L	ST20_uc002bfa.3_Intron	NM_175898	NP_787094			RecName: Full=Putative uncharacterized protein C15orf37;												0						CCAGAGGGTCCACAATCCAGA	0.597													21	43	---	---	---	---	PASS
MEX3B	84206	broad.mit.edu	37	15	82337786	82337786	+	Intron	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82337786C>G	uc002bgq.1	-							NM_032246	NP_115622	Q6ZN04	MEX3B_HUMAN	mex-3 homolog B						protein autophosphorylation	cytoplasmic mRNA processing body|nucleus	calcium ion binding|RNA binding|zinc ion binding			breast(1)|kidney(1)	2						CCCTCCTCGACCTACCTTGCC	0.647													4	12	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83358139	83358139	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83358139C>G	uc010uoh.1	-	2	357	c.180G>C	c.(178-180)AGG>AGC	p.R60S	AP3B2_uc010uoi.1_Missense_Mutation_p.R60S|AP3B2_uc010uoj.1_Missense_Mutation_p.R60S|AP3B2_uc010uok.1_Missense_Mutation_p.R60S	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	60					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			CCGCCACAATCCTCTTCATGG	0.582													16	36	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84611828	84611828	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84611828G>A	uc002bjz.3	+	19	2708	c.2484G>A	c.(2482-2484)TGG>TGA	p.W828*	ADAMTSL3_uc010bmt.1_Nonsense_Mutation_p.W828*|ADAMTSL3_uc010bmu.1_Nonsense_Mutation_p.W828*	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	828	TSP type-1 7.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGGGAGACTGGTCGAAGGTAA	0.438													21	33	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89400078	89400078	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89400078C>T	uc010upo.1	+	12	4636	c.4262C>T	c.(4261-4263)ACT>ATT	p.T1421I	ACAN_uc010upp.1_Missense_Mutation_p.T1421I|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	1421					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTTCTAGAGACTACTGCCCCT	0.537													110	187	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90349349	90349349	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90349349C>A	uc002bop.3	-	2	758	c.466G>T	c.(466-468)GTG>TTG	p.V156L		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	156	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	GTGGGCTCCACCAGCTCAGTC	0.617													34	52	---	---	---	---	PASS
ARRDC4	91947	broad.mit.edu	37	15	98513248	98513248	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98513248A>G	uc010bom.2	+	6	1177	c.1018A>G	c.(1018-1020)ACA>GCA	p.T340A	ARRDC4_uc002bui.3_Missense_Mutation_p.T253A	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	340					signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			GAGCTGGTTGACACTGACCCT	0.428													11	60	---	---	---	---	PASS
LASS3	204219	broad.mit.edu	37	15	101024834	101024834	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101024834C>A	uc002bvz.2	-	6	830	c.328G>T	c.(328-330)GAG>TAG	p.E110*	LASS3_uc002bwa.2_Nonsense_Mutation_p.E121*|LASS3_uc002bwb.2_Nonsense_Mutation_p.E110*	NM_178842	NP_849164	Q8IU89	CERS3_HUMAN	LAG1 longevity assurance homolog 3	110	Homeobox.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4	Lung NSC(78;0.0018)|all_lung(78;0.00278)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000867)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)			ACCTGGCGCTCCGTCAAGTTA	0.483													33	38	---	---	---	---	PASS
SOLH	6650	broad.mit.edu	37	16	601631	601631	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:601631G>A	uc002chi.2	+	9	2675	c.2312G>A	c.(2311-2313)GGT>GAT	p.G771D	SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	771	Calpain catalytic.				proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				AGCAGTGAGGGTGTCTTCTGG	0.682													10	42	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1561113	1561113	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1561113G>C	uc002cmb.2	-	31	4583	c.4221C>G	c.(4219-4221)CCC>CCG	p.P1407P	IFT140_uc002clz.2_Silent_p.P1020P	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1407	TPR 9.									ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				TGTTGGCCAAGGGAAGCCGCC	0.662													5	27	---	---	---	---	PASS
ZNF434	54925	broad.mit.edu	37	16	3434809	3434809	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3434809C>G	uc002cuz.2	-	5	1050	c.248G>C	c.(247-249)TGG>TCG	p.W83S	ZNF434_uc002cux.3_Missense_Mutation_p.W294S|ZNF434_uc010uwx.1_Missense_Mutation_p.W6S|ZNF434_uc002cuy.3_Missense_Mutation_p.W6S|ZNF434_uc010uwy.1_Missense_Mutation_p.W6S|ZNF434_uc010uwz.1_Missense_Mutation_p.W294S|ZNF434_uc010uxa.1_Missense_Mutation_p.W83S	NM_017810	NP_060280	Q9NX65	ZN434_HUMAN	zinc finger protein 434	83					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ACCCTGCTCCCAGAGTCCTTC	0.522													108	109	---	---	---	---	PASS
TFAP4	7023	broad.mit.edu	37	16	4312391	4312391	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4312391G>T	uc010uxg.1	-	3	542	c.288C>A	c.(286-288)ATC>ATA	p.I96I		NM_003223	NP_003214	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer	96	Helix-loop-helix motif.				DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation by host of viral transcription|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|regulation of S phase of mitotic cell cycle	transcriptional repressor complex	E-box binding|histone deacetylase binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						CCAGGGAGAAGATGTACTCGG	0.592													30	105	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19483417	19483417	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19483417T>A	uc002dgc.3	+	11	2539	c.1790T>A	c.(1789-1791)CTG>CAG	p.L597Q	TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Missense_Mutation_p.L597Q|TMC5_uc010var.1_Missense_Mutation_p.L597Q|TMC5_uc002dgd.1_Missense_Mutation_p.L351Q|TMC5_uc002dge.3_Missense_Mutation_p.L351Q|TMC5_uc002dgf.3_Missense_Mutation_p.L280Q|TMC5_uc002dgg.3_Missense_Mutation_p.L238Q	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	597	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						TAGGAGAACCTGTCAGAGCTC	0.328													72	74	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20552086	20552086	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20552086C>A	uc002dhj.3	-	14	1729	c.1519G>T	c.(1519-1521)GCA>TCA	p.A507S	ACSM2B_uc002dhk.3_Missense_Mutation_p.A507S	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	507					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						ATCACAAATGCCTTCACCACC	0.468													60	70	---	---	---	---	PASS
GGA2	23062	broad.mit.edu	37	16	23497395	23497395	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23497395C>G	uc002dlq.2	-	8	815	c.739G>C	c.(739-741)GAG>CAG	p.E247Q	GGA2_uc010bxo.1_RNA	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2	247	GAT.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		CTCAGCATCTCCTGCAGCACC	0.527													29	106	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24373168	24373168	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24373168G>C	uc002dmf.2	+	4	2132	c.932G>C	c.(931-933)CGC>CCC	p.R311P		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	311					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		GCCAACAGGCGCACCACGCCC	0.562													27	32	---	---	---	---	PASS
NFATC2IP	84901	broad.mit.edu	37	16	28970122	28970122	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28970122A>G	uc002dru.2	+	6	946	c.931A>G	c.(931-933)ACA>GCA	p.T311A	uc010vct.1_Intron|NFATC2IP_uc002drt.2_Missense_Mutation_p.T32A|NFATC2IP_uc002drv.2_Missense_Mutation_p.T30A|NFATC2IP_uc010vdh.1_Missense_Mutation_p.T19A	NM_032815	NP_116204	Q8NCF5	NF2IP_HUMAN	nuclear factor of activated T-cells,	311						cytoplasm|nucleus				ovary(1)	1						TTTTGGAGAGACAGAGCTATC	0.582													52	52	---	---	---	---	PASS
ZNF747	65988	broad.mit.edu	37	16	30545881	30545881	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30545881G>A	uc002dyn.2	-	1	314	c.120C>T	c.(118-120)GCC>GCT	p.A40A	ZNF768_uc010vex.1_5'UTR|ZNF747_uc002dyo.1_Silent_p.A40A|ZNF747_uc010vey.1_Silent_p.A40A|uc002dyp.1_5'Flank	NM_023931	NP_076420	Q9BV97	ZN747_HUMAN	zinc finger protein 747	40	KRAB.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0						CGGCCACGTCGGCGAAGCTCA	0.731													6	12	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30976331	30976331	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30976331A>T	uc002ead.1	+	7	1954	c.1268A>T	c.(1267-1269)CAG>CTG	p.Q423L		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	423	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CCCACCGACCAGGACTACCGG	0.657													42	47	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31335990	31335990	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31335990G>C	uc002ebq.2	+	18	2274	c.2176G>C	c.(2176-2178)GTG>CTG	p.V726L	ITGAM_uc002ebr.2_Missense_Mutation_p.V727L|ITGAM_uc010can.2_Missense_Mutation_p.V132L|ITGAM_uc002ebs.1_Missense_Mutation_p.V132L|ITGAM_uc010vfj.1_5'Flank	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	726	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						CGAGGACCCAGTGAGCCCCAT	0.597													6	24	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48149463	48149463	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48149463A>G	uc002efc.1	-	13	2198	c.1852T>C	c.(1852-1854)TAC>CAC	p.Y618H	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	618	ABC transporter 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				CGGTCGGAGTAGACAGCGCGG	0.622													18	31	---	---	---	---	PASS
RBL2	5934	broad.mit.edu	37	16	53473056	53473056	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53473056G>C	uc002ehi.3	+	2	487	c.369G>C	c.(367-369)CAG>CAC	p.Q123H	RBL2_uc010vgv.1_Missense_Mutation_p.Q49H	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	123					cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						GTTCAGAGCAGAGGTAACTAT	0.353													12	33	---	---	---	---	PASS
MT1A	4489	broad.mit.edu	37	16	56673870	56673870	+	3'UTR	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56673870A>G	uc002ejq.2	+	3					MT1A_uc002eji.2_RNA	NM_005946	NP_005937	P04731	MT1A_HUMAN	metallothionein 1A							cytoplasm	cadmium ion binding|copper ion binding|zinc ion binding				0						TGATGTCCGGACAGCCCTGCT	0.488													22	38	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69973306	69973306	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69973306A>G	uc002exu.1	+	24	2592	c.2503A>G	c.(2503-2505)AGC>GGC	p.S835G	WWP2_uc002exv.1_Missense_Mutation_p.S835G|WWP2_uc010vlm.1_Missense_Mutation_p.S719G|WWP2_uc010vln.1_Missense_Mutation_p.S453G|WWP2_uc002exw.1_Missense_Mutation_p.S396G	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	835	HECT.				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						GCTGCCCAGAAGCCACACCTG	0.567													24	41	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76573654	76573654	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76573654G>T	uc002feu.1	+	22	3644	c.3259G>T	c.(3259-3261)GAG>TAG	p.E1087*	CNTNAP4_uc002fev.1_Nonsense_Mutation_p.E951*|CNTNAP4_uc010chb.1_Nonsense_Mutation_p.E1014*|CNTNAP4_uc002fex.1_Nonsense_Mutation_p.E1090*	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	1087	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TAAATATCAAGAGCCTGATGT	0.343													19	46	---	---	---	---	PASS
KCNG4	93107	broad.mit.edu	37	16	84270496	84270496	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84270496C>T	uc010voc.1	-	2	717	c.596G>A	c.(595-597)CGC>CAC	p.R199H	KCNG4_uc002fhu.1_Missense_Mutation_p.R199H	NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	199						voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3						CAGGCCCCAGCGCGAGGAGTG	0.677													11	30	---	---	---	---	PASS
JPH3	57338	broad.mit.edu	37	16	87636784	87636784	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87636784A>T	uc002fkd.2	+	1	286	c.32A>T	c.(31-33)GAC>GTC	p.D11V	JPH3_uc010vou.1_Intron	NM_020655	NP_065706	Q8WXH2	JPH3_HUMAN	junctophilin 3	11	Gly-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0287)		AATTTTGACGACGGAGGGTCC	0.617													29	60	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195614	3195614	+	Missense_Mutation	SNP	A	G	G	rs149271851		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195614A>G	uc002fvh.1	-	1	263	c.263T>C	c.(262-264)CTC>CCC	p.L88P		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						GCGGGACAGGAGACGACTCAA	0.562													34	21	---	---	---	---	PASS
P2RX1	5023	broad.mit.edu	37	17	3807617	3807617	+	Intron	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3807617A>G	uc002fww.2	-							NM_002558	NP_002549	P51575	P2RX1_HUMAN	purinergic receptor P2X1						platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		GAGGAGGCTGACCTTACCTTG	0.652													22	13	---	---	---	---	PASS
ZNF232	7775	broad.mit.edu	37	17	5009781	5009781	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5009781C>A	uc002gas.2	-	5	1346	c.592G>T	c.(592-594)GAG>TAG	p.E198*	ZNF232_uc002gar.1_Nonsense_Mutation_p.E216*|ZNF232_uc002gat.2_Nonsense_Mutation_p.E225*	NM_014519	NP_055334	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	198					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TCCTTGGGCTCTGGGCCATCT	0.388													45	26	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5072240	5072240	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5072240T>G	uc002gau.1	+	35	5637	c.3407T>G	c.(3406-3408)CTG>CGG	p.L1136R	USP6_uc002gav.1_Missense_Mutation_p.L1136R|USP6_uc010ckz.1_Missense_Mutation_p.L819R	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	1136					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CCCAGGATTCTGGCAAGAGAG	0.542			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								89	49	---	---	---	---	PASS
YBX2	51087	broad.mit.edu	37	17	7193680	7193680	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7193680G>A	uc002gfq.2	-	5	691	c.634C>T	c.(634-636)CGG>TGG	p.R212W		NM_015982	NP_057066	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	212	Pro-rich.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter|translational attenuation	cytoplasm|nucleus	DNA binding				0						TCTTCAGCCCGCTCCCCTTTA	0.677													62	37	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578177	7578177	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578177C>T	uc002gim.2	-	6	866	c.672G>A	c.(670-672)GAG>GAA	p.E224E	TP53_uc002gig.1_Silent_p.E224E|TP53_uc002gih.2_Silent_p.E224E|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Silent_p.E92E|TP53_uc010cng.1_Silent_p.E92E|TP53_uc002gii.1_Silent_p.E92E|TP53_uc010cnh.1_Silent_p.E224E|TP53_uc010cni.1_Silent_p.E224E|TP53_uc002gij.2_Silent_p.E224E|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Silent_p.E131E|TP53_uc002gio.2_Silent_p.E92E|TP53_uc010vug.1_Silent_p.E185E	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	224	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E224D(11)|p.0?(7)|p.E224E(6)|p.E224K(5)|p.E224*(4)|p.?(3)|p.E224G(2)|p.E224fs*4(1)|p.E224fs*5(1)|p.V218_E224delVPYEPPE(1)|p.E224fs*23(1)|p.V225fs*24(1)|p.E224fs*24(1)|p.E224_V225insXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAAACCAGACCTCAGGCGGCT	0.522		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			19	7	---	---	---	---	PASS
