Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SDF4	51150	broad.mit.edu	37	1	1154233	1154233	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1154233C>T	uc001adh.3	-	5	981	c.652G>A	c.(652-654)GAG>AAG	p.E218K	SDF4_uc001adg.2_RNA|SDF4_uc001adi.3_Missense_Mutation_p.E218K|SDF4_uc009vjv.2_Missense_Mutation_p.E96K|SDF4_uc009vjw.2_RNA	NM_016176	NP_057260	Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4 isoform 2	218	EF-hand 3.|3 (Potential).				cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding			upper_aerodigestive_tract(1)|large_intestine(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		AACTCCTCCTCCGTCAGCAGC	0.642													51	440	---	---	---	---	PASS
SSU72	29101	broad.mit.edu	37	1	1509930	1509930	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1509930G>A	uc001agd.2	-	1	333	c.8C>T	c.(7-9)TCG>TTG	p.S3L	SSU72_uc009vkg.1_Missense_Mutation_p.S3L|SSU72_uc001age.1_Missense_Mutation_p.S3L	NM_014188	NP_054907	Q9NP77	SSU72_HUMAN	Ssu72 RNA polymerase II CTD phosphatase homolog	3					mRNA processing	cytoplasm|nucleus	phosphoprotein phosphatase activity				0	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CAGCGGGGACGACGGCATGGC	0.706													10	31	---	---	---	---	PASS
GPR153	387509	broad.mit.edu	37	1	6314966	6314966	+	5'UTR	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6314966G>A	uc001amp.1	-	2						NM_207370	NP_997253	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153							integral to membrane|plasma membrane	G-protein coupled receptor activity				0	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		CATCACTCATGGTGCAGACCG	0.672													9	24	---	---	---	---	PASS
THAP3	90326	broad.mit.edu	37	1	6692962	6692962	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6692962T>C	uc001aoc.2	+	6	704	c.545T>C	c.(544-546)CTT>CCT	p.L182P	THAP3_uc001aod.2_Missense_Mutation_p.L181P|THAP3_uc001aoe.1_Intron			Q8WTV1	THAP3_HUMAN	RecName: Full=THAP domain-containing protein 3;	182							DNA binding|metal ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		AGCTATGCCCTTTTGGACTTA	0.567													4	174	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10434507	10434507	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10434507G>C	uc001aqx.3	+	46	5282	c.5080G>C	c.(5080-5082)GAA>CAA	p.E1694Q	KIF1B_uc001aqw.3_Missense_Mutation_p.E1648Q|KIF1B_uc001aqy.2_Missense_Mutation_p.E1668Q|KIF1B_uc001aqz.2_Missense_Mutation_p.E1694Q|KIF1B_uc001ara.2_Missense_Mutation_p.E1654Q|KIF1B_uc001arb.2_Missense_Mutation_p.E1680Q	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1694					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TCCAGATATTGAAGAAATTAG	0.428													12	226	---	---	---	---	PASS
PRAMEF10	343071	broad.mit.edu	37	1	12954412	12954412	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12954412C>G	uc001auo.2	-							NM_001039361	NP_001034450	O60809	PRA10_HUMAN	PRAME family member 10												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACCATCATTTCTTACCTGAGC	0.323													14	94	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21036133	21036133	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21036133C>T	uc001bdr.3	-	4	787	c.669G>A	c.(667-669)GTG>GTA	p.V223V	KIF17_uc001bds.3_Silent_p.V223V	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	223	Kinesin-motor.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CTCGCATACCCACGGCAGACA	0.612													6	104	---	---	---	---	PASS
C1QB	713	broad.mit.edu	37	1	22987712	22987712	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22987712G>T	uc001bgd.2	+	3	727	c.595G>T	c.(595-597)GAC>TAC	p.D199Y		NM_000491	NP_000482	P02746	C1QB_HUMAN	complement component 1, q subcomponent, B chain	199	C1q.				complement activation, classical pathway|innate immune response	collagen|complement component C1 complex				breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.06e-27)|Colorectal(126;1.58e-07)|GBM - Glioblastoma multiforme(114;6.72e-06)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000551)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CACCTTCTGTGACTATGCCTA	0.592													20	76	---	---	---	---	PASS
TXLNA	200081	broad.mit.edu	37	1	32657926	32657926	+	Silent	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32657926C>G	uc001bui.2	+	7	1043	c.978C>G	c.(976-978)GTC>GTG	p.V326V	TXLNA_uc001buj.2_Silent_p.V326V	NM_175852	NP_787048	P40222	TXLNA_HUMAN	taxilin	326	Potential.				cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				TCGACAAAGTCTTCAAACACA	0.577													25	178	---	---	---	---	PASS
SNIP1	79753	broad.mit.edu	37	1	38003401	38003401	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38003401T>C	uc001cbi.2	-	4	1212	c.1139A>G	c.(1138-1140)GAC>GGC	p.D380G	SNIP1_uc010oid.1_RNA	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein	380					production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding			upper_aerodigestive_tract(1)|lung(1)	2		Myeloproliferative disorder(586;0.0393)				ATCTTTCCTGTCTATTTCAGA	0.423													52	187	---	---	---	---	PASS
HPDL	84842	broad.mit.edu	37	1	45793514	45793514	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45793514G>A	uc001cne.2	+	1	970	c.694G>A	c.(694-696)GAG>AAG	p.E232K		NM_032756	NP_116145	Q96IR7	HPDL_HUMAN	glyoxalase domain containing 1	232					aromatic amino acid family metabolic process		4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	Acute lymphoblastic leukemia(166;0.155)					TGTTCTGGCTGAGTCCCTTCC	0.652													80	252	---	---	---	---	PASS
CC2D1B	200014	broad.mit.edu	37	1	52821929	52821929	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52821929C>T	uc001ctq.1	-	18	2139	c.2001G>A	c.(1999-2001)CTG>CTA	p.L667L	CC2D1B_uc001ctr.2_Silent_p.L207L|CC2D1B_uc001cts.2_Silent_p.L352L	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	667										ovary(2)	2						GGGCCAGCTGCAGGATCTCCA	0.562													43	253	---	---	---	---	PASS
TMEM59	9528	broad.mit.edu	37	1	54511465	54511465	+	Intron	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54511465A>G	uc001cwp.2	-						TMEM59_uc001cwn.2_5'Flank|TMEM59_uc001cwo.2_Intron|TMEM59_uc001cwq.2_Intron|TMEM59_uc001cwr.2_Intron|TMEM59_uc001cws.1_Intron	NM_004872	NP_004863	Q9BXS4	TMM59_HUMAN	thymic dendritic cell-derived factor 1							Golgi membrane|integral to membrane					0						ACATGCTGTAAGAGAAAAATA	0.333													15	81	---	---	---	---	PASS
JUN	3725	broad.mit.edu	37	1	59247951	59247951	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59247951G>C	uc001cze.2	-	1	1835	c.792C>G	c.(790-792)ATC>ATG	p.I264M	uc001czf.2_5'Flank|uc010oop.1_5'Flank	NM_002228	NP_002219	P05412	JUN_HUMAN	jun oncogene	264	Basic motif.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation by host of viral transcription|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein import into nucleus|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		R-SMAD binding|Rho GTPase activator activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity|transcription factor binding|transcription regulatory region DNA binding				0	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Vinblastine(DB00570)	TGGAGGCAGCGATGCGGTTCC	0.612			A		sarcoma								70	216	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62330108	62330108	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62330108C>G	uc001dab.2	+	20	2752	c.2638C>G	c.(2638-2640)CAA>GAA	p.Q880E	INADL_uc009waf.1_Missense_Mutation_p.Q880E|INADL_uc001daa.2_Missense_Mutation_p.Q880E|INADL_uc001dad.3_Missense_Mutation_p.Q577E|INADL_uc001dac.2_RNA	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	880					intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						TGAGTTATATCAAGATCCCTC	0.438													15	130	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62713308	62713308	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62713308C>T	uc001dah.3	-	9	3096	c.2719G>A	c.(2719-2721)GAC>AAC	p.D907N	KANK4_uc001dai.3_Missense_Mutation_p.D279N|KANK4_uc001daf.3_Missense_Mutation_p.D45N|KANK4_uc001dag.3_Missense_Mutation_p.D263N	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	907	ANK 3.									ovary(3)|skin(2)|lung(1)	6						TCCTCCCTGTCGTGGCTGACT	0.622													28	110	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75065587	75065587	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75065587C>G	uc001dgg.2	-	11	1737	c.1518G>C	c.(1516-1518)GAG>GAC	p.E506D	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.E300D	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	506	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTTGTTTCTCCTCATCTACTT	0.338													19	167	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79357344	79357344	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79357344G>T	uc001diq.3	-	14	2031	c.1875C>A	c.(1873-1875)TTC>TTA	p.F625L		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	625	Helical; Name=6; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGCCGAGAAGGAACAGAAGAG	0.478													4	90	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82409045	82409045	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82409045A>T	uc001dit.3	+	6	971	c.790A>T	c.(790-792)ATC>TTC	p.I264F	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.I264F|LPHN2_uc001div.2_Missense_Mutation_p.I264F|LPHN2_uc009wcd.2_Missense_Mutation_p.I264F	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	264	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		AAAGACTGATATCGACCTAGC	0.413													41	152	---	---	---	---	PASS
SH3GLB1	51100	broad.mit.edu	37	1	87207947	87207947	+	Nonsense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87207947C>G	uc001dlw.2	+	8	1144	c.818C>G	c.(817-819)TCA>TGA	p.S273*	SH3GLB1_uc001dlx.2_Nonsense_Mutation_p.S294*|SH3GLB1_uc001dly.2_Nonsense_Mutation_p.S302*|SH3GLB1_uc001dlz.2_Nonsense_Mutation_p.S173*	NM_016009	NP_057093	Q9Y371	SHLB1_HUMAN	SH3-containing protein SH3GLB1	273					anti-apoptosis|filopodium assembly|signal transduction	Golgi membrane|mitochondrial outer membrane	cytoskeletal adaptor activity|protein homodimerization activity|SH3 domain binding				0		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		CCTGTACCATCAGTTTTACCA	0.408													17	138	---	---	---	---	PASS
SH3GLB1	51100	broad.mit.edu	37	1	87208108	87208108	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87208108C>T	uc001dlw.2	+	8	1305	c.979C>T	c.(979-981)CTG>TTG	p.L327L	SH3GLB1_uc001dlx.2_Silent_p.L348L|SH3GLB1_uc001dly.2_Silent_p.L356L|SH3GLB1_uc001dlz.2_Silent_p.L227L	NM_016009	NP_057093	Q9Y371	SHLB1_HUMAN	SH3-containing protein SH3GLB1	327	SH3.				anti-apoptosis|filopodium assembly|signal transduction	Golgi membrane|mitochondrial outer membrane	cytoskeletal adaptor activity|protein homodimerization activity|SH3 domain binding				0		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		ATTATCACTTCTGGCAGATGA	0.388													17	107	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92177902	92177902	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92177902G>A	uc001doh.2	-	13	2530	c.2064C>T	c.(2062-2064)TTC>TTT	p.F688F	TGFBR3_uc009wde.2_Intron|TGFBR3_uc010osy.1_Silent_p.F646F|TGFBR3_uc001doi.2_Silent_p.F687F|TGFBR3_uc001doj.2_Silent_p.F687F	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	688	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		AGACAAAGCTGAATCGCTTCT	0.448													14	104	---	---	---	---	PASS
AGL	178	broad.mit.edu	37	1	100366315	100366315	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100366315G>T	uc001dsi.1	+	26	3886	c.3486G>T	c.(3484-3486)CAG>CAT	p.Q1162H	AGL_uc001dsj.1_Missense_Mutation_p.Q1162H|AGL_uc001dsk.1_Missense_Mutation_p.Q1162H|AGL_uc001dsl.1_Missense_Mutation_p.Q1162H|AGL_uc001dsm.1_Missense_Mutation_p.Q1146H|AGL_uc001dsn.1_Missense_Mutation_p.Q1145H	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	1162	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		AGTGTATCCAGGATTACTGTA	0.468													8	380	---	---	---	---	PASS
MIR553	693138	broad.mit.edu	37	1	100746847	100746847	+	RNA	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100746847C>T	hsa-mir-553|MI0003558	+			c.51C>T			RTCD1_uc001dtd.2_Intron|RTCD1_uc001dtc.2_Intron																	0						GAGAAAATCTCGCTGTTTTAG	0.090													11	108	---	---	---	---	PASS
S1PR1	1901	broad.mit.edu	37	1	101705208	101705208	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101705208G>A	uc001dud.2	+	2	1182	c.668G>A	c.(667-669)AGA>AAA	p.R223K	S1PR1_uc009weg.2_Missense_Mutation_p.R223K	NM_001400	NP_001391	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	223	Cytoplasmic (By similarity).				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity			ovary(2)|lung(1)	3						CTGTACTGCAGAATCTACTCC	0.572													50	187	---	---	---	---	PASS
C1orf103	55791	broad.mit.edu	37	1	111494566	111494566	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111494566C>T	uc001eaa.2	-	2	1196	c.940G>A	c.(940-942)GCT>ACT	p.A314T	C1orf103_uc001dzz.2_Intron|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	314					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		ATCTTTGAAGCCACATTATTT	0.378													20	95	---	---	---	---	PASS
ADORA3	140	broad.mit.edu	37	1	112029246	112029246	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112029246G>A	uc001ebf.2	-	4	1601	c.834C>T	c.(832-834)TGC>TGT	p.C278C	ADORA3_uc001ebg.3_Silent_p.C197C	NM_020683	NP_065734	P33765	AA3R_HUMAN	adenosine A3 receptor isoform 1	Error:Variant_position_missing_in_P33765_after_alignment					activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled			ovary(2)|large_intestine(1)|skin(1)	4		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)	TGGGAGCCTTGCAGCTTCTGG	0.577													11	40	---	---	---	---	PASS
WNT2B	7482	broad.mit.edu	37	1	113059968	113059968	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113059968G>C	uc001ecb.2	+	4	1422	c.907G>C	c.(907-909)GAC>CAC	p.D303H	WNT2B_uc001eca.2_Missense_Mutation_p.D284H|WNT2B_uc009wgg.2_Missense_Mutation_p.D211H	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	303					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTCTACTTTGACAACTCTCC	0.572													3	79	---	---	---	---	PASS
PHTF1	10745	broad.mit.edu	37	1	114247382	114247382	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114247382G>C	uc009wgp.1	-	13	2161	c.1709C>G	c.(1708-1710)TCT>TGT	p.S570C	PHTF1_uc001edn.2_Missense_Mutation_p.S570C|PHTF1_uc001edm.2_Missense_Mutation_p.S327C	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	570						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTCCTGGCAGAAGTAATATG	0.313													17	132	---	---	---	---	PASS
FCGR1A	2209	broad.mit.edu	37	1	149760129	149760129	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149760129G>A	uc001esp.3	+	4	565	c.515G>A	c.(514-516)GGA>GAA	p.G172E	HIST2H2BF_uc010pbj.1_Intron|FCGR1A_uc009wlg.2_RNA|FCGR1A_uc009wlh.1_RNA	NM_000566	NP_000557	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor	172	Ig-like C2-type 2.|Extracellular (Potential).				interferon-gamma-mediated signaling pathway|phagocytosis, engulfment	integral to membrane|plasma membrane	IgG binding|receptor activity|receptor signaling protein activity			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCAGGCATGGGAAAGCATCGC	0.393													5	238	---	---	---	---	PASS
HIST2H2BE	8349	broad.mit.edu	37	1	149858143	149858143	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149858143C>T	uc001etc.2	-	1	90	c.48G>A	c.(46-48)AAG>AAA	p.K16K	HIST2H2AC_uc001etd.2_5'Flank	NM_003528	NP_003519	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	16					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TGACGGCTTTCTTGGAGCCCT	0.532													65	311	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152191617	152191617	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152191617G>A	uc001ezt.1	-	3	2564	c.2488C>T	c.(2488-2490)CAG>TAG	p.Q830*		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	830	8.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAACCATGCTGACTATAGCCC	0.547													31	123	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152275409	152275409	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152275409C>G	uc001ezu.1	-	3	11989	c.11953G>C	c.(11953-11955)GAT>CAT	p.D3985H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3985					keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCACCATAATCATAATCTGCA	0.398									Ichthyosis				48	215	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152281208	152281208	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281208C>A	uc001ezu.1	-	3	6190	c.6154G>T	c.(6154-6156)GAA>TAA	p.E2052*		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2052	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGAGTCTTCTGAATGTCCC	0.562									Ichthyosis				128	791	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154042813	154042813	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154042813G>A	uc001fdw.2	-	17	2562	c.2490C>T	c.(2488-2490)TTC>TTT	p.F830F	NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Silent_p.F830F	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	830						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TATAATCTTCGAAATGGGCTA	0.378													34	162	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156507057	156507057	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156507057C>T	uc001fpf.2	-	27	3413	c.3338G>A	c.(3337-3339)AGA>AAA	p.R1113K		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1113	Ras-GAP.				small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTCCAGTCGTCTCTGGACCTC	0.557													7	121	---	---	---	---	PASS
TADA1	117143	broad.mit.edu	37	1	166831654	166831654	+	Intron	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166831654G>C	uc001gdw.2	-						TADA1_uc001gdv.2_5'UTR	NM_053053	NP_444281	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1-like						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(1)	1						TCTATGCTATGAGTAAGAAAA	0.393													22	156	---	---	---	---	PASS
DNM3	26052	broad.mit.edu	37	1	171956860	171956860	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171956860G>T	uc001gie.2	+	3	476	c.300G>T	c.(298-300)GAG>GAT	p.E100D	DNM3_uc001gid.3_Missense_Mutation_p.E100D|DNM3_uc009wwb.2_Missense_Mutation_p.E100D|DNM3_uc001gif.2_Missense_Mutation_p.E100D	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a	100					endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						TTCGCCTTGAGATTGAAGCAG	0.343													19	276	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564447	176564447	+	Silent	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564447C>A	uc001gkz.2	+	3	2871	c.1707C>A	c.(1705-1707)GTC>GTA	p.V569V	PAPPA2_uc001gky.1_Silent_p.V569V|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	569	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						AGCTGAGCGTCCACCAGGTCC	0.572													19	111	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186157078	186157078	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186157078G>C	uc001grq.1	+	106	16707	c.16478G>C	c.(16477-16479)AGA>ACA	p.R5493T	HMCN1_uc001grs.1_Missense_Mutation_p.R945T	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5493					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TTCAACATGAGAGGAAGCTAC	0.502													38	248	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067726	190067726	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067726G>T	uc001gse.1	-	8	1955	c.1723C>A	c.(1723-1725)CCC>ACC	p.P575T	FAM5C_uc010pot.1_Missense_Mutation_p.P473T	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	575						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					CCTCCGAAGGGATTGACATAA	0.468													40	336	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200972830	200972830	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200972830G>A	uc001gvs.1	-	8	1413	c.1096C>T	c.(1096-1098)CGG>TGG	p.R366W	KIF21B_uc001gvr.1_Missense_Mutation_p.R366W|KIF21B_uc009wzl.1_Missense_Mutation_p.R366W|KIF21B_uc010ppn.1_Missense_Mutation_p.R366W|KIF21B_uc001gvt.1_Missense_Mutation_p.R224W	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	366					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						TTGCGGGCCCGATTGGCATAT	0.552													30	221	---	---	---	---	PASS
SRGAP2	23380	broad.mit.edu	37	1	206623739	206623739	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206623739C>G	uc001hdy.2	+	16	2180	c.1847C>G	c.(1846-1848)CCT>CGT	p.P616R	SRGAP2_uc010prt.1_Missense_Mutation_p.P539R|SRGAP2_uc001hdx.2_Missense_Mutation_p.P616R|SRGAP2_uc010pru.1_Missense_Mutation_p.P539R|SRGAP2_uc010prv.1_Missense_Mutation_p.P540R	NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	703					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)					AGTGATAGCCCTCATGGAGAG	0.552													6	93	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216061896	216061896	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216061896G>A	uc001hku.1	-	41	8482	c.8095C>T	c.(8095-8097)CGG>TGG	p.R2699W		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2699	Extracellular (Potential).|Fibronectin type-III 13.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATCAGTACCCGATATTCATAT	0.493										HNSCC(13;0.011)			9	110	---	---	---	---	PASS
GPATCH2	55105	broad.mit.edu	37	1	217784282	217784282	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217784282C>G	uc001hlf.1	-	4	1063	c.967G>C	c.(967-969)GAA>CAA	p.E323Q	GPATCH2_uc001hlg.3_Missense_Mutation_p.E323Q	NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	323						intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		AAGATACTTTCAAAGACAGGA	0.453													22	179	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228444513	228444513	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228444513G>C	uc009xez.1	+	15	4515	c.4471G>C	c.(4471-4473)GAG>CAG	p.E1491Q	OBSCN_uc001hsn.2_Missense_Mutation_p.E1491Q	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1491	Ig-like 15.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				AGTGCGCATGGAGGCTGTGGG	0.672													22	174	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228471478	228471478	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228471478G>T	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsp.1_Silent_p.A703A|OBSCN_uc001hsq.1_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				AAGGTGAGGCGGCCAAGTGTG	0.612													19	176	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228475624	228475624	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228475624C>T	uc009xez.1	+	36	9818	c.9774C>T	c.(9772-9774)TTC>TTT	p.F3258F	OBSCN_uc001hsn.2_Silent_p.F3258F|OBSCN_uc001hsq.1_Silent_p.F514F	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	3258	Ig-like 32.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CATGCTCCTTCGGGGACCAGA	0.617													11	111	---	---	---	---	PASS
TAF5L	27097	broad.mit.edu	37	1	229730377	229730377	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229730377G>A	uc001htq.2	-	5	1603	c.1437C>T	c.(1435-1437)AAC>AAT	p.N479N		NM_014409	NP_055224	O75529	TAF5L_HUMAN	PCAF associated factor 65 beta isoform a	479	WD 5.				histone H3 acetylation|transcription from RNA polymerase II promoter	STAGA complex|transcription factor TFTC complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				AGTACTTACCGTTGGGAGAAA	0.587													27	338	---	---	---	---	PASS
C1orf198	84886	broad.mit.edu	37	1	230979318	230979318	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230979318C>A	uc001hub.2	-	3	753	c.709G>T	c.(709-711)GAC>TAC	p.D237Y	C1orf198_uc009xfh.1_Missense_Mutation_p.D107Y|C1orf198_uc001huc.1_Missense_Mutation_p.D20Y|C1orf198_uc001hud.1_Missense_Mutation_p.D199Y	NM_032800	NP_116189	Q9H425	CA198_HUMAN	hypothetical protein LOC84886 isoform 1	237											0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GCCTCCCTGTCCTTCGGGGCA	0.632													18	146	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233394590	233394590	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233394590C>T	uc001hvl.2	-	5	1253	c.1018G>A	c.(1018-1020)GAC>AAC	p.D340N	PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	340						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				AAGGGCAGGTCCCCCTGGCAG	0.572													28	237	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235383152	235383152	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235383152G>A	uc001hwq.2	-	16	2037	c.1539C>T	c.(1537-1539)TCC>TCT	p.S513S	ARID4B_uc001hwr.2_Silent_p.S513S|ARID4B_uc001hws.3_Silent_p.S513S|ARID4B_uc001hwt.3_Silent_p.S194S	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	513	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTATGTTGAGGGATTCATCTA	0.343													8	230	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235937219	235937219	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235937219C>G	uc001hxj.2	-	19	5882	c.5707G>C	c.(5707-5709)GAC>CAC	p.D1903H	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1903					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GCATTAGAGTCTACATCCAAC	0.328									Chediak-Higashi_syndrome				12	138	---	---	---	---	PASS
ERO1LB	56605	broad.mit.edu	37	1	236399131	236399131	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236399131G>A	uc001hxt.2	-	8	887	c.631C>T	c.(631-633)CGA>TGA	p.R211*		NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta	211					electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			TAAACAGATCGAGGCCTGAAA	0.338													17	116	---	---	---	---	PASS
LGALS8	3964	broad.mit.edu	37	1	236702172	236702172	+	Intron	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236702172C>T	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGTCTTCCCTCATATAGATTC	0.532													5	154	---	---	---	---	PASS