CHD3	1107	broad.mit.edu	37	17	7798755	7798755	+	Silent	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7798755A>T	uc002gje.2	+	10	1752	c.1602A>T	c.(1600-1602)CCA>CCT	p.P534P	CHD3_uc002gjd.2_Silent_p.P593P|CHD3_uc002gjf.2_Silent_p.P534P|CHD3_uc002gjg.1_Silent_p.P362P	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	534	Chromo 1.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				ATGGAAATCCAGATGTCCCAC	0.592													70	38	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8753096	8753096	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8753096G>A	uc002glq.1	-						PIK3R6_uc002glr.1_Intron|PIK3R6_uc002gls.1_Intron	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0						CCACCACACTGACCTGAGCTC	0.597													14	6	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11666833	11666833	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11666833A>G	uc002gne.2	+	36	7140	c.7072A>G	c.(7072-7074)ACG>GCG	p.T2358A	DNAH9_uc010coo.2_Missense_Mutation_p.T1652A	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2358					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCTCCTGACCACGGAGGACAT	0.502													79	37	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12626289	12626289	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12626289C>G	uc002gnn.2	+	5	678	c.379C>G	c.(379-381)CTT>GTT	p.L127V	MYOCD_uc002gno.2_Missense_Mutation_p.L127V|MYOCD_uc002gnp.1_Missense_Mutation_p.L31V	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	127	RPEL 3.				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AAAAAACATTCTTCCTGTGGA	0.483													85	60	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26110057	26110057	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26110057C>A	uc002gzu.2	-	6	807	c.543G>T	c.(541-543)CTG>CTT	p.L181L	NOS2_uc010crh.1_Silent_p.L181L|NOS2_uc010wab.1_Silent_p.L181L	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	181					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	CATCTCCCGTCAGTTGGTAGG	0.547													44	90	---	---	---	---	PASS
SARM1	23098	broad.mit.edu	37	17	26686017	26686017	+	Intron	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26686017G>T	uc010wah.1	+						POLDIP2_uc002haz.2_5'Flank|POLDIP2_uc010wag.1_5'Flank|TMEM199_uc002hba.2_Intron	NM_152464	NP_689677	Q6SZW1	SARM1_HUMAN	transmembrane protein 199						innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity				0	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CCACGGGTATGTAAGGGATAT	0.393													29	56	---	---	---	---	PASS
SLC46A1	113235	broad.mit.edu	37	17	26732154	26732154	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26732154G>T	uc002hbf.1	-	2	657	c.561C>A	c.(559-561)AGC>AGA	p.S187R	SLC46A1_uc002hbg.1_Missense_Mutation_p.S187R|SLC46A1_uc010wak.1_Missense_Mutation_p.S187R	NM_080669	NP_542400	Q96NT5	PCFT_HUMAN	proton-coupled folate transporter	187	Helical; (Potential).				cellular iron ion homeostasis|folic acid metabolic process	apical plasma membrane|cytoplasm|integral to membrane	folic acid binding|folic acid transporter activity|heme transporter activity				0	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)	CCACCCCGATGCTGGCTTCCA	0.662													10	29	---	---	---	---	PASS
SUPT6H	6830	broad.mit.edu	37	17	27010298	27010298	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27010298G>A	uc002hby.2	+	16	1981	c.1891G>A	c.(1891-1893)GCC>ACC	p.A631T	SUPT6H_uc010crt.2_Missense_Mutation_p.A631T	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	631					chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					TGTGGATGAGGCCCACTATGC	0.507													48	59	---	---	---	---	PASS
C17orf63	55731	broad.mit.edu	37	17	27086441	27086441	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27086441G>A	uc002hct.1	-	3	803	c.536C>T	c.(535-537)CCG>CTG	p.P179L	C17orf63_uc010wax.1_Missense_Mutation_p.P179L|C17orf63_uc010way.1_Missense_Mutation_p.P179L|C17orf63_uc002hcw.2_Missense_Mutation_p.P51L	NM_018182	NP_060652	Q8WU58	CQ063_HUMAN	hypothetical protein LOC55731	179	Gln-rich.									ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)			CTGGGGTGGCGGGATACCCTG	0.711													9	16	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30520215	30520215	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30520215A>G	uc002hgz.2	+	10	939	c.700A>G	c.(700-702)AGA>GGA	p.R234G	RHOT1_uc002hgw.2_Missense_Mutation_p.R234G|RHOT1_uc002hgy.2_Missense_Mutation_p.R234G|RHOT1_uc002hha.2_Missense_Mutation_p.R107G|RHOT1_uc010csv.2_RNA|RHOT1_uc002hgx.2_Missense_Mutation_p.R107G|RHOT1_uc010wby.1_Missense_Mutation_p.R234G|RHOT1_uc002hhb.2_Missense_Mutation_p.R213G|RHOT1_uc002hgv.2_Missense_Mutation_p.R234G	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3	234	Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				GAATGTAGTCAGAAAACATAT	0.358													39	56	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35913393	35913393	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35913393T>C	uc002hoa.2	-	14	2515	c.2432A>G	c.(2431-2433)AAG>AGG	p.K811R	SYNRG_uc010wde.1_Missense_Mutation_p.K733R|SYNRG_uc010wdf.1_Missense_Mutation_p.K733R|SYNRG_uc002hoc.2_Missense_Mutation_p.K732R|SYNRG_uc002hoe.2_Missense_Mutation_p.K733R|SYNRG_uc002hod.2_Missense_Mutation_p.K733R|SYNRG_uc010wdg.1_Missense_Mutation_p.K650R|SYNRG_uc002hob.2_Missense_Mutation_p.K811R|SYNRG_uc002hof.2_Missense_Mutation_p.K523R|SYNRG_uc010cvd.1_Missense_Mutation_p.K611R	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	811					endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						ATCTAAGGACTTCACTGATGC	0.468													54	70	---	---	---	---	PASS
KRT27	342574	broad.mit.edu	37	17	38938327	38938327	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38938327G>C	uc002hvg.2	-	1	460	c.419C>G	c.(418-420)CCA>CGA	p.P140R		NM_181537	NP_853515	Q7Z3Y8	K1C27_HUMAN	keratin 27	140	Rod.|Linker 1.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.000812)				GTCAATAATTGGGAAATATCT	0.463													40	73	---	---	---	---	PASS
KRTAP9-2	83899	broad.mit.edu	37	17	39382983	39382983	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39382983C>A	uc002hwf.2	+	1	84	c.77C>A	c.(76-78)CCC>CAC	p.P26H		NM_031961	NP_114167	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9.2	26	17 X 5 AA repeats of C-C-[RQVSGE]-[SPTQ]- [TASP].					keratin filament	protein binding			upper_aerodigestive_tract(1)	1		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TGCTGGAAGCCCACCACTGTG	0.642													4	113	---	---	---	---	PASS
KRTAP9-8	83901	broad.mit.edu	37	17	39394365	39394365	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39394365C>A	uc002hwh.3	+	1	96	c.62C>A	c.(61-63)CCC>CAC	p.P21H	KRTAP9-9_uc010wfq.1_Intron	NM_031963	NP_114169	Q9BYQ0	KRA98_HUMAN	keratin associated protein 9.8	21	15 X 5 AA repeats of C-C-[RQVSGE]- [SPSNQ]-[TASPI].					keratin filament				ovary(1)	1		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TGCTGGAAGCCCACCACTGTG	0.607													5	130	---	---	---	---	PASS
KRTAP9-4	85280	broad.mit.edu	37	17	39406049	39406049	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39406049C>A	uc002hwi.2	+	1	111	c.77C>A	c.(76-78)CCC>CAC	p.P26H	KRTAP9-9_uc010wfq.1_Intron	NM_033191	NP_149461	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	26	15 X 5 AA repeats of C-C-[RQVGE]-[SPTN]- [TASPF].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TGCTGGAAGCCCACCACTGTG	0.622													29	73	---	---	---	---	PASS
KIF18B	146909	broad.mit.edu	37	17	43012623	43012623	+	Intron	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43012623C>A	uc010wji.1	-						KIF18B_uc002iht.2_Intron|KIF18B_uc010wjh.1_Intron	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				CAGGGGCAGCCGACCTCCTGG	0.642													5	22	---	---	---	---	PASS
MYL4	4635	broad.mit.edu	37	17	45299068	45299068	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45299068G>T	uc002ilg.2	+	5	462	c.334G>T	c.(334-336)GAC>TAC	p.D112Y	MYL4_uc002ilh.2_Missense_Mutation_p.D112Y	NM_001002841	NP_001002841	P12829	MYL4_HUMAN	atrial/embryonic alkali myosin light chain	112					cardiac muscle contraction|muscle filament sliding|muscle organ development|positive regulation of ATPase activity|regulation of the force of heart contraction	A band|cytosol|muscle myosin complex	actin filament binding|actin monomer binding|calcium ion binding|myosin II heavy chain binding|structural constituent of muscle			ovary(2)	2						CAAGATGCTGGACTTTGAGAC	0.537													73	102	---	---	---	---	PASS
SNF8	11267	broad.mit.edu	37	17	47010711	47010711	+	Intron	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47010711G>C	uc002ioj.2	-						SNF8_uc002iok.2_Intron	NM_007241	NP_009172	Q96H20	SNF8_HUMAN	EAP30 subunit of ELL complex						cellular membrane organization|endosome transport|protein transport|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytosol|late endosome membrane|transcription factor complex	transcription factor binding				0						GGTCATCTCTGAGGTAAGGAA	0.493													37	86	---	---	---	---	PASS
GIP	2695	broad.mit.edu	37	17	47044509	47044509	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47044509C>A	uc002iol.1	-	2	184	c.86G>T	c.(85-87)AGC>ATC	p.S29I		NM_004123	NP_004114	P09681	GIP_HUMAN	gastric inhibitory polypeptide preproprotein	29					energy reserve metabolic process|signal transduction	extracellular region|soluble fraction	hormone activity			skin(1)	1						CCACTCCTACCTGAAGTGACC	0.527													4	129	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54554865	54554865	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54554865A>G	uc002iun.1	+	15	1834	c.1799A>G	c.(1798-1800)CAC>CGC	p.H600R		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	600										large_intestine(1)|ovary(1)	2						CTATCCTATCACAAAAGGAGT	0.348													31	39	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56737950	56737950	+	Intron	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56737950C>G	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron|TEX14_uc010wnz.1_Missense_Mutation_p.Q337H	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGCCCATGTTCTGTCGGTTGC	0.557													71	125	---	---	---	---	PASS
INTS2	57508	broad.mit.edu	37	17	60004014	60004014	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60004014T>C	uc002izn.2	-	2	92	c.16A>G	c.(16-18)ACA>GCA	p.T6A	INTS2_uc002izm.2_5'UTR	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	6					snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						ATTATTACTGTTTGTTGATCC	0.363													6	16	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61957775	61957775	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61957775C>T	uc002jco.1	-	5	622	c.560G>A	c.(559-561)GGG>GAG	p.G187E	GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_3'UTR|GH2_uc002jcm.1_Missense_Mutation_p.G186S|GH2_uc002jcn.1_Missense_Mutation_p.G172E	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	187						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						GTAGAGCAGCCCGTAGTTCTT	0.562													44	69	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67186506	67186506	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67186506A>T	uc010dfa.1	-	19	3003	c.2124T>A	c.(2122-2124)GAT>GAA	p.D708E	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Missense_Mutation_p.D309E	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	708					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TACCTGGTTCATCAATTGCTG	0.323													30	48	---	---	---	---	PASS
KCNJ2	3759	broad.mit.edu	37	17	68171777	68171777	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68171777C>T	uc010dfg.2	+	2	998	c.597C>T	c.(595-597)GCC>GCT	p.A199A	KCNJ2_uc002jir.2_Silent_p.A199A	NM_000891	NP_000882	P63252	IRK2_HUMAN	potassium inwardly-rectifying channel J2	199	Cytoplasmic (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity|protein binding				0	Breast(10;1.64e-08)					GTCACAATGCCGTGATTGCCA	0.512													55	68	---	---	---	---	PASS
KIF19	124602	broad.mit.edu	37	17	72351440	72351440	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72351440C>G	uc002jkm.3	+	20	3124	c.2986C>G	c.(2986-2988)CGG>GGG	p.R996G		NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	996					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						TGGATGCTCCCGGCATAACTG	0.647													8	19	---	---	---	---	PASS
GRIN2C	2905	broad.mit.edu	37	17	72845955	72845955	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72845955G>T	uc002jlt.1	-	7	1765	c.1609C>A	c.(1609-1611)CGC>AGC	p.R537S	GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_Missense_Mutation_p.R537S	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C	537	Extracellular (Potential).				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)	CCATTGCTGCGAGCCACCATC	0.627													43	70	---	---	---	---	PASS
OTOP2	92736	broad.mit.edu	37	17	72923879	72923879	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72923879G>A	uc010wrp.1	+	6	718	c.629G>A	c.(628-630)CGT>CAT	p.R210H	OTOP2_uc002jmf.1_3'UTR	NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	210						integral to membrane				ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)					AGCCACGCCCGTCTCATCTCT	0.577													17	27	---	---	---	---	PASS
LLGL2	3993	broad.mit.edu	37	17	73560510	73560510	+	Missense_Mutation	SNP	G	A	A	rs34553577		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73560510G>A	uc002joh.2	+	10	1112	c.958G>A	c.(958-960)GAT>AAT	p.D320N	LLGL2_uc002jog.1_Missense_Mutation_p.D320N|LLGL2_uc010dgf.1_Missense_Mutation_p.D320N|LLGL2_uc002joi.2_Missense_Mutation_p.D320N|LLGL2_uc010dgg.1_Missense_Mutation_p.D320N|LLGL2_uc002joj.2_Missense_Mutation_p.D309N|LLGL2_uc010wsd.1_5'UTR|uc002jok.2_5'Flank	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	320	WD 6.				cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			AGTGATCCACGATGGCCAGCA	0.637													42	53	---	---	---	---	PASS
C17orf56	146705	broad.mit.edu	37	17	79205420	79205420	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79205420C>T	uc002jzu.1	-	9	795	c.773G>A	c.(772-774)CGC>CAC	p.R258H	C17orf56_uc002jzr.1_5'Flank|C17orf56_uc002jzs.1_Missense_Mutation_p.R174H|C17orf56_uc002jzt.1_Missense_Mutation_p.R174H|C17orf56_uc002jzv.1_Missense_Mutation_p.R106H|uc002jzw.1_RNA	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705	258						integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CAGGAAGGCGCGTGGTCCCCG	0.667													13	22	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5438068	5438068	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5438068G>C	uc002kmt.1	-	6	657	c.571C>G	c.(571-573)CCA>GCA	p.P191A	EPB41L3_uc010wzh.1_Missense_Mutation_p.P191A|EPB41L3_uc002kmu.1_Missense_Mutation_p.P191A|EPB41L3_uc010dkq.1_Missense_Mutation_p.P82A|EPB41L3_uc010dks.1_Missense_Mutation_p.P213A|EPB41L3_uc002kmv.1_Missense_Mutation_p.P82A	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	191	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GCAGGGTCTGGTGGATAAAAT	0.383													28	97	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	5969551	5969551	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5969551C>A	uc002kmz.3	-	18	1642	c.1482G>T	c.(1480-1482)GTG>GTT	p.V494V	L3MBTL4_uc010dkt.2_Silent_p.V494V|L3MBTL4_uc002kmy.3_Silent_p.V323V	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4	494					chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				GCGCCTGCTCCACCGAGTATT	0.627													40	41	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6873568	6873568	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6873568G>T	uc010wzi.1	+	7	822	c.584G>T	c.(583-585)GGA>GTA	p.G195V	ARHGAP28_uc002knc.2_Missense_Mutation_p.G320V|ARHGAP28_uc002knd.2_Missense_Mutation_p.G213V|ARHGAP28_uc002kne.2_Missense_Mutation_p.G213V|ARHGAP28_uc002knf.2_Missense_Mutation_p.G204V			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;	195					signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				AAAGTAAAAGGACGAGGTAAC	0.358													41	67	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13056424	13056424	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13056424C>T	uc010xac.1	+	19	3915	c.3835C>T	c.(3835-3837)CAG>TAG	p.Q1279*	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Nonsense_Mutation_p.Q804*|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_5'UTR|CEP192_uc002krs.1_Nonsense_Mutation_p.Q1020*	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1279										ovary(4)|pancreas(1)	5						CACCTTGCCTCAGTGCCATGC	0.562													24	62	---	---	---	---	PASS
MC2R	4158	broad.mit.edu	37	18	13885023	13885023	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13885023C>A	uc002ksp.1	-	2	672	c.495G>T	c.(493-495)ATG>ATT	p.M165I		NM_000529	NP_000520	Q01718	ACTHR_HUMAN	melanocortin 2 receptor	165	Helical; Name=4; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding			ovary(4)|skin(1)	5					Corticotropin(DB01285)|Cosyntropin(DB01284)	AGAAGATCACCATGGTGATGC	0.572													33	54	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806327	22806327	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806327A>G	uc002kvk.2	-	4	1802	c.1555T>C	c.(1555-1557)TAT>CAT	p.Y519H	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.Y519H|ZNF521_uc002kvl.2_Missense_Mutation_p.Y299H	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	519	C2H2-type 12.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AACCCCATATAGCAATGGGGA	0.473			T	PAX5	ALL								35	553	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806627	22806627	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806627C>A	uc002kvk.2	-	4	1502	c.1255G>T	c.(1255-1257)GCA>TCA	p.A419S	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.A419S|ZNF521_uc002kvl.2_Missense_Mutation_p.A199S	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	419	C2H2-type 9; degenerate.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGCAGAACTGCAAGACTTGAA	0.438			T	PAX5	ALL								38	577	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806745	22806745	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806745C>G	uc002kvk.2	-	4	1384	c.1137G>C	c.(1135-1137)AAG>AAC	p.K379N	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.K379N|ZNF521_uc002kvl.2_Missense_Mutation_p.K159N	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	379					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TCCCTCGACTCTTTGGGATTG	0.532			T	PAX5	ALL								38	549	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806872	22806872	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806872G>A	uc002kvk.2	-	4	1257	c.1010C>T	c.(1009-1011)TCA>TTA	p.S337L	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.S337L|ZNF521_uc002kvl.2_Missense_Mutation_p.S117L	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	337					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTGATTGCATGACTCCGGTTG	0.527			T	PAX5	ALL								34	344	---	---	---	---	PASS
AQP4	361	broad.mit.edu	37	18	24436197	24436197	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24436197C>G	uc002kwa.2	-	5	1013	c.950G>C	c.(949-951)GGA>GCA	p.G317A	AQP4_uc002kvz.2_Missense_Mutation_p.G295A	NM_001650	NP_001641	P55087	AQP4_HUMAN	aquaporin 4 isoform a	317	Cytoplasmic (Potential).				cellular response to interferon-gamma|excretion|nervous system development	cytoplasm|external side of plasma membrane|integral to plasma membrane	water channel activity				0	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					CAATACCTCTCCAGATTGGTC	0.468													77	848	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50705329	50705329	+	Intron	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50705329C>A	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TTTGATTTCTCAGGGAACGAG	0.438													34	18	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72343094	72343094	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72343094T>A	uc002llw.2	+	1	176	c.119T>A	c.(118-120)ATA>AAA	p.I40K	ZNF407_uc010xfc.1_Missense_Mutation_p.I40K|ZNF407_uc010dqu.1_Missense_Mutation_p.I40K|ZNF407_uc002llu.2_Missense_Mutation_p.I39K	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	40					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TCTGATGTGATAGCAAGTTTC	0.388													23	16	---	---	---	---	PASS
ZNF516	9658	broad.mit.edu	37	18	74154101	74154101	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74154101T>A	uc010dqx.1	-	2	1145	c.910A>T	c.(910-912)AGC>TGC	p.S304C	ZNF516_uc002lme.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	304					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGTTCTTGCTGCCCGTCTTG	0.637													27	23	---	---	---	---	PASS
GALR1	2587	broad.mit.edu	37	18	74962644	74962644	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74962644G>T	uc002lms.3	+	1	637	c.140G>T	c.(139-141)GGT>GTT	p.G47V		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	47	Helical; Name=1; (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		TTCGCGCTGGGTGTGCTGGGC	0.682													16	5	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76754897	76754897	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76754897G>C	uc002lmt.2	+	2	2906	c.2906G>C	c.(2905-2907)AGG>ACG	p.R969T	SALL3_uc010dra.2_Missense_Mutation_p.R576T	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	969					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		TTCCTGAGCAGGGAGCGGGGT	0.468													7	10	---	---	---	---	PASS
ATP9B	374868	broad.mit.edu	37	18	76953201	76953201	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76953201G>T	uc002lmx.2	+	9	906	c.892G>T	c.(892-894)GCT>TCT	p.A298S	ATP9B_uc002lmv.1_RNA|ATP9B_uc002lmw.1_Missense_Mutation_p.A298S|ATP9B_uc002lmy.1_RNA|ATP9B_uc002lmz.1_5'UTR	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	298	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TTCTATCAGTGCTTATGTTTA	0.313													48	31	---	---	---	---	PASS
SHC2	25759	broad.mit.edu	37	19	440869	440869	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:440869C>A	uc002loq.3	-	2	532	c.532G>T	c.(532-534)GTG>TTG	p.V178L	SHC2_uc002lop.3_5'Flank	NM_012435	NP_036567	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing)	178	PID.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol					0		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCTGGTCACCTGCGTGCGC	0.642													41	91	---	---	---	---	PASS
POLRMT	5442	broad.mit.edu	37	19	621340	621340	+	Silent	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:621340C>G	uc002lpf.1	-	10	2414	c.2358G>C	c.(2356-2358)GCG>GCC	p.A786A		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	786					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGGTGCTGCGCCAGCGAGA	0.721													18	16	---	---	---	---	PASS
POLRMT	5442	broad.mit.edu	37	19	621342	621342	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:621342C>T	uc002lpf.1	-	10	2412	c.2356G>A	c.(2356-2358)GCG>ACG	p.A786T		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	786					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTGCTGCGCCAGCGAGAGG	0.721													17	16	---	---	---	---	PASS
HMHA1	23526	broad.mit.edu	37	19	1073249	1073249	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1073249G>A	uc002lqz.1	+	3	754	c.523G>A	c.(523-525)GAG>AAG	p.E175K	HMHA1_uc010xgd.1_Missense_Mutation_p.E191K|HMHA1_uc010xge.1_Missense_Mutation_p.E15K|HMHA1_uc002lra.1_Missense_Mutation_p.E15K|HMHA1_uc002lrb.1_Missense_Mutation_p.E58K	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	175					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACACCGTGGAGACGCTCAC	0.592													37	79	---	---	---	---	PASS
FAM108A1	81926	broad.mit.edu	37	19	1877698	1877698	+	Intron	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1877698G>C	uc002lug.2	-						FAM108A1_uc002lud.2_Intron|FAM108A1_uc002lue.2_Intron|FAM108A1_uc002luf.2_Intron	NM_001130111	NP_001123583	Q96GS6	F18A1_HUMAN	hypothetical protein LOC81926 isoform 2							extracellular region	hydrolase activity				0		Ovarian(11;0.000137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCGGCGCCGGAGCAGGGTC	0.726													4	29	---	---	---	---	PASS
SGTA	6449	broad.mit.edu	37	19	2757453	2757453	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2757453C>A	uc002lwi.1	-	11	977	c.830G>T	c.(829-831)GGC>GTC	p.G277V		NM_003021	NP_003012	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide	277	Gln-rich.				interspecies interaction between organisms	cytoplasm	protein binding			ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAACTGCTGGCCCCTGCGGGG	0.672													21	19	---	---	---	---	PASS
AES	166	broad.mit.edu	37	19	3055691	3055691	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3055691C>A	uc002lwy.1	-	5	441	c.268G>T	c.(268-270)GCC>TCC	p.A90S	AES_uc002lwx.1_3'UTR|AES_uc002lwz.1_Missense_Mutation_p.A90S|AES_uc002lxa.1_Missense_Mutation_p.A34S|AES_uc002lxb.1_Missense_Mutation_p.A157S|AES_uc002lxc.2_Missense_Mutation_p.A157S	NM_001130	NP_001121	Q08117	AES_HUMAN	amino-terminal enhancer of split isoform b	90	Gln-rich (Q domain).				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of response to cytokine stimulus|negative regulation of transcription from RNA polymerase II promoter|organ morphogenesis|response to interleukin-1|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGACCTGGGCACAAATCCCG	0.642													12	140	---	---	---	---	PASS
SAFB	6294	broad.mit.edu	37	19	5664436	5664436	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5664436G>C	uc002mcf.2	+	17	2373	c.2320G>C	c.(2320-2322)GAA>CAA	p.E774Q	SAFB_uc002mcg.2_Missense_Mutation_p.E774Q|SAFB_uc002mce.3_Missense_Mutation_p.E773Q|SAFB_uc010xir.1_Missense_Mutation_p.E773Q|SAFB_uc010xis.1_Missense_Mutation_p.E705Q|SAFB_uc010xit.1_Missense_Mutation_p.E616Q|SAFB_uc010xiu.1_Missense_Mutation_p.E573Q	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B	774	Interaction with SAFB2.|Interaction with POLR2A.|Arg-rich.				chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		AATGATGGGAGAACGAGAAGG	0.473													24	50	---	---	---	---	PASS
DUS3L	56931	broad.mit.edu	37	19	5790284	5790284	+	Missense_Mutation	SNP	C	T	T	rs145101341	byFrequency	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5790284C>T	uc002mdc.2	-	2	258	c.161G>A	c.(160-162)TGC>TAC	p.C54Y	DUS3L_uc002mdd.2_Missense_Mutation_p.C54Y|DUS3L_uc010duk.2_5'UTR|DUS3L_uc010xiw.1_RNA	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1	54					tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						GGTTTCCCGGCAAGTCTTCTC	0.577													51	106	---	---	---	---	PASS
FUT5	2527	broad.mit.edu	37	19	5867626	5867626	+	Silent	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5867626G>T	uc002mdo.3	-	2	199	c.111C>A	c.(109-111)TCC>TCA	p.S37S	FUT5_uc010duo.2_Silent_p.S37S	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	37	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						CATCGTCTCGGGACACACGCA	0.652													25	65	---	---	---	---	PASS
ZNF558	148156	broad.mit.edu	37	19	8922260	8922260	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8922260C>T	uc002mkn.1	-	6	1136	c.906G>A	c.(904-906)AGG>AGA	p.R302R	ZNF558_uc010xkh.1_Silent_p.R231R|ZNF558_uc010dwg.1_Silent_p.R302R	NM_144693	NP_653294	Q96NG5	ZN558_HUMAN	zinc finger protein 558	302	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1						AGGAGCTCTTCCTGAAGGTTT	0.443													68	109	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9057646	9057646	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9057646T>C	uc002mkp.2	-	3	30004	c.29800A>G	c.(29800-29802)ATC>GTC	p.I9934V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9936	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCAGTGATGATGTCTGGAGAC	0.463													172	347	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10087287	10087287	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10087287C>A	uc002mmq.1	-	45	3375	c.3289G>T	c.(3289-3291)GGC>TGC	p.G1097C		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1097	Triple-helical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			CCAGGTGGGCCCTGGGAGAAC	0.547													13	24	---	---	---	---	PASS
RLN3	117579	broad.mit.edu	37	19	14141727	14141727	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14141727G>C	uc002mxw.1	+	2	396	c.396G>C	c.(394-396)GGG>GGC	p.G132G	IL27RA_uc002mxx.2_5'Flank|RLN3_uc010dzj.1_3'UTR	NM_080864	NP_543140	Q8WXF3	REL3_HUMAN	relaxin 3 preproprotein	132						extracellular region	hormone activity				0						GCAAGTGGGGGTGTAGCAAAA	0.597													41	141	---	---	---	---	PASS
CYP4F22	126410	broad.mit.edu	37	19	15648391	15648391	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15648391G>T	uc002nbh.3	+	6	634	c.467G>T	c.(466-468)CGT>CTT	p.R156L		NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,	156						endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						AGCCGGCACCGTCGCCTGCTG	0.542													53	83	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17086940	17086940	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17086940T>G	uc002nfb.2	-	16	1953	c.1921A>C	c.(1921-1923)AAT>CAT	p.N641H		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	594						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						TGGGTCTCATTTGCTGAATAC	0.438													21	58	---	---	---	---	PASS
MPV17L2	84769	broad.mit.edu	37	19	18304774	18304774	+	Silent	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18304774A>G	uc002nid.2	+	2	340	c.288A>G	c.(286-288)CCA>CCG	p.P96P	MPV17L2_uc010ebj.2_Silent_p.P32P	NM_032683	NP_116072	Q567V2	M17L2_HUMAN	MPV17 mitochondrial membrane protein-like 2	96						integral to membrane					0						GAGGCTTCCCAAATGTCCTCA	0.587													31	77	---	---	---	---	PASS