LGALS8	3964	broad.mit.edu	37	1	236706288	236706288	+	Intron	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236706288T>C	uc001hxz.1	+						LGALS8_uc001hxw.1_Missense_Mutation_p.V208A|LGALS8_uc001hxy.1_Missense_Mutation_p.V208A|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Missense_Mutation_p.V149A	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GATTCGACTGTCAATCACACT	0.378													118	91	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236727888	236727888	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236727888C>G	uc001hyd.1	-	32	4634	c.4509G>C	c.(4507-4509)GAG>GAC	p.E1503D	HEATR1_uc009xgh.1_Missense_Mutation_p.E665D	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	1503					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TAGTGTGAGTCTCTACATTAA	0.363													22	168	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237604775	237604775	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237604775C>A	uc001hyl.1	+	13	1282	c.1162C>A	c.(1162-1164)CAA>AAA	p.Q388K		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	388	Cytoplasmic (By similarity).|MIR 5.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGGATCTATACAACGTAAGGT	0.343													8	149	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237868571	237868571	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237868571T>C	uc001hyl.1	+	67	9628	c.9508T>C	c.(9508-9510)TTT>CTT	p.F3170L	RYR2_uc010pxz.1_Missense_Mutation_p.F125L	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3170	Helical; Name=M''; (Potential).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCCTGTAGCATTTTTGGAAAC	0.398													17	13	---	---	---	---	PASS
CHRM3	1131	broad.mit.edu	37	1	240070744	240070744	+	5'UTR	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240070744G>C	uc001hyp.2	+	5						NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	CTATGTCAGAGAGTCACAATG	0.453													24	204	---	---	---	---	PASS
HNRNPU	3192	broad.mit.edu	37	1	245027180	245027180	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245027180C>T	uc001iaz.1	-	1	648	c.430G>A	c.(430-432)GAG>AAG	p.E144K	HNRNPU_uc001iay.1_5'Flank|HNRNPU_uc001iba.1_Missense_Mutation_p.E144K|HNRNPU_uc001ibb.1_Intron	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	144	Asp/Glu-rich (acidic).				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			TCCCCGAGCTCATCTTCCCCT	0.711													15	121	---	---	---	---	PASS
VN1R5	317705	broad.mit.edu	37	1	247419770	247419770	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247419770A>G	uc010pyu.1	+	2	397	c.397A>G	c.(397-399)ATC>GTC	p.I133V		NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	vomeronasal 1 receptor 5	133	Helical; Name=4; (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	OV - Ovarian serous cystadenocarcinoma(106;0.00854)			GGGCCTCTCCATCTGCACCCC	0.473													82	140	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769106	247769106	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769106C>T	uc010pyz.1	+	1	219	c.219C>T	c.(217-219)TTC>TTT	p.F73F		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ACATCTGCTTCACTACTAGCC	0.443													75	619	---	---	---	---	PASS
OR13G1	441933	broad.mit.edu	37	1	247835987	247835987	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247835987G>C	uc001idi.1	-	1	357	c.357C>G	c.(355-357)CGC>CGG	p.R119R		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	119	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TGGCCACATAGCGGTCATAGG	0.458													47	68	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343428	248343428	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343428C>T	uc010pzf.1	+	1	141	c.141C>T	c.(139-141)CTC>CTT	p.L47L		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	47	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCATGGTTCTCCTCATCTACC	0.527													387	483	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436606	248436606	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436606C>A	uc010pzi.1	-	1	511	c.511G>T	c.(511-513)GAG>TAG	p.E171*		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	171	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TGATCGATCTCGTGTGCACCA	0.547													7	68	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248524910	248524910	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248524910C>A	uc001ieh.1	+	1	28	c.28C>A	c.(28-30)CAC>AAC	p.H10N		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GATGGCCAGCCACACTGGATG	0.483													69	82	---	---	---	---	PASS
KLF11	8462	broad.mit.edu	37	2	10188682	10188682	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10188682C>G	uc002raf.1	+	3	1380	c.1218C>G	c.(1216-1218)TTC>TTG	p.F406L	KLF11_uc010yjc.1_Missense_Mutation_p.F389L	NM_003597	NP_003588	O14901	KLF11_HUMAN	Kruppel-like factor 11	406	C2H2-type 1.				apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		AGACCTACTTCAAAAGTTCCC	0.542											OREG0014425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	167	---	---	---	---	PASS
ITSN2	50618	broad.mit.edu	37	2	24524941	24524941	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24524941C>T	uc002rfe.2	-	10	1146	c.888G>A	c.(886-888)CAG>CAA	p.Q296Q	ITSN2_uc002rff.2_Silent_p.Q296Q|ITSN2_uc002rfg.2_Silent_p.Q296Q|ITSN2_uc010eyd.2_Silent_p.Q321Q	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	296	EH 2.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCTTTTAGCTGTCCATCAC	0.388													28	70	---	---	---	---	PASS
CIB4	130106	broad.mit.edu	37	2	26864137	26864137	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26864137C>T	uc002rhm.2	-	1	75	c.46G>A	c.(46-48)GAG>AAG	p.E16K		NM_001029881	NP_001025052	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	16							calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCTGGTACTCTTCCAGGTCC	0.547													56	314	---	---	---	---	PASS
SLC30A6	55676	broad.mit.edu	37	2	32445321	32445321	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32445321G>T	uc002roe.1	+	14	962	c.925G>T	c.(925-927)GAA>TAA	p.E309*	SLC30A6_uc002rof.1_Nonsense_Mutation_p.E349*|SLC30A6_uc010ymw.1_Nonsense_Mutation_p.E280*|SLC30A6_uc010ezr.1_Nonsense_Mutation_p.E286*|SLC30A6_uc002rog.1_Nonsense_Mutation_p.E112*|SLC30A6_uc010ezs.1_Nonsense_Mutation_p.E235*|SLC30A6_uc002roh.1_Nonsense_Mutation_p.E112*	NM_017964	NP_060434	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter),	309	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGATGCCAATGAACAAATGGT	0.378													26	95	---	---	---	---	PASS
STRN	6801	broad.mit.edu	37	2	37085108	37085108	+	Silent	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37085108A>T	uc002rpn.2	-	14	1737	c.1728T>A	c.(1726-1728)GCT>GCA	p.A576A	STRN_uc010ezx.2_Silent_p.A539A	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	576	WD 3.				dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CTGCACTATAAGCCAAACCCC	0.443													4	30	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37255256	37255256	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37255256C>T	uc002rpp.1	-	24	3759	c.3663G>A	c.(3661-3663)GAG>GAA	p.E1221E		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1221							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				CATCATCCATCTCATCTTTCT	0.403													4	110	---	---	---	---	PASS
PRKD3	23683	broad.mit.edu	37	2	37543546	37543546	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37543546G>C	uc002rqd.2	-	1	677	c.122C>G	c.(121-123)TCT>TGT	p.S41C	PRKD3_uc002rqf.1_Missense_Mutation_p.S41C	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3	41					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				GCTTCCATTAGAGAGTCGGGC	0.512													21	171	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39214723	39214723	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39214723G>C	uc002rrk.3	-	22	3442	c.3401C>G	c.(3400-3402)TCT>TGT	p.S1134C	SOS1_uc002rrj.3_Missense_Mutation_p.S733C	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	1134					apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				AGATGATACAGAAGCAGATCC	0.388									Noonan_syndrome				3	24	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48896892	48896892	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48896892G>T	uc010yol.1	+	6	3028	c.2981G>T	c.(2980-2982)CGG>CTG	p.R994L	STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.R1041L|GTF2A1L_uc002rws.1_Missense_Mutation_p.R337L|GTF2A1L_uc010yom.1_Missense_Mutation_p.R303L|GTF2A1L_uc002rwt.2_Missense_Mutation_p.R337L	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	994					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTAAGCATTCGGGTTACTGAT	0.308													22	165	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49190072	49190072	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49190072T>C	uc002rww.2	-	10	1962	c.1888A>G	c.(1888-1890)ACC>GCC	p.T630A	FSHR_uc002rwx.2_Missense_Mutation_p.T568A|FSHR_uc010fbn.2_Missense_Mutation_p.T604A	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	630	Helical; Name=7; (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	AAGTTTTTGGTAAAGATGGCA	0.463									Gonadal_Dysgenesis_46_XX				31	83	---	---	---	---	PASS
MIR217	406999	broad.mit.edu	37	2	56210178	56210178	+	RNA	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56210178T>C	hsa-mir-217|MI0000293	-			c.34T>C			uc002rzk.2_Intron|uc010ypd.1_RNA																	0						TGATGCAGTATCTGCGACATC	0.323													6	21	---	---	---	---	PASS
PELI1	57162	broad.mit.edu	37	2	64321978	64321978	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64321978G>A	uc002scs.3	-	6	5154	c.1115C>T	c.(1114-1116)TCA>TTA	p.S372L	PELI1_uc002sct.3_Missense_Mutation_p.S372L|PELI1_uc002scr.3_Missense_Mutation_p.S193L	NM_020651	NP_065702	Q96FA3	PELI1_HUMAN	pellino protein	372					innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol				ovary(1)	1						TGTCTTTTCTGAACACACATG	0.512													28	169	---	---	---	---	PASS
MPHOSPH10	10199	broad.mit.edu	37	2	71376996	71376996	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71376996G>A	uc002sht.1	+	11	2249	c.1897G>A	c.(1897-1899)GAT>AAT	p.D633N		NM_005791	NP_005782	O00566	MPP10_HUMAN	M-phase phosphoprotein 10	633					RNA splicing, via transesterification reactions|rRNA processing	chromosome|nucleolus|small nucleolar ribonucleoprotein complex	protein binding			skin(2)|ovary(1)	3						TTAATTGCAGGATGAAGGTAA	0.313													26	183	---	---	---	---	PASS
C2orf3	6936	broad.mit.edu	37	2	75915073	75915073	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75915073A>G	uc002sno.2	-	11	1700	c.1570T>C	c.(1570-1572)TGG>CGG	p.W524R	C2orf3_uc010ffs.2_Missense_Mutation_p.W86R|C2orf3_uc002snn.2_Missense_Mutation_p.W355R|C2orf3_uc010fft.2_Missense_Mutation_p.W199R	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936	524					negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						GATTTGAACCATGGCATCTCT	0.289													15	67	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77746749	77746749	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746749G>T	uc002snr.2	-	3	661	c.246C>A	c.(244-246)GCC>GCA	p.A82A	LRRTM4_uc002snq.2_Silent_p.A82A|LRRTM4_uc002sns.2_Silent_p.A82A|LRRTM4_uc002snt.2_Silent_p.A83A	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	82	LRR 1.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		GGTTAAGGCCGGCAAACTGAT	0.408													19	80	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79348732	79348732	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79348732C>G	uc002snz.2	+	3	212	c.109C>G	c.(109-111)CCA>GCA	p.P37A	REG1A_uc010ffx.1_Missense_Mutation_p.P37A|REG1A_uc010ysd.1_Missense_Mutation_p.P37A	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor	37	C-type lectin.				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						GATCAGCTGCCCAGAAGGCAC	0.527													80	390	---	---	---	---	PASS
DNAH6	1768	broad.mit.edu	37	2	84775530	84775530	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84775530G>C	uc010fgb.2	+	8	1442	c.1305G>C	c.(1303-1305)ATG>ATC	p.M435I	DNAH6_uc002soo.2_Missense_Mutation_p.M14I|DNAH6_uc002sop.2_Missense_Mutation_p.M14I	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6	435	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						ATTATTGCATGAGGCTGACGT	0.348													11	92	---	---	---	---	PASS
ST3GAL5	8869	broad.mit.edu	37	2	86088343	86088343	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86088343G>T	uc002sqq.1	-	3	408	c.279C>A	c.(277-279)GAC>GAA	p.D93E	ST3GAL5_uc010ysy.1_Missense_Mutation_p.D93E|ST3GAL5_uc010ysz.1_Missense_Mutation_p.D93E|ST3GAL5_uc010fgq.1_5'UTR|ST3GAL5_uc002sqp.1_Missense_Mutation_p.D70E	NM_003896	NP_003887	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	93	Lumenal (Potential).				ganglioside biosynthetic process|protein glycosylation	integral to Golgi membrane|integral to plasma membrane	lactosylceramide alpha-2,3-sialyltransferase activity|neolactotetraosylceramide alpha-2,3-sialyltransferase activity				0						TTTTTTTCATGTCACATTCTT	0.333													8	73	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86378415	86378415	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86378415C>G	uc002sqz.3	-						IMMT_uc002sqy.3_Intron|IMMT_uc002srb.3_Intron|IMMT_uc002sra.3_Intron|IMMT_uc010ytd.1_Intron|IMMT_uc010yte.1_Intron|IMMT_uc002src.1_Intron	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1							integral to mitochondrial inner membrane	protein binding			skin(1)	1						TCTCATTTCTCTTACCTTTCT	0.323													9	55	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86378500	86378500	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86378500C>T	uc002sqz.3	-	12	1709	c.1321G>A	c.(1321-1323)GAA>AAA	p.E441K	IMMT_uc002sqy.3_Missense_Mutation_p.E182K|IMMT_uc002srb.3_Missense_Mutation_p.E430K|IMMT_uc002sra.3_Missense_Mutation_p.E440K|IMMT_uc010ytd.1_Missense_Mutation_p.E429K|IMMT_uc010yte.1_Missense_Mutation_p.E394K|IMMT_uc002src.1_Missense_Mutation_p.E177K	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	441	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1						GCCCGCTTTTCTTCCAGCTTT	0.448													18	123	---	---	---	---	PASS
THNSL2	55258	broad.mit.edu	37	2	88474877	88474877	+	Silent	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88474877C>A	uc002ssz.3	+	4	681	c.528C>A	c.(526-528)CTC>CTA	p.L176L	THNSL2_uc002ssv.2_RNA|THNSL2_uc002ssw.3_Silent_p.L176L|THNSL2_uc002ssx.3_Silent_p.L144L|THNSL2_uc002sta.3_Silent_p.L18L|THNSL2_uc002ssy.3_Silent_p.L176L|THNSL2_uc010fhe.2_Silent_p.L18L	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2	176					threonine biosynthetic process		threonine synthase activity			ovary(1)	1						TTCAGGAGCTCCAGATGACAA	0.522													20	80	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89986898	89986898	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89986898G>T	uc010fhm.2	+						uc002stn.1_RNA					Parts of antibodies, mostly variable regions.																		TATTTGTATTGGTACCTGCAG	0.557													14	82	---	---	---	---	PASS
ZNF514	84874	broad.mit.edu	37	2	95815590	95815590	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95815590G>A	uc002sue.1	-	5	1014	c.640C>T	c.(640-642)CAC>TAC	p.H214Y	ZNF514_uc002sud.1_Missense_Mutation_p.H287Y	NM_032788	NP_116177	Q96K75	ZN514_HUMAN	zinc finger protein 514	214	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GACTGGAAGTGAAAGGACTTC	0.448													64	313	---	---	---	---	PASS
GPAT2	150763	broad.mit.edu	37	2	96690252	96690252	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96690252T>C	uc002svf.2	-	15	1815	c.1592A>G	c.(1591-1593)CAG>CGG	p.Q531R	GPAT2_uc002svd.2_Missense_Mutation_p.Q350R|GPAT2_uc002sve.2_Missense_Mutation_p.Q333R|GPAT2_uc002svg.2_Missense_Mutation_p.Q410R|GPAT2_uc010yuh.1_Missense_Mutation_p.Q460R|GPAT2_uc002svh.2_Missense_Mutation_p.Q531R	NM_207328	NP_997211	Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2,	531					glycerol-3-phosphate metabolic process|phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity				0						TGGGCCAGGCTGCGGCACCAC	0.677													44	177	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125660566	125660566	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125660566C>A	uc002tno.2	+	22	3905	c.3541C>A	c.(3541-3543)CGC>AGC	p.R1181S	CNTNAP5_uc010flu.2_Missense_Mutation_p.R1182S	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1181	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGCTGCCCTGCGCCATGCCAC	0.537													10	27	---	---	---	---	PASS
AMMECR1L	83607	broad.mit.edu	37	2	128628485	128628485	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128628485C>A	uc002tpl.2	-	5	787	c.536G>T	c.(535-537)CGA>CTA	p.R179L	AMMECR1L_uc002tpm.2_Missense_Mutation_p.R179L	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like	179	AMMECR1.									central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		GGGGGGAAATCGGCTGTCCTT	0.517													6	36	---	---	---	---	PASS
PLA2R1	22925	broad.mit.edu	37	2	160803951	160803951	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160803951G>C	uc002ube.1	-	26	4036	c.3829C>G	c.(3829-3831)CAT>GAT	p.H1277D	PLA2R1_uc010zcp.1_Missense_Mutation_p.H1277D|PLA2R1_uc002ubf.2_Missense_Mutation_p.H1277D	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	1277	Extracellular (Potential).|C-type lectin 8.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						CAAAATTCATGAGCAGCCTCA	0.348													26	121	---	---	---	---	PASS
PLA2R1	22925	broad.mit.edu	37	2	160824165	160824165	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160824165G>A	uc002ube.1	-	20	2996	c.2789C>T	c.(2788-2790)TCA>TTA	p.S930L	PLA2R1_uc010zcp.1_Missense_Mutation_p.S930L|PLA2R1_uc002ubf.2_Missense_Mutation_p.S930L	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	930	Extracellular (Potential).|C-type lectin 5.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						CATAGAAACTGAACACTCTTC	0.408													28	130	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163241255	163241255	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163241255C>T	uc002uch.1	-	13	3117	c.2905G>A	c.(2905-2907)GAA>AAA	p.E969K		NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	969	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	GGCACTGTTTCTTCAAAATCG	0.433													43	235	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164467850	164467850	+	Silent	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164467850T>A	uc002uck.1	-	3	803	c.492A>T	c.(490-492)TCA>TCT	p.S164S		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	164						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						AGGTACTACTTGAATAACTAG	0.507													10	71	---	---	---	---	PASS
PPIG	9360	broad.mit.edu	37	2	170488434	170488434	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170488434A>T	uc002uez.2	+	11	1140	c.920A>T	c.(919-921)GAA>GTA	p.E307V	PPIG_uc010fpx.2_Missense_Mutation_p.E292V|PPIG_uc010fpy.2_Missense_Mutation_p.E300V|PPIG_uc002ufa.2_Missense_Mutation_p.E307V|PPIG_uc002ufb.2_Missense_Mutation_p.E307V|PPIG_uc002ufd.2_Missense_Mutation_p.E304V	NM_004792	NP_004783	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G	307					protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)	agagaaagggaaagagagTGG	0.239													10	43	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179599307	179599307	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179599307C>G	uc010zfg.1	-	49	11736	c.11512G>C	c.(11512-11514)GAG>CAG	p.E3838Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E499Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4765							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGCAGGCTCAAGAGTTTTG	0.363													24	137	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179600714	179600714	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179600714C>A	uc010zfg.1	-	47	10951	c.10727G>T	c.(10726-10728)GGG>GTG	p.G3576V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G237V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4503							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACAGGAGTCCCTGTCACTGT	0.453													30	86	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179611982	179611982	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179611982C>T	uc002unb.2	-	46	15369	c.15145G>A	c.(15145-15147)GAA>AAA	p.E5049K	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	1153							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTATCTTTCTCCTACCTCA	0.483													24	96	---	---	---	---	PASS
CWC22	57703	broad.mit.edu	37	2	180817210	180817210	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180817210C>G	uc010frh.1	-	17	2105	c.1805G>C	c.(1804-1806)AGA>ACA	p.R602T	CWC22_uc002uno.2_Missense_Mutation_p.R124T|CWC22_uc002unp.2_Missense_Mutation_p.R602T	NM_020943	NP_065994	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein homolog	602						catalytic step 2 spliceosome	protein binding|RNA binding				0						ATCCTTTAATCTTGCATTAAG	0.358													2	12	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187626263	187626263	+	Silent	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187626263C>A	uc002ups.2	+	8	1306	c.1194C>A	c.(1192-1194)CTC>CTA	p.L398L	FAM171B_uc002upr.1_Silent_p.L398L|FAM171B_uc002upt.2_5'Flank	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	398	Cytoplasmic (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						TTGAGGTCCTCAAGAGAGACC	0.358													59	270	---	---	---	---	PASS
ANKRD44	91526	broad.mit.edu	37	2	197870509	197870509	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197870509C>T	uc002uua.1	-	21	2258	c.2181G>A	c.(2179-2181)CTG>CTA	p.L727L	ANKRD44_uc002utz.3_Silent_p.L459L	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	752	ANK 22.						protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCAGCTCGCTCAGCCACGTGG	0.527													54	296	---	---	---	---	PASS
RQCD1	9125	broad.mit.edu	37	2	219445385	219445385	+	Silent	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219445385A>T	uc010zkh.1	+	2	126	c.126A>T	c.(124-126)CTA>CTT	p.L42L	RQCD1_uc002vih.1_Silent_p.L42L|RQCD1_uc010zki.1_Silent_p.L42L	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog	42					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCTGGAGCTAAGTAAGAAGC	0.463													20	103	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220337643	220337643	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220337643C>T	uc010fwg.2	+	16	3972	c.3972C>T	c.(3970-3972)CAC>CAT	p.H1324H		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1324	Fibronectin type-III 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CAGTGCAGCACCAGGTGCTGG	0.667													8	126	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225729638	225729638	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225729638G>C	uc010fwz.1	-	12	1663	c.1424C>G	c.(1423-1425)TCA>TGA	p.S475*	DOCK10_uc002vob.2_Nonsense_Mutation_p.S469*|DOCK10_uc002vod.1_Nonsense_Mutation_p.S475*	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	475							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGGTTCTTCTGATTGTCTTGG	0.448													33	367	---	---	---	---	PASS
SLC16A14	151473	broad.mit.edu	37	2	230923839	230923839	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230923839G>C	uc002vqd.1	-	2	593	c.230C>G	c.(229-231)TCC>TGC	p.S77C	FBXO36_uc010fxi.1_Intron|SLC16A14_uc002vqe.2_Missense_Mutation_p.S77C|SLC16A14_uc002vqf.2_Missense_Mutation_p.S77C	NM_152527	NP_689740	Q7RTX9	MOT14_HUMAN	solute carrier family 16 (monocarboxylic acid	77	Helical; (Potential).					integral to membrane|plasma membrane	symporter activity			ovary(4)|skin(2)	6		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CATGCTGAGGGAGCTGACCCA	0.527													8	102	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1363468	1363468	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1363468C>G	uc003boz.2	+	8	1163	c.896C>G	c.(895-897)GCA>GGA	p.A299G	CNTN6_uc011asj.1_Missense_Mutation_p.A227G|CNTN6_uc003bpa.2_Missense_Mutation_p.A299G	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	299	Ig-like C2-type 3.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GAGTGCATTGCAAGCAACCTT	0.408													32	161	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9786684	9786684	+	Intron	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9786684C>T	uc003bse.2	+						BRPF1_uc003bsf.2_Intron|BRPF1_uc003bsg.2_Intron|BRPF1_uc011ati.1_Intron	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1						histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					CCCTTCCCTTCAACCAAGACT	0.532													23	83	---	---	---	---	PASS
WNT7A	7476	broad.mit.edu	37	3	13921278	13921278	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13921278G>C	uc003bye.1	-	1	341	c.36C>G	c.(34-36)CTC>CTG	p.L12L		NM_004625	NP_004616	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family,	12					activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3						GGCTGAGAAAGAGGTGGCCCA	0.493													14	50	---	---	---	---	PASS
LAMB2	3913	broad.mit.edu	37	3	49161171	49161171	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49161171C>G	uc003cwe.2	-	24	4086	c.3787G>C	c.(3787-3789)GAG>CAG	p.E1263Q	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1263	Domain II.|Potential.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGCAGCTCCTCTGTGGCCTCC	0.617													36	106	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65425633	65425633	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65425633C>T	uc003dmn.2	-	9	1717	c.1191G>A	c.(1189-1191)AAG>AAA	p.K397K	MAGI1_uc003dmm.2_Silent_p.K397K|MAGI1_uc003dmo.2_Silent_p.K397K|MAGI1_uc003dmp.2_Silent_p.K397K|MAGI1_uc010hny.2_Silent_p.K282K	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	397					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CAAGCTGCTTCTTCCGTTTGG	0.323											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	87	---	---	---	---	PASS
OR5H2	79310	broad.mit.edu	37	3	98002374	98002374	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98002374A>G	uc003dsj.1	+	1	643	c.643A>G	c.(643-645)ACC>GCC	p.T215A		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						TCAGGTATTCACCATTGTGAC	0.348													18	76	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108175640	108175640	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108175640C>G	uc003dxa.1	-	20	2228	c.2171G>C	c.(2170-2172)CGA>CCA	p.R724P		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	724	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						ATACTGCAGTCGGTTTGGAAA	0.443													62	214	---	---	---	---	PASS