UPF1	5976	broad.mit.edu	37	19	18961004	18961004	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18961004C>T	uc002nkg.2	+	4	857	c.582C>T	c.(580-582)CTC>CTT	p.L194L	UPF1_uc002nkf.2_Silent_p.L194L	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	194	Sufficient for interaction with RENT2.|C4-type.				cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TCTTCCTCCTCGGCTTCATCC	0.607													60	128	---	---	---	---	PASS
ZNF85	7639	broad.mit.edu	37	19	21132690	21132690	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21132690A>C	uc002npg.3	+	4	1497	c.1370A>C	c.(1369-1371)GAA>GCA	p.E457A	ZNF85_uc010ecn.2_Missense_Mutation_p.E392A|ZNF85_uc010eco.2_Missense_Mutation_p.E405A|ZNF85_uc002npi.2_Missense_Mutation_p.E398A	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	457	C2H2-type 12.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						TATGAATGTGAAAAATGTGGC	0.333													9	33	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940721	22940721	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940721G>T	uc010xrh.1	-	5	1717	c.1717C>A	c.(1717-1719)CTT>ATT	p.L573I		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TGTCTAGTAAGGTGTGAGGAC	0.378													18	37	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23542322	23542322	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23542322C>G	uc002nre.2	-	4	3572	c.3459G>C	c.(3457-3459)AAG>AAC	p.K1153N	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.K1121N	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	1153	C2H2-type 36.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TATGAATTTTCTTATGGTTAG	0.189													20	59	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31769848	31769848	+	Missense_Mutation	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769848A>C	uc002nsy.3	-	2	916	c.851T>G	c.(850-852)TTT>TGT	p.F284C		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	284	C2H2-type 2.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					CAGGGACTCAAAGGAGTGGCC	0.522													66	118	---	---	---	---	PASS
KRTDAP	388533	broad.mit.edu	37	19	35981310	35981310	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35981310A>G	uc002nzh.2	-	1	47	c.35T>C	c.(34-36)CTC>CCC	p.L12P		NM_207392	NP_997275	P60985	KTDAP_HUMAN	keratinocyte differentiation-associated protein	12					cell differentiation	extracellular region					0	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CAGGAGGGAGAGGAGCACCAC	0.577													80	123	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36218436	36218436	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36218436G>C	uc010eei.2	+	17	4215	c.4215G>C	c.(4213-4215)CTG>CTC	p.L1405L		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1405					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGAGGCCCTGAGCGGGGCCC	0.687													29	113	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36223339	36223339	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36223339G>A	uc010eei.2	+	29	5889	c.5889G>A	c.(5887-5889)CCG>CCA	p.P1963P		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1963	Poly-Pro.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCCTGGCCCGGCCCCATCTC	0.657													4	48	---	---	---	---	PASS
APLP1	333	broad.mit.edu	37	19	36362656	36362656	+	Intron	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36362656G>C	uc002oce.2	+						APLP1_uc010xsz.1_Intron|APLP1_uc002ocf.2_Intron|APLP1_uc002ocg.2_Intron|APLP1_uc010xta.1_Intron	NM_005166	NP_005157	P51693	APLP1_HUMAN	amyloid precursor-like protein 1 isoform 2						apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding			ovary(2)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGTGAGTGGGAGGGAACCCT	0.632													22	23	---	---	---	---	PASS
ZFP30	22835	broad.mit.edu	37	19	38127064	38127064	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38127064C>A	uc002ogv.1	-	6	894	c.378G>T	c.(376-378)AGG>AGT	p.R126S	ZFP30_uc002ogw.1_Missense_Mutation_p.R126S|ZFP30_uc002ogx.1_Missense_Mutation_p.R126S|ZFP30_uc010xtt.1_Missense_Mutation_p.R125S	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog	126					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTGTCACTTGCCTGAAACACA	0.373													35	77	---	---	---	---	PASS
SPRED3	399473	broad.mit.edu	37	19	38882899	38882899	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38882899G>T	uc002oim.2	+	3	398	c.394G>T	c.(394-396)GAT>TAT	p.D132Y	SPRED3_uc002oil.1_Missense_Mutation_p.D132Y	NM_001042522	NP_001035987	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	132	Ser-rich.				multicellular organismal development					central_nervous_system(2)|lung(1)|skin(1)	4	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			tcctTCCCAGGATACTGCAGA	0.443													6	10	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39218672	39218672	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39218672G>A	uc002oja.1	+						ACTN4_uc002ojb.1_Intron	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4						platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGCAGGTACTGCACCCTGGGC	0.572													9	18	---	---	---	---	PASS
NCCRP1	342897	broad.mit.edu	37	19	39688711	39688711	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39688711C>A	uc002okq.1	+	2	375	c.356C>A	c.(355-357)CCA>CAA	p.P119Q		NM_001001414	NP_001001414	Q6ZVX7	NCRP1_HUMAN	non-specific cytotoxic cell receptor protein 1	119	FBA.				protein catabolic process					ovary(1)	1						ATTTATGAGCCAGCACCCCCT	0.627													4	162	---	---	---	---	PASS
ZNF780B	163131	broad.mit.edu	37	19	40541700	40541700	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40541700T>C	uc002omu.2	-	5	1131	c.1066A>G	c.(1066-1068)ATG>GTG	p.M356V	ZNF780B_uc002omv.2_Missense_Mutation_p.M208V	NM_001005851	NP_001005851	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	356					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TTCTCACCCATATGAATCTTC	0.423													52	63	---	---	---	---	PASS
ITPKC	80271	broad.mit.edu	37	19	41242989	41242989	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41242989C>G	uc002oot.2	+	5	1806	c.1773C>G	c.(1771-1773)ATC>ATG	p.I591M		NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C	591						cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ACCACGTCATCCTGGTGAGTG	0.333													5	10	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42860341	42860341	+	Nonsense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42860341C>G	uc002otl.3	+	24	4933	c.4298C>G	c.(4297-4299)TCA>TGA	p.S1433*	MEGF8_uc002otm.3_Nonsense_Mutation_p.S1041*	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1500	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				AGCCGCCTCTCAGCCGTGAGT	0.657													3	3	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42879930	42879930	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42879930G>T	uc002otl.3	+	41	7975	c.7340G>T	c.(7339-7341)CGT>CTT	p.R2447L	MEGF8_uc002otm.3_Missense_Mutation_p.R2055L|MEGF8_uc002otn.3_Missense_Mutation_p.R108L	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2514	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				TTCGTGGTCCGTGTGGCCCCT	0.652													16	29	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47422255	47422255	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47422255A>G	uc010ekv.2	+	1	323	c.323A>G	c.(322-324)CAT>CGT	p.H108R		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	108					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		TTTCAACCTCATCGAAGCACG	0.493													59	141	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51135922	51135922	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51135922C>T	uc002pst.2	-	2	929	c.295G>A	c.(295-297)GAC>AAC	p.D99N	SYT3_uc002psv.2_Missense_Mutation_p.D99N|SYT3_uc010ycd.1_Missense_Mutation_p.D99N	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	99	Cytoplasmic (Potential).					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GGGCCTAGGTCTTTGCGCAGG	0.697													21	31	---	---	---	---	PASS
ZNF610	162963	broad.mit.edu	37	19	52856995	52856995	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52856995G>T	uc002pyx.3	+	4	530	c.124G>T	c.(124-126)GAC>TAC	p.D42Y	ZNF610_uc002pyy.3_Missense_Mutation_p.D42Y|ZNF610_uc002pyz.3_Missense_Mutation_p.D42Y|ZNF610_uc002pza.2_Missense_Mutation_p.D42Y	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GAAATCCCTGGACCCTGGACA	0.493													40	86	---	---	---	---	PASS
ZNF534	147658	broad.mit.edu	37	19	52941112	52941112	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52941112G>T	uc002pzk.2	+	4	499	c.438G>T	c.(436-438)AAG>AAT	p.K146N	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.K133N	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	146					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATGGATGTAAGCATGTTGAGA	0.323													23	57	---	---	---	---	PASS
ZNF701	55762	broad.mit.edu	37	19	53086642	53086642	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53086642G>T	uc002pzs.1	+	4	1457	c.1330G>T	c.(1330-1332)GGC>TGC	p.G444C	ZNF701_uc010ydn.1_Missense_Mutation_p.G510C	NM_018260	NP_060730	Q9NV72	ZN701_HUMAN	zinc finger protein 701	444	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		TAATGAATGTGGCAAGGTTTT	0.353													17	24	---	---	---	---	PASS
ZNF765	91661	broad.mit.edu	37	19	53911449	53911449	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53911449C>G	uc010ydx.1	+	6	968	c.641C>G	c.(640-642)TCT>TGT	p.S214C	ZNF765_uc002qbm.2_Missense_Mutation_p.S214C|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	214					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)		AGGGAAAAATCTTTCCAATGC	0.338													17	30	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54392977	54392977	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54392977T>C	uc002qcq.1	+	4	653	c.371T>C	c.(370-372)CTT>CCT	p.L124P	PRKCG_uc010eqz.1_Missense_Mutation_p.L124P|PRKCG_uc010yef.1_Missense_Mutation_p.L124P|PRKCG_uc010yeg.1_Missense_Mutation_p.L124P|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	124	Phorbol-ester/DAG-type 2.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		CTCTACGGGCTTGTGCACCAG	0.632													16	19	---	---	---	---	PASS
TFPT	29844	broad.mit.edu	37	19	54613499	54613499	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54613499G>T	uc010yej.1	-	3	694	c.288C>A	c.(286-288)AAC>AAA	p.N96K	TFPT_uc010erd.2_Missense_Mutation_p.N96K	NM_013342	NP_037474	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner	96					apoptosis|DNA recombination|DNA repair|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex	DNA binding|protein binding				0	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					GGACCCGCTCGTTCACCTATG	0.577			T	TCF3	pre-B ALL								21	48	---	---	---	---	PASS
KIR3DX1	90011	broad.mit.edu	37	19	55044296	55044296	+	RNA	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55044296G>A	uc010yfa.1	+	2		c.175G>A			KIR3DX1_uc010yfb.1_RNA|KIR3DX1_uc010yfc.1_RNA|KIR3DX1_uc010yfd.1_RNA	NR_026716				Homo sapiens mRNA for FLJ00060 protein, partial cds.											ovary(1)	1				GBM - Glioblastoma multiforme(193;0.099)		GCCCACATGCGGGTGAGTCCT	0.473													51	77	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243388	56243388	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243388T>C	uc002qly.2	-	2	1837	c.1809A>G	c.(1807-1809)CCA>CCG	p.P603P		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	603						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CTGAGTCATCTGGAAAGATAT	0.428													20	22	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243389	56243389	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243389G>T	uc002qly.2	-	2	1836	c.1808C>A	c.(1807-1809)CCA>CAA	p.P603Q		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	603						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TGAGTCATCTGGAAAGATATT	0.423													20	22	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56487502	56487502	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56487502G>A	uc002qmh.2	+	8	2780	c.2709G>A	c.(2707-2709)CTG>CTA	p.L903L	NLRP8_uc010etg.2_Silent_p.L884L	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	903						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TTTGCAGACTGAGAAAGTGTG	0.274													27	49	---	---	---	---	PASS
ZNF264	9422	broad.mit.edu	37	19	57723037	57723037	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57723037G>T	uc002qob.2	+	4	985	c.572G>T	c.(571-573)GGT>GTT	p.G191V		NM_003417	NP_003408	O43296	ZN264_HUMAN	zinc finger protein 264	191					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TGTGAGTCAGGTAAAGATCCC	0.418													13	44	---	---	---	---	PASS
ZSCAN4	201516	broad.mit.edu	37	19	58189754	58189754	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58189754C>G	uc002qpu.2	+	5	1480	c.783C>G	c.(781-783)ATC>ATG	p.I261M		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	261					telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAAATGGAATCACTTTCCAAG	0.507													24	66	---	---	---	---	PASS
ZNF329	79673	broad.mit.edu	37	19	58639432	58639432	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58639432T>C	uc002qrn.2	-	4	1676	c.1439A>G	c.(1438-1440)GAG>GGG	p.E480G	ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	480					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		ATATGGGGTCTCCTTAGTGTG	0.522													51	84	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3670649	3670649	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3670649G>C	uc002wja.2	-	18	4854	c.4854C>G	c.(4852-4854)GTC>GTG	p.V1618V	SIGLEC1_uc002wjb.1_Silent_p.V257V|SIGLEC1_uc002wiz.3_Silent_p.V1618V	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1618	Ig-like C2-type 16.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CAGAGCCCAGGACATTTGAGG	0.607													6	18	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8737759	8737759	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8737759G>T	uc002wnb.2	+	24	2593	c.2590G>T	c.(2590-2592)GTG>TTG	p.V864L	PLCB1_uc010zrb.1_Missense_Mutation_p.V763L|PLCB1_uc002wna.2_Missense_Mutation_p.V864L|PLCB1_uc002wnc.1_Missense_Mutation_p.V763L|PLCB1_uc002wnd.1_Missense_Mutation_p.V441L	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	864					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						AGAAAATGGGGTGAATCACAC	0.498													27	68	---	---	---	---	PASS
DSTN	11034	broad.mit.edu	37	20	17581618	17581618	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17581618G>A	uc002wpr.2	+	2	494	c.239G>A	c.(238-240)TGT>TAT	p.C80Y	DSTN_uc002wpq.2_Missense_Mutation_p.C63Y|DSTN_uc010gck.2_Missense_Mutation_p.C63Y	NM_006870	NP_006861	P60981	DEST_HUMAN	destrin isoform a	80	ADF-H.				actin filament severing|actin polymerization or depolymerization		actin binding			large_intestine(1)|skin(1)	2						GAAAAAGATTGTCGCTATGCT	0.363													64	89	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20270957	20270957	+	Silent	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20270957T>C	uc002wru.2	+	24	3214	c.3138T>C	c.(3136-3138)CCT>CCC	p.P1046P	C20orf26_uc002wrw.2_RNA	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	1046										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		GCATTCTTCCTGGGTCTTACC	0.388													54	85	---	---	---	---	PASS