C3orf27	23434	broad.mit.edu	37	3	128292266	128292266	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128292266G>C	uc003ekq.2	-	3	1274	c.307C>G	c.(307-309)CTG>GTG	p.L103V		NM_007354	NP_031380	O15544	GR6_HUMAN	putative GR6 protein	103											0				GBM - Glioblastoma multiforme(114;0.176)		TGGCACAGCAGAGTCCTGGCA	0.577													34	170	---	---	---	---	PASS
NUDT16	131870	broad.mit.edu	37	3	131100970	131100970	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131100970G>A	uc003eof.2	+	2	161	c.120G>A	c.(118-120)CTG>CTA	p.L40L	uc003eoc.1_5'Flank|NUDT16_uc011bln.1_Silent_p.L27L|NUDT16_uc003eog.1_Silent_p.L40L	NM_152395	NP_689608	Q96DE0	NUD16_HUMAN	nudix-type motif 16	73	Nudix box.|Nudix hydrolase.					nucleolus|nucleoplasm	hydrolase activity|metal ion binding|RNA binding				0						AGGACGGGCTGAACCGCGAGC	0.692													21	136	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147114180	147114180	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147114180C>A	uc003ewd.1	-	3	420	c.147G>T	c.(145-147)GAG>GAT	p.E49D	ZIC4_uc003ewc.1_5'UTR|ZIC4_uc011bno.1_Missense_Mutation_p.E99D	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	49						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						CCTGGGGAGGCTCCTCGTGGA	0.687													21	73	---	---	---	---	PASS
CPA3	1359	broad.mit.edu	37	3	148583347	148583347	+	Intron	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148583347G>A	uc003ewm.2	+							NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor						proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TAAGCATTTAGAGGGATATTT	0.408													25	99	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151072956	151072956	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151072956C>G	uc003eyp.2	+	16	2379	c.2341C>G	c.(2341-2343)CCA>GCA	p.P781A	MED12L_uc011bnz.1_Missense_Mutation_p.P641A|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_5'Flank	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	781					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GGAGACATTTCCAACACTGGA	0.378													19	130	---	---	---	---	PASS
GFM1	85476	broad.mit.edu	37	3	158363948	158363948	+	Intron	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158363948G>A	uc003fce.2	+						GFM1_uc003fcd.2_Intron|GFM1_uc003fcf.2_Intron|GFM1_uc003fcg.2_5'Flank	NM_024996	NP_079272	Q96RP9	EFGM_HUMAN	G elongation factor, mitochondrial 1 precursor						mitochondrial translational elongation	mitochondrion	GTP binding|GTPase activity|translation elongation factor activity			ovary(3)|central_nervous_system(1)	4			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CTGTGCTTGTGTTTAGGTGAA	0.368													32	145	---	---	---	---	PASS
SAMD7	344658	broad.mit.edu	37	3	169644860	169644860	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169644860G>T	uc003fgd.2	+	6	1077	c.810G>T	c.(808-810)CTG>CTT	p.L270L	SAMD7_uc003fge.2_Silent_p.L270L|SAMD7_uc011bpo.1_Silent_p.L171L	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	270										skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			CCACTACCCTGAAAGCAAAGG	0.532													5	224	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	G	G	rs121913279		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952085A>G	uc003fjk.2	+	21	3297	c.3140A>G	c.(3139-3141)CAT>CGT	p.H1047R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1047	PI3K/PI4K.		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATGATGCACATCATGGTGGC	0.378	H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			50	105	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179525455	179525455	+	Intron	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179525455A>G	uc003fki.1	-						PEX5L_uc011bqd.1_Intron|PEX5L_uc011bqe.1_Intron|PEX5L_uc011bqf.1_Intron|PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CTGTTGCTGTACTTCACCTGT	0.507													68	437	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	183041140	183041140	+	Splice_Site	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183041140C>A	uc003fli.1	-	6	577	c.487_splice	c.e6-1	p.I163_splice	MCF2L2_uc003flj.1_Splice_Site_p.I163_splice|MCF2L2_uc003flp.1_Splice_Site_p.I198_splice	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CCATGATGATCTGTAAGGTAA	0.338													38	148	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192516700	192516700	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192516700G>C	uc011bsp.1	-	2	1272	c.951C>G	c.(949-951)ATC>ATG	p.I317M		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	317											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		GCAGTTTAATGATGATGGCTT	0.557													20	92	---	---	---	---	PASS
WHSC1	7468	broad.mit.edu	37	4	1957923	1957923	+	Intron	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1957923G>A	uc003gdz.3	+						WHSC1_uc003geb.3_Intron|WHSC1_uc003gec.3_Intron|WHSC1_uc003ged.3_Intron|WHSC1_uc003gee.3_Intron|WHSC1_uc003gef.3_Intron|WHSC1_uc003gei.3_Intron|WHSC1_uc011bvh.1_Intron|WHSC1_uc010icf.2_Intron	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		ACGGTACGGAGATATTCAGAT	0.473			T	IGH@	MM								31	125	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3230464	3230464	+	Silent	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3230464C>G	uc011bvq.1	+	59	8122	c.7977C>G	c.(7975-7977)GTC>GTG	p.V2659V		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	2657					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CGTCTCCAGTCAACTCCAGGT	0.383													24	114	---	---	---	---	PASS
ACOX3	8310	broad.mit.edu	37	4	8416093	8416093	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8416093C>A	uc010idk.2	-	5	614	c.469G>T	c.(469-471)GCT>TCT	p.A157S	ACOX3_uc003glc.3_Missense_Mutation_p.A157S|ACOX3_uc003gld.3_Missense_Mutation_p.A157S|ACOX3_uc003gle.1_Missense_Mutation_p.A62S	NM_003501	NP_003492	O15254	ACOX3_HUMAN	acyl-Coenzyme A oxidase 3 isoform a	157					bile acid metabolic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|pristanoyl-CoA oxidase activity			central_nervous_system(1)	1						TCGGTCAGAGCAAAACATCCA	0.468													4	117	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13604368	13604368	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13604368G>C	uc003gmz.1	-	10	4273	c.4156C>G	c.(4156-4158)CTT>GTT	p.L1386V	BOD1L_uc010idr.1_Missense_Mutation_p.L723V	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1386							DNA binding			ovary(5)|breast(1)	6						TTACTTCCAAGAGGCATGATT	0.408													4	138	---	---	---	---	PASS
C1QTNF7	114905	broad.mit.edu	37	4	15437466	15437466	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15437466C>T	uc011bxb.1	+	2	326	c.99C>T	c.(97-99)ATC>ATT	p.I33I	C1QTNF7_uc003gno.2_Silent_p.I40I|C1QTNF7_uc003gnp.2_Silent_p.I33I	NM_001135171	NP_001128643	Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	33						collagen					0						CCAGGTATATCTGCAGCATTC	0.542													18	60	---	---	---	---	PASS
KIAA1211	57482	broad.mit.edu	37	4	57194534	57194534	+	3'UTR	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57194534C>T	uc003hbk.2	+	11					KIAA1211_uc010iha.2_3'UTR	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					TCTTAGTTTTCATGAGTTTTC	0.443													34	220	---	---	---	---	PASS
UGT2B15	7366	broad.mit.edu	37	4	69519750	69519750	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69519750C>G	uc011cal.1	-							NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor						steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						AACTGTAATACTCACACAGGG	0.378													45	224	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	74005638	74005638	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74005638G>T	uc003hgp.2	-	15	2812	c.2695C>A	c.(2695-2697)CAG>AAG	p.Q899K	ANKRD17_uc003hgo.2_Missense_Mutation_p.Q786K|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Missense_Mutation_p.Q899K|ANKRD17_uc011cbd.1_Missense_Mutation_p.Q464K	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	899	Gln-rich.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGCTGTTGCTGAAGTTGAATT	0.438													32	210	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76805905	76805905	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76805905G>A	uc003hix.2	-	8	945	c.588C>T	c.(586-588)CTC>CTT	p.L196L	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Silent_p.L196L	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	196	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTGGCGACGGGAGGCCATTCT	0.433													55	297	---	---	---	---	PASS
BMP2K	55589	broad.mit.edu	37	4	79782588	79782588	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79782588G>A	uc003hlk.2	+	9	1199	c.1033G>A	c.(1033-1035)GAA>AAA	p.E345K	BMP2K_uc010ijl.1_RNA|BMP2K_uc003hlj.2_Missense_Mutation_p.E345K	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	345						nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						GACTGCTAGTGAAGCAGCTGC	0.294													5	23	---	---	---	---	PASS
PPM1K	152926	broad.mit.edu	37	4	89199700	89199700	+	Silent	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89199700A>G	uc003hrm.3	-	2	426	c.36T>C	c.(34-36)AGT>AGC	p.S12S	PPM1K_uc010ikp.1_Silent_p.S12S|PPM1K_uc003hrn.2_Silent_p.S12S	NM_152542	NP_689755	Q8N3J5	PPM1K_HUMAN	protein phosphatase 1K (PP2C domain containing)	12					protein dephosphorylation	mitochondrial matrix|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		GGTTCCCACCACTTCTGACCA	0.517													12	68	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96761311	96761311	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761311G>A	uc003htr.3	+	1	73	c.10G>A	c.(10-12)GCC>ACC	p.A4T		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	4					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	TATGCTGGCCGCCTTCATCTC	0.587													6	57	---	---	---	---	PASS
BANK1	55024	broad.mit.edu	37	4	102965044	102965044	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102965044G>A	uc003hvy.3	+	11	2223	c.1949G>A	c.(1948-1950)TGT>TAT	p.C650Y	BANK1_uc003hvx.3_Missense_Mutation_p.C635Y|BANK1_uc010ill.2_Missense_Mutation_p.C517Y|BANK1_uc003hvz.3_Missense_Mutation_p.C620Y	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	650					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GACAAGTTCTGTGGTCTTCCT	0.313													33	139	---	---	---	---	PASS
NHEDC2	133308	broad.mit.edu	37	4	103971519	103971519	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103971519G>T	uc003hwx.3	-	5	1335	c.463C>A	c.(463-465)CTC>ATC	p.L155I	NHEDC2_uc010iln.1_Missense_Mutation_p.L7I|NHEDC2_uc003hwy.2_Missense_Mutation_p.L155I|NHEDC2_uc011cew.1_Missense_Mutation_p.L98I|NHEDC2_uc011cex.1_Missense_Mutation_p.L98I|NHEDC2_uc011cey.1_Missense_Mutation_p.L98I	NM_178833	NP_849155	Q86UD5	NHDC2_HUMAN	Na+/H+ exchanger domain containing 2	155	Helical; (Potential).				sodium ion transport	integral to membrane|mitochondrial membrane	solute:hydrogen antiporter activity				0				OV - Ovarian serous cystadenocarcinoma(123;2.3e-08)		TTTCTGATGAGAAACCCTGCA	0.368													14	72	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104032074	104032074	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104032074C>T	uc003hxb.1	-	47	7725	c.7635G>A	c.(7633-7635)TTG>TTA	p.L2545L	CENPE_uc003hxc.1_Silent_p.L2424L	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	2545	Potential.|Globular autoinhibitory domain (By similarity).				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GTTCACTTTTCAAAATAAGAG	0.348													32	167	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113483616	113483616	+	Silent	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113483616A>G	uc003iau.2	-	18	4819	c.4608T>C	c.(4606-4608)TGT>TGC	p.C1536C	C4orf21_uc003iav.2_RNA|C4orf21_uc003iat.2_5'Flank	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	358						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TGCTAGCATTACAAACCAATA	0.363													7	14	---	---	---	---	PASS
UGT8	7368	broad.mit.edu	37	4	115585244	115585244	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115585244A>G	uc003ibs.2	+	3	1438	c.916A>G	c.(916-918)AAC>GAC	p.N306D	UGT8_uc003ibt.2_Missense_Mutation_p.N306D|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	306					central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		AGACATTGCTAACAAACTGGC	0.403													10	168	---	---	---	---	PASS
BBS7	55212	broad.mit.edu	37	4	122780234	122780234	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122780234G>C	uc003ied.2	-	5	615	c.441C>G	c.(439-441)ATC>ATG	p.I147M	BBS7_uc003iee.1_Missense_Mutation_p.I147M	NM_176824	NP_789794	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7 protein isoform a	147					cilium morphogenesis|digestive tract morphogenesis|fat cell differentiation|heart looping|melanosome transport|pigment granule aggregation in cell center|response to stimulus|visual perception	BBSome|centrosome|cilium membrane	protein binding			ovary(1)	1						TCACATCATTGATTTTATCCC	0.418									Bardet-Biedl_syndrome				39	206	---	---	---	---	PASS
IL21	59067	broad.mit.edu	37	4	123542124	123542124	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123542124G>A	uc003ies.2	-	1	88	c.43C>T	c.(43-45)CTG>TTG	p.L15L	uc003iet.2_RNA|IL21_uc010int.2_Silent_p.L8L	NM_021803	NP_068575	Q9HBE4	IL21_HUMAN	interleukin 21	8					cell maturation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-17 production|positive regulation of T cell proliferation|signal transduction	extracellular space	cytokine activity|interleukin-2 receptor binding				0						ATGACCATCAGACAGATGACA	0.448													10	128	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126241565	126241565	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126241565C>T	uc003ifj.3	+	1	3999	c.3999C>T	c.(3997-3999)CTC>CTT	p.L1333L		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1333	Cadherin 13.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TTGGTGAACTCGTGTCCTCTG	0.358													17	213	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169197295	169197295	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169197295C>T	uc003irp.2	-	15	2308	c.2016G>A	c.(2014-2016)GTG>GTA	p.V672V		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	672							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TCCTTTTCATCACCTGAACAG	0.318													14	81	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175899051	175899051	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175899051C>G	uc003iuc.2	+	5	3045	c.2375C>G	c.(2374-2376)CCT>CGT	p.P792R	ADAM29_uc003iud.2_Missense_Mutation_p.P792R|ADAM29_uc010irr.2_Missense_Mutation_p.P792R|ADAM29_uc011cki.1_Missense_Mutation_p.P792R	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	792	Cytoplasmic (Potential).|6.|9 X 9 AA approximate repeats.				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CAGTTGACGCCTTCCCAGAGT	0.572													38	204	---	---	---	---	PASS
WWC2	80014	broad.mit.edu	37	4	184182146	184182146	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184182146G>C	uc010irx.2	+	11	1552	c.1370G>C	c.(1369-1371)AGC>ACC	p.S457T	WWC2_uc003ivk.3_Missense_Mutation_p.S252T|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_Missense_Mutation_p.S139T|WWC2_uc003ivn.3_Missense_Mutation_p.S21T	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	457	Ser-rich.									ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		AACACCTCCAGCAGAGGGTCA	0.512													11	51	---	---	---	---	PASS
KLKB1	3818	broad.mit.edu	37	4	187173027	187173027	+	Intron	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187173027C>T	uc003iyy.2	+						KLKB1_uc011clc.1_Intron|KLKB1_uc011cld.1_Intron	NM_000892	NP_000883	P03952	KLKB1_HUMAN	plasma kallikrein B1 precursor						blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(1)	1		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		TGAGTAACCTCACTTTTTCGT	0.438													39	157	---	---	---	---	PASS
LRRC14B	389257	broad.mit.edu	37	5	195364	195364	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:195364G>T	uc003jal.1	+	2	1469	c.1441G>T	c.(1441-1443)GAC>TAC	p.D481Y		NM_001080478	NP_001073947	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	481										skin(1)	1						TGGAAGTTTTGACCCAGACAT	0.498													30	243	---	---	---	---	PASS
NSUN2	54888	broad.mit.edu	37	5	6602600	6602600	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6602600G>A	uc003jdu.2	-	18	2036	c.1971C>T	c.(1969-1971)ATC>ATT	p.I657I	NSUN2_uc003jds.2_Silent_p.I103I|NSUN2_uc003jdt.2_Silent_p.I421I|NSUN2_uc011cmk.1_Silent_p.I622I|NSUN2_uc003jdv.2_Silent_p.I421I	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	657						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						ACTTCAGCACGATGCTTCCCT	0.478													198	447	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14485175	14485175	+	Intron	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14485175A>T	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					TTTTTTTTTTAAGGTGAGTTG	0.234													5	164	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33534985	33534985	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33534985G>T	uc003jia.1	-	23	4722	c.4559C>A	c.(4558-4560)CCT>CAT	p.P1520H	ADAMTS12_uc010iuq.1_Missense_Mutation_p.P1435H	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1520	TSP type-1 8.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						GAATTCTGGAGGTCTGGGTTT	0.483										HNSCC(64;0.19)			68	155	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37201803	37201803	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37201803G>T	uc011cpa.1	-	19	3628	c.3397C>A	c.(3397-3399)CTG>ATG	p.L1133M	C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.L208M|C5orf42_uc011cpb.1_Missense_Mutation_p.L14M	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1133										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GAGTCTATCAGAAGTTGAAAT	0.448													31	205	---	---	---	---	PASS
HMGCS1	3157	broad.mit.edu	37	5	43299062	43299062	+	Silent	SNP	A	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43299062A>C	uc003jnr.3	-	3	213	c.6T>G	c.(4-6)CCT>CCG	p.P2P	HMGCS1_uc003jnq.3_Silent_p.P2P	NM_001098272	NP_001091742	Q01581	HMCS1_HUMAN	hydroxymethylglutaryl-CoA synthase 1	2					cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0						GAAGTGATCCAGGCATGGTGA	0.358													24	170	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43536991	43536991	+	Missense_Mutation	SNP	C	T	T	rs140543083		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43536991C>T	uc003job.2	-	6	1149	c.902G>A	c.(901-903)CGA>CAA	p.R301Q	PAIP1_uc003joa.2_Missense_Mutation_p.R222Q|PAIP1_uc010ivp.2_Missense_Mutation_p.R222Q|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Missense_Mutation_p.R189Q	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	301	MIF4G.				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					CAGCAATTCTCGAAGACCAAC	0.323													22	71	---	---	---	---	PASS
MOCS2	4338	broad.mit.edu	37	5	52404424	52404424	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52404424G>A	uc011cqf.1	-	2	107	c.68C>T	c.(67-69)TCA>TTA	p.S23L	MOCS2_uc003joz.2_5'UTR|uc003jpb.1_5'Flank	NM_176806	NP_789776	O96033	MOC2A_HUMAN	molybdopterin synthase small subunit MOCS2A	23					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex	nucleotide binding				0		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				AATGGTCTCTGAACGAACTCC	0.358													19	92	---	---	---	---	PASS
CDC20B	166979	broad.mit.edu	37	5	54420686	54420686	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54420686C>T	uc003jpo.1	-	9	1335	c.1160G>A	c.(1159-1161)GGT>GAT	p.G387D	CDC20B_uc003jpn.1_Missense_Mutation_p.G387D|CDC20B_uc010ivu.1_Missense_Mutation_p.G387D|CDC20B_uc010ivv.1_3'UTR	NM_152623	NP_689836	Q86Y33	CD20B_HUMAN	CDC20 cell division cycle 20 homolog B isoform	387	WD 4.										0		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			TGCACTGGCACCTGGATCGTG	0.542													22	102	---	---	---	---	PASS
PDE4D	5144	broad.mit.edu	37	5	58272239	58272239	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58272239C>T	uc003jsa.2	-	13	1940	c.1768G>A	c.(1768-1770)GAA>AAA	p.E590K	PDE4D_uc003jrx.2_Missense_Mutation_p.E454K|PDE4D_uc003jry.2_Missense_Mutation_p.E288K|PDE4D_uc003jrz.2_Missense_Mutation_p.E526K|PDE4D_uc003jsb.2_Missense_Mutation_p.E529K|PDE4D_uc003jrt.2_Missense_Mutation_p.E288K|PDE4D_uc003jru.2_Missense_Mutation_p.E366K|PDE4D_uc003jrv.2_Missense_Mutation_p.E460K|PDE4D_uc003jrw.2_Missense_Mutation_p.E468K|PDE4D_uc003jrs.2_Missense_Mutation_p.E299K	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1	590					signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	TTCTTAGTTTCAACCATAGTC	0.353													7	16	---	---	---	---	PASS
PPWD1	23398	broad.mit.edu	37	5	64859172	64859172	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64859172G>A	uc003jtv.3	+	1	42	c.35G>A	c.(34-36)AGA>AAA	p.R12K	PPWD1_uc011cqv.1_5'UTR|PPWD1_uc011cqw.1_5'UTR|CENPK_uc003jts.2_5'Flank|CENPK_uc003jtt.2_5'Flank|CENPK_uc003jtu.2_5'Flank	NM_015342	NP_056157	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat	12	Poly-Arg.				protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		TTTCAGCAGAGACGTAGAAGG	0.567													19	116	---	---	---	---	PASS
NLN	57486	broad.mit.edu	37	5	65073347	65073347	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65073347G>C	uc003juf.2	+	4	660	c.544G>C	c.(544-546)GAA>CAA	p.E182Q	NLN_uc003jue.2_Missense_Mutation_p.E182Q|NLN_uc003jug.2_Missense_Mutation_p.E11Q	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor	182					proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		CCATCTTCCTGAACAAGTACA	0.289													24	122	---	---	---	---	PASS
REEP5	7905	broad.mit.edu	37	5	112257809	112257809	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112257809C>T	uc003kqe.1	-	1	223	c.79G>A	c.(79-81)GAG>AAG	p.E27K	REEP5_uc011cvw.1_5'Flank|REEP5_uc011cvx.1_RNA|REEP5_uc011cvy.1_Missense_Mutation_p.E27K|REEP5_uc011cvz.1_RNA	NM_005669	NP_005660	Q00765	REEP5_HUMAN	receptor accessory protein 5	27						integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		GTTTTGGCCTCGAGCTTGGCC	0.677													6	61	---	---	---	---	PASS
SNX2	6643	broad.mit.edu	37	5	122137637	122137637	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122137637C>G	uc003kte.2	+						SNX2_uc011cwn.1_Intron	NM_003100	NP_003091	O60749	SNX2_HUMAN	sorting nexin 2						cell communication|endocytosis|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding|protein transporter activity			kidney(1)	1		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		GTTGGTGAGTCAATACTTATT	0.249													20	79	---	---	---	---	PASS
SLC27A6	28965	broad.mit.edu	37	5	128364138	128364138	+	Intron	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128364138A>G	uc003kuy.2	+						SLC27A6_uc003kuz.2_Intron	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid						long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		TATATCAGGTATAAATATATT	0.338													11	72	---	---	---	---	PASS
ISOC1	51015	broad.mit.edu	37	5	128440953	128440953	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128440953C>G	uc003kva.2	+	3	523	c.505C>G	c.(505-507)CAA>GAA	p.Q169E		NM_016048	NP_057132	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	169						peroxisome	catalytic activity				0		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		GAGCACGGTTCAAGAAATTGA	0.398													4	80	---	---	---	---	PASS
IRF1	3659	broad.mit.edu	37	5	131825175	131825175	+	5'UTR	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131825175G>C	uc003kxa.2	-	2					IRF1_uc003kxd.2_Intron|IRF1_uc003kxb.2_5'UTR|IRF1_uc010jdt.1_5'UTR	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1						blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		GGGCATGTTGGCTGTAAAGAG	0.517													24	108	---	---	---	---	PASS
CXCL14	9547	broad.mit.edu	37	5	134914177	134914177	+	Silent	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134914177C>G	uc003lay.2	-	2	618	c.153G>C	c.(151-153)GTG>GTC	p.V51V		NM_004887	NP_004878	O95715	CXL14_HUMAN	small inducible cytokine B14 precursor	51					cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCAGCTTCTTCACGTCGCTGT	0.592													7	316	---	---	---	---	PASS
BRD8	10902	broad.mit.edu	37	5	137501561	137501561	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137501561C>G	uc003lcf.1	-	11	1289	c.1234G>C	c.(1234-1236)GAT>CAT	p.D412H	BRD8_uc003lcc.1_RNA|BRD8_uc011cyl.1_Missense_Mutation_p.D191H|BRD8_uc003lcg.2_Missense_Mutation_p.D485H|BRD8_uc003lci.2_Missense_Mutation_p.D415H|BRD8_uc003lch.2_Missense_Mutation_p.D306H|BRD8_uc011cym.1_Missense_Mutation_p.D396H|BRD8_uc010jer.1_Missense_Mutation_p.D381H|BRD8_uc011cyn.1_Missense_Mutation_p.D371H	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	412					cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GTCTCAAAATCCAGCTCTTCA	0.463													16	141	---	---	---	---	PASS
HSPA9	3313	broad.mit.edu	37	5	137904611	137904611	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137904611C>G	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TAAACCCACTCACCTGCAGTC	0.473													47	230	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140236873	140236873	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140236873C>A	uc003lhx.2	+	1	1240	c.1240C>A	c.(1240-1242)CGC>AGC	p.R414S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.R414S|PCDHA10_uc011dad.1_Missense_Mutation_p.R414S	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	414	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTCTGGACCGCGAGAGGGT	0.642													79	444	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140604413	140604413	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140604413G>C	uc003ljb.2	+	1	1336	c.1336G>C	c.(1336-1338)GAC>CAC	p.D446H	PCDHB14_uc011dal.1_Missense_Mutation_p.D293H	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	446	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGACGTCAATGACAACGCCCC	0.582													83	431	---	---	---	---	PASS
PCDHB15	56121	broad.mit.edu	37	5	140626581	140626581	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140626581G>T	uc003lje.2	+	1	1435	c.1435G>T	c.(1435-1437)GAC>TAC	p.D479Y		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	479	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACAGACAGAGACTCGGGCAC	0.657													60	205	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140711217	140711217	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140711217G>T	uc003lji.1	+	1	966	c.966G>T	c.(964-966)CAG>CAT	p.Q322H	PCDHGA1_uc011dan.1_Missense_Mutation_p.Q322H	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	322	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAAGCCCAGGATGGTGCGG	0.398													41	182	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140736427	140736427	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140736427G>T	uc003ljq.1	+	1	1660	c.1660G>T	c.(1660-1662)GAC>TAC	p.D554Y	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Missense_Mutation_p.D554Y	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	554	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGTGCTGGACCAGAACGA	0.572													80	443	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741050	140741050	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741050C>A	uc003ljs.1	+	1	1348	c.1348C>A	c.(1348-1350)CCA>ACA	p.P450T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.P450T|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	450	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGATAATGCCCCAGTTTTCCA	0.552													67	307	---	---	---	---	PASS
TCERG1	10915	broad.mit.edu	37	5	145863154	145863154	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145863154C>T	uc003lob.2	+	14	2114	c.2074C>T	c.(2074-2076)CCC>TCC	p.P692S	TCERG1_uc003loc.2_Missense_Mutation_p.P671S	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1	692	FF 1.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGTTTTTGATCCCCGGTACTT	0.328													8	65	---	---	---	---	PASS
HTR4	3360	broad.mit.edu	37	5	147889510	147889510	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147889510G>T	uc003lpn.2	-	6	749	c.585C>A	c.(583-585)ACC>ACA	p.T195T	HTR4_uc010jgu.1_RNA|HTR4_uc003lpi.1_Silent_p.T195T|HTR4_uc003lpj.1_Silent_p.T195T|HTR4_uc003lpk.2_Silent_p.T195T|HTR4_uc011dby.1_Silent_p.T195T|HTR4_uc003lpl.2_Silent_p.T209T|HTR4_uc003lpm.2_Silent_p.T195T|HTR4_uc010jgv.2_RNA|HTR4_uc003lpo.1_Silent_p.T195T	NM_000870	NP_000861	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform b	195	Helical; Name=5; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	CCACAGAGCAGGTGATGGCGT	0.493													14	60	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167626084	167626084	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167626084G>T	uc010jjd.2	+	16	3100	c.3100G>T	c.(3100-3102)GCC>TCC	p.A1034S	ODZ2_uc003lzr.3_Missense_Mutation_p.A811S|ODZ2_uc003lzt.3_Missense_Mutation_p.A407S|ODZ2_uc010jje.2_Missense_Mutation_p.A305S	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CTTTAGTGCTGCCCCTGGGCA	0.577													8	50	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167645606	167645606	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167645606C>T	uc010jjd.2	+	23	4683	c.4683C>T	c.(4681-4683)GTC>GTT	p.V1561V	ODZ2_uc003lzr.3_Silent_p.V1331V|ODZ2_uc003lzt.3_Silent_p.V934V|ODZ2_uc010jje.2_Silent_p.V825V	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TCAGGGCGGTCAGCAAGAACA	0.483													54	259	---	---	---	---	PASS
CCDC99	54908	broad.mit.edu	37	5	169021691	169021691	+	Intron	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169021691G>C	uc003mae.3	+						CCDC99_uc010jjj.2_Intron|CCDC99_uc011deq.1_Intron|CCDC99_uc010jjk.2_Intron	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	coiled-coil domain containing 99						cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding			ovary(1)|liver(1)	2	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAAGGTATAGAACTTTCACT	0.333													9	64	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170395390	170395390	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170395390C>G	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGGTAGGTTTCTACTAGAGAG	0.323			T	TRD@	ALL								15	34	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170722917	170722917	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170722917G>C	uc003mba.2	+	27	3085	c.3069G>C	c.(3067-3069)TTG>TTC	p.L1023F	RANBP17_uc003mbb.2_Missense_Mutation_p.L348F|RANBP17_uc010jjs.2_RNA	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	1023					mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GAGCAAGTTTGATAAACAGCC	0.527			T	TRD@	ALL								19	131	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180046774	180046774	+	Intron	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180046774C>T	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CTCTCCCTGTCGGGGCAGGGG	0.682									Congenital_Hereditary_Lymphedema				25	143	---	---	---	---	PASS
NEDD9	4739	broad.mit.edu	37	6	11233530	11233530	+	5'Flank	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11233530G>C	uc003mzv.2	-						NEDD9_uc010joz.2_Intron|NEDD9_uc003mzw.3_Intron|NEDD9_uc003mzx.2_5'Flank	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			TAGTGAAAAGGAACCCTCTAG	0.483													35	203	---	---	---	---	PASS
JARID2	3720	broad.mit.edu	37	6	15517468	15517468	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15517468G>A	uc003nbj.2	+	17	3771	c.3527G>A	c.(3526-3528)CGA>CAA	p.R1176Q	JARID2_uc011div.1_Missense_Mutation_p.R1004Q	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	1176					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AAGTCCTGCCGAGGGCTGAAG	0.617													28	197	---	---	---	---	PASS
HIST1H3B	8358	broad.mit.edu	37	6	26032007	26032007	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26032007C>A	uc003nfs.1	-	1	282	c.282G>T	c.(280-282)CAG>CAT	p.Q94H		NM_003537	NP_003528	P68431	H31_HUMAN	histone cluster 1, H3b	94					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						CACAAGCCTCCTGCAGCGCCA	0.557													25	158	---	---	---	---	PASS
OR11A1	26531	broad.mit.edu	37	6	29394932	29394932	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29394932G>T	uc003nmg.2	-	1	578	c.487C>A	c.(487-489)CTG>ATG	p.L163M		NM_013937	NP_039225	Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A,	163	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TGGGCCACCAGGGCCACAACC	0.582													11	61	---	---	---	---	PASS
GABBR1	2550	broad.mit.edu	37	6	29574954	29574954	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29574954G>A	uc003nmt.3	-	17	2370	c.2034C>T	c.(2032-2034)TAC>TAT	p.Y678Y	GABBR1_uc003nmp.3_Silent_p.Y561Y|GABBR1_uc003nms.3_Silent_p.Y561Y|GABBR1_uc003nmu.3_Silent_p.Y616Y|GABBR1_uc011dlr.1_Silent_p.Y501Y	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1	678	Helical; Name=3; (Potential).				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	ACATGGAACCGTAGCCCAGAC	0.562													32	118	---	---	---	---	PASS
DDR1	780	broad.mit.edu	37	6	30856996	30856996	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30856996G>T	uc003nrr.2	+	5	465	c.206G>T	c.(205-207)GGG>GTG	p.G69V	DDR1_uc010jse.2_Missense_Mutation_p.G69V|DDR1_uc003nrq.2_Missense_Mutation_p.G69V|DDR1_uc003nrs.2_Missense_Mutation_p.G69V|DDR1_uc003nrt.2_Missense_Mutation_p.G69V|DDR1_uc011dms.1_Missense_Mutation_p.G87V|DDR1_uc011dmt.1_Missense_Mutation_p.G95V|DDR1_uc003nru.2_Missense_Mutation_p.G69V|DDR1_uc011dmu.1_Missense_Mutation_p.G69V|DDR1_uc003nrv.2_Missense_Mutation_p.G69V|DDR1_uc003nrw.1_5'Flank	NM_013993	NP_054699	Q08345	DDR1_HUMAN	discoidin domain receptor family, member 1	69	Extracellular (Potential).|F5/8 type C.				cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)	AGCAGTGACGGGGATGGGGCC	0.602													71	484	---	---	---	---	PASS
MSH5	4439	broad.mit.edu	37	6	31725965	31725965	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31725965G>A	uc003nwv.1	+	13	1117	c.1038G>A	c.(1036-1038)CTG>CTA	p.L346L	MSH5_uc003nwt.1_Silent_p.L363L|MSH5_uc003nwu.1_Silent_p.L346L|MSH5_uc003nww.1_Silent_p.L346L|MSH5_uc003nwx.1_Silent_p.L363L|MSH5_uc011dof.1_Silent_p.L45L|MSH5_uc003nwy.1_Silent_p.L20L|MSH5_uc003nwz.3_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	346					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						CCCTGGGCCTGAGGGATGCCT	0.567								Direct_reversal_of_damage|MMR					8	66	---	---	---	---	PASS
C2	717	broad.mit.edu	37	6	31868898	31868898	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31868898A>G	uc011dop.1	+	1	123	c.55A>G	c.(55-57)AAC>GAC	p.N19D	C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|ZBTB12_uc003nyd.1_Missense_Mutation_p.F62S	NM_001145903	NP_001139375	P06681	CO2_HUMAN	complement component 2 isoform 2 preproprotein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					complement activation, classical pathway|innate immune response|proteolysis	extracellular space	serine-type endopeptidase activity			ovary(1)|skin(1)	2		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		GTTCAGCAGGAACTGGTCCCG	0.622													29	143	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33626839	33626839	+	Silent	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33626839C>A	uc011drk.1	+	6	789	c.570C>A	c.(568-570)GCC>GCA	p.A190A		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	190	Cytoplasmic (Potential).|MIR 2.				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						CTGTCAATGCCGGGCAGCCTC	0.637													35	255	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33626840	33626840	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33626840G>T	uc011drk.1	+	6	790	c.571G>T	c.(571-573)GGG>TGG	p.G191W		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	191	Cytoplasmic (Potential).|MIR 2.				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						TGTCAATGCCGGGCAGCCTCT	0.632													31	257	---	---	---	---	PASS
KCTD20	222658	broad.mit.edu	37	6	36447401	36447401	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36447401G>C	uc003ome.2	+	5	962	c.571G>C	c.(571-573)GAT>CAT	p.D191H	KCTD20_uc011dtm.1_Missense_Mutation_p.D46H|KCTD20_uc011dtn.1_Intron|KCTD20_uc010jwk.2_Intron|KCTD20_uc011dto.1_Intron	NM_173562	NP_775833	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerisation domain	191	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2						CAATTGTCCTGATGGCATCTC	0.358													4	163	---	---	---	---	PASS
TSPO2	222642	broad.mit.edu	37	6	41010728	41010728	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41010728C>T	uc003opj.2	+	2	305	c.4C>T	c.(4-6)CGG>TGG	p.R2W	UNC5CL_uc010jxe.1_Intron|TSPO2_uc003opk.2_Silent_p.C11C|TSPO2_uc011dub.1_Missense_Mutation_p.R2W	NM_001010873	NP_001010873	Q5TGU0	TSPO2_HUMAN	benzodiazapine receptor (peripheral)-like 1	2					transport	endoplasmic reticulum membrane|integral to membrane	cholesterol binding|receptor activity				0						AAGGTGAATGCGGCTTCAAGG	0.582													4	115	---	---	---	---	PASS
UBR2	23304	broad.mit.edu	37	6	42631065	42631065	+	Silent	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42631065T>C	uc011dur.1	+	32	3606	c.3606T>C	c.(3604-3606)GAT>GAC	p.D1202D	UBR2_uc011dus.1_Silent_p.D847D|UBR2_uc003osh.2_RNA	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	1202	RING-type; atypical.				cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			CGAGCTATGATGTAGAAAACG	0.368													30	112	---	---	---	---	PASS
PTCRA	171558	broad.mit.edu	37	6	42883813	42883813	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42883813C>T	uc003osx.2	+	1	87	c.6C>T	c.(4-6)GCC>GCT	p.A2A	PTCRA_uc011duz.1_5'UTR|PTCRA_uc010jxx.1_Silent_p.A2A|PTCRA_uc010jxy.2_Silent_p.A2A|PTCRA_uc010jxz.2_Silent_p.A2A	NM_138296	NP_612153	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha precursor	2						integral to membrane	receptor activity			ovary(2)	2	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			GGGCCATGGCCGGTACATGGC	0.642													27	123	---	---	---	---	PASS
GPR116	221395	broad.mit.edu	37	6	46836746	46836746	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46836746A>T	uc003oyo.3	-	12	1784	c.1495T>A	c.(1495-1497)TAT>AAT	p.Y499N	GPR116_uc011dwj.1_Missense_Mutation_p.Y54N|GPR116_uc011dwk.1_5'UTR|GPR116_uc003oyp.3_Missense_Mutation_p.Y357N|GPR116_uc003oyq.3_Missense_Mutation_p.Y499N|GPR116_uc010jzi.1_Missense_Mutation_p.Y171N	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	499	Ig-like 3.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			ACCTCATCATAGTTACTCACA	0.373													18	94	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47681722	47681722	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47681722C>G	uc003oza.1	+	6	999	c.741C>G	c.(739-741)ATC>ATG	p.I247M	GPR115_uc003oyz.1_Missense_Mutation_p.I304M|GPR115_uc003ozb.1_Missense_Mutation_p.I245M	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	247	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						GGTTTCACATCAACCATAATA	0.393													16	106	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47682288	47682288	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47682288C>A	uc003oza.1	+	6	1565	c.1307C>A	c.(1306-1308)TCA>TAA	p.S436*	GPR115_uc003oyz.1_Nonsense_Mutation_p.S493*|GPR115_uc003ozb.1_Nonsense_Mutation_p.S434*	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	436	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						ACGGAGATATCATACATGCGT	0.488													57	277	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47682589	47682589	+	Silent	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47682589C>A	uc003oza.1	+	6	1866	c.1608C>A	c.(1606-1608)ATC>ATA	p.I536I	GPR115_uc003oyz.1_Silent_p.I593I|GPR115_uc003ozb.1_Silent_p.I534I	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	536	Helical; Name=4; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	p.I536M(1)		ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						CAGTTGCTATCACAGAGCCAG	0.488													52	207	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47682682	47682682	+	Silent	SNP	C	T	T	rs115968193	byFrequency	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47682682C>T	uc003oza.1	+	6	1959	c.1701C>T	c.(1699-1701)TTC>TTT	p.F567F	GPR115_uc003oyz.1_Silent_p.F624F|GPR115_uc003ozb.1_Silent_p.F565F	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	567	Helical; Name=5; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						TCCCGGCGTTCGTCATTGTGG	0.473													34	146	---	---	---	---	PASS
GPR115	221393	broad.mit.edu	37	6	47682734	47682734	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47682734C>G	uc003oza.1	+	6	2011	c.1753C>G	c.(1753-1755)CAG>GAG	p.Q585E	GPR115_uc003oyz.1_Missense_Mutation_p.Q642E|GPR115_uc003ozb.1_Missense_Mutation_p.Q583E	NM_153838	NP_722580	Q8IZF3	GP115_HUMAN	G-protein coupled receptor 115 precursor	585	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8						TGTCAACACTCAGAGGCCCTC	0.473													27	159	---	---	---	---	PASS
CRISP1	167	broad.mit.edu	37	6	49814356	49814356	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49814356A>T	uc003ozw.2	-	5	391	c.312T>A	c.(310-312)CAT>CAA	p.H104Q	CRISP1_uc003ozx.2_Missense_Mutation_p.H104Q	NM_001131	NP_001122	P54107	CRIS1_HUMAN	acidic epididymal glycoprotein-like 1 isoform 1	104					fusion of sperm to egg plasma membrane	extracellular space					0	Lung NSC(77;0.0358)					AAGATGTCATATGCATATTTT	0.383													27	109	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50682828	50682828	+	Splice_Site	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50682828G>C	uc003paf.2	+	2	552	c.40_splice	c.e2-1	p.I14_splice	TFAP2D_uc011dwt.1_Splice_Site	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1								DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					CTTCCTTCCAGATACGTCACG	0.522													29	143	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52993008	52993008	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52993008C>T	uc003pbp.2	-	6	1516	c.1307G>A	c.(1306-1308)AGA>AAA	p.R436K		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	436						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					TTTGGGTCATCTCAAAGGACA	0.413													57	287	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52998945	52998945	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52998945C>A	uc003pbp.2	-	3	462	c.253G>T	c.(253-255)GAC>TAC	p.D85Y	GCM1_uc010jzr.2_Missense_Mutation_p.D85Y	NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	85	GCM.					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					GCGAGACAGTCGCGGCCGCAC	0.622													29	118	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66204664	66204664	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66204664G>C	uc011dxu.1	-	4	1178	c.640C>G	c.(640-642)CTT>GTT	p.L214V	EYS_uc003peq.2_Missense_Mutation_p.L214V|EYS_uc003per.1_Missense_Mutation_p.L214V|EYS_uc010kaj.1_RNA	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	214	EGF-like 2.				response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						CATGCATCAAGTTCCTGGCAG	0.393													16	37	---	---	---	---	PASS
EEF1A1	1915	broad.mit.edu	37	6	74227747	74227747	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74227747C>G	uc003phi.2	-						EEF1A1_uc003phd.2_Intron|EEF1A1_uc003phe.2_Intron|EEF1A1_uc003phf.2_Intron|EEF1A1_uc003phg.2_Intron|EEF1A1_uc003phh.2_Intron|EEF1A1_uc003phj.2_Intron|EEF1A1_uc003phk.2_Intron|EEF1A1_uc003phl.2_Intron|EEF1A1_uc003phm.1_Intron	NM_001402	NP_001393	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha							cytosol|eukaryotic translation elongation factor 1 complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0						AAGTAGTCATCCTTACCCAAA	0.368											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	21	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75852968	75852968	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75852968C>G	uc003phs.2	-	26	4993	c.4827G>C	c.(4825-4827)GAG>GAC	p.E1609D	COL12A1_uc003pht.2_Missense_Mutation_p.E445D	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1609	Fibronectin type-III 11.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTCAACCTACCTCTTTGACAT	0.338													4	134	---	---	---	---	PASS
MICAL1	64780	broad.mit.edu	37	6	109767339	109767339	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109767339C>A	uc003ptj.2	-	18	2835	c.2581G>T	c.(2581-2583)GCT>TCT	p.A861S	MICAL1_uc003ptk.2_Missense_Mutation_p.A861S|MICAL1_uc010kdr.2_Missense_Mutation_p.A775S|MICAL1_uc011eaq.1_Missense_Mutation_p.A880S	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	861					cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		GATGGGTTACCTTGAGGGCTC	0.647													3	50	---	---	---	---	PASS
PLN	5350	broad.mit.edu	37	6	118880183	118880183	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118880183C>G	uc003pye.2	+	2	310	c.99C>G	c.(97-99)ATC>ATG	p.I33M	C6orf204_uc003pxz.1_Intron|C6orf204_uc003pya.1_Intron|C6orf204_uc003pyb.2_Intron|C6orf204_uc011ebj.1_Intron|C6orf204_uc003pyc.2_Intron	NM_002667	NP_002658	P26678	PPLA_HUMAN	phospholamban	33	Helical; (Potential).				blood circulation|regulation of calcium ion transport	integral to membrane|mitochondrial membrane|sarcoplasmic reticulum	calcium channel regulator activity|protein binding				0		all_cancers(87;0.0916)|all_epithelial(87;0.131)		GBM - Glioblastoma multiforme(226;0.0325)|all cancers(137;0.154)|OV - Ovarian serous cystadenocarcinoma(136;0.176)		ATCTATTTATCAATTTCTGTC	0.413													32	191	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128151032	128151032	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128151032C>G	uc003qbi.2	-	4	617	c.298G>C	c.(298-300)GAA>CAA	p.E100Q	THEMIS_uc010kfa.2_Missense_Mutation_p.E3Q|THEMIS_uc011ebt.1_Missense_Mutation_p.E100Q|THEMIS_uc010kfb.2_Missense_Mutation_p.E65Q	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	100	CABIT 1.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						CTTGTGATTTCTTCCATAGTA	0.363													33	123	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144835177	144835177	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144835177G>T	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGTGAAGGTAGCAAACACAGA	0.403													140	108	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146747736	146747736	+	Intron	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146747736C>A	uc010khw.1	+						GRM1_uc010khv.1_Nonsense_Mutation_p.S901*|GRM1_uc003qll.2_Nonsense_Mutation_p.S901*|GRM1_uc011edz.1_Nonsense_Mutation_p.S901*|GRM1_uc011eea.1_Intron	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CAATGTCCGTCGGCACATGTG	0.493													16	33	---	---	---	---	PASS
ESR1	2099	broad.mit.edu	37	6	152129166	152129166	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152129166G>T	uc003qom.3	+	3	489	c.119G>T	c.(118-120)GGC>GTC	p.G40V	ESR1_uc010kin.2_Missense_Mutation_p.G40V|ESR1_uc010kio.2_Missense_Mutation_p.G40V|ESR1_uc010kip.2_Missense_Mutation_p.G40V|ESR1_uc003qon.3_Missense_Mutation_p.G40V|ESR1_uc003qoo.3_Missense_Mutation_p.G40V|ESR1_uc010kiq.2_5'UTR|ESR1_uc010kir.2_Missense_Mutation_p.G40V	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	40	Modulating; mediates interaction with MACROD1.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	CGGCCCCTGGGCGAGGTGTAC	0.662													18	70	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166576077	166576077	+	Silent	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166576077C>G	uc003quu.1	-	7	1255	c.762G>C	c.(760-762)CTG>CTC	p.L254L	T_uc003qut.1_Silent_p.L255L|T_uc003quv.1_Intron	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	254					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		CAGGTGGACACAGGGTGCTGG	0.587									Chordoma_Familial_Clustering_of				61	52	---	---	---	---	PASS
FRMD1	79981	broad.mit.edu	37	6	168458026	168458026	+	Intron	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168458026G>A	uc003qwo.3	-						FRMD1_uc003qwm.3_Intron|FRMD1_uc011egs.1_Intron|FRMD1_uc011egt.1_Intron|FRMD1_uc003qwn.3_Intron	NM_024919	NP_079195	Q8N878	FRMD1_HUMAN	FERM domain containing 1 isoform 1							cytoskeleton	binding			ovary(1)	1		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGATCTGCGGGGAGAGGCCAT	0.662													12	85	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169641872	169641872	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169641872C>T	uc003qwt.2	-	6	1124	c.876G>A	c.(874-876)GAG>GAA	p.E292E		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	292					cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		TCTTGAGGTTCTCGCTGAGCT	0.647													58	335	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4169653	4169653	+	Silent	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4169653C>G	uc003smx.2	+	27	4192	c.4053C>G	c.(4051-4053)CTC>CTG	p.L1351L	SDK1_uc010kso.2_Silent_p.L627L|SDK1_uc003smy.2_5'UTR	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1351	Fibronectin type-III 7.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TCTACGAGCTCCAGGTGCTGG	0.662													26	169	---	---	---	---	PASS
SLC29A4	222962	broad.mit.edu	37	7	5338675	5338675	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5338675C>T	uc003sod.2	+	8	1100	c.939C>T	c.(937-939)CAC>CAT	p.H313H	SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Silent_p.H313H|SLC29A4_uc003soe.2_Silent_p.H299H|SLC29A4_uc010ksw.2_RNA	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	313	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		GCCCAGCCCACGAGGTGACCG	0.692													5	120	---	---	---	---	PASS
TNRC18	84629	broad.mit.edu	37	7	5353171	5353171	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5353171G>T	uc003soi.3	-	27	7700	c.7351C>A	c.(7351-7353)CCT>ACT	p.P2451T		NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2451							DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGCCTCCGAGGGCCCTTGGCA	0.672													8	29	---	---	---	---	PASS
MIOS	54468	broad.mit.edu	37	7	7635937	7635937	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7635937C>T	uc003srf.2	+	11	2554	c.2246C>T	c.(2245-2247)TCA>TTA	p.S749L	MIOS_uc003srg.2_Missense_Mutation_p.S284L|MIOS_uc010ktq.2_Missense_Mutation_p.S144L	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	749											0						TACAGCTGTTCAGCTGTGCCT	0.403													14	271	---	---	---	---	PASS
SNX13	23161	broad.mit.edu	37	7	17890515	17890515	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17890515C>G	uc003stw.1	-	10	1123	c.910G>C	c.(910-912)GAA>CAA	p.E304Q	SNX13_uc003stv.2_Missense_Mutation_p.E304Q|SNX13_uc010kuc.2_Missense_Mutation_p.E101Q			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;	304					cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					CTGACTGCTTCTAGCTCTCCA	0.328													9	35	---	---	---	---	PASS
NT5C3	51251	broad.mit.edu	37	7	33057128	33057128	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33057128C>G	uc003tdk.2	-	7	708	c.631G>C	c.(631-633)GAG>CAG	p.E211Q	AVL9_uc011kai.1_Intron|NT5C3_uc003tdi.2_Missense_Mutation_p.E172Q|NT5C3_uc003tdj.2_Missense_Mutation_p.E172Q	NM_001002010	NP_001002010	Q9H0P0	5NT3_HUMAN	5'-nucleotidase, cytosolic III isoform 1	211					nucleotide metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol|endoplasmic reticulum	2'-phosphotransferase activity|5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1			GBM - Glioblastoma multiforme(11;0.0894)			ATAACTTCCTCTAGTACATCG	0.378													28	146	---	---	---	---	PASS
CDK13	8621	broad.mit.edu	37	7	40037170	40037170	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40037170C>T	uc003thh.3	+	3	2231	c.1949C>T	c.(1948-1950)CCG>CTG	p.P650L	CDK13_uc003thi.3_Missense_Mutation_p.P650L|CDK13_uc011kbf.1_Missense_Mutation_p.P36L	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	650					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5						GCTGATTTACCGCTGCCCCCT	0.403													39	265	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42065846	42065846	+	Silent	SNP	C	A	A	rs148822237		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42065846C>A	uc011kbh.1	-	8	1285	c.1194G>T	c.(1192-1194)ACG>ACT	p.T398T	GLI3_uc011kbg.1_Silent_p.T339T	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	398					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GGTTCAGAACCGTAGGGATCC	0.617									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				7	57	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50566927	50566927	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50566927G>A	uc003tpf.3	-	8	881	c.795C>T	c.(793-795)GAC>GAT	p.D265D	DDC_uc010kza.2_Silent_p.D180D|DDC_uc003tpg.3_Silent_p.D265D	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	265					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	GCAGCCATATGTCTTCCTTGT	0.562													18	44	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57188631	57188631	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57188631T>A	uc010kzo.2	-	5	762	c.491A>T	c.(490-492)AAA>ATA	p.K164I		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	164					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			ACCAAAGACTTTGACATATTT	0.308													9	56	---	---	---	---	PASS