CST9L	128821	broad.mit.edu	37	20	23545589	23545589	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23545589T>A	uc002wtk.3	-	3	739	c.440A>T	c.(439-441)CAC>CTC	p.H147L		NM_080610	NP_542177	Q9H4G1	CST9L_HUMAN	cystatin 9-like precursor	147						extracellular region	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TTTCACTCAGTGGAATCCCTC	0.532													46	91	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25439071	25439071	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25439071C>A	uc002wux.1	-	22	3865	c.3791G>T	c.(3790-3792)CGC>CTC	p.R1264L	NINL_uc010gdn.1_Missense_Mutation_p.R915L|NINL_uc002wuw.1_Missense_Mutation_p.R55L	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	1264	Potential.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						GCTGAGCAGGCGATGCAGCTC	0.667													27	45	---	---	---	---	PASS
DEFB115	245929	broad.mit.edu	37	20	29847261	29847261	+	Splice_Site	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29847261A>T	uc002wvp.1	+	2	95	c.95_splice	c.e2-2	p.D32_splice		NM_001037730	NP_001032819	Q30KQ5	DB115_HUMAN	beta-defensin 115 precursor						defense response to bacterium	extracellular region				ovary(1)	1			Colorectal(19;0.00445)|COAD - Colon adenocarcinoma(19;0.0347)			TTATTTTGATAGATGGATGGA	0.299													27	38	---	---	---	---	PASS
C20orf112	140688	broad.mit.edu	37	20	31044086	31044086	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31044086G>A	uc002wxu.3	-	3	379	c.222C>T	c.(220-222)GCC>GCT	p.A74A	C20orf112_uc010gec.2_5'UTR	NM_080616	NP_542183	Q96MY1	CT112_HUMAN	hypothetical protein LOC140688	74											0						TGGGGGCCACGGCGCCGTTGC	0.667													34	47	---	---	---	---	PASS
DNMT3B	1789	broad.mit.edu	37	20	31375187	31375187	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31375187G>T	uc002wyc.2	+	6	905	c.584G>T	c.(583-585)AGC>ATC	p.S195I	DNMT3B_uc010ztx.1_RNA|DNMT3B_uc010zty.1_RNA|DNMT3B_uc002wyd.2_Missense_Mutation_p.S195I|DNMT3B_uc002wye.2_Missense_Mutation_p.S195I|DNMT3B_uc010gee.2_RNA|DNMT3B_uc010gef.2_RNA|DNMT3B_uc010ztz.1_Missense_Mutation_p.S153I|DNMT3B_uc010zua.1_Missense_Mutation_p.S119I|DNMT3B_uc002wyf.2_Missense_Mutation_p.S207I	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform	195	Interaction with DNMT1 and DNMT3A.				negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						GCCCAGGACAGCCAGCAGGGG	0.632													46	56	---	---	---	---	PASS
SNTA1	6640	broad.mit.edu	37	20	31998117	31998117	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31998117G>C	uc002wzd.1	-	6	1333	c.1061C>G	c.(1060-1062)TCC>TGC	p.S354C	SNTA1_uc010zuf.1_Missense_Mutation_p.S279C	NM_003098	NP_003089	Q13424	SNTA1_HUMAN	acidic alpha 1 syntrophin	354	PH 2.				muscle contraction	cell junction|cytoplasm|cytoskeleton|sarcolemma	actin binding|calmodulin binding			skin(1)	1						TGAGCCCTTGGAGGGGCCTGA	0.642													7	5	---	---	---	---	PASS
ITCH	83737	broad.mit.edu	37	20	33030120	33030120	+	Intron	SNP	A	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33030120A>C	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						TAAGTATCTAAATTTAAAAAG	0.368													38	50	---	---	---	---	PASS
DLGAP4	22839	broad.mit.edu	37	20	35060493	35060493	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35060493C>T	uc002xff.2	+	3	808	c.373C>T	c.(373-375)CCC>TCC	p.P125S	DLGAP4_uc010zvp.1_Missense_Mutation_p.P125S	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	125					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CCTCCAATTTCCCCGTGGCGA	0.632													48	90	---	---	---	---	PASS
FAM83D	81610	broad.mit.edu	37	20	37580850	37580850	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37580850C>G	uc002xjg.2	+	4	1576	c.1535C>G	c.(1534-1536)TCT>TGT	p.S512C		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	482	Ser-rich.				cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)				TCCTCTGTGTCTTCCCAAGGC	0.507													58	54	---	---	---	---	PASS
MYBL2	4605	broad.mit.edu	37	20	42331428	42331428	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42331428G>A	uc002xlb.1	+	8	1465	c.1250G>A	c.(1249-1251)CGT>CAT	p.R417H	MYBL2_uc010zwj.1_Missense_Mutation_p.R393H|MYBL2_uc002xla.1_Missense_Mutation_p.R417H	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	417	Nuclear localization signal.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	p.R417C(1)		lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGGAAGAGGCGTGTGGCTCTG	0.617													19	72	---	---	---	---	PASS
TOX2	84969	broad.mit.edu	37	20	42683132	42683132	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42683132C>T	uc002xlf.3	+	5	889	c.872C>T	c.(871-873)TCC>TTC	p.S291F	TOX2_uc010ggo.2_Missense_Mutation_p.S282F|TOX2_uc002xle.3_Missense_Mutation_p.S240F|TOX2_uc010ggp.2_Missense_Mutation_p.S240F|TOX2_uc002xlg.2_Missense_Mutation_p.S240F|TOX2_uc010zwk.1_Missense_Mutation_p.S160F	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	291	HMG box.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			ATCGTGGCCTCCATGTGGGAC	0.582													6	23	---	---	---	---	PASS
SEMG1	6406	broad.mit.edu	37	20	43836129	43836129	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43836129C>T	uc002xni.2	+	2	248	c.191C>T	c.(190-192)TCT>TTT	p.S64F	SEMG1_uc002xnj.2_Missense_Mutation_p.S64F|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.S64F	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	64					insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				GGCAGTTTTTCTATTCAATAC	0.393													56	83	---	---	---	---	PASS
ATP9A	10079	broad.mit.edu	37	20	50287801	50287801	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50287801G>A	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						CGCAAACTAGGCACAAAACCA	0.502													22	37	---	---	---	---	PASS
SOX18	54345	broad.mit.edu	37	20	62680534	62680534	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62680534G>A	uc002yhs.2	-	1	446	c.336C>T	c.(334-336)AAC>AAT	p.N112N		NM_018419	NP_060889	P35713	SOX18_HUMAN	SRY-box 18	112	HMG box.				angiogenesis|blood vessel endothelial cell migration|endocardial cell differentiation|endocardium formation|establishment of endothelial barrier|heart looping|lymphangiogenesis|lymphatic endothelial cell differentiation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|positive regulation of transcription from RNA polymerase II promoter|vasculogenesis	nucleus	transcription regulatory region DNA binding				0	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					TGAGCACCGCGTTGTGCAGGT	0.393													31	49	---	---	---	---	PASS
JAM2	58494	broad.mit.edu	37	21	27078377	27078377	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27078377C>A	uc002ylp.1	+	7	1329	c.784C>A	c.(784-786)CAG>AAG	p.Q262K	JAM2_uc011ace.1_Missense_Mutation_p.Q262K|JAM2_uc002ylq.1_RNA|JAM2_uc011acf.1_Missense_Mutation_p.Q226K|JAM2_uc010glh.1_RNA|JAM2_uc002ylr.1_Missense_Mutation_p.Q262K|JAM2_uc010gli.1_Missense_Mutation_p.Q262K	NM_021219	NP_067042	P57087	JAM2_HUMAN	junctional adhesion molecule 2 precursor	262	Cytoplasmic (Potential).				blood coagulation|cell-cell adhesion|leukocyte migration	integral to plasma membrane|tight junction					0						ATGCTATGCTCAGAGGAAAGG	0.403													37	80	---	---	---	---	PASS
HLCS	3141	broad.mit.edu	37	21	38137351	38137351	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38137351C>A	uc010gnb.2	-	8	2843	c.1642G>T	c.(1642-1644)GCT>TCT	p.A548S	HLCS_uc002yvs.2_Missense_Mutation_p.A548S	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase	548					cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	TCCACGACAGCCACGGACATC	0.527													63	79	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47851652	47851652	+	Silent	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47851652A>T	uc002zji.3	+	38	8381	c.8274A>T	c.(8272-8274)TCA>TCT	p.S2758S	PCNT_uc002zjj.2_Silent_p.S2640S	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2758	Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					TGGAGCTGTCAGAGGCCTTGC	0.657													15	14	---	---	---	---	PASS
S100B	6285	broad.mit.edu	37	21	48019325	48019325	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48019325A>G	uc002zju.1	-	3	341	c.230T>C	c.(229-231)TTT>TCT	p.F77S	S100B_uc002zjv.1_3'UTR	NM_006272	NP_006263	P04271	S100B_HUMAN	S100 calcium-binding protein, beta	77	EF-hand 2.				axonogenesis|cell proliferation|central nervous system development|innate immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade	extracellular region|nucleus|perinuclear region of cytoplasm|ruffle	calcium ion binding|calcium-dependent protein binding|protein homodimerization activity|RAGE receptor binding|S100 beta binding|tau protein binding|zinc ion binding				0	Breast(49;0.247)	Lung NSC(3;0.245)		OV - Ovarian serous cystadenocarcinoma(3;1.84e-06)|Epithelial(3;4.45e-06)|all cancers(3;2.07e-05)|Colorectal(79;0.241)		CATGGCAACAAAGGCCATGAA	0.458													61	109	---	---	---	---	PASS
IL17RA	23765	broad.mit.edu	37	22	17589968	17589968	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17589968G>A	uc002zly.2	+	13	1992	c.1859G>A	c.(1858-1860)CGG>CAG	p.R620Q	IL17RA_uc010gqt.2_Missense_Mutation_p.R568Q	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor	620	Cytoplasmic (Potential).				fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		ATCGTGAAGCGGGCGCCCCTG	0.652													4	11	---	---	---	---	PASS
PRAME	23532	broad.mit.edu	37	22	22893284	22893284	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22893284C>T	uc002zwf.2	-	3	405	c.249G>A	c.(247-249)CTG>CTA	p.L83L	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Silent_p.L67L|PRAME_uc010gtr.2_Silent_p.L83L|PRAME_uc002zwg.2_Silent_p.L83L|PRAME_uc002zwh.2_Silent_p.L83L|PRAME_uc002zwi.2_Silent_p.L83L|PRAME_uc002zwj.2_Silent_p.L83L|PRAME_uc002zwk.2_Silent_p.L83L	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	83					apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		TCAGCACTCCCAGAGGGAGGC	0.587													30	105	---	---	---	---	PASS
GGT5	2687	broad.mit.edu	37	22	24629879	24629879	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24629879G>A	uc002zzo.3	-	2	684	c.267C>T	c.(265-267)GGC>GGT	p.G89G	GGT5_uc002zzp.3_Silent_p.G89G|GGT5_uc002zzr.3_Silent_p.G89G|GGT5_uc002zzq.3_Silent_p.G89G|GGT5_uc011ajm.1_Intron|GGT5_uc011ajn.1_Intron	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b	89	Extracellular (Potential).				glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						TGACCCCTCCGCCCAGGCCCA	0.612													24	38	---	---	---	---	PASS
GATSL3	652968	broad.mit.edu	37	22	30682090	30682090	+	Intron	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30682090G>A	uc003ahd.2	-						GATSL3_uc003ahc.2_Intron|GATSL3_uc003ahe.2_Intron|GATSL3_uc003ahf.2_Intron|GATSL3_uc003ahg.2_Intron|GATSL3_uc003ahh.2_Intron|GATSL3_uc010gvq.2_RNA|GATSL3_uc003ahi.2_Intron	NM_001037666	NP_001032755	Q8WTX7	GATL3_HUMAN	GATS protein-like 3											breast(1)	1						TGGGGAACCTGGGGAGGGAGA	0.657													14	21	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30975748	30975748	+	Silent	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30975748T>A	uc003aij.1	-	12	1418	c.1344A>T	c.(1342-1344)GGA>GGT	p.G448G	PES1_uc003aik.1_Silent_p.G443G|PES1_uc003ail.1_Silent_p.G431G|PES1_uc003aim.1_Silent_p.G448G|PES1_uc003ain.1_Silent_p.G309G|PES1_uc003aio.1_Silent_p.G309G	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	448					cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						CTGGGTCCTCTCCCCGCTGCA	0.622													31	67	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37480798	37480798	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37480798G>A	uc003aqs.1	-	9	1196	c.1082C>T	c.(1081-1083)TCG>TTG	p.S361L	TMPRSS6_uc003aqt.1_Missense_Mutation_p.S352L|TMPRSS6_uc003aqu.2_Missense_Mutation_p.S352L	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	361	CUB 2.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GGTTTGGGGCGAGTAGTAGCT	0.652													4	9	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38130422	38130422	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38130422C>A	uc003atr.2	+	9	4350	c.4079C>A	c.(4078-4080)GCC>GAC	p.A1360D	TRIOBP_uc003atu.2_Missense_Mutation_p.A1188D	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	1360					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					ATGCTCCCTGCCAAACAGGCA	0.637													26	37	---	---	---	---	PASS
MICALL1	85377	broad.mit.edu	37	22	38320668	38320668	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38320668G>A	uc003aui.2	+	7	1110	c.1026G>A	c.(1024-1026)GGG>GGA	p.G342G		NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13	342	Pro-rich.					cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					CCCATCTAGGGAGACTGCACG	0.662													55	76	---	---	---	---	PASS
ACO2	50	broad.mit.edu	37	22	41911921	41911921	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41911921G>T	uc003bac.2	+	6	857	c.835G>T	c.(835-837)GGC>TGC	p.G279C	ACO2_uc003bad.2_Missense_Mutation_p.G279C	NM_001098	NP_001089	Q99798	ACON_HUMAN	aconitase 2, mitochondrial precursor	279					citrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron ion binding|isocitrate hydro-lyase (cis-aconitate-forming) activity			breast(2)|ovary(1)|lung(1)	4						CTCCTGCACTGGTGAGGAAGG	0.587													13	20	---	---	---	---	PASS
TRMU	55687	broad.mit.edu	37	22	46749686	46749686	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46749686C>A	uc003bhp.2	+	8	1159	c.795C>A	c.(793-795)GGC>GGA	p.G265G	TRMU_uc011arb.1_Silent_p.G265G|TRMU_uc003bhq.2_Silent_p.G47G|TRMU_uc003bhs.2_Silent_p.G265G|TRMU_uc003bhr.2_Silent_p.G151G|TRMU_uc003bht.2_Silent_p.G118G|TRMU_uc003bhu.2_Silent_p.G47G|TRMU_uc003bhv.2_Silent_p.G118G	NM_018006	NP_060476	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate	265						mitochondrion	ATP binding|sulfurtransferase activity|tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity|tRNA binding			ovary(1)	1		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		ATACCTTGGGCCAGAGAGCAA	0.547													53	99	---	---	---	---	PASS
GRAMD4	23151	broad.mit.edu	37	22	47069575	47069575	+	Silent	SNP	G	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47069575G>C	uc003bhx.2	+	14	1287	c.1248G>C	c.(1246-1248)ACG>ACC	p.T416T	GRAMD4_uc010had.2_Silent_p.T355T|GRAMD4_uc003bhy.2_5'Flank	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN	death-inducing-protein	416					apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		AGCTGCAGACGACCTCGTCAC	0.647													52	94	---	---	---	---	PASS