PMS2L3	5387	broad.mit.edu	37	7	75145477	75145477	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75145477C>A	uc003udp.2	-	3	629	c.85G>T	c.(85-87)GAG>TAG	p.E29*	PMS2L3_uc003udn.2_RNA|PMS2L3_uc003udq.2_Nonsense_Mutation_p.E29*|PMS2L3_uc003udr.1_RNA	NM_005395	NP_005386			SubName: Full=Postmeiotic segregation increased 2-like 3; SubName: Full=Postmeiotic segregation increased 2-like 3, isoform CRA_b;												0						GCTATCTTCTCATCAGGGTCC	0.493								Direct_reversal_of_damage|MMR					40	110	---	---	---	---	PASS
SRCRB4D	136853	broad.mit.edu	37	7	76022746	76022746	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76022746C>T	uc003ufb.2	-	9	1657	c.1309G>A	c.(1309-1311)GAG>AAG	p.E437K	SRCRB4D_uc003ufa.2_5'UTR	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	437	SRCR 3.					extracellular region|membrane	scavenger receptor activity			pancreas(1)	1						CCCGCGTCCTCGTGGTGGCCG	0.751													6	29	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87183183	87183183	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87183183G>C	uc003uiz.1	-	10	1311	c.893C>G	c.(892-894)TCT>TGT	p.S298C	ABCB1_uc011khc.1_Missense_Mutation_p.S234C	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	298	Helical; (Potential).|ABC transmembrane type-1 1.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	AGCACCTATAGAAATATTGGC	0.373													30	253	---	---	---	---	PASS
SLC25A40	55972	broad.mit.edu	37	7	87483531	87483531	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87483531G>A	uc003uje.2	-	5	603	c.252C>T	c.(250-252)TTC>TTT	p.F84F		NM_018843	NP_061331	Q8TBP6	S2540_HUMAN	mitochondrial carrier family protein	84	Solcar 1.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			haematopoietic_and_lymphoid_tissue(1)	1	Esophageal squamous(14;0.00202)					ATGTTCCCTGGAAATTTCCTG	0.323													8	227	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91715626	91715626	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91715626G>C	uc003ulg.2	+	37	9334	c.9109G>C	c.(9109-9111)GAG>CAG	p.E3037Q	AKAP9_uc003ulf.2_Missense_Mutation_p.E3029Q|AKAP9_uc003uli.2_Missense_Mutation_p.E2660Q|AKAP9_uc003ulj.2_Missense_Mutation_p.E807Q|AKAP9_uc003ulk.2_Missense_Mutation_p.E312Q	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3041					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTTCTTAGAAGAGCGTAGTGT	0.418			T	BRAF	papillary thyroid								64	527	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	91936822	91936822	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91936822G>C	uc003ulw.2	+	3	714	c.338G>C	c.(337-339)AGA>ACA	p.R113T		NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	113							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GATTTCAGAAGAGCAGATTGT	0.413													4	232	---	---	---	---	PASS
MIR489	574442	broad.mit.edu	37	7	93113265	93113265	+	RNA	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93113265G>T	hsa-mir-489|MI0003124	-			c.67G>T			CALCR_uc003ums.1_Intron|CALCR_uc003umt.1_Intron|CALCR_uc003umu.1_Intron|CALCR_uc003umv.1_Intron|CALCR_uc003umw.2_Intron|MIR653_hsa-mir-653|MI0003674_5'Flank																	0						TTTAGCTGCCGTATATGTGAT	0.403													20	72	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94045750	94045750	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94045750G>T	uc003ung.1	+	31	2269	c.1798G>T	c.(1798-1800)GCC>TCC	p.A600S	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_5'Flank	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	600					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GAGTGGTGCTGCCGGTCCTAC	0.478										HNSCC(75;0.22)			6	16	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94182478	94182478	+	Intron	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94182478A>T	uc003uni.3	+						CASD1_uc003unj.3_Intron	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor							integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			tatcacttatactattaatta	0.085													6	30	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677363	100677363	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677363C>T	uc003uxp.1	+	3	2719	c.2666C>T	c.(2665-2667)CCT>CTT	p.P889L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	889	Extracellular (Potential).|12.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TCAACAACTCCTGTTGACACC	0.498													80	818	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100678116	100678116	+	Nonsense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678116C>G	uc003uxp.1	+	3	3472	c.3419C>G	c.(3418-3420)TCA>TGA	p.S1140*	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1140	Extracellular (Potential).|59 X approximate tandem repeats.|17.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGCCAGTTCATCTCCTACA	0.547													18	854	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100678753	100678753	+	Silent	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678753T>C	uc003uxp.1	+	3	4109	c.4056T>C	c.(4054-4056)TCT>TCC	p.S1352S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1352	Extracellular (Potential).|20.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TGGCCAGTTCTGCAATCAGCA	0.468													267	478	---	---	---	---	PASS
PNPLA8	50640	broad.mit.edu	37	7	108155098	108155098	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108155098G>C	uc003vff.1	-	4	1245	c.838C>G	c.(838-840)CAA>GAA	p.Q280E	PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Missense_Mutation_p.Q280E|PNPLA8_uc003vfi.1_Missense_Mutation_p.Q180E|PNPLA8_uc003vfj.1_Missense_Mutation_p.Q280E|PNPLA8_uc003vfk.1_Missense_Mutation_p.Q180E	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	280					fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						GTTGAAACTTGAAGAACATCA	0.438													20	231	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119914784	119914784	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119914784A>G	uc003vjj.1	+	1	1063	c.98A>G	c.(97-99)CAG>CGG	p.Q33R		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	33	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					CCCCCGAGGCAGGAGAGGAAA	0.627													261	398	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140534436	140534436	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140534436G>C	uc003vwc.3	-	3	538	c.477C>G	c.(475-477)GTC>GTG	p.V159V		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	159	RBD.				activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TGGGCAGGAAGACTCTAACGA	0.403		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				58	172	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140534629	140534629	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140534629C>G	uc003vwc.3	-	3	345	c.284G>C	c.(283-285)AGA>ACA	p.R95T		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	95					activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	CTGTTGTTCTCTTTGTTGGAG	0.393		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				33	180	---	---	---	---	PASS
PRSS1	5644	broad.mit.edu	37	7	142459677	142459677	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142459677G>C	uc003wak.2	+	3	270	c.253G>C	c.(253-255)GAG>CAG	p.E85Q	uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_3'UTR|PRSS1_uc003wam.2_Missense_Mutation_p.E25Q	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein	85	Peptidase S1.	Calcium.			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			GGAGGGGAATGAGCAGTTCAT	0.547									Hereditary_Pancreatitis				31	313	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142583234	142583234	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142583234C>T	uc003wbx.1	-	1	244	c.28G>A	c.(28-30)GGG>AGG	p.G10R		NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	10	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					AGAATTAGCCCTTTCTCCTTG	0.612													100	169	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	148080915	148080915	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148080915C>T	uc003weu.1	+	22	4166	c.3650C>T	c.(3649-3651)TCG>TTG	p.S1217L	CNTNAP2_uc003wev.1_5'UTR	NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	1217	Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGCGGGGCCTCGCCGCTGACC	0.562										HNSCC(39;0.1)			27	74	---	---	---	---	PASS
ZNF862	643641	broad.mit.edu	37	7	149545106	149545106	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149545106C>T	uc010lpn.2	+	4	716	c.524C>T	c.(523-525)TCA>TTA	p.S175L	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	175	TTF-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1						GACAAACGGTCAAGACTAATA	0.512													12	30	---	---	---	---	PASS
WDR86	349136	broad.mit.edu	37	7	151093180	151093180	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151093180G>T	uc003wkb.2	-	3	857	c.408C>A	c.(406-408)CAC>CAA	p.H136Q	WDR86_uc003wka.2_Missense_Mutation_p.H94Q|WDR86_uc011kvk.1_Missense_Mutation_p.H136Q|WDR86_uc003wkc.2_Missense_Mutation_p.H8Q	NM_198285	NP_938026	Q86TI4	WDR86_HUMAN	WD repeat domain 86	136	WD 4.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCAGTTGCGGTGGCCCCGGA	0.677													51	44	---	---	---	---	PASS
HTR5A	3361	broad.mit.edu	37	7	154862691	154862691	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154862691G>C	uc003wlu.1	+	1	146	c.82G>C	c.(82-84)GAC>CAC	p.D28H	uc011kvt.1_Intron|uc003wlt.2_Intron	NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	28	Extracellular (By similarity).					integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		CGGCAAAGACGACCTGCGCCC	0.607													113	132	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3165999	3165999	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3165999G>A	uc011kwk.1	-	24	4051	c.3661C>T	c.(3661-3663)CCG>TCG	p.P1221S	CSMD1_uc011kwj.1_Missense_Mutation_p.P613S|CSMD1_uc003wqe.2_Missense_Mutation_p.P377S	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1221	Extracellular (Potential).|Sushi 7.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGGATGCCCGGATCCTCACAT	0.483													10	25	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43171102	43171102	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43171102G>A	uc003xpz.1	+	7	1016	c.973G>A	c.(973-975)GAG>AAG	p.E325K	POTEA_uc003xqa.1_Missense_Mutation_p.E279K	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	325										ovary(1)	1						TAGTCAGCATGAGGCATGtaa	0.318													4	28	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61754598	61754598	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61754598C>T	uc003xue.2	+	21	5314	c.4837C>T	c.(4837-4839)CTG>TTG	p.L1613L		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1613					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGAGAAGAATCTGCTTGTCTA	0.418													4	27	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67578320	67578320	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67578320T>C	uc003xwn.2	-	1	1133	c.874A>G	c.(874-876)ATA>GTA	p.I292V	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	292	OTU.				protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			AGACCAAATATGTGGATATTC	0.468													38	208	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69069666	69069666	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69069666G>T	uc003xxv.1	+	35	4368	c.4341G>T	c.(4339-4341)AAG>AAT	p.K1447N		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1447					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						ACAACCAGAAGCTCAGGTATG	0.323													15	62	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77775917	77775917	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77775917C>T	uc003yav.2	+	11	10219	c.9832C>T	c.(9832-9834)CAG>TAG	p.Q3278*		NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3274	Potential.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ccaacagtatcagcagaacct	0.313										HNSCC(33;0.089)			3	18	---	---	---	---	PASS
GDF6	392255	broad.mit.edu	37	8	97172923	97172923	+	5'UTR	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97172923C>T	uc003yhp.2	-	1						NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN	growth differentiation factor 6 precursor						activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(1)|breast(1)|pancreas(1)	3	Breast(36;2.67e-05)					GTATCCATGGCGGGCAAGTGG	0.697													5	137	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120594757	120594757	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120594757G>A	uc003yot.1	-	18	1715	c.1629C>T	c.(1627-1629)ACC>ACT	p.T543T	ENPP2_uc011lic.1_Silent_p.T60T|ENPP2_uc003yor.1_Silent_p.T182T|ENPP2_uc003yos.1_Silent_p.T595T|ENPP2_uc010mdd.1_Silent_p.T543T	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	543					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CCTCTGGCATGGTTGGCCTGA	0.453													76	377	---	---	---	---	PASS
FBXO32	114907	broad.mit.edu	37	8	124553156	124553156	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124553156G>A	uc003yqr.2	-	1	291	c.99C>T	c.(97-99)TTC>TTT	p.F33F	FBXO32_uc010mdk.2_Silent_p.F33F	NM_058229	NP_478136	Q969P5	FBX32_HUMAN	F-box only protein 32 isoform 1	33										skin(3)|breast(2)|lung(1)	6	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GGTCGCTCACGAAACTGCCGC	0.677													14	116	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131146584	131146584	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131146584C>G	uc003yta.1	-	14	1203	c.1175G>C	c.(1174-1176)AGA>ACA	p.R392T	ASAP1_uc003ysz.1_Missense_Mutation_p.R203T|ASAP1_uc011liw.1_Missense_Mutation_p.R385T	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	392	PH.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GTGATATGTTCTATTATCTAA	0.348													14	71	---	---	---	---	PASS
EFR3A	23167	broad.mit.edu	37	8	133014041	133014041	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133014041G>A	uc003yte.2	+	20	2394	c.2193G>A	c.(2191-2193)TTG>TTA	p.L731L		NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A	731						plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TTGAAGCATTGAAGAAAGCAA	0.328													11	85	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145006373	145006373	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145006373C>T	uc003zaf.1	-	17	2588	c.2418G>A	c.(2416-2418)GAG>GAA	p.E806E	PLEC_uc003zab.1_Silent_p.E669E|PLEC_uc003zac.1_Silent_p.E673E|PLEC_uc003zad.2_Silent_p.E669E|PLEC_uc003zae.1_Silent_p.E637E|PLEC_uc003zag.1_Silent_p.E647E|PLEC_uc003zah.2_Silent_p.E655E|PLEC_uc003zaj.2_Silent_p.E696E	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	806	Spectrin 2.|Globular 1.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						TGATCTTCTTCTCCTTCAGCT	0.647													5	89	---	---	---	---	PASS
BOP1	23246	broad.mit.edu	37	8	145512892	145512892	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145512892C>A	uc003zbr.1	-	2	261	c.193G>T	c.(193-195)GAT>TAT	p.D65Y	HSF1_uc003zbt.3_5'Flank|HSF1_uc003zbu.3_5'Flank	NM_015201	NP_056016	Q14137	BOP1_HUMAN	block of proliferation 1	65					cell proliferation|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	nucleoplasm|PeBoW complex	protein binding				0	all_cancers(97;4.06e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;2.61e-39)|all cancers(56;1.37e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.087)			CTGCCGGAATCTTCCAGGCCT	0.607													35	198	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145623969	145623969	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145623969G>A	uc003zcj.2	-	18	1773	c.1698C>T	c.(1696-1698)GAC>GAT	p.D566D		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	566					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GGCCGTCGTCGTCTGCTTCAG	0.662													42	442	---	---	---	---	PASS
SH3GL2	6456	broad.mit.edu	37	9	17793502	17793502	+	Intron	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17793502G>C	uc003zna.2	+						SH3GL2_uc011lmy.1_Intron	NM_003026	NP_003017	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2						axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		TCAGGTAAGAGCTGAAACTGC	0.483													10	49	---	---	---	---	PASS
IFNA7	3444	broad.mit.edu	37	9	21201638	21201638	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21201638G>C	uc003zop.1	-	1	567	c.527C>G	c.(526-528)TCT>TGT	p.S176C	IFNA14_uc003zoo.1_Intron	NM_021057	NP_066401	P01567	IFNA7_HUMAN	interferon, alpha 7 precursor	176					blood coagulation|cell-cell signaling|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding				0				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TGTTGAAAAAGAGAAGGATCT	0.378													70	367	---	---	---	---	PASS
RASEF	158158	broad.mit.edu	37	9	85624551	85624551	+	Intron	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85624551C>T	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						ATGCAAAGTTCATACCTTTCA	0.348													27	55	---	---	---	---	PASS
PTPDC1	138639	broad.mit.edu	37	9	96866628	96866628	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96866628G>T	uc004auf.1	+	9	2449	c.2109G>T	c.(2107-2109)GAG>GAT	p.E703D	PTPDC1_uc004aug.1_Missense_Mutation_p.E698D|PTPDC1_uc004auh.1_Missense_Mutation_p.E755D|PTPDC1_uc010mrj.1_Missense_Mutation_p.E757D	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	703							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						TGGATGTGGAGGAAGCTTTCC	0.438													17	37	---	---	---	---	PASS
PTPDC1	138639	broad.mit.edu	37	9	96866629	96866629	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96866629G>T	uc004auf.1	+	9	2450	c.2110G>T	c.(2110-2112)GAA>TAA	p.E704*	PTPDC1_uc004aug.1_Nonsense_Mutation_p.E699*|PTPDC1_uc004auh.1_Nonsense_Mutation_p.E756*|PTPDC1_uc010mrj.1_Nonsense_Mutation_p.E758*	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	704							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						GGATGTGGAGGAAGCTTTCCT	0.443													17	37	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104433333	104433333	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104433333G>C	uc004bbp.1	-	3	1962	c.1361C>G	c.(1360-1362)TCC>TGC	p.S454C	GRIN3A_uc004bbq.1_Missense_Mutation_p.S454C	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	454	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	GACGATGGTGGAACCTTTTAC	0.493													84	214	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	117031543	117031543	+	Missense_Mutation	SNP	C	G	G	rs139237104	byFrequency	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117031543C>G	uc011lxl.1	+	35	3524	c.3524C>G	c.(3523-3525)ACT>AGT	p.T1175S	COL27A1_uc004bii.2_RNA	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	1175	Pro-rich.|Collagen-like 9.|Triple-helical region.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						CCCCTGGGCACTCCTGGGGAG	0.607													13	40	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123922541	123922541	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123922541C>A	uc004bkx.1	+	30	5081	c.5050C>A	c.(5050-5052)CTT>ATT	p.L1684I	CEP110_uc010mvo.1_Missense_Mutation_p.L353I|CEP110_uc004blb.1_Missense_Mutation_p.L353I|CEP110_uc010mvp.1_5'UTR	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1684	Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						GGAAGAAAATCTTCAGGTTGT	0.303													56	88	---	---	---	---	PASS
OR1L4	254973	broad.mit.edu	37	9	125486937	125486937	+	Silent	SNP	C	A	A	rs140014211		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125486937C>A	uc004bmu.1	+	1	669	c.669C>A	c.(667-669)ATC>ATA	p.I223I		NM_001005235	NP_001005235	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGCAAATCATCGTCACTGTGC	0.542													107	535	---	---	---	---	PASS
SH2D3C	10044	broad.mit.edu	37	9	130504196	130504196	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130504196G>T	uc004bsc.2	-	9	2101	c.1959C>A	c.(1957-1959)GGC>GGA	p.G653G	SH2D3C_uc010mxo.2_Silent_p.G493G|SH2D3C_uc004bry.2_Silent_p.G495G|SH2D3C_uc004brz.3_Silent_p.G299G|SH2D3C_uc011mak.1_Silent_p.G299G|SH2D3C_uc004bsa.2_Silent_p.G496G|SH2D3C_uc004bsb.2_Silent_p.G585G	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	653	Ras-GEF.				JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						AGCCGGTGCAGCCCAGGATGT	0.687													6	55	---	---	---	---	PASS
FPGS	2356	broad.mit.edu	37	9	130569530	130569530	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130569530A>G	uc004bsg.1	+	6	594	c.544A>G	c.(544-546)ACA>GCA	p.T182A	FPGS_uc004bsh.1_5'UTR|FPGS_uc011mal.1_Intron|FPGS_uc004bsi.1_Missense_Mutation_p.T132A	NM_004957	NP_004948	Q05932	FOLC_HUMAN	folylpolyglutamate synthase isoform a precursor	182					folic acid metabolic process|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|one-carbon metabolic process	cytosol|mitochondrial matrix	ATP binding|tetrahydrofolylpolyglutamate synthase activity				0					L-Glutamic Acid(DB00142)	CCGCTTCCTGACACTCATGGC	0.612													119	197	---	---	---	---	PASS
URM1	81605	broad.mit.edu	37	9	131151543	131151543	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131151543G>A	uc004buv.2	+	4	254	c.192G>A	c.(190-192)CGG>CGA	p.R64R	URM1_uc011may.1_Silent_p.R64R|URM1_uc004buw.2_RNA	NM_030914	NP_112176	Q9BTM9	URM1_HUMAN	ubiquitin related modifier 1 homolog isoform a	64					tRNA thio-modification|tRNA wobble uridine modification		protein binding				0						CCCACAGGCGGCCAGGAATTC	0.592													72	148	---	---	---	---	PASS
C9orf78	51759	broad.mit.edu	37	9	132591590	132591590	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132591590C>G	uc004byp.2	-						C9orf78_uc004byo.2_Intron|C9orf78_uc004byq.1_Intron	NM_016520	NP_057604	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78												0		Ovarian(14;0.00556)				AAACTGGACCCAAAGAGACCA	0.552													51	78	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136662864	136662864	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136662864C>T	uc004ces.2	-	10	950	c.904G>A	c.(904-906)GCC>ACC	p.A302T	VAV2_uc004cer.2_Missense_Mutation_p.A297T	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	302	DH.				angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TCCCGGCTGGCCAGGAGCTGG	0.617													23	46	---	---	---	---	PASS
SSNA1	8636	broad.mit.edu	37	9	140083606	140083606	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140083606G>A	uc004cls.2	+	2	266	c.141G>A	c.(139-141)GTG>GTA	p.V47V	ANAPC2_uc004clq.1_5'Flank|ANAPC2_uc004clr.1_5'Flank|ANAPC2_uc011mer.1_5'Flank	NM_003731	NP_003722	O43805	SSNA1_HUMAN	nuclear autoantigen of 14 kDa	47	Potential.				G2/M transition of mitotic cell cycle	centrosome|cytosol|nucleus				breast(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		AGAATGAGGTGAGGCAGCTGA	0.652													14	31	---	---	---	---	PASS
C10orf18	54906	broad.mit.edu	37	10	5803348	5803348	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5803348G>A	uc001iij.2	+	19	7713	c.7088G>A	c.(7087-7089)CGA>CAA	p.R2363Q	C10orf18_uc001iik.2_Missense_Mutation_p.R1207Q	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	2363										ovary(1)|central_nervous_system(1)	2						TGTGACTCTCGATCATCAACA	0.388													33	163	---	---	---	---	PASS
FAM171A1	221061	broad.mit.edu	37	10	15325930	15325930	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15325930G>C	uc001iob.2	-	2	279	c.272C>G	c.(271-273)TCG>TGG	p.S91W		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor	91	Extracellular (Potential).					integral to membrane				ovary(2)|breast(1)|skin(1)	4						GGCATGCTTCGAGGCGGTGAC	0.532													16	106	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15726081	15726081	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15726081C>T	uc001ioc.1	-	4	490	c.490G>A	c.(490-492)GAA>AAA	p.E164K	ITGA8_uc010qcb.1_Missense_Mutation_p.E164K	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	164	Extracellular (Potential).|FG-GAP 2.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						GGGTCCTTTTCTGGTGTCGGT	0.423													19	87	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16873253	16873253	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16873253G>C	uc001ioo.2	-	65	10578	c.10526C>G	c.(10525-10527)TCT>TGT	p.S3509C		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3509					cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTCTTACCAGAGGGTGATGA	0.363													22	109	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17275778	17275778	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17275778G>A	uc001iou.2	+	5	1143	c.730G>A	c.(730-732)GAG>AAG	p.E244K	VIM_uc001iov.1_Missense_Mutation_p.E244K|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.E244K|VIM_uc001ioy.1_Missense_Mutation_p.E244K|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.E244K|VIM_uc001ipc.1_Missense_Mutation_p.E244K	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	244	Rod.|Coil 1B.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GGAAATCCAGGAGCTGCAGGC	0.532													19	89	---	---	---	---	PASS
KIF5B	3799	broad.mit.edu	37	10	32306105	32306105	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32306105C>T	uc001iwe.3	-	24	3197	c.2727G>A	c.(2725-2727)AAG>AAA	p.K909K		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	909					stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				TGGCCATATTCTTTGACCTGA	0.398													98	428	---	---	---	---	PASS
CXCL12	6387	broad.mit.edu	37	10	44880406	44880406	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44880406G>C	uc001jbf.2	-	1	137	c.48C>G	c.(46-48)CTC>CTG	p.L16L	CXCL12_uc001jbh.2_Silent_p.L16L|CXCL12_uc001jbi.2_Silent_p.L16L	NM_000609	NP_000600	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12 (stromal	16					blood circulation|cell adhesion|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|negative regulation of leukocyte apoptosis|positive regulation of monocyte chemotaxis|regulation of actin polymerization or depolymerization|response to virus	extracellular space	chemokine activity|growth factor activity|signal transducer activity				0					Dexamethasone(DB01234)	CGCTGAGGCAGAGCGCGGTCA	0.637													3	20	---	---	---	---	PASS