SHANK3	85358	broad.mit.edu	37	22	51117847	51117847	+	Silent	SNP	C	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51117847C>G	uc003bne.1	+	7	876	c.876C>G	c.(874-876)CTC>CTG	p.L292L		NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3	292										central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TCTGTGCCCTCTACAACCAGG	0.597													15	34	---	---	---	---	PASS
DHRSX	207063	broad.mit.edu	37	X	2184966	2184966	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2184966C>A	uc004cqf.3	-	5	460	c.411G>T	c.(409-411)CAG>CAT	p.Q137H		NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	137							binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TGGTTTTCCTCTGAGGGACCA	0.493													129	92	---	---	---	---	PASS
ARSD	414	broad.mit.edu	37	X	2828760	2828760	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2828760C>T	uc004cqy.2	-	7	1151	c.1075G>A	c.(1075-1077)GGA>AGA	p.G359R	ARSD_uc004cqz.1_Intron	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor	359						lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTAAATGTCCTCCATGGTCA	0.433													108	36	---	---	---	---	PASS
STS	412	broad.mit.edu	37	X	7268228	7268228	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7268228C>T	uc004cry.3	+	10	1923	c.1678C>T	c.(1678-1680)CAG>TAG	p.Q560*		NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	560	Lumenal.		Q -> P (in IXL).		female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	GCCCTGGCTTCAGCTGTGCTG	0.557									Ichthyosis				30	5	---	---	---	---	PASS
CXorf23	256643	broad.mit.edu	37	X	19983480	19983480	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19983480T>C	uc004czp.2	-	3	956	c.956A>G	c.(955-957)AAT>AGT	p.N319S	CXorf23_uc010nfn.2_RNA|CXorf23_uc011mjg.1_5'UTR|CXorf23_uc004czo.2_Missense_Mutation_p.N269S	NM_198279	NP_938020	A2AJT9	CX023_HUMAN	hypothetical protein LOC256643	319						mitochondrion				lung(1)|skin(1)	2						TAACTCTCTATTTAGAGGGCC	0.398													78	12	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24859851	24859851	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24859851C>T	uc004dbl.2	+	33	3824	c.3801C>T	c.(3799-3801)CTC>CTT	p.L1267L		NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	1267	Potential.				cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	CAGCACAGCTCACTGATGAAG	0.383													40	14	---	---	---	---	PASS
TAB3	257397	broad.mit.edu	37	X	30849553	30849553	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30849553C>T	uc004dcj.2	-	11	2793	c.2130G>A	c.(2128-2130)CGG>CGA	p.R710R	TAB3_uc004dck.2_Silent_p.R710R|TAB3_uc010ngl.2_Silent_p.R682R	NM_152787	NP_690000	Q8N5C8	TAB3_HUMAN	mitogen-activated protein kinase kinase kinase 7	710	RanBP2-type.				activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein binding|zinc ion binding			ovary(1)	1						TTCAGGTGTACCGTGGCATCT	0.493													22	5	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32509416	32509416	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32509416T>C	uc004dda.1	-	20	2844	c.2600A>G	c.(2599-2601)AAA>AGA	p.K867R	DMD_uc004dcz.2_Missense_Mutation_p.K744R|DMD_uc004dcy.1_Missense_Mutation_p.K863R|DMD_uc004ddb.1_Missense_Mutation_p.K859R|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	867	Spectrin 5.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TAACTGACTTTTAATTGCTGT	0.373													67	13	---	---	---	---	PASS
MAGEB16	139604	broad.mit.edu	37	X	35820581	35820581	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35820581C>A	uc010ngt.1	+	2	547	c.268C>A	c.(268-270)CAA>AAA	p.Q90K		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	90										lung(3)|ovary(2)|breast(1)|skin(1)	7						TTCCAGCAATCAAGAAGAGGA	0.488													11	2	---	---	---	---	PASS
GATA1	2623	broad.mit.edu	37	X	48652347	48652347	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48652347G>A	uc004dkq.3	+	6	1109	c.1018G>A	c.(1018-1020)GGC>AGC	p.G340S		NM_002049	NP_002040	P15976	GATA1_HUMAN	GATA binding protein 1	340					basophil differentiation|eosinophil differentiation|erythrocyte development|megakaryocyte differentiation|platelet aggregation|platelet formation|positive regulation of anti-apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|regulation of glycoprotein biosynthetic process|transcription from RNA polymerase II promoter	nuclear membrane|nucleolus|nucleoplasm	C2H2 zinc finger domain binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(246)|lung(2)	248						GGTGGCTGGGGGCAGCGGTAG	0.632			Mis|F		megakaryoblastic leukemia of Downs Syndrome								5	2	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50165518	50165518	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50165518G>T	uc010njr.1	-	3	823	c.763C>A	c.(763-765)CAC>AAC	p.H255N		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	255	PH.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					GTTTCAAAGTGTGCAAACTGG	0.358													37	17	---	---	---	---	PASS
PHF8	23133	broad.mit.edu	37	X	54012307	54012307	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54012307T>C	uc004dsu.2	-	17	2252	c.2179A>G	c.(2179-2181)ATT>GTT	p.I727V	PHF8_uc004dst.2_Missense_Mutation_p.I691V|PHF8_uc004dsv.2_Missense_Mutation_p.I557V|PHF8_uc004dsw.2_Missense_Mutation_p.I590V|PHF8_uc004dsx.2_Missense_Mutation_p.I455V|PHF8_uc004dsy.2_Intron	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	727					brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						AGATCAAGAATGCCACCAGCG	0.537													48	21	---	---	---	---	PASS
PFKFB1	5207	broad.mit.edu	37	X	54986326	54986326	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54986326C>T	uc004dty.1	-	4	389	c.318G>A	c.(316-318)AAG>AAA	p.K106K	PFKFB1_uc010nkd.1_Silent_p.K92K|PFKFB1_uc011mol.1_Silent_p.K41K	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,	106	6-phosphofructo-2-kinase.				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						GGGCGCACTGCCTGAAATAGA	0.443													25	5	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65393453	65393453	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65393453C>T	uc011moz.1	+	4	504	c.444C>T	c.(442-444)TCC>TCT	p.S148S	HEPH_uc004dwn.2_Silent_p.S148S|HEPH_uc004dwo.2_5'UTR|HEPH_uc010nkr.2_Silent_p.S148S|HEPH_uc011mpa.1_Silent_p.S148S	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	145	Extracellular (Potential).|Plastocyanin-like 1.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						CAGATGGCTCCTCTGGGCCAC	0.517													22	5	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65409665	65409665	+	Silent	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65409665T>A	uc011moz.1	+	6	1017	c.957T>A	c.(955-957)CGT>CGA	p.R319R	HEPH_uc004dwn.2_Silent_p.R319R|HEPH_uc004dwo.2_Silent_p.R49R|HEPH_uc010nkr.2_Silent_p.R319R|HEPH_uc011mpa.1_Silent_p.R319R	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	316	Extracellular (Potential).|Plastocyanin-like 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						TGACTACCCGTGGACACCACA	0.502													14	4	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65476032	65476032	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65476032G>A	uc011moz.1	+	17	2825	c.2765G>A	c.(2764-2766)CGG>CAG	p.R922Q	HEPH_uc004dwn.2_Missense_Mutation_p.R922Q|HEPH_uc004dwo.2_Missense_Mutation_p.R652Q|HEPH_uc010nkr.2_Missense_Mutation_p.R730Q|HEPH_uc011mpa.1_Missense_Mutation_p.R922Q|HEPH_uc010nks.2_Missense_Mutation_p.R211Q	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	919	Extracellular (Potential).|Plastocyanin-like 6.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						GACATGGATCGGGAATTTGCA	0.498													47	13	---	---	---	---	PASS
IL2RG	3561	broad.mit.edu	37	X	70330030	70330030	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70330030C>A	uc004dyw.1	-	4	584	c.570G>T	c.(568-570)CGG>CGT	p.R190R	IL2RG_uc004dyv.1_5'Flank|IL2RG_uc004dyx.1_Intron	NM_000206	NP_000197	P31785	IL2RG_HUMAN	interleukin 2 receptor, gamma precursor	190	Extracellular (Potential).|Fibronectin type-III.				immune response|interleukin-4-mediated signaling pathway|interspecies interaction between organisms	external side of plasma membrane|integral to plasma membrane	cytokine receptor activity|interleukin-2 binding			pancreas(1)	1	Renal(35;0.156)				Aldesleukin(DB00041)|Denileukin diftitox(DB00004)	CCCAGTCAGTCCGGTACTGCA	0.478									Severe_Combined_Immunodeficiency_X-linked				65	15	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177433	89177433	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177433A>T	uc004efe.2	+	2	398	c.349A>T	c.(349-351)AGA>TGA	p.R117*		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	117						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						TCAACAGCGTAGAAACGACCC	0.532													47	11	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133246	91133246	+	Silent	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133246C>T	uc004efk.1	+	2	2852	c.2007C>T	c.(2005-2007)AAC>AAT	p.N669N	PCDH11X_uc004efl.1_Silent_p.N669N|PCDH11X_uc004efo.1_Silent_p.N669N|PCDH11X_uc010nmv.1_Silent_p.N669N|PCDH11X_uc004efm.1_Silent_p.N669N|PCDH11X_uc004efn.1_Silent_p.N669N|PCDH11X_uc004efh.1_Silent_p.N669N|PCDH11X_uc004efj.1_Silent_p.N669N	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	669	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TCAATGACAACAAACCAGTTT	0.408													71	19	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100497460	100497460	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100497460G>A	uc004egz.2	+	8	1344	c.975G>A	c.(973-975)CAG>CAA	p.Q325Q	DRP2_uc011mrh.1_Silent_p.Q247Q	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	325	Spectrin 2.				central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						AACAACTACAGGTAGAAGAGC	0.498													67	25	---	---	---	---	PASS
ARMCX2	9823	broad.mit.edu	37	X	100911581	100911581	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100911581G>T	uc004eid.2	-	3	1349	c.994C>A	c.(994-996)CTG>ATG	p.L332M	ARMCX2_uc004eie.3_Missense_Mutation_p.L332M|ARMCX2_uc004eif.3_Missense_Mutation_p.L332M|ARMCX2_uc004eig.3_Missense_Mutation_p.L332M|ARMCX2_uc010nnt.2_Missense_Mutation_p.L332M	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	332						integral to membrane	binding			ovary(6)	6						ACCTCTGCCAGGAAAGCCTGT	0.592													53	12	---	---	---	---	PASS
RNF128	79589	broad.mit.edu	37	X	106031167	106031167	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106031167A>G	uc004eml.2	+	4	1074	c.824A>G	c.(823-825)GAT>GGT	p.D275G	RNF128_uc004emk.2_Missense_Mutation_p.D249G	NM_194463	NP_919445	Q8TEB7	RN128_HUMAN	ring finger protein 128 isoform 1	275						endomembrane system|integral to membrane|perinuclear region of cytoplasm	zinc ion binding			ovary(1)|central_nervous_system(1)	2						CCTGATGGAGATAGTTGTGCT	0.323													36	12	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111078268	111078268	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111078268T>A	uc004epl.1	-	7	2696	c.1777A>T	c.(1777-1779)AGA>TGA	p.R593*	TRPC5_uc004epm.1_Nonsense_Mutation_p.R593*	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	593	Extracellular (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						AATTCGTGTCTGGCTTTCACA	0.418													244	51	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111078269	111078269	+	Silent	SNP	G	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111078269G>A	uc004epl.1	-	7	2695	c.1776C>T	c.(1774-1776)GCC>GCT	p.A592A	TRPC5_uc004epm.1_Silent_p.A592A	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	592	Extracellular (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						ATTCGTGTCTGGCTTTCACAT	0.418													241	50	---	---	---	---	PASS
ZCCHC16	340595	broad.mit.edu	37	X	111697946	111697946	+	5'UTR	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111697946C>A	uc004epo.1	+	3						NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16								nucleic acid binding|zinc ion binding			ovary(1)	1						CACCTGATTCCAGGAGACATA	0.458													68	21	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123205135	123205135	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123205135A>G	uc004etz.3	+	24	2834	c.2495A>G	c.(2494-2496)CAT>CGT	p.H832R	STAG2_uc004eua.2_Missense_Mutation_p.H832R|STAG2_uc004eub.2_Missense_Mutation_p.H832R|STAG2_uc004euc.2_Missense_Mutation_p.H832R|STAG2_uc004eud.2_Missense_Mutation_p.H832R|STAG2_uc004eue.2_Missense_Mutation_p.H832R	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	832					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						ATTTTGGATCATGTCTTCATT	0.363													92	26	---	---	---	---	PASS
XPNPEP2	7512	broad.mit.edu	37	X	128879190	128879190	+	Silent	SNP	C	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128879190C>A	uc004eut.1	+	4	490	c.246C>A	c.(244-246)ATC>ATA	p.I82I	XPNPEP2_uc011mum.1_Silent_p.I82I	NM_003399	NP_003390	O43895	XPP2_HUMAN	X-prolyl aminopeptidase 2, membrane-bound	82					cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0						ACGAGTACATCGGCCAACATG	0.488													35	12	---	---	---	---	PASS
FRMD7	90167	broad.mit.edu	37	X	131218580	131218580	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131218580T>C	uc004ewn.2	-	8	857	c.679A>G	c.(679-681)AAA>GAA	p.K227E	FRMD7_uc011muy.1_Missense_Mutation_p.K212E	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	227	FERM.				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TTGCGGATTTTAGCCCAGTTA	0.333													70	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	146271220	146271220	+	IGR	SNP	C	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146271220C>T								CXorf51 (379296 upstream) : MIR513C (2 downstream)																							atatgcagtgcatgctgtaca	0.229													52	13	---	---	---	---	PASS
FMR1NB	158521	broad.mit.edu	37	X	147063148	147063148	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147063148A>G	uc004fcm.2	+	1	300	c.226A>G	c.(226-228)ATT>GTT	p.I76V		NM_152578	NP_689791	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	76	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CATGCTCTCCATTTGGATCCT	0.532													98	24	---	---	---	---	PASS
RPS4Y1	6192	broad.mit.edu	37	Y	2709655	2709655	+	5'UTR	SNP	A	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2709655A>T	uc004fqi.2	+	1						NM_001008	NP_000999	P22090	RS4Y1_HUMAN	ribosomal protein S4, Y-linked 1 Y isoform						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0						CTTCCGTCGCAGAGTTTCGCC	0.448													17	9	---	---	---	---	PASS
NEGR1	257194	broad.mit.edu	37	1	71873131	71873132	+	Frame_Shift_Ins	INS	-	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71873131_71873132insT	uc001dfw.2	-	7	1162_1163	c.1062_1063insA	c.(1060-1065)CAATAAfs	p.Q354fs	NEGR1_uc001dfv.2_Frame_Shift_Ins_p.Q226fs|NEGR1_uc010oqs.1_Frame_Shift_Ins_p.Q310fs	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor	354_355					cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CTTTGAATTTATTGTAGAATGG	0.421													13	25	---	---	---	---	