ASAH2B	653308	broad.mit.edu	37	10	52502713	52502713	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52502713G>A	uc001jjg.2	+	2	94	c.29G>A	c.(28-30)CGC>CAC	p.R10H	ASAH2B_uc010qhm.1_5'UTR	NM_001079516	NP_001072984	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal	Error:Variant_position_missing_in_Q9NR71_after_alignment					apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity				0						TTTATGGACCGCACGCATTAT	0.363													40	207	---	---	---	---	PASS
TSPAN15	23555	broad.mit.edu	37	10	71243548	71243548	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71243548C>T	uc001jpo.1	+	2	323	c.198C>T	c.(196-198)CTC>CTT	p.L66L		NM_012339	NP_036471	O95858	TSN15_HUMAN	transmembrane 4 superfamily member 15	66	Helical; (Potential).					integral to plasma membrane|membrane fraction					0						CCATCATCCTCATCCTCCTGG	0.552													25	122	---	---	---	---	PASS
PLAU	5328	broad.mit.edu	37	10	75676259	75676259	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75676259G>C	uc001jwa.2	+	11	1378	c.1232G>C	c.(1231-1233)AGA>ACA	p.R411T	C10orf55_uc001jvz.1_Intron|PLAU_uc010qkw.1_Missense_Mutation_p.R394T|PLAU_uc010qkx.1_Missense_Mutation_p.R325T|PLAU_uc001jwb.2_RNA|PLAU_uc001jwc.2_Missense_Mutation_p.R411T|PLAU_uc009xrq.1_Missense_Mutation_p.R375T	NM_002658	NP_002649	P00749	UROK_HUMAN	plasminogen activator, urokinase isoform 1	411	Peptidase S1.				blood coagulation|chemotaxis|fibrinolysis|proteolysis|regulation of cell adhesion mediated by integrin|regulation of receptor activity|regulation of smooth muscle cell migration|regulation of smooth muscle cell-matrix adhesion|signal transduction	cell surface|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(2)|kidney(1)	3	Prostate(51;0.0112)				Amiloride(DB00594)|Urokinase(DB00013)	GTCTACACGAGAGTCTCACAC	0.602													6	41	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84745006	84745006	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84745006C>T	uc001kco.2	+	9	1763	c.1736C>T	c.(1735-1737)TCA>TTA	p.S579L	NRG3_uc010qlz.1_Missense_Mutation_p.S578L|NRG3_uc001kcp.2_Missense_Mutation_p.S382L|NRG3_uc001kcq.2_Missense_Mutation_p.S229L|NRG3_uc001kcr.2_Missense_Mutation_p.S253L	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	603	Cytoplasmic (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ATCATCCCTTCAGTGGGTTTA	0.468													60	272	---	---	---	---	PASS
GLUD1	2746	broad.mit.edu	37	10	88854340	88854340	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88854340C>T	uc001keh.2	-	1	284	c.187G>A	c.(187-189)GAC>AAC	p.D63N	FAM35A_uc001kei.3_5'Flank|GLUD1_uc001keg.2_5'Flank|GLUD1_uc010qmp.1_5'Flank	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor	63					glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	AAGTTGGGGTCGTCCTCGCGG	0.721													18	285	---	---	---	---	PASS
DNMBP	23268	broad.mit.edu	37	10	101715112	101715112	+	Missense_Mutation	SNP	T	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101715112T>G	uc001kqj.2	-	4	2211	c.2119A>C	c.(2119-2121)ATG>CTG	p.M707L	NCRNA00093_uc001kqk.1_Intron	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	707	Potential.				intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CTACTGTACATATCCAAGTCC	0.512													4	121	---	---	---	---	PASS
CYP17A1	1586	broad.mit.edu	37	10	104594716	104594716	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104594716G>A	uc001kwg.2	-	3	664	c.492C>T	c.(490-492)TCC>TCT	p.S164S		NM_000102	NP_000093	P05093	CP17A_HUMAN	cytochrome P450, family 17	164					androgen biosynthetic process|glucocorticoid biosynthetic process|sex differentiation|xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|oxygen binding|steroid 17-alpha-monooxygenase activity				0		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	NADH(DB00157)|Progesterone(DB00396)	AGATGTCTATGGACTGTCCGT	0.493											OREG0020487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	153	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106960951	106960951	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106960951G>A	uc001kyi.1	+	16	2428	c.2201G>A	c.(2200-2202)CGA>CAA	p.R734Q	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	734	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GCCCTGGGCCGAGACCACTCA	0.488													22	99	---	---	---	---	PASS
GPAM	57678	broad.mit.edu	37	10	113924352	113924352	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113924352T>A	uc009xxy.1	-	13	1436	c.1238A>T	c.(1237-1239)CAA>CTA	p.Q413L	GPAM_uc001kzp.2_Missense_Mutation_p.Q413L|GPAM_uc001kzq.1_Missense_Mutation_p.Q413L	NM_020918	NP_065969	Q9HCL2	GPAT1_HUMAN	mitochondrial glycerol 3-phosphate	413					phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity			ovary(1)|skin(1)	2				Epithelial(162;0.0306)|all cancers(201;0.123)		TTTCTGACTTTGGCTTTCTAA	0.358													16	46	---	---	---	---	PASS
HSPA12A	259217	broad.mit.edu	37	10	118451946	118451946	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118451946C>T	uc001lct.2	-	6	684	c.579G>A	c.(577-579)GAG>GAA	p.E193E	HSPA12A_uc001lcu.2_Silent_p.E110E	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	193							ATP binding			ovary(1)	1				all cancers(201;0.0158)		CATCAGAGTTCTCGAACTCCG	0.572													58	339	---	---	---	---	PASS
KIAA1598	57698	broad.mit.edu	37	10	118704424	118704424	+	Intron	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118704424A>T	uc009xyw.2	-						KIAA1598_uc001lcz.3_Intron|KIAA1598_uc010qso.1_Intron|KIAA1598_uc010qsp.1_Intron|KIAA1598_uc010qsq.1_Intron|KIAA1598_uc001lcy.3_Intron	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a						axon guidance	axon					0				all cancers(201;0.00494)		AGATTTTTACAAGATACCCAC	0.234													14	207	---	---	---	---	PASS
SEC23IP	11196	broad.mit.edu	37	10	121677437	121677437	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121677437C>T	uc001leu.1	+	9	1706	c.1634C>T	c.(1633-1635)CCC>CTC	p.P545L	SEC23IP_uc010qtc.1_Missense_Mutation_p.P334L|SEC23IP_uc009xzk.1_5'Flank	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	545					Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		TATAACAGCCCCACCTACTGT	0.368													20	124	---	---	---	---	PASS
INPP5A	3632	broad.mit.edu	37	10	134579283	134579283	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134579283G>C	uc001llp.2	+	12	1158	c.910G>C	c.(910-912)GAG>CAG	p.E304Q	INPP5A_uc001llo.1_Missense_Mutation_p.E304Q|INPP5A_uc001llq.2_Missense_Mutation_p.E199Q	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A	304					cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		TTAGCTCTTGGAGTTTGACAA	0.488													20	146	---	---	---	---	PASS
RBMXL2	27288	broad.mit.edu	37	11	7110612	7110612	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7110612G>C	uc001mfc.2	+	1	448	c.261G>C	c.(259-261)CCG>CCC	p.P87P		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	87						nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCACCAAACCGGCGTTCGAGA	0.592													4	16	---	---	---	---	PASS
C11orf16	56673	broad.mit.edu	37	11	8948644	8948644	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8948644C>G	uc001mhb.3	-	4	526	c.402G>C	c.(400-402)CAG>CAC	p.Q134H	C11orf16_uc001mhc.3_Missense_Mutation_p.Q134H	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673	134										upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		AGACCACTCTCTGCTGCTGGG	0.557													13	44	---	---	---	---	PASS
IPO7	10527	broad.mit.edu	37	11	9450345	9450345	+	Intron	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9450345C>T	uc001mho.2	+						SNORA23_uc001mhp.1_RNA	NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7						interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		TAGGTTTCATCTGTGTCTGGT	0.383													17	74	---	---	---	---	PASS
MICAL2	9645	broad.mit.edu	37	11	12225953	12225953	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12225953G>A	uc001mjz.2	+	4	709	c.421G>A	c.(421-423)GGA>AGA	p.G141R	MICAL2_uc010rch.1_Missense_Mutation_p.G141R|MICAL2_uc001mjy.2_Missense_Mutation_p.G141R|MICAL2_uc001mka.2_Missense_Mutation_p.G141R|MICAL2_uc010rci.1_Missense_Mutation_p.G141R|MICAL2_uc001mkb.2_Missense_Mutation_p.G141R|MICAL2_uc001mkc.2_Missense_Mutation_p.G141R	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	141						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		TCGTGGCCTGGGAGCCAAGAA	0.557													33	125	---	---	---	---	PASS
RASSF10	644943	broad.mit.edu	37	11	13031130	13031130	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13031130C>T	uc001mkn.1	+	2	331	c.331C>T	c.(331-333)CCT>TCT	p.P111S		NM_001080521	NP_001073990	A6NK89	RASFA_HUMAN	Ras association (RalGDS/AF-6) domain family	3					signal transduction						0				Epithelial(150;0.00399)		CGCCATGGATCCTTCGGAAAA	0.637													12	41	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17552952	17552952	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17552952C>A	uc001mnf.2	-	3	351	c.242G>T	c.(241-243)CGC>CTC	p.R81L	USH1C_uc001mne.2_Missense_Mutation_p.R81L|USH1C_uc009yhb.2_Missense_Mutation_p.R81L|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.R45L	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a	81					equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						GCACCTGGAGCGCCGGGGGGT	0.627													8	16	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20070277	20070277	+	Silent	SNP	C	T	T	rs140548628	byFrequency	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20070277C>T	uc010rdm.1	+	16	4336	c.3975C>T	c.(3973-3975)CTC>CTT	p.L1325L	NAV2_uc001mpp.2_Silent_p.L1238L|NAV2_uc001mpr.3_Silent_p.L1302L|NAV2_uc001mpt.2_Silent_p.L388L|NAV2_uc009yhx.2_Silent_p.L388L|NAV2_uc009yhy.1_Silent_p.L301L|NAV2_uc009yhz.2_5'UTR	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	1325						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TTCACAGACTCTTTGGTGGGA	0.512													20	48	---	---	---	---	PASS
SLC17A6	57084	broad.mit.edu	37	11	22399221	22399221	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22399221G>T	uc001mqk.2	+	12	2097	c.1684G>T	c.(1684-1686)GAG>TAG	p.E562*		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	562	Cytoplasmic (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						GGAAAAGAAAGAGGAATTTGT	0.368													15	58	---	---	---	---	PASS
CKAP5	9793	broad.mit.edu	37	11	46811703	46811703	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46811703G>A	uc001ndi.1	-	15	1908	c.1798C>T	c.(1798-1800)CTT>TTT	p.L600F	CKAP5_uc009ylg.1_Missense_Mutation_p.L486F|CKAP5_uc001ndj.1_Missense_Mutation_p.L600F	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	600					cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						GTAGGGGGAAGAACAGCTGAA	0.393													26	103	---	---	---	---	PASS
NR1H3	10062	broad.mit.edu	37	11	47282842	47282842	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47282842G>C	uc009ylm.2	+	5	771	c.550G>C	c.(550-552)GAG>CAG	p.E184Q	NR1H3_uc009yll.1_Missense_Mutation_p.E190Q|NR1H3_uc010rhk.1_Missense_Mutation_p.E190Q|NR1H3_uc001nek.2_Missense_Mutation_p.E139Q|NR1H3_uc001nej.2_Missense_Mutation_p.E184Q|NR1H3_uc001nel.2_Missense_Mutation_p.E139Q|NR1H3_uc001nen.3_Missense_Mutation_p.E184Q|NR1H3_uc001nem.2_Missense_Mutation_p.E184Q|NR1H3_uc001nep.2_Missense_Mutation_p.E93Q	NM_005693	NP_005684	Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	184					apoptotic cell clearance|cellular response to lipopolysaccharide|cholesterol homeostasis|negative regulation of cholesterol storage|negative regulation of inflammatory response|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of macrophage activation|negative regulation of pancreatic juice secretion|negative regulation of pinocytosis|negative regulation of secretion of lysosomal enzymes|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of cholesterol homeostasis|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor biosynthetic process|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of circadian rhythm|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to progesterone stimulus|triglyceride homeostasis	nuclear chromatin|nucleoplasm	cholesterol binding|steroid hormone receptor activity|sterol response element binding|transcription coactivator activity|zinc ion binding			ovary(2)|lung(1)	3						GCGGCAAGAGGAGGAACAGGC	0.577													6	103	---	---	---	---	PASS
PSMC3	5702	broad.mit.edu	37	11	47446672	47446672	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47446672C>A	uc001nfh.2	-	3	479	c.285G>T	c.(283-285)GAG>GAT	p.E95D	PSMC3_uc009ylr.1_Intron	NM_002804	NP_002795	P17980	PRS6A_HUMAN	proteasome 26S ATPase subunit 3	95					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|nucleoside-triphosphatase activity|protein binding|transcription coactivator activity|transcription corepressor activity			ovary(4)	4				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ACACACACACCTCGATGACGT	0.532													34	140	---	---	---	---	PASS
CELF1	10658	broad.mit.edu	37	11	47510421	47510421	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47510421C>G	uc001nfl.2	-	1	156	c.146G>C	c.(145-147)AGG>ACG	p.R49T	CELF1_uc001nfm.2_Missense_Mutation_p.R49T|CELF1_uc001nfn.2_Missense_Mutation_p.R49T|CELF1_uc001nfo.1_Missense_Mutation_p.R76T|CELF1_uc010rhm.1_Missense_Mutation_p.R49T|CELF1_uc001nfp.2_Missense_Mutation_p.R76T|CELF1_uc001nfq.1_Missense_Mutation_p.R49T|CELF1_uc001nfr.1_Missense_Mutation_p.R49T	NM_001025596	NP_001020767	Q92879	CELF1_HUMAN	CUG triplet repeat, RNA-binding protein 1	49	RRM 1.				embryo development|mRNA splice site selection|regulation of RNA splicing|RNA interference	cytoplasm|nucleus|ribonucleoprotein complex	BRE binding|mRNA binding|nucleotide binding|translation repressor activity, nucleic acid binding			central_nervous_system(2)|ovary(1)	3						GCTCCTATCCCTTAGGACGTT	0.483													44	294	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587932	55587932	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587932C>G	uc010rin.1	+	1	827	c.827C>G	c.(826-828)TCT>TGT	p.S276C		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	276	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				AAAGTGGCCTCTGTGTTTTAC	0.493													34	111	---	---	---	---	PASS
OR5I1	10798	broad.mit.edu	37	11	55703748	55703748	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55703748C>T	uc010ris.1	-	1	129	c.129G>A	c.(127-129)GGG>GGA	p.G43G		NM_006637	NP_006628	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ATCCAATGTTCCCTATCAGAA	0.393													21	89	---	---	---	---	PASS
OR8K5	219453	broad.mit.edu	37	11	55927259	55927259	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55927259A>T	uc010rja.1	-	1	535	c.535T>A	c.(535-537)TGT>AGT	p.C179S		NM_001004058	NP_001004058	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K,	179	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				ACATCATCACAGTAAAAATGA	0.358													21	102	---	---	---	---	PASS
HRASLS5	117245	broad.mit.edu	37	11	63257743	63257743	+	Silent	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63257743A>G	uc001nwy.2	-	2	415	c.241T>C	c.(241-243)TTA>CTA	p.L81L	HRASLS5_uc001nwz.2_Silent_p.L71L|HRASLS5_uc010rmq.1_Silent_p.L81L|HRASLS5_uc009yos.2_RNA	NM_054108	NP_473449	Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5 isoform 1	81										ovary(1)	1						CCCTGTTCTAATGTGCCCGGC	0.493													172	665	---	---	---	---	PASS
MACROD1	28992	broad.mit.edu	37	11	63919774	63919774	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63919774C>G	uc001nyh.2	-	2	509	c.390G>C	c.(388-390)GAG>GAC	p.E130D		NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	130											0						CTTTCGCCATCTCCTTCCATG	0.577													51	310	---	---	---	---	PASS
SF1	7536	broad.mit.edu	37	11	64533522	64533522	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64533522T>C	uc001obb.1	-	13	2065	c.1688A>G	c.(1687-1689)AAC>AGC	p.N563S	SF1_uc010rnm.1_Intron|SF1_uc010rnn.1_Missense_Mutation_p.N537S|SF1_uc001oaz.1_Intron|SF1_uc001oba.1_Missense_Mutation_p.N563S|SF1_uc001obc.1_Intron|SF1_uc001obd.1_Intron|SF1_uc001obe.1_Intron|SF1_uc010rno.1_Intron	NM_004630	NP_004621	Q15637	SF01_HUMAN	splicing factor 1 isoform 1	563	Pro-rich.				nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3						CATAGTGGGGTTGCCTTGCAT	0.716													3	66	---	---	---	---	PASS
TIGD3	220359	broad.mit.edu	37	11	65124249	65124249	+	Missense_Mutation	SNP	G	A	A	rs150239664		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65124249G>A	uc001odo.3	+	2	1133	c.970G>A	c.(970-972)GAT>AAT	p.D324N		NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	324	DDE.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						AAGCGAGAGGGATGGCACCTC	0.662													15	64	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65385808	65385808	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65385808C>T	uc001oey.2	+	6	975	c.975C>T	c.(973-975)AGC>AGT	p.S325S		NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	325						integral to membrane					0						ATCTGGACAGCCCCCCAGGGG	0.647													26	99	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65403086	65403086	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65403086C>T	uc001oey.2	+	32	5271	c.5271C>T	c.(5269-5271)AGC>AGT	p.S1757S	PCNXL3_uc001oez.2_Silent_p.S644S	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	1757						integral to membrane					0						AGCGTGGCAGCATCCAGAACG	0.662													17	55	---	---	---	---	PASS
ACTN3	89	broad.mit.edu	37	11	66328210	66328210	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66328210A>G	uc001oio.1	+	16	1862	c.1844A>G	c.(1843-1845)AAC>AGC	p.N615S	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3	615	Spectrin 3.				focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						CAGGACATCAACACCAAGTGG	0.582													56	248	---	---	---	---	PASS
CORO1B	57175	broad.mit.edu	37	11	67207901	67207901	+	Missense_Mutation	SNP	C	G	G	rs149251927		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67207901C>G	uc001olj.1	-	6	802	c.766G>C	c.(766-768)GAG>CAG	p.E256Q	PTPRCAP_uc001oli.1_5'Flank|CORO1B_uc009yrs.1_RNA|CORO1B_uc001olk.1_Missense_Mutation_p.E256Q|CORO1B_uc009yrt.1_RNA|CORO1B_uc009yru.1_RNA|CORO1B_uc001oll.1_Missense_Mutation_p.E256Q	NM_020441	NP_065174	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	256	WD 4.				actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin filament binding			large_intestine(1)|ovary(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			ATGGGTTCCTCGAGGTTTTCC	0.622													23	102	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	70009404	70009404	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70009404G>A	uc001opj.2	+	19	2213	c.1908G>A	c.(1906-1908)CCG>CCA	p.P636P	ANO1_uc001opk.1_Silent_p.P578P|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Silent_p.P345P	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	636	Extracellular (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						TTGGACGCCCGGGCGACTACG	0.532													5	68	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71724415	71724415	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71724415C>T	uc001orl.1	-	15	4306	c.4134G>A	c.(4132-4134)GAG>GAA	p.E1378E	NUMA1_uc009ysw.1_Silent_p.E941E|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Silent_p.E1378E|NUMA1_uc001orn.2_Silent_p.E941E|NUMA1_uc009ysx.1_Silent_p.E1378E|NUMA1_uc001oro.1_Silent_p.E1378E	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1378	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						GGTGGCGTTTCTCGGCAGCGG	0.687			T	RARA	APL								11	36	---	---	---	---	PASS
SLCO2B1	11309	broad.mit.edu	37	11	74913991	74913991	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74913991C>T	uc001owb.2	+	12	2196	c.1809C>T	c.(1807-1809)TTC>TTT	p.F603F	SLCO2B1_uc010rrq.1_Silent_p.F348F|SLCO2B1_uc010rrr.1_Silent_p.F459F|SLCO2B1_uc010rrs.1_Silent_p.F487F|SLCO2B1_uc001owc.2_Silent_p.F376F|SLCO2B1_uc001owd.2_Silent_p.F581F	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	603	Helical; Name=11; (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	GCATCCAGTTCATGTTCCTGA	0.428													53	229	---	---	---	---	PASS
MOGAT2	80168	broad.mit.edu	37	11	75438510	75438510	+	Silent	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75438510C>A	uc010rru.1	+	3	301	c.301C>A	c.(301-303)CGG>AGG	p.R101R	MOGAT2_uc001oww.1_Silent_p.R101R|MOGAT2_uc010rrv.1_Silent_p.R19R	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	101					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					GGACCCCTCTCGGAACTACAT	0.463													19	108	---	---	---	---	PASS
UVRAG	7405	broad.mit.edu	37	11	75852449	75852449	+	Missense_Mutation	SNP	G	A	A	rs147254159		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75852449G>A	uc001oxc.2	+	15	2333	c.2092G>A	c.(2092-2094)GAT>AAT	p.D698N	UVRAG_uc010rrw.1_Missense_Mutation_p.D597N|UVRAG_uc001oxd.2_Missense_Mutation_p.D326N|UVRAG_uc010rrx.1_Missense_Mutation_p.D326N|UVRAG_uc010rry.1_Missense_Mutation_p.D254N	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	698					DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						CAGGAGTTCCGATAAGTGAAG	0.478													13	65	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	89486957	89486957	+	IGR	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89486957A>T								TRIM77 (35919 upstream) : TRIM49 (43867 downstream)																							ATCTCTAACCATTTGAGTCTG	0.368													11	92	---	---	---	---	PASS
TRIM49	57093	broad.mit.edu	37	11	89537478	89537478	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89537478C>T	uc001pdb.2	-	3	489	c.160G>A	c.(160-162)GAA>AAA	p.E54K		NM_020358	NP_065091	P0CI25	TRI49_HUMAN	ring finger protein 18	54	RING-type.					intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TTTGTGCATTCAGAGCACTGG	0.463													23	161	---	---	---	---	PASS
PANX1	24145	broad.mit.edu	37	11	93862491	93862491	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93862491C>T	uc001per.2	+	1	398	c.13C>T	c.(13-15)CAA>TAA	p.Q5*	uc001pen.1_Intron|PANX1_uc001peq.2_Nonsense_Mutation_p.Q5*	NM_015368	NP_056183	Q96RD7	PANX1_HUMAN	pannexin 1	5	Cytoplasmic (Potential).				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GGCCATCGCTCAACTGGCCAC	0.662													21	57	---	---	---	---	PASS
MRE11A	4361	broad.mit.edu	37	11	94180422	94180422	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94180422C>T	uc001peu.2	-	15	1935	c.1746G>A	c.(1744-1746)CAG>CAA	p.Q582Q	MRE11A_uc001pev.2_Silent_p.Q582Q|MRE11A_uc009ywj.2_Silent_p.Q585Q	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1	582					DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				ATGCTGAATTCTGCCCTCTTC	0.478								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				22	426	---	---	---	---	PASS
CCDC82	79780	broad.mit.edu	37	11	96117808	96117808	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96117808G>C	uc009ywp.2	-	1	347	c.104C>G	c.(103-105)TCA>TGA	p.S35*	CCDC82_uc009ywq.2_Nonsense_Mutation_p.S35*|CCDC82_uc001pfx.3_Nonsense_Mutation_p.S35*|CCDC82_uc009ywr.2_Nonsense_Mutation_p.S35*|CCDC82_uc009yws.2_Nonsense_Mutation_p.S35*	NM_024725	NP_079001	Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	35							protein binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		AAGTAATTGTGAGATACTACT	0.358													13	61	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	102993708	102993708	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102993708C>T	uc001pho.2	+	11	1784	c.1640C>T	c.(1639-1641)TCT>TTT	p.S547F	DYNC2H1_uc001phn.1_Missense_Mutation_p.S547F|DYNC2H1_uc009yxe.1_Missense_Mutation_p.S547F	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	547	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TCAGGTTTATCTGATTCCAGA	0.333													4	16	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105623869	105623869	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105623869C>A	uc001pix.2	+	4	856	c.410C>A	c.(409-411)TCG>TAG	p.S137*	GRIA4_uc001piu.1_Nonsense_Mutation_p.S137*|GRIA4_uc001piw.2_Nonsense_Mutation_p.S137*|GRIA4_uc001piv.2_Nonsense_Mutation_p.S137*|GRIA4_uc009yxk.1_Nonsense_Mutation_p.S137*	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	137	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	CTAAGACCTTCGTTACGAGGA	0.473													29	107	---	---	---	---	PASS
KIAA1826	84437	broad.mit.edu	37	11	105881453	105881453	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105881453C>G	uc001piy.2	-	2	365	c.192G>C	c.(190-192)AGG>AGC	p.R64S	KIAA1826_uc001piz.2_Missense_Mutation_p.R64S	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	64						nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)		CTGTCCCTGTCCTCTGTTCTC	0.453													10	502	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107288944	107288944	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107288944G>C	uc010rvp.1	-	9	1533	c.1503C>G	c.(1501-1503)ATC>ATG	p.I501M	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	501							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TCTCTGCTTTGATAATCTTGG	0.363													17	78	---	---	---	---	PASS
DIXDC1	85458	broad.mit.edu	37	11	111864426	111864426	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111864426G>T	uc001pml.2	+	15	1696	c.1399G>T	c.(1399-1401)GTC>TTC	p.V467F	DIXDC1_uc001pmm.2_Missense_Mutation_p.V256F|DIXDC1_uc001pmn.2_Missense_Mutation_p.V173F|DIXDC1_uc010rwq.1_Missense_Mutation_p.V132F	NM_001037954	NP_001033043	Q155Q3	DIXC1_HUMAN	DIX domain containing 1 isoform a	467					multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity			ovary(1)	1		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		ACACAAAGATGTCCTCTTGGC	0.463													11	59	---	---	---	---	PASS
ZBTB16	7704	broad.mit.edu	37	11	114121138	114121138	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114121138C>T	uc001pop.2	+	7	2147	c.1883C>T	c.(1882-1884)TCG>TTG	p.S628L	ZBTB16_uc001poq.2_Missense_Mutation_p.S628L	NM_006006	NP_005997	Q05516	ZBT16_HUMAN	promyelocytic leukemia zinc finger protein	628					apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		AACGGCGCCTCGCCCTACCAG	0.627													28	140	---	---	---	---	PASS