CHD1L	9557	broad.mit.edu	37	1	146731281	146731281	+	Intron	DEL	A	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146731281delA	uc001epm.3	+						uc001epp.2_RNA|CHD1L_uc001epn.3_Intron|CHD1L_uc010ozo.1_Intron|CHD1L_uc009wjg.2_Intron|CHD1L_uc009wjh.2_Intron|CHD1L_uc010ozp.1_Intron|CHD1L_uc001epo.3_Intron	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein						chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					CCATTTTGTTAAAAAAAAAAA	0.299													4	2	---	---	---	---	
OR6K3	391114	broad.mit.edu	37	1	158688032	158688033	+	5'Flank	INS	-	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158688032_158688033insT	uc010pip.1	-							NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					TGAAGGTTTCATTTTTTTTCCT	0.312													8	5	---	---	---	---	
CAPN9	10753	broad.mit.edu	37	1	230915002	230915003	+	Intron	DEL	TG	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230915002_230915003delTG	uc001htz.1	+						CAPN9_uc009xfg.1_Intron|CAPN9_uc001hua.1_Intron	NM_006615	NP_006606	O14815	CAN9_HUMAN	calpain 9 isoform 1						digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CAAAAGTGACTGGGGAAAAAAG	0.366													10	21	---	---	---	---	
CAPN13	92291	broad.mit.edu	37	2	30961206	30961206	+	Intron	DEL	T	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30961206delT	uc002rnn.2	-						CAPN13_uc002rnm.2_Intron	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CAGTGGGGTGTGGGGTGGGGT	0.592													26	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	52799450	52799451	+	IGR	INS	-	G	G			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52799450_52799451insG								None (None upstream) : None (None downstream)																							CAGTCTCCCCCGGCCCCCCAGC	0.599													14	19	---	---	---	---	
SUMO1	7341	broad.mit.edu	37	2	203084829	203084829	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203084829delC	uc002uyz.1	-	2	161	c.13delG	c.(13-15)GAGfs	p.E5fs	SUMO1_uc002uza.1_Intron	NM_001005781	NP_001005781	P63165	SUMO1_HUMAN	SMT3 suppressor of mif two 3 homolog 1 isoform a	5					DNA repair|interferon-gamma-mediated signaling pathway|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|palate development|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein complex assembly|protein sumoylation|regulation of interferon-gamma-mediated signaling pathway|regulation of protein localization	cytoplasm|nuclear membrane|nuclear pore|nuclear speck	ubiquitin protein ligase binding				0						GGTTTTGCCTCCTGAAAGAAA	0.338													127	130	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	73793379	73793384	+	IGR	DEL	CTTGTC	-	-	rs4575964	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73793379_73793384delCTTGTC								ADAMTS3 (358863 upstream) : COX18 (127032 downstream)																							tttgagagatcttgtcctttgtaggg	0.000													7	6	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114286429	114286430	+	Intron	INS	-	T	T	rs71582168		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114286429_114286430insT	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GACCTACTGTCTTTTTTTTTTT	0.178													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11364830	11364831	+	Frame_Shift_Del	DEL	GG	-	-	rs138883759	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11364830_11364831delGG	uc003jfa.1	-	8	1494_1495	c.1349_1350delCC	c.(1348-1350)ACCfs	p.T450fs	CTNND2_uc010itt.2_Frame_Shift_Del_p.T359fs|CTNND2_uc011cmy.1_Frame_Shift_Del_p.T113fs|CTNND2_uc011cmz.1_Frame_Shift_Del_p.T17fs|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Frame_Shift_Del_p.T17fs	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	450					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GGTAGGTGCCGGTGTGTGCTGG	0.604													23	12	---	---	---	---	
AGXT2	64902	broad.mit.edu	37	5	35026700	35026700	+	Intron	DEL	A	-	-	rs72168991		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35026700delA	uc003jjf.2	-						AGXT2_uc003jje.1_5'Flank|AGXT2_uc011com.1_Intron	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	alanine-glyoxylate aminotransferase 2 precursor						glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)	GAAAAACAGGAAAAAAAAAAA	0.393													6	3	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	79975047	79975047	+	Intron	DEL	A	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79975047delA	uc003kgz.2	+							NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		GTGGAAATTTAAAAAAAAAAG	0.139								MMR					4	2	---	---	---	---	
CAST	831	broad.mit.edu	37	5	96082016	96082016	+	Intron	DEL	T	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96082016delT	uc003klz.1	+						CAST_uc003klt.2_Intron|CAST_uc003klu.2_Intron|CAST_uc003klv.2_Intron|CAST_uc003klw.2_Intron|CAST_uc003klx.2_Intron|CAST_uc003kly.2_Intron|CAST_uc011cuo.1_Intron|CAST_uc011cuq.1_Intron|CAST_uc011cur.1_Intron|CAST_uc011cus.1_Intron|CAST_uc003kma.1_Intron|CAST_uc011cut.1_Intron|CAST_uc003kmb.2_Intron|CAST_uc003kmc.2_Intron|CAST_uc003kmd.2_Intron|CAST_uc003kme.2_Intron|CAST_uc003kmf.2_Intron|CAST_uc003kmh.2_Intron|CAST_uc010jbj.2_Intron|CAST_uc010jbk.2_Intron|CAST_uc010jbl.1_Intron|CAST_uc003kmi.2_Intron|CAST_uc003kmj.2_Intron	NM_001042443	NP_001035908	P20810	ICAL_HUMAN	calpastatin isoform i								calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding			central_nervous_system(3)|ovary(1)|kidney(1)	5		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		ATTATCCAACTACTTTTTTTT	0.214													24	18	---	---	---	---	
YTHDC2	64848	broad.mit.edu	37	5	112862523	112862527	+	Intron	DEL	AATAT	-	-	rs59216476		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112862523_112862527delAATAT	uc003kqn.2	+						YTHDC2_uc010jce.1_Intron|YTHDC2_uc010jcf.1_Intron	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		AAAAAAAAAAAatatatatatatat	0.224													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12514213	12514236	+	IGR	DEL	CACACACACACACACACACACGCG	-	-	rs145031469	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12514213_12514236delCACACACACACACACACACACGCG								EDN1 (216787 upstream) : PHACTR1 (202652 downstream)																							cacacacacacacacacacacacacacacacgcgcacacacaca	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	25181580	25181580	+	IGR	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25181580delC								CMAH (14787 upstream) : LRRC16A (98068 downstream)																							ACGGGACCCACCCCCGCCCAG	0.567													4	4	---	---	---	---	
FILIP1	27145	broad.mit.edu	37	6	76028608	76028609	+	Intron	INS	-	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76028608_76028609insA	uc003pia.2	-						FILIP1_uc003phy.1_Intron|FILIP1_uc003phz.2_Intron|FILIP1_uc010kbe.2_Intron|FILIP1_uc003pib.1_Intron	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1											skin(3)|ovary(1)	4						GTTAACTATACAAAAAAAAAAG	0.342													4	2	---	---	---	---	
AGPAT4	56895	broad.mit.edu	37	6	161586754	161586755	+	Intron	INS	-	A	A	rs112552218		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161586754_161586755insA	uc003qtr.1	-						AGPAT4_uc003qts.1_Intron|AGPAT4_uc011egb.1_Intron|AGPAT4_uc003qtt.1_Intron|AGPAT4_uc011egc.1_Intron|AGPAT4_uc011egd.1_Intron|AGPAT4_uc011ege.1_Intron	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		AACTAGTTGGGAAAAAAAAAAA	0.406													4	4	---	---	---	---	
T	6862	broad.mit.edu	37	6	166580845	166580846	+	Intron	DEL	GC	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166580845_166580846delGC	uc003quu.1	-						T_uc003qut.1_Intron|T_uc003quv.1_Intron	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T						anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GGAGAGCGCGGCGCGCGCGGGC	0.653									Chordoma_Familial_Clustering_of				1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4589342	4589343	+	IGR	INS	-	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4589342_4589343insA								SDK1 (280713 upstream) : FOXK1 (94045 downstream)																							aggaaagaaggaaaaaaaaaaa	0.282													3	4	---	---	---	---	
PMS2	5395	broad.mit.edu	37	7	6031805	6031805	+	Intron	DEL	T	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6031805delT	uc003spl.2	-						PMS2_uc003spj.2_Intron|PMS2_uc003spk.2_Intron|PMS2_uc011jwl.1_Intron|PMS2_uc010ktg.2_Intron|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Intron	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform						mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TACttttttgttttttttttt	0.189			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	3	---	---	---	---	
TARP	445347	broad.mit.edu	37	7	38299571	38299572	+	3'UTR	DEL	AC	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38299571_38299572delAC	uc003tge.1	-	7					uc003tfx.1_5'Flank|uc003tfz.1_Intron|TARP_uc003tgb.2_3'UTR|TARP_uc003tgc.1_3'UTR|TARP_uc003tgd.1_3'UTR			A2JGV3	A2JGV3_HUMAN	Homo sapiens TCRgamma alternate reading frame protein (TCRg) mRNA, complete cds.												0						ATAGAATAGTACACACATGAGA	0.446													4	16	---	---	---	---	
POM121L12	285877	broad.mit.edu	37	7	53103652	53103653	+	Frame_Shift_Ins	INS	-	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53103652_53103653insT	uc003tpz.2	+	1	304_305	c.288_289insT	c.(286-291)GGCTGGfs	p.G96fs		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	96_97											0						TCTCCGAGGGCTGGAGGCGCCC	0.708													15	54	---	---	---	---	
ST7	7982	broad.mit.edu	37	7	116612281	116612282	+	Intron	INS	-	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116612281_116612282insT	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		AGGCGCTGTCCTTTGGTGCatt	0.436													60	30	---	---	---	---	
FLNC	2318	broad.mit.edu	37	7	128483646	128483646	+	Intron	DEL	T	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128483646delT	uc003vnz.3	+						FLNC_uc003voa.3_Intron	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a						cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GCTCTGCCCCTCCCATGCTAC	0.632													40	22	---	---	---	---	
CALD1	800	broad.mit.edu	37	7	134576496	134576498	+	Intron	DEL	TAA	-	-	rs67949979		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134576496_134576498delTAA	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0						CGAATTGTTGTaaaaaaaaaaaa	0.419													4	2	---	---	---	---	
PSD3	23362	broad.mit.edu	37	8	18725142	18725143	+	Intron	INS	-	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18725142_18725143insA	uc003wza.2	-							NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		AGAAATCCTACAAAAACCACCA	0.401													15	22	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133184645	133184646	+	Intron	DEL	AC	-	-	rs138308682		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133184645_133184646delAC	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GCACATTAATacacacacacac	0.342													4	3	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34666941	34666942	+	Frame_Shift_Ins	INS	-	C	C			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34666941_34666942insC	uc010qej.1	-	10	1492_1493	c.1492_1493insG	c.(1492-1494)GCGfs	p.A498fs	PARD3_uc010qek.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qel.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qem.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qen.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qeo.1_Frame_Shift_Ins_p.A498fs|PARD3_uc010qep.1_Frame_Shift_Ins_p.A454fs|PARD3_uc010qeq.1_Frame_Shift_Ins_p.A454fs|PARD3_uc001ixo.1_Frame_Shift_Ins_p.A228fs|PARD3_uc001ixp.1_Frame_Shift_Ins_p.A363fs|PARD3_uc001ixq.1_Frame_Shift_Ins_p.A498fs|PARD3_uc001ixr.1_Frame_Shift_Ins_p.A498fs|PARD3_uc001ixt.1_Frame_Shift_Ins_p.A319fs|PARD3_uc001ixu.1_Frame_Shift_Ins_p.A454fs|PARD3_uc001ixs.1_Frame_Shift_Ins_p.A151fs	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	498	PDZ 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				CTGAATGGCCGCCCCCCGGGGG	0.480													70	134	---	---	---	---	
CTNNA3	29119	broad.mit.edu	37	10	67726252	67726253	+	Intron	INS	-	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67726252_67726253insA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						ATAAAAACTCCAATTTAGTTTT	0.277													14	8	---	---	---	---	
KIF11	3832	broad.mit.edu	37	10	94388745	94388745	+	Intron	DEL	T	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94388745delT	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						TCCTTCAAGAttttttttttt	0.119													4	2	---	---	---	---	
PYROXD2	84795	broad.mit.edu	37	10	100152083	100152083	+	Intron	DEL	T	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100152083delT	uc001kpc.2	-						PYROXD2_uc001kpb.2_Intron|PYROXD2_uc001kpd.2_Intron	NM_032709	NP_116098	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			central_nervous_system(1)	1						GAGACTTGGCTTTTGCATCTC	0.443													13	17	---	---	---	---	
OR5B3	441608	broad.mit.edu	37	11	58170130	58170130	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58170130delC	uc010rkf.1	-	1	753	c.753delG	c.(751-753)GGGfs	p.G251fs		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	251	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGATAATAGTCCCATAGAAGA	0.448													93	47	---	---	---	---	
FADS2	9415	broad.mit.edu	37	11	61602460	61602461	+	Intron	DEL	CA	-	-	rs149597144	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61602460_61602461delCA	uc001nsl.1	+						FADS2_uc001nsj.2_Intron|FADS2_uc010rlo.1_Intron|FADS2_uc001nsk.2_Intron	NM_004265	NP_004256	O95864	FADS2_HUMAN	fatty acid desaturase 2						electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)	cctgcccccccaccccagccct	0.381													4	2	---	---	---	---	
INTS4	92105	broad.mit.edu	37	11	77639340	77639340	+	Intron	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77639340delG	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			gATTTTAACAGGGGGGGGTGA	0.254													23	11	---	---	---	---	
PICALM	8301	broad.mit.edu	37	11	85692259	85692259	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85692259delC	uc001pbm.2	-	17	1978	c.1692delG	c.(1690-1692)TGGfs	p.W564fs	PICALM_uc001pbl.2_Frame_Shift_Del_p.W514fs|PICALM_uc001pbn.2_Frame_Shift_Del_p.W557fs|PICALM_uc010rtl.1_Frame_Shift_Del_p.W463fs|PICALM_uc001pbk.2_RNA|PICALM_uc010rtk.1_Frame_Shift_Del_p.W141fs|PICALM_uc001pbo.1_Frame_Shift_Del_p.W196fs	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly	564					clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				CTGGTTGACTCCAATTTACAT	0.343			T	MLLT10|MLL	TALL|AML|								40	27	---	---	---	---	
ROBO3	64221	broad.mit.edu	37	11	124740208	124740208	+	Intron	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124740208delC	uc001qbc.2	+							NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3						axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		AGGTGAGAGACCCCCTTCTGC	0.552													13	13	---	---	---	---	
C12orf40	283461	broad.mit.edu	37	12	40110462	40110462	+	Intron	DEL	A	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40110462delA	uc001rmc.2	+						C12orf40_uc009zjv.1_Intron	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461											ovary(6)	6						GTTGTTAGCTAAATTTGTTTT	0.303													8	11	---	---	---	---	
RASSF9	9182	broad.mit.edu	37	12	86199850	86199851	+	Intron	INS	-	T	T	rs149030946	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199850_86199851insT	uc001taf.1	-							NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family						endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						TGAGAGAGGCATTTTTTTtctg	0.163													6	6	---	---	---	---	
SLC5A8	160728	broad.mit.edu	37	12	101588851	101588851	+	Intron	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101588851delG	uc001thz.3	-							NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),						apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						AGAGTGAAAAGGGAAATATGT	0.468													36	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22300097	22300102	+	IGR	DEL	CATCAG	-	-	rs148298958		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22300097_22300102delCATCAG								FGF9 (21457 upstream) : None (None downstream)																							ccatcaccaccatcagcaccatcagc	0.000													3	3	---	---	---	---	
WASF3	10810	broad.mit.edu	37	13	27250966	27250966	+	Intron	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27250966delC	uc001uqv.2	+						WASF3_uc001uqw.2_Intron	NM_006646	NP_006637	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3						actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		GTTTATATGGCCCTTGATGTC	0.363													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20182058	20182059	+	IGR	INS	-	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20182058_20182059insA								P704P (161786 upstream) : OR4Q3 (33528 downstream)																							CAGTGACATGCAAGGTCAAGGG	0.292													82	39	---	---	---	---	
OR4K17	390436	broad.mit.edu	37	14	20585592	20585592	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20585592delC	uc001vwo.1	+	1	27	c.27delC	c.(25-27)CTCfs	p.L9fs		NM_001004715	NP_001004715	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K,	Error:Variant_position_missing_in_Q8NGC6_after_alignment					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CACTCATACTCCATGGTATGA	0.363													52	45	---	---	---	---	
MAPK1IP1L	93487	broad.mit.edu	37	14	55530165	55530174	+	Intron	DEL	ATATTAAATA	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55530165_55530174delATATTAAATA	uc001xbq.1	+							NM_144578	NP_653179	Q8NDC0	MISSL_HUMAN	MAPK-interacting and spindle-stabilizing												0						GGGTGTGTGTATATTAAATAAGTAAATTTC	0.319													3	3	---	---	---	---	
RAGE	5891	broad.mit.edu	37	14	102698300	102698300	+	Intron	DEL	T	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102698300delT	uc001ylm.2	-						RAGE_uc010txv.1_Intron|RAGE_uc001yln.2_Intron|RAGE_uc001ylh.2_Intron|RAGE_uc001yli.2_Intron|RAGE_uc001yll.2_Intron|RAGE_uc001ylj.2_Intron|RAGE_uc001ylk.2_Intron	NM_014226	NP_055041	Q9UQ07	MOK_HUMAN	MAPK/MAK/MRK overlapping kinase						signal transduction	Golgi apparatus	ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						ATCAGGAGCCTTTTTTTTTCT	0.512													4	2	---	---	---	---	
TUBGCP5	114791	broad.mit.edu	37	15	22862067	22862068	+	Intron	INS	-	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22862067_22862068insT	uc001yur.3	+						TUBGCP5_uc001yuq.2_Intron|TUBGCP5_uc010axz.1_Intron	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		Tttctttttccttttttttttt	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	35376211	35376211	+	IGR	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35376211delG								ZNF770 (95757 upstream) : LOC723972 (153316 downstream)																							AAAAAAAAAAGAAACCTCGCT	0.289													2	4	---	---	---	---	
TLN2	83660	broad.mit.edu	37	15	62945428	62945428	+	Frame_Shift_Del	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62945428delG	uc002alb.3	+	4	432	c.432delG	c.(430-432)ACGfs	p.T144fs		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	144	FERM.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AGGAAGGAACGGGCACACTCA	0.363													23	18	---	---	---	---	
CALML4	91860	broad.mit.edu	37	15	68489660	68489661	+	Intron	DEL	GC	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68489660_68489661delGC	uc002arb.2	-						CALML4_uc002arc.2_Intron|CALML4_uc002ard.2_Intron|CALML4_uc002are.2_Intron|CALML4_uc010bhz.2_Intron	NM_033429	NP_219501	Q96GE6	CALL4_HUMAN	calmodulin-like 4 isoform 1								calcium ion binding				0						ACAGTCTCCTGCGCGCGCATCA	0.609													9	9	---	---	---	---	
SIN3A	25942	broad.mit.edu	37	15	75704038	75704038	+	Frame_Shift_Del	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75704038delG	uc002bai.2	-	6	1062	c.803delC	c.(802-804)CCAfs	p.P268fs	SIN3A_uc002baj.2_Frame_Shift_Del_p.P268fs|SIN3A_uc010uml.1_Frame_Shift_Del_p.P268fs	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A	268	Interaction with REST (By similarity).				blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						CGGTGGAAGTGGGGGAGTCTG	0.512													209	124	---	---	---	---	
ADAMTS7	11173	broad.mit.edu	37	15	79068511	79068511	+	Intron	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79068511delC	uc002bej.3	-						ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Intron	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						CCCAAGGGCACCCTGGGCCCC	0.637													25	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80236962	80236962	+	IGR	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80236962delG								C15orf37 (19766 upstream) : BCL2A1 (16271 downstream)																							AGGATGAGATGGGGCACTCAG	0.507													25	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102292874	102292876	+	Intron	DEL	CTC	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102292874_102292876delCTC	uc010usj.1	+						uc002bxo.2_5'Flank|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		AGTTCATCTTCTCAGAGCTGCTG	0.581													4	3	---	---	---	---	
MON1B	22879	broad.mit.edu	37	16	77232211	77232211	+	3'UTR	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77232211delG	uc002fez.2	+	6					MON1B_uc010vnf.1_3'UTR|MON1B_uc010vng.1_3'UTR|MON1B_uc002ffa.2_3'UTR|SYCE1L_uc010vnh.1_5'Flank	NM_014940	NP_055755	Q7L1V2	MON1B_HUMAN	MON1 homolog B								protein binding				0						TCTGATAGTTGGAGCTCCCAG	0.537													56	28	---	---	---	---	
SLC35B1	10237	broad.mit.edu	37	17	47783738	47783739	+	Intron	INS	-	A	A	rs144238441		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47783738_47783739insA	uc002iph.1	-						SLC35B1_uc002ipi.1_Intron|SLC35B1_uc002ipj.1_Intron|SLC35B1_uc010wly.1_Intron	NM_005827	NP_005818	P78383	S35B1_HUMAN	solute carrier family 35, member B1							endoplasmic reticulum membrane|integral to membrane|microsome	UDP-galactose transmembrane transporter activity				0						gaaaagaaaagaaaaaaaaaaa	0.386													4	2	---	---	---	---	
PPM1D	8493	broad.mit.edu	37	17	58733813	58733814	+	Intron	INS	-	A	A	rs76607874		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58733813_58733814insA	uc002iyt.1	+						PPM1D_uc010ddm.1_Intron	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D						negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			gactctgtctcaaaaaaaaaaa	0.134													4	2	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64754611	64754611	+	Intron	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64754611delC	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	ATCTGCACTGCCAAGGCTGAG	0.493													26	21	---	---	---	---	
GRB2	2885	broad.mit.edu	37	17	73316761	73316761	+	Intron	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73316761delC	uc002jnx.3	-						GRB2_uc002jny.3_Intron	NM_002086	NP_002077	P62993	GRB2_HUMAN	growth factor receptor-bound protein 2 isoform						axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity			ovary(3)	3	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	AAACTCACCTCCCATCTCCCA	0.473													2	4	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	55712000	55712000	+	Intron	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55712000delG	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_5'Flank|NEDD4L_uc002lha.1_5'Flank	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						CGCGCCGGCAGGGGGAGGGGA	0.726													6	11	---	---	---	---	
TMEM38A	79041	broad.mit.edu	37	19	16799109	16799117	+	In_Frame_Del	DEL	CGGCCATGC	-	-	rs147713228		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16799109_16799117delCGGCCATGC	uc002nes.2	+	6	918_926	c.827_835delCGGCCATGC	c.(826-837)TCGGCCATGCCC>TCC	p.AMP277del		NM_024074	NP_076979	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	277_279	Cytoplasmic (Potential).					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			central_nervous_system(2)|ovary(1)	3						GCTCAGCATTCGGCCATGCCCGCCAAGTC	0.651													81	63	---	---	---	---	
NWD1	284434	broad.mit.edu	37	19	16874799	16874801	+	Intron	DEL	GCA	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16874799_16874801delGCA	uc002neu.3	+						NWD1_uc002net.3_Intron|NWD1_uc002nev.3_Intron			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;								ATP binding			skin(3)|ovary(2)|pancreas(2)	7						CCTGGTGACTGCACCACGCTCCA	0.507													25	13	---	---	---	---	
ZNF676	163223	broad.mit.edu	37	19	22364432	22364433	+	Intron	INS	-	A	A			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22364432_22364433insA	uc002nqs.1	-							NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ATATTAGACTCAGATAAGTACA	0.302													1	8	---	---	---	---	
ERCC2	2068	broad.mit.edu	37	19	45854705	45854705	+	3'UTR	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45854705delC	uc002pbj.2	-	23					KLC3_uc002pbf.1_3'UTR|KLC3_uc010ejy.1_3'UTR|KLC3_uc002pbg.1_3'UTR|ERCC2_uc002pbh.2_3'UTR|ERCC2_uc002pbi.2_3'UTR|ERCC2_uc010ejz.2_3'UTR	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CATCTCCTGGCCCCCCCTTGC	0.582			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				25	12	---	---	---	---	
LILRA4	23547	broad.mit.edu	37	19	54849937	54849938	+	Frame_Shift_Ins	INS	-	T	T			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54849937_54849938insT	uc002qfj.2	-	3	141_142	c.84_85insA	c.(82-87)AAACCCfs	p.K28fs	LILRA4_uc002qfi.2_5'UTR	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	28_29	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CACAGGATGGGTTTGGGTAGGT	0.589											OREG0003656	type=REGULATORY REGION|Gene=LILRA4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	70	34	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21112409	21112410	+	IGR	INS	-	A	A	rs144954828	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21112409_21112410insA								None (None upstream) : None (None downstream)																							agaacaaggagagaaaaaaaaa	0.158													5	3	---	---	---	---	
TTC3	7267	broad.mit.edu	37	21	38519833	38519833	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38519833delC	uc002yvz.2	+	22	2051	c.1946delC	c.(1945-1947)GCCfs	p.A649fs	TTC3_uc011aee.1_Frame_Shift_Del_p.A339fs|TTC3_uc002ywa.2_Frame_Shift_Del_p.A649fs|TTC3_uc002ywb.2_Frame_Shift_Del_p.A649fs|TTC3_uc010gnf.2_Frame_Shift_Del_p.A414fs|TTC3_uc002ywc.2_Frame_Shift_Del_p.A339fs|TTC3_uc011aed.1_Frame_Shift_Del_p.A339fs	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	649					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				GTGCCAGATGCCATTTGTTGC	0.343													77	56	---	---	---	---	
RRP1	8568	broad.mit.edu	37	21	45219308	45219309	+	Intron	INS	-	C	C	rs4997169		TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45219308_45219309insC	uc002zds.2	+						RRP1_uc011aez.1_Intron|RRP1_uc010gpk.1_Intron|RRP1_uc010gpl.1_Intron|RRP1_uc010gpm.1_Intron	NM_003683	NP_003674	P56182	RRP1_HUMAN	ribosomal RNA processing 1 homolog						rRNA processing	nucleolus|preribosome, small subunit precursor					0				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		ACCAGGGTGCAGGGTGGGCTGT	0.619													4	2	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45499777	45499777	+	Intron	DEL	A	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45499777delA	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc011afa.1_5'Flank	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CTAGTAACTTAAAAAAAAAAA	0.388													4	2	---	---	---	---	
PLA2G3	50487	broad.mit.edu	37	22	31536282	31536282	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31536282delC	uc003aka.2	-	1	188	c.59delG	c.(58-60)GGCfs	p.G20fs		NM_015715	NP_056530	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III precursor	20					cilium morphogenesis|lipid catabolic process|phospholipid metabolic process	centriole|extracellular space|plasma membrane	calcium ion binding|calcium-dependent phospholipase A2 activity				0						GGCAGGGGAGCCCCCCAGGGC	0.657													60	39	---	---	---	---	
CACNA1I	8911	broad.mit.edu	37	22	39994293	39994294	+	Intron	INS	-	GCCCT	GCCCT	rs148307297	by1000genomes	TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39994293_39994294insGCCCT	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	cgccccgccccgccctgcccTC	0.327													8	5	---	---	---	---	
RPS4X	6191	broad.mit.edu	37	X	71496159	71496163	+	Intron	DEL	TTAGT	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71496159_71496163delTTAGT	uc004ear.2	-						RPS4X_uc011mqb.1_Intron	NM_001007	NP_000998	P62701	RS4X_HUMAN	ribosomal protein S4, X-linked X isoform						endocrine pancreas development|positive regulation of cell proliferation|positive regulation of translation|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0	Renal(35;0.156)					AACTAAACTCTTAGTTTAGTTTCAT	0.346													3	5	---	---	---	---	
DACH2	117154	broad.mit.edu	37	X	85769298	85769298	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85769298delC	uc004eew.2	+	3	714	c.544delC	c.(544-546)CCCfs	p.P182fs	DACH2_uc004eex.2_Frame_Shift_Del_p.P169fs|DACH2_uc010nmq.2_Frame_Shift_Del_p.P48fs|DACH2_uc011mra.1_Frame_Shift_Del_p.P15fs|DACH2_uc010nmr.2_5'UTR	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	182					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						ACCCGGCAGGCCCCCTAAGCG	0.438													9	16	---	---	---	---	
HSFX2	100130086	broad.mit.edu	37	X	148731812	148731812	+	Intron	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148731812delG	uc004fdl.2	-						HSFX1_uc004fdm.2_Intron	NM_016153	NP_057237	Q9UBD0	HSFX1_HUMAN	heat shock transcription factor family, X linked							cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGGTCAGAATGGCAGAGTGTG	0.607													2	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13496206	13496206	+	IGR	DEL	G	-	-			TCGA-34-5231-01A-21D-1817-08	TCGA-34-5231-10A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13496206delG								None (None upstream) : None (None downstream)																							CTTCTGTCATGTGAAATAATT	0.318													6	3	---	---	---	---	