BUD13	84811	broad.mit.edu	37	11	116633715	116633715	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116633715G>A	uc001ppn.2	-	4	624	c.590C>T	c.(589-591)TCT>TTT	p.S197F	BUD13_uc001ppo.2_Missense_Mutation_p.S197F|BUD13_uc009yzc.2_Missense_Mutation_p.S197F	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1	197	Arg-rich.									large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		AGGATCTGGAGAATCATGACG	0.567													39	253	---	---	---	---	PASS
TMPRSS4	56649	broad.mit.edu	37	11	117969767	117969767	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117969767C>T	uc010rxo.1	+	3	402	c.111C>T	c.(109-111)ATC>ATT	p.I37I	TMPRSS4_uc010rxp.1_Silent_p.I37I|TMPRSS4_uc010rxq.1_Intron|TMPRSS4_uc010rxr.1_Silent_p.I12I|TMPRSS4_uc010rxs.1_Intron|TMPRSS4_uc009yzu.2_RNA|TMPRSS4_uc010rxt.1_Silent_p.I12I	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	37	Helical; Signal-anchor for type II membrane protein; (Potential).				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		TCCCCATCATCATAGCACTAC	0.527													36	134	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118374740	118374740	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118374740G>A	uc001pta.2	+	27	8147	c.8124G>A	c.(8122-8124)CAG>CAA	p.Q2708Q	MLL_uc001ptb.2_Silent_p.Q2711Q	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2708					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		AGGAGGAACAGTGTGATCTTC	0.428			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								21	83	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120329880	120329880	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120329880C>G	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CTTTCCTGTTCAGAATTGTTC	0.373			T	MLL	AML								16	85	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124135314	124135314	+	IGR	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124135314A>G								OR8G2 (39004 upstream) : OR8D1 (44423 downstream)																							TATAGGCTGTATGTTTAGGGT	0.363													56	239	---	---	---	---	PASS
OR8D2	283160	broad.mit.edu	37	11	124189230	124189230	+	Silent	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124189230T>A	uc010sah.1	-	1	864	c.864A>T	c.(862-864)CTA>CTT	p.L288L		NM_001002918	NP_001002918	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D,	288	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)|central_nervous_system(1)|pancreas(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		GGCTATAGATTAGAGGATTCA	0.433													51	242	---	---	---	---	PASS
KCNA6	3742	broad.mit.edu	37	12	4920413	4920413	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4920413C>T	uc001qng.2	+	1	2072	c.1206C>T	c.(1204-1206)GAC>GAT	p.D402D		NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related	402						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						CTGACGATGACGATTCGCTTT	0.572										HNSCC(72;0.22)			25	218	---	---	---	---	PASS
ACSM4	341392	broad.mit.edu	37	12	7469835	7469835	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7469835C>T	uc001qsx.1	+	4	723	c.723C>T	c.(721-723)CAC>CAT	p.H241H		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	241					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						TGGCCCAGCACTCTCAGAGCA	0.428													5	15	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9318783	9318783	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9318783A>T	uc001qvl.2	-	18	2152	c.2123T>A	c.(2122-2124)GTA>GAA	p.V708E	PZP_uc009zgl.2_Missense_Mutation_p.V577E|PZP_uc010sgo.1_RNA|PZP_uc009zgm.1_Missense_Mutation_p.V40E	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						TGGTCTCTCTACTACTCCTAG	0.368													13	81	---	---	---	---	PASS
MANSC1	54682	broad.mit.edu	37	12	12483226	12483226	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12483226G>C	uc001rai.1	-	4	1289	c.1031C>G	c.(1030-1032)TCA>TGA	p.S344*	MANSC1_uc010shm.1_Nonsense_Mutation_p.S278*|MANSC1_uc001raj.1_Nonsense_Mutation_p.S310*|MANSC1_uc009zht.1_Nonsense_Mutation_p.S263*	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1 precursor	344	Extracellular (Potential).					integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		CTCCACATTTGACATAGAAAG	0.463													26	215	---	---	---	---	PASS
STRAP	11171	broad.mit.edu	37	12	16043599	16043599	+	Missense_Mutation	SNP	A	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16043599A>C	uc001rdc.3	+	4	753	c.399A>C	c.(397-399)GAA>GAC	p.E133D	STRAP_uc010shw.1_Missense_Mutation_p.E146D|STRAP_uc001rdd.3_Missense_Mutation_p.E39D	NM_007178	NP_009109	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated	133	WD 3.				mRNA processing|RNA splicing	cell junction|mitochondrion|spliceosomal complex	identical protein binding			skin(1)	1		Hepatocellular(102;0.121)				ACAAACCTGAAGCAGGTAAGC	0.289													14	76	---	---	---	---	PASS
KCNJ8	3764	broad.mit.edu	37	12	21926476	21926476	+	Silent	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21926476C>G	uc001rff.2	-	2	413	c.75G>C	c.(73-75)CCG>CCC	p.P25P		NM_004982	NP_004973	Q15842	IRK8_HUMAN	potassium inwardly-rectifying channel J8	25	Cytoplasmic (By similarity).					voltage-gated potassium channel complex					0					Levosimendan(DB00922)	CTCGGATGCGCGGCTTGCGCA	0.607											OREG0021704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	160	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21982000	21982000	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21982000G>T	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CATGCCTGCAGAAAACAAAAA	0.408													16	71	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26839460	26839460	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26839460C>T	uc001rhg.2	-	11	1519	c.1102G>A	c.(1102-1104)GAA>AAA	p.E368K		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	368	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					GCATCTAGTTCAAAAAGGGAT	0.413													32	171	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31307356	31307356	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31307356T>C	uc010sjy.1	-	7	724	c.724A>G	c.(724-726)AAA>GAA	p.K242E						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		ATTTGGGTTTTCCCTTGCACA	0.383													2	14	---	---	---	---	PASS
DENND5B	160518	broad.mit.edu	37	12	31540554	31540554	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31540554T>C	uc001rki.1	-	21	3994	c.3808A>G	c.(3808-3810)AAA>GAA	p.K1270E	DENND5B_uc001rkh.1_Missense_Mutation_p.K1305E|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1270						integral to membrane				ovary(1)|central_nervous_system(1)	2						TCCACTCCTTTGATGAGTGAT	0.502													8	62	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41327501	41327501	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41327501C>T	uc001rmm.1	+	9	919	c.806C>T	c.(805-807)CCT>CTT	p.P269L	CNTN1_uc009zjy.1_Missense_Mutation_p.P269L|CNTN1_uc001rmn.1_Missense_Mutation_p.P258L|CNTN1_uc001rmo.2_Missense_Mutation_p.P269L	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	269	Ig-like C2-type 3.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ATTTAAAGTCCTGTTCCGGAT	0.363													13	112	---	---	---	---	PASS
CNTN1	1272	broad.mit.edu	37	12	41327632	41327632	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41327632G>A	uc001rmm.1	+	9	1050	c.937G>A	c.(937-939)GAG>AAG	p.E313K	CNTN1_uc009zjy.1_Missense_Mutation_p.E313K|CNTN1_uc001rmn.1_Missense_Mutation_p.E302K|CNTN1_uc001rmo.2_Missense_Mutation_p.E313K	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	313	Ig-like C2-type 3.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ATGTGAGGCTGAGAACATTAG	0.348													13	90	---	---	---	---	PASS
DBX2	440097	broad.mit.edu	37	12	45410159	45410159	+	Silent	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45410159T>A	uc001rok.1	-	4	1102	c.930A>T	c.(928-930)CCA>CCT	p.P310P		NM_001004329	NP_001004329	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	310						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		CTTCTGGGGGTGGTGCCCCTG	0.483													24	124	---	---	---	---	PASS
EIF4B	1975	broad.mit.edu	37	12	53427811	53427811	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53427811C>T	uc001sbh.3	+	9	1407	c.1201C>T	c.(1201-1203)CGG>TGG	p.R401W	EIF4B_uc010snu.1_Missense_Mutation_p.R401W|EIF4B_uc010snv.1_Missense_Mutation_p.R362W|EIF4B_uc001sbi.2_Missense_Mutation_p.R153W	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	401					insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2						ACGACGGCCTCGGGAGAGGTG	0.348													3	11	---	---	---	---	PASS
CALCOCO1	57658	broad.mit.edu	37	12	54109031	54109031	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54109031T>C	uc001sef.2	-	10	1483	c.1339A>G	c.(1339-1341)AAC>GAC	p.N447D	CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Missense_Mutation_p.N362D|CALCOCO1_uc010son.1_Missense_Mutation_p.N324D|CALCOCO1_uc001seh.2_Missense_Mutation_p.N447D|CALCOCO1_uc009znd.2_Missense_Mutation_p.N447D|CALCOCO1_uc001seg.2_Missense_Mutation_p.N272D|CALCOCO1_uc010soo.1_Missense_Mutation_p.N440D	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	447	Potential.				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						AACACTTGGTTTTGGGTCCTC	0.537													34	123	---	---	---	---	PASS
ITGA5	3678	broad.mit.edu	37	12	54795380	54795380	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54795380G>A	uc001sga.2	-	23	2444	c.2376C>T	c.(2374-2376)GTC>GTT	p.V792V		NM_002205	NP_002196	P08648	ITA5_HUMAN	integrin alpha 5 precursor	792	Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			ovary(2)	2						CGTTCAGGGTGACCTGGGCCT	0.562													40	227	---	---	---	---	PASS
OR6C6	283365	broad.mit.edu	37	12	55688850	55688850	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55688850G>T	uc010sph.1	-	1	167	c.167C>A	c.(166-168)CCA>CAA	p.P56Q		NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C,	56	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|skin(1)	2						GAAATACATTGGCGTCTTGAG	0.403													11	73	---	---	---	---	PASS
ORMDL2	29095	broad.mit.edu	37	12	56214138	56214138	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56214138C>G	uc001shw.1	+	4	513	c.421C>G	c.(421-423)CAG>GAG	p.Q141E	SARNP_uc009zoa.2_5'Flank|SARNP_uc001shs.3_5'Flank|SARNP_uc001sht.2_5'Flank|DNAJC14_uc001shu.1_Intron|SARNP_uc001shv.3_5'Flank	NM_014182	NP_054901	Q53FV1	ORML2_HUMAN	ORMDL2	141					ceramide metabolic process	endoplasmic reticulum membrane|integral to membrane					0						GAAGTTGCCCCAGTTCCATGG	0.517													55	220	---	---	---	---	PASS
GNS	2799	broad.mit.edu	37	12	65115370	65115370	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65115370C>G	uc001ssg.3	-						GNS_uc001ssf.2_Intron|GNS_uc010ssq.1_Intron|GNS_uc010ssr.1_Intron	NM_002076	NP_002067	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase precursor							lysosome	metal ion binding|N-acetylglucosamine-6-sulfatase activity|protein binding			central_nervous_system(1)	1	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		AGAAGTCCCTCTTACCTCCTG	0.488													29	132	---	---	---	---	PASS
LEMD3	23592	broad.mit.edu	37	12	65564780	65564780	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65564780C>A	uc001ssl.1	+	1	1410	c.1404C>A	c.(1402-1404)TTC>TTA	p.F468L	LEMD3_uc009zqo.1_Missense_Mutation_p.F468L	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	468					negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		CAGGGAGTTTCAGTGCCCACT	0.468													30	154	---	---	---	---	PASS
KCNMB4	27345	broad.mit.edu	37	12	70824332	70824332	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70824332C>T	uc001svx.2	+	3	985	c.532C>T	c.(532-534)CTG>TTG	p.L178L	uc001svy.1_5'Flank	NM_014505	NP_055320	Q86W47	KCMB4_HUMAN	calcium-activated potassium channel beta 4	178	Helical; Name=2; (Potential).				detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			CCTCTGGCCCCTGGTGACATT	0.512													49	266	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72032189	72032189	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72032189C>G	uc001swo.2	-							NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						GAAATCAATTCTGACTTACAG	0.358													6	16	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72866928	72866928	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72866928G>T	uc001sxa.2	+	5	1447	c.1417G>T	c.(1417-1419)GGT>TGT	p.G473C		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	473	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TGAATTTGTTGGTACAGACTA	0.423													43	272	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78400750	78400750	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78400750G>C	uc001syp.2	+	8	1605	c.1432G>C	c.(1432-1434)GTT>CTT	p.V478L	NAV3_uc001syo.2_Missense_Mutation_p.V478L	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	478						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CAAAAATAAAGTTTGCACTGA	0.408										HNSCC(70;0.22)			21	85	---	---	---	---	PASS
C12orf26	84190	broad.mit.edu	37	12	82850552	82850552	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82850552G>C	uc001szq.2	+	9	1546	c.1525G>C	c.(1525-1527)GAT>CAT	p.D509H		NM_032230	NP_115606	Q8N6Q8	CL026_HUMAN	hypothetical protein LOC84190	509											0						TTCTTTTCTGGATTATGTCAG	0.303													3	12	---	---	---	---	PASS
LTA4H	4048	broad.mit.edu	37	12	96407023	96407023	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96407023T>C	uc001ten.1	-	14	1390	c.1322A>G	c.(1321-1323)AAT>AGT	p.N441S	LTA4H_uc010suy.1_Missense_Mutation_p.N403S|LTA4H_uc010suz.1_Missense_Mutation_p.N403S|LTA4H_uc010sva.1_RNA|LTA4H_uc009ztj.2_RNA	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	441					hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1						ATCAACTTGATTGAGAACATC	0.373													22	94	---	---	---	---	PASS
SLC17A8	246213	broad.mit.edu	37	12	100811899	100811899	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100811899T>A	uc010svi.1	+	11	1703	c.1390T>A	c.(1390-1392)TGT>AGT	p.C464S	SLC17A8_uc009ztx.2_Missense_Mutation_p.C414S	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	464	Helical; (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TGGAATGGTCTGTCCCCTCAT	0.502													42	233	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101491677	101491677	+	Missense_Mutation	SNP	A	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101491677A>C	uc010svm.1	+	21	2532	c.1960A>C	c.(1960-1962)ATG>CTG	p.M654L	ANO4_uc001thw.2_Missense_Mutation_p.M619L|ANO4_uc001thx.2_Missense_Mutation_p.M654L|ANO4_uc001thy.2_Missense_Mutation_p.M174L	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	654	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GGGTATTATAATGgtgctaaa	0.289										HNSCC(74;0.22)			32	237	---	---	---	---	PASS
SYCP3	50511	broad.mit.edu	37	12	102131722	102131722	+	5'UTR	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102131722G>A	uc001tiq.2	-	2					SYCP3_uc001tir.2_5'UTR|SYCP3_uc001tis.2_5'UTR	NM_153694	NP_710161	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3						cell division|male meiosis I|spermatogenesis, exchange of chromosomal proteins	nucleus	DNA binding				0						ATATTTAGATGCTTCCTGACT	0.358													72	278	---	---	---	---	PASS
ANAPC7	51434	broad.mit.edu	37	12	110834113	110834113	+	Silent	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110834113C>A	uc001tqo.2	-	2	349	c.348G>T	c.(346-348)GTG>GTT	p.V116V	ANAPC7_uc001tqp.3_Silent_p.V116V	NM_016238	NP_057322	Q9UJX3	APC7_HUMAN	anaphase-promoting complex subunit 7 isoform a	116					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding				0						TTGAAGGTCTCACTTTTGAAG	0.348													27	134	---	---	---	---	PASS
SDSL	113675	broad.mit.edu	37	12	113874664	113874664	+	Silent	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113874664T>C	uc001tvi.2	+	8	990	c.780T>C	c.(778-780)GCT>GCC	p.A260A	SDSL_uc009zwh.2_Silent_p.A260A	NM_138432	NP_612441	Q96GA7	SDSL_HUMAN	serine dehydratase-like	260					cellular amino acid metabolic process		L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	CTGTGAGCGCTGTGCAGCAGC	0.577													4	37	---	---	---	---	PASS
TAOK3	51347	broad.mit.edu	37	12	118693275	118693275	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118693275C>G	uc001twx.2	-	3	393	c.98G>C	c.(97-99)GGA>GCA	p.G33A	TAOK3_uc001twy.3_Missense_Mutation_p.G33A	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	33	ATP (By similarity).|Protein kinase.				MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCCAAAACTTCCATGTCCAAT	0.328													24	148	---	---	---	---	PASS
CRYL1	51084	broad.mit.edu	37	13	20978388	20978388	+	Intron	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20978388G>C	uc001une.2	-						CRYL1_uc001unf.2_Intron|CRYL1_uc001ung.2_Intron	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		TGTCCTGCAAGAAGGAGAAGG	0.443													23	135	---	---	---	---	PASS
WASF3	10810	broad.mit.edu	37	13	27255321	27255321	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27255321G>A	uc001uqv.2	+	8	1072	c.847G>A	c.(847-849)GAG>AAG	p.E283K	WASF3_uc001uqw.2_Missense_Mutation_p.E280K	NM_006646	NP_006637	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	283					actin filament polymerization	cytoplasm|cytoskeleton	actin binding			pancreas(1)	1	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CCAGGCTGCGGAGCATGAGTA	0.682													52	163	---	---	---	---	PASS
PAN3	255967	broad.mit.edu	37	13	28844960	28844960	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28844960C>T	uc001urz.2	+	12	1485	c.1477C>T	c.(1477-1479)CGA>TGA	p.R493*	PAN3_uc010tdo.1_Nonsense_Mutation_p.R639*|PAN3_uc001ury.2_Nonsense_Mutation_p.R327*|PAN3_uc001urx.2_Nonsense_Mutation_p.R439*	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	639	Protein kinase.|Interaction with PAN2.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		TTTGGCATGTCGAGTTATGGA	0.398													35	266	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29599209	29599209	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29599209G>A	uc001usl.3	+	1	462	c.404G>A	c.(403-405)CGG>CAG	p.R135Q		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	125						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						CAGACCACGCGGAGTATTCAG	0.493													8	141	---	---	---	---	PASS
SMAD9	4093	broad.mit.edu	37	13	37446942	37446942	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37446942C>T	uc001uvw.2	-	3	866	c.523G>A	c.(523-525)GCC>ACC	p.A175T	SMAD9_uc001uvx.2_Missense_Mutation_p.A175T|SMAD9_uc010tep.1_Missense_Mutation_p.A5T	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a	175					BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		GGATAGGTGGCGTTGTGTGGC	0.622													10	80	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41533078	41533078	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41533078G>A	uc001uxs.2	-	3	520	c.147C>T	c.(145-147)GCC>GCT	p.A49A	ELF1_uc010tfc.1_Silent_p.A49A|ELF1_uc010acd.2_5'UTR	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	49					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		AGGCTAGACCGGCATAACTAT	0.448													17	163	---	---	---	---	PASS
EPSTI1	94240	broad.mit.edu	37	13	43491753	43491753	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43491753C>G	uc001uyw.1	-	9	774	c.698G>C	c.(697-699)AGC>ACC	p.S233T	EPSTI1_uc001uyx.1_Missense_Mutation_p.S222T	NM_001002264	NP_001002264	Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 isoform 1	233										ovary(1)	1		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		GTAAGCCCAGCTTCTGGCCTG	0.388													35	193	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61985578	61985578	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61985578G>C	uc001vid.3	-	2	3018	c.2654C>G	c.(2653-2655)TCT>TGT	p.S885C	PCDH20_uc010thj.1_Missense_Mutation_p.S885C	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	858	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GGGCATACAAGACACAGATTC	0.403													14	52	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84455289	84455289	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84455289G>A	uc001vlk.2	-	1	1240	c.354C>T	c.(352-354)ATC>ATT	p.I118I		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	118	Extracellular (Potential).|LRR 3.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GAAAAGACTTGATCTTGTTGT	0.468													29	173	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88330396	88330396	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88330396G>T	uc001vln.2	+	2	2972	c.2753G>T	c.(2752-2754)AGC>ATC	p.S918I	SLITRK5_uc010tic.1_Missense_Mutation_p.S677I	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	918	Cytoplasmic (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GTGCTCTACAGCCCCCCGAGT	0.542													69	321	---	---	---	---	PASS
OXGR1	27199	broad.mit.edu	37	13	97639439	97639439	+	Missense_Mutation	SNP	A	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97639439A>C	uc001vmx.1	-	4	819	c.575T>G	c.(574-576)CTC>CGC	p.L192R	OXGR1_uc010afr.1_Missense_Mutation_p.L192R	NM_080818	NP_543008	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	192	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			AATAGTATTGAGTTCATCCGA	0.448													24	145	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103326657	103326657	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103326657C>T	uc001vpi.3	+	27	3460	c.3357C>T	c.(3355-3357)ACC>ACT	p.T1119T		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1119					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AAAAATCCACCCTCGTAGATG	0.388													12	70	---	---	---	---	PASS
CLEC14A	161198	broad.mit.edu	37	14	38724625	38724625	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38724625G>T	uc001wum.1	-	1	950	c.603C>A	c.(601-603)GCC>GCA	p.A201A		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	201	Extracellular (Potential).					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		AGTCCAGAGCGGCGCTGTGCA	0.537													44	262	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360802	42360802	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360802C>A	uc001wvm.2	+	4	2933	c.1735C>A	c.(1735-1737)CAA>AAA	p.Q579K	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	579	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GGCTCAAATACAAGGCTGTAG	0.453										HNSCC(30;0.082)			9	116	---	---	---	---	PASS
FRMD6	122786	broad.mit.edu	37	14	52192507	52192507	+	Silent	SNP	G	C	C	rs147239419		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52192507G>C	uc001wzd.2	+	13	1788	c.1503G>C	c.(1501-1503)GTG>GTC	p.V501V	FRMD6_uc001wzb.2_Silent_p.V493V|FRMD6_uc001wzc.2_Silent_p.V493V|FRMD6_uc001wze.2_Silent_p.V424V|FRMD6_uc001wzf.2_Silent_p.V194V|FRMD6_uc001wzg.2_Silent_p.V143V	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6	501						cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					GGTTGATTGTGAAAGAAATTG	0.358													16	136	---	---	---	---	PASS
TBPL2	387332	broad.mit.edu	37	14	55903374	55903374	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55903374C>T	uc001xby.2	-	2	513	c.513G>A	c.(511-513)GAG>GAA	p.E171E		NM_199047	NP_950248	Q6SJ96	TBPL2_HUMAN	TATA box binding protein like 2	171					multicellular organismal development|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding				0						AGTTTGGTTTCTCAGGAGAGG	0.493													61	93	---	---	---	---	PASS
MTHFD1	4522	broad.mit.edu	37	14	64906988	64906988	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64906988G>T	uc001xhb.2	+						MTHFD1_uc010aqe.2_Missense_Mutation_p.G643C|MTHFD1_uc010aqf.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	AGATCTGGTGGGTACCCAGAC	0.478													11	69	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68228958	68228958	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68228958C>G	uc001xka.2	-	34	6470	c.6331G>C	c.(6331-6333)GAG>CAG	p.E2111Q	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkb.2_5'Flank|ZFYVE26_uc001xkc.3_Missense_Mutation_p.E2111Q	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2111					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCTAGGTACTCAACCACATCC	0.542													25	57	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68238752	68238752	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68238752G>T	uc001xka.2	-						ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkc.3_Intron	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26						cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGTGGAGACCGATGCTGCTTA	0.542													3	32	---	---	---	---	PASS
SIPA1L1	26037	broad.mit.edu	37	14	72054674	72054674	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72054674G>A	uc001xms.2	+	2	433	c.85G>A	c.(85-87)GTC>ATC	p.V29I	SIPA1L1_uc001xmt.2_Missense_Mutation_p.V29I|SIPA1L1_uc001xmu.2_Missense_Mutation_p.V29I|SIPA1L1_uc001xmv.2_Missense_Mutation_p.V29I	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	29					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CACCCCCAAAGTCCACACTGA	0.527													61	145	---	---	---	---	PASS
TMEM90A	646658	broad.mit.edu	37	14	74876048	74876048	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74876048C>T	uc001xpx.2	-	2	648	c.400G>A	c.(400-402)GAC>AAC	p.D134N		NM_001105579	NP_001099049	A6NDD5	SYN1L_HUMAN	transmembrane protein 90A	134					response to biotic stimulus	Golgi apparatus|integral to membrane					0				BRCA - Breast invasive adenocarcinoma(234;0.00159)		TCCTCCTGGTCATCCTCCTGG	0.408													119	238	---	---	---	---	PASS
NDN	4692	broad.mit.edu	37	15	23932119	23932119	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23932119G>T	uc001ywk.2	-	1	332	c.246C>A	c.(244-246)GCC>GCA	p.A82A		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	82					negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CCGCGCTCGGGGCCTGGTGGG	0.766									Prader-Willi_syndrome				10	17	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24922909	24922909	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24922909C>T	uc001ywo.2	+	1	2369	c.1895C>T	c.(1894-1896)ACC>ATC	p.T632I		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	632					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CACAATACCACCCCAAGTTTT	0.498													8	179	---	---	---	---	PASS
FMN1	342184	broad.mit.edu	37	15	33359183	33359183	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33359183C>G	uc001zhf.3	-	1	903	c.903G>C	c.(901-903)AAG>AAC	p.K301N	FMN1_uc001zhg.2_Missense_Mutation_p.K301N	NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		AGTCCCCATCCTTTGGTTTAA	0.502													16	59	---	---	---	---	PASS
C15orf24	56851	broad.mit.edu	37	15	34380305	34380305	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34380305T>C	uc001zhm.2	-	4	538	c.525A>G	c.(523-525)ATA>ATG	p.I175M	C15orf24_uc001zhn.2_Missense_Mutation_p.I58M	NM_020154	NP_064539	Q9NPA0	CO024_HUMAN	chromosome 15 open reading frame 24 precursor	175	Helical; (Potential).					cytoplasm|integral to membrane	carbohydrate binding|carboxypeptidase activity|purine nucleotide binding				0		all_lung(180;1.76e-08)		all cancers(64;2.02e-17)|GBM - Glioblastoma multiforme(113;2.15e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		GAAGCACAAATATCAATAAAG	0.328													11	35	---	---	---	---	PASS
SPRED1	161742	broad.mit.edu	37	15	38591612	38591612	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38591612G>C	uc001zka.3	+	2	406	c.71G>C	c.(70-72)CGA>CCA	p.R24P		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain	24	WH1.				inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GTGATGACCCGAGATGACTCA	0.458									Legius_syndrome				21	99	---	---	---	---	PASS
SPRED1	161742	broad.mit.edu	37	15	38614556	38614556	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38614556G>A	uc001zka.3	+	3	657	c.322G>A	c.(322-324)GAT>AAT	p.D108N		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain	108	WH1.				inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AAGTCCTGCTGATGCTAGGGC	0.343									Legius_syndrome				8	180	---	---	---	---	PASS
SLTM	79811	broad.mit.edu	37	15	59179632	59179632	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59179632C>G	uc002afp.2	-	18	2571	c.2483G>C	c.(2482-2484)AGA>ACA	p.R828T	SLTM_uc002afn.2_Missense_Mutation_p.R370T|SLTM_uc002afo.2_Missense_Mutation_p.R810T|SLTM_uc002afq.2_Missense_Mutation_p.R397T|SLTM_uc010bgd.2_Missense_Mutation_p.R397T	NM_024755	NP_079031	Q9NWH9	SLTM_HUMAN	modulator of estrogen induced transcription	828	Arg/Glu-rich.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)	1						AGGCTCATTTCTTCTGGAGTC	0.468													51	177	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65772652	65772652	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65772652C>T	uc002aov.2	-	10	2830	c.1252G>A	c.(1252-1254)GAT>AAT	p.D418N	DPP8_uc002aow.2_Missense_Mutation_p.D418N|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.D402N|DPP8_uc002aoy.2_Missense_Mutation_p.D418N|DPP8_uc002aoz.2_Missense_Mutation_p.D402N|DPP8_uc010bhj.2_Missense_Mutation_p.D418N|DPP8_uc002apa.2_Missense_Mutation_p.D315N|DPP8_uc010bhk.1_Intron	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	418					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						TCCATAACATCATCTTCTACT	0.393													21	55	---	---	---	---	PASS
PDIA2	64714	broad.mit.edu	37	16	335575	335575	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:335575G>C	uc002cgn.1	+	12	2099	c.991G>C	c.(991-993)GAG>CAG	p.E331Q	PDIA2_uc010bqt.1_Missense_Mutation_p.E176Q|PDIA2_uc002cgo.1_Missense_Mutation_p.E331Q	NM_006849	NP_006840	Q13087	PDIA2_HUMAN	protein disulfide isomerase A2 precursor	331					apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding			central_nervous_system(1)|skin(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				ACTCAAGGCTGAGGCAGCCCC	0.612													22	152	---	---	---	---	PASS
TMEM8A	58986	broad.mit.edu	37	16	424308	424308	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:424308G>C	uc002cgu.3	-	10	1797	c.1668C>G	c.(1666-1668)CTC>CTG	p.L556L	TMEM8A_uc002cgv.3_Silent_p.L363L	NM_021259	NP_067082	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8 (five membrane-spanning	556	Helical; (Potential).				cell adhesion	integral to plasma membrane				central_nervous_system(2)|pancreas(1)	3						CCAGGAACATGAGGTTGCTGA	0.657											OREG0003702	type=REGULATORY REGION|Gene=TMEM8|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	154	---	---	---	---	PASS
ZSCAN10	84891	broad.mit.edu	37	16	3139147	3139147	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3139147C>T	uc002ctv.1	-	5	2211	c.2123G>A	c.(2122-2124)CGC>CAC	p.R708H	ZSCAN10_uc002cty.1_Missense_Mutation_p.R369H|ZSCAN10_uc002ctw.1_Missense_Mutation_p.R626H|ZSCAN10_uc002ctx.1_Missense_Mutation_p.R636H	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	708	C2H2-type 14.				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						GTGGGAGTTGCGGCTGAAGCT	0.706													3	26	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4935007	4935007	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4935007C>G	uc002cyd.1	-	22	3739	c.3649G>C	c.(3649-3651)GAG>CAG	p.E1217Q		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	1217	Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						CTGAGGGCCTCCAGCTCACTC	0.597													32	157	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16103674	16103674	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16103674C>T	uc010bvi.2	+	3	442	c.267C>T	c.(265-267)CTC>CTT	p.L89L	ABCC1_uc010bvj.2_Silent_p.L89L|ABCC1_uc010bvk.2_Silent_p.L89L|ABCC1_uc010bvl.2_Silent_p.L89L|ABCC1_uc010bvm.2_Silent_p.L89L|ABCC1_uc002del.3_5'UTR	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	89	Helical; Name=2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	GGGCAGACCTCTTCTACTCTT	0.552													28	365	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19505576	19505576	+	Intron	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19505576C>G	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron|TMC5_uc002dge.3_Intron|TMC5_uc002dgf.3_Intron|TMC5_uc002dgg.3_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						TGTTTTCCTTCTTGGTAGGAG	0.398													33	179	---	---	---	---	PASS
RBBP6	5930	broad.mit.edu	37	16	24582687	24582687	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24582687C>G	uc002dmh.2	+	18	5340	c.4300C>G	c.(4300-4302)CTG>GTG	p.L1434V	RBBP6_uc002dmi.2_Missense_Mutation_p.L1400V|RBBP6_uc010bxr.2_Missense_Mutation_p.L594V|RBBP6_uc002dmk.2_Missense_Mutation_p.L1267V	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	1434	Interaction with p53 (By similarity).				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		TTTGGACCGTCTGAATGAACA	0.398													26	116	---	---	---	---	PASS
SHCBP1	79801	broad.mit.edu	37	16	46649999	46649999	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46649999G>A	uc002eec.3	-	4	495	c.455C>T	c.(454-456)TCT>TTT	p.S152F		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	152										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				GCTCACTTGAGAGTCACAGAG	0.473													15	120	---	---	---	---	PASS
CYLD	1540	broad.mit.edu	37	16	50830242	50830242	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50830242G>C	uc002egp.1	+	19	3109	c.2694G>C	c.(2692-2694)CAG>CAC	p.Q898H	CYLD_uc002egq.1_Missense_Mutation_p.Q895H|CYLD_uc002egr.1_Missense_Mutation_p.Q895H	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	898					cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				TAGGTGGTCAGAATGGCTTCA	0.438			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				3	86	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57238833	57238833	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57238833G>A	uc002elb.2	+	2	541	c.263G>A	c.(262-264)CGA>CAA	p.R88Q	RSPRY1_uc002elc.2_Missense_Mutation_p.R88Q|RSPRY1_uc002eld.2_Missense_Mutation_p.R88Q|RSPRY1_uc002ele.1_Missense_Mutation_p.R88Q	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	88						extracellular region	zinc ion binding			ovary(1)	1						AGGAGGGGCCGAGGACCTCAT	0.527													25	99	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61851444	61851444	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61851444G>C	uc002eog.1	-	7	1468	c.1216C>G	c.(1216-1218)CTA>GTA	p.L406V	CDH8_uc002eoh.2_Missense_Mutation_p.L175V	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	406	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ACGGAGTTTAGAGCAGCATTT	0.433													16	93	---	---	---	---	PASS
THAP11	57215	broad.mit.edu	37	16	67876805	67876805	+	Silent	SNP	A	G	G	rs28434205	byFrequency	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67876805A>G	uc002euo.2	+	1	593	c.348A>G	c.(346-348)CAA>CAG	p.Q116Q	CENPT_uc002eun.3_Intron	NM_020457	NP_065190	Q96EK4	THA11_HUMAN	THAP domain containing 11	116	Gln-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		aacagcagcaacagcagcagc	0.303													6	38	---	---	---	---	PASS
HPR	3250	broad.mit.edu	37	16	72108264	72108264	+	Missense_Mutation	SNP	G	A	A	rs152833		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72108264G>A	uc002fby.2	+	3	203	c.173G>A	c.(172-174)AGA>AAA	p.R58K	TXNL4B_uc010cgl.2_Intron	NM_020995	NP_066275	P00739	HPTR_HUMAN	haptoglobin-related protein precursor	58	Sushi.				proteolysis	spherical high-density lipoprotein particle	hemoglobin binding|serine-type endopeptidase activity			central_nervous_system(1)	1		Ovarian(137;0.125)				AACTACTACAGACTGCGCACA	0.507													28	98	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	T	T	rs28934576	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577120C>T	uc002gim.2	-	8	1012	c.818G>A	c.(817-819)CGT>CAT	p.R273H	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141H|TP53_uc010cng.1_Missense_Mutation_p.R141H|TP53_uc002gii.1_Missense_Mutation_p.R141H|TP53_uc010cnh.1_Missense_Mutation_p.R273H|TP53_uc010cni.1_Missense_Mutation_p.R273H|TP53_uc002gij.2_Missense_Mutation_p.R273H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACAAACACGCACCTCAAA	0.542	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			13	41	---	---	---	---	PASS
KSR1	8844	broad.mit.edu	37	17	25938601	25938601	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25938601C>T	uc010crg.2	+	19	2539	c.2094C>T	c.(2092-2094)AGC>AGT	p.S698S	KSR1_uc002gzm.2_Silent_p.S477S|KSR1_uc002gzn.2_Silent_p.S49S	NM_014238	NP_055053	Q8IVT5	KSR1_HUMAN	kinase suppressor of ras	833	Protein kinase.				Ras protein signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(1)	4	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		AGATTGGAAGCGGGGAAGGAA	0.567													14	68	---	---	---	---	PASS
IFT20	90410	broad.mit.edu	37	17	26655743	26655743	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26655743C>T	uc002haw.1	-	5	466	c.334G>A	c.(334-336)GAA>AAA	p.E112K	IFT20_uc002hau.1_3'UTR|IFT20_uc002hav.1_Missense_Mutation_p.E138K|TNFAIP1_uc002hax.1_5'Flank			Q8IY31	IFT20_HUMAN	RecName: Full=Intraflagellar transport protein 20 homolog;          Short=hIFT20;	112	IFT57-binding (By similarity).|Potential.				cell projection organization	centriole|cilium|Golgi apparatus|microtubule basal body	protein binding				0	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		CACAAAGCTTCATATTCAACC	0.318													6	51	---	---	---	---	PASS
IFT20	90410	broad.mit.edu	37	17	26655748	26655748	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26655748T>A	uc002haw.1	-	5	461	c.329A>T	c.(328-330)GAA>GTA	p.E110V	IFT20_uc002hau.1_Nonstop_Mutation_p.*149C|IFT20_uc002hav.1_Missense_Mutation_p.E136V|TNFAIP1_uc002hax.1_5'Flank			Q8IY31	IFT20_HUMAN	RecName: Full=Intraflagellar transport protein 20 homolog;          Short=hIFT20;	110	IFT57-binding (By similarity).|Potential.				cell projection organization	centriole|cilium|Golgi apparatus|microtubule basal body	protein binding				0	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		AGCTTCATATTCAACCCGATA	0.313													6	52	---	---	---	---	PASS
NEK8	284086	broad.mit.edu	37	17	27065226	27065226	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27065226C>G	uc002hcp.2	+	8	1185	c.1185C>G	c.(1183-1185)CAC>CAG	p.H395Q		NM_178170	NP_835464	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	395						cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6	Lung NSC(42;0.0158)					CCATCAAGCACGTGGCCTGTG	0.627													18	118	---	---	---	---	PASS
CRLF3	51379	broad.mit.edu	37	17	29111225	29111225	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29111225A>G	uc002hfr.3	-	8	1418	c.1309T>C	c.(1309-1311)TGG>CGG	p.W437R	CRLF3_uc010wbr.1_Missense_Mutation_p.W321R	NM_015986	NP_057070	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	437					negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				AACACTTTCCATCCAGGATAG	0.378													16	78	---	---	---	---	PASS
PNMT	5409	broad.mit.edu	37	17	37824826	37824826	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37824826G>A	uc002hsi.1	+	1	320	c.98G>A	c.(97-99)CGC>CAC	p.R33H		NM_002686	NP_002677	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	33					catecholamine biosynthetic process|hormone biosynthetic process	cytosol	phenylethanolamine N-methyltransferase activity			ovary(1)	1	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TTCGAGCCGCGCGCCTACCTC	0.731													6	21	---	---	---	---	PASS
KRT24	192666	broad.mit.edu	37	17	38859884	38859884	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38859884G>C	uc002hvd.2	-	1	119	c.62C>G	c.(61-63)TCT>TGT	p.S21C		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	21	Head.|Gly-rich.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				TCCACCAGCAGACACCCTGGC	0.637													5	105	---	---	---	---	PASS
ATXN7L3	56970	broad.mit.edu	37	17	42273202	42273202	+	Intron	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42273202G>C	uc002iga.2	-						ATXN7L3_uc010wiv.1_5'Flank|ATXN7L3_uc002ifz.2_Intron	NM_001098833	NP_001092303	Q14CW9	AT7L3_HUMAN	ataxin 7-like 3 isoform b						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|metal ion binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TTCCCCTGAAGAAGAAAAAAG	0.507													8	26	---	---	---	---	PASS
SCPEP1	59342	broad.mit.edu	37	17	55079507	55079507	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55079507C>G	uc002iuv.3	+	12	1314	c.1261C>G	c.(1261-1263)CTT>GTT	p.L421V	SCPEP1_uc010dcl.2_RNA|SCPEP1_uc010wnk.1_Missense_Mutation_p.L371V	NM_021626	NP_067639	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1 precursor	421					proteolysis	extracellular region	serine-type carboxypeptidase activity			skin(1)	1	Breast(9;2.86e-08)					CTACAAGAACCTTGCTTTCTA	0.438													30	117	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60038399	60038399	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60038399T>C	uc002izo.2	-	23	5386	c.5309A>G	c.(5308-5310)AAG>AGG	p.K1770R		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1770					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						CTGTTTGTCCTTCACTGGAGC	0.348													26	112	---	---	---	---	PASS
ERN1	2081	broad.mit.edu	37	17	62130629	62130629	+	Intron	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62130629C>T	uc002jdz.2	-							NM_001433	NP_001424	O75460	ERN1_HUMAN	endoplasmic reticulum to nucleus signalling 1						activation of signaling protein activity involved in unfolded protein response|apoptosis|cell cycle arrest|induction of apoptosis|mRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to endoplasmic reticulum membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(4)|lung(2)|stomach(1)|ovary(1)|kidney(1)	9						TGCAGCCTCTCACCGATGTTG	0.632													16	95	---	---	---	---	PASS
TEX2	55852	broad.mit.edu	37	17	62272454	62272454	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62272454C>A	uc002jec.2	-	3	1819	c.1646G>T	c.(1645-1647)GGA>GTA	p.G549V	TEX2_uc002jed.2_Missense_Mutation_p.G549V|TEX2_uc002jee.2_Missense_Mutation_p.G549V	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	549					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		ATTCATCCATCCCTGATGAAG	0.373													24	68	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67023959	67023959	+	Intron	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67023959G>A	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					GACTGAACCTGAAAGCAGAAG	0.353													15	120	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67146196	67146196	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67146196G>C	uc010dfa.1	-	38	5285	c.4406C>G	c.(4405-4407)TCT>TGT	p.S1469C	ABCA10_uc002jhz.2_RNA|ABCA10_uc010wqs.1_Missense_Mutation_p.S461C|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	1469					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					CGCCATTAAAGAGGAATATCT	0.363													4	90	---	---	---	---	PASS
GRIN2C	2905	broad.mit.edu	37	17	72840614	72840614	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72840614G>A	uc002jlt.1	-	12	2540	c.2384C>T	c.(2383-2385)TCA>TTA	p.S795L	GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_Missense_Mutation_p.S795L	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C	795	Extracellular (Potential).				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)	GCAGATCCCTGAGAGCCACAC	0.557													52	413	---	---	---	---	PASS
OTOP2	92736	broad.mit.edu	37	17	72926486	72926486	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72926486C>T	uc010wrp.1	+	7	845	c.756C>T	c.(754-756)CTC>CTT	p.L252L		NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	252	Helical; (Potential).					integral to membrane				ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)					AGTACAGCCTCTTCGCCTCCA	0.587													83	771	---	---	---	---	PASS
OTOP2	92736	broad.mit.edu	37	17	72926487	72926487	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72926487T>A	uc010wrp.1	+	7	846	c.757T>A	c.(757-759)TTC>ATC	p.F253I		NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	253	Helical; (Potential).					integral to membrane				ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)					GTACAGCCTCTTCGCCTCCAC	0.592													81	763	---	---	---	---	PASS
MIF4GD	57409	broad.mit.edu	37	17	73263722	73263722	+	Intron	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73263722G>C	uc002jnr.2	-						MIF4GD_uc002jno.2_Intron|MIF4GD_uc002jnp.2_Intron|MIF4GD_uc002jnq.2_Intron			A9UHW6	MI4GD_HUMAN	RecName: Full=MIF4G domain-containing protein; AltName: Full=SLBP-interacting protein 1;          Short=hSLIP1;						regulation of translation|RNA metabolic process	cytoplasm|nucleus	protein C-terminus binding			ovary(1)	1	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			CTGTGAGGAAGAGGAGGGGTC	0.622													10	311	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73723837	73723837	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73723837G>C	uc002jpg.2	+	5	557	c.370G>C	c.(370-372)GAG>CAG	p.E124Q	ITGB4_uc002jph.2_Missense_Mutation_p.E124Q|ITGB4_uc010dgo.2_Missense_Mutation_p.E124Q|ITGB4_uc002jpi.3_Missense_Mutation_p.E124Q|ITGB4_uc010dgp.1_Missense_Mutation_p.E124Q|ITGB4_uc002jpj.2_Missense_Mutation_p.E124Q	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	124	Extracellular (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGAGGTGTTTGAGCCACTGGA	0.612													13	135	---	---	---	---	PASS
CDK3	1018	broad.mit.edu	37	17	73998415	73998415	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73998415C>T	uc010dgt.2	+	5	478	c.402C>T	c.(400-402)CTC>CTT	p.L134L	CDK3_uc002jqg.3_Silent_p.L162L	NM_001258	NP_001249	Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	134	Protein kinase.				cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity			central_nervous_system(1)	1						AGAACCTGCTCATCAATGAGT	0.592													6	249	---	---	---	---	PASS
CDK3	1018	broad.mit.edu	37	17	73998597	73998597	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73998597G>A	uc010dgt.2	+	6	568	c.492G>A	c.(490-492)GTG>GTA	p.V164V	CDK3_uc002jqg.3_Silent_p.V192V	NM_001258	NP_001249	Q00526	CDK3_HUMAN	cyclin-dependent kinase 3	164	Protein kinase.				cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity			central_nervous_system(1)	1						TGCAGGTGGTGACACTGTGGT	0.532													10	218	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5398145	5398145	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5398145G>T	uc002kmt.1	-						EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Intron|EPB41L3_uc010wzf.1_Intron|EPB41L3_uc010wzg.1_Intron|EPB41L3_uc010dkr.2_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TGCTTAGTCTGAGTGAACAAA	0.438													76	354	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8394534	8394534	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8394534G>T	uc002knn.3	+	30	4733	c.4230G>T	c.(4228-4230)CGG>CGT	p.R1410R	PTPRM_uc010dkv.2_Silent_p.R1423R|PTPRM_uc010wzl.1_Silent_p.R1197R	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1410	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				AGATGCTCCGGCACCAGAGAA	0.562													6	49	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13056361	13056361	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13056361G>T	uc010xac.1	+	19	3852	c.3772G>T	c.(3772-3774)GCT>TCT	p.A1258S	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.A783S|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_5'UTR|CEP192_uc002krs.1_Missense_Mutation_p.A999S	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1258										ovary(4)|pancreas(1)	5						CTCTCTCAGCGCTGCTCCTTT	0.552													21	73	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25593661	25593661	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25593661C>T	uc002kwg.2	-	3	844	c.385G>A	c.(385-387)GAG>AAG	p.E129K	CDH2_uc010xbn.1_Missense_Mutation_p.E98K	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	129					adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						ACTGACTCCTCAGTTAAGGTT	0.418													52	229	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32462073	32462073	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32462073G>C	uc010dmn.1	+	20	2123	c.2122G>C	c.(2122-2124)GAA>CAA	p.E708Q	DTNA_uc002kxw.2_Missense_Mutation_p.E651Q|DTNA_uc010dmj.2_Missense_Mutation_p.E648Q|DTNA_uc002kxz.2_Missense_Mutation_p.E655Q|DTNA_uc002kxy.2_Missense_Mutation_p.E648Q|DTNA_uc010xby.1_Missense_Mutation_p.E398Q|DTNA_uc010xbz.1_Missense_Mutation_p.E417Q|DTNA_uc010xca.1_Missense_Mutation_p.E360Q|DTNA_uc002kye.2_Missense_Mutation_p.E356Q	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1	708					neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						GCCTGAAGATGAAAACTATGA	0.443													26	129	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42531989	42531989	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42531989A>G	uc010dni.2	+	4	2980	c.2684A>G	c.(2683-2685)GAT>GGT	p.D895G		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	895						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TACTCTTTTGATTTCTGCTCC	0.552									Schinzel-Giedion_syndrome				8	31	---	---	---	---	PASS
POLI	11201	broad.mit.edu	37	18	51813728	51813728	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51813728G>T	uc002lfj.3	+	8	1213	c.1145G>T	c.(1144-1146)CGT>CTT	p.R382L	POLI_uc010xds.1_Missense_Mutation_p.R303L|POLI_uc002lfk.3_Missense_Mutation_p.R279L|POLI_uc010dpg.2_5'UTR	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota	382	DNA binding.				DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		CACTATGGTCGTGAGAGTCGT	0.403								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					6	25	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67816221	67816221	+	Missense_Mutation	SNP	T	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67816221T>G	uc002lkp.2	-	17	2293	c.2225A>C	c.(2224-2226)AAA>ACA	p.K742T	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_5'UTR	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	742							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				AGAACTTGCTTTGCTTAGAAG	0.393													30	154	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72346592	72346592	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72346592C>A	uc002llw.2	+	1	3674	c.3617C>A	c.(3616-3618)TCT>TAT	p.S1206Y	ZNF407_uc010xfc.1_Missense_Mutation_p.S1206Y|ZNF407_uc010dqu.1_Missense_Mutation_p.S1206Y|ZNF407_uc002llu.2_Missense_Mutation_p.S1205Y	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1206					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TCAGGAAGCTCTGCCTTAAAT	0.438													7	42	---	---	---	---	PASS
ANGPTL4	51129	broad.mit.edu	37	19	8438651	8438651	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8438651C>T	uc002mjq.1	+	7	1297	c.1102C>T	c.(1102-1104)CCA>TCA	p.P368S	ANGPTL4_uc002mjr.1_Missense_Mutation_p.P330S|ANGPTL4_uc010xkc.1_Missense_Mutation_p.P201S	NM_139314	NP_647475	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4 protein isoform a precursor	368	Fibrinogen C-terminal.				angiogenesis|cell differentiation|cellular lipid metabolic process|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|positive regulation of angiogenesis|response to hypoxia|signal transduction|triglyceride homeostasis	extracellular space|proteinaceous extracellular matrix	enzyme inhibitor activity|receptor binding			ovary(1)	1						CCGCTCCATCCCACAGCAGCG	0.612													79	403	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9017381	9017381	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9017381G>A	uc002mkp.2	-	26	38147	c.37943C>T	c.(37942-37944)CCC>CTC	p.P12648L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12650	SEA 4.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAGGGTGTAGGGGCCCAGCTC	0.557													68	418	---	---	---	---	PASS
OR7D2	162998	broad.mit.edu	37	19	9297353	9297353	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9297353G>A	uc002mkz.1	+	1	1084	c.896G>A	c.(895-897)GGA>GAA	p.G299E		NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D,	299	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|upper_aerodigestive_tract(1)	3						GATGTGAAGGGAGCCCTGGGG	0.527													15	88	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9577788	9577788	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9577788C>A	uc002mlp.1	-	10	2045	c.1835G>T	c.(1834-1836)CGC>CTC	p.R612L	ZNF560_uc010dwr.1_Missense_Mutation_p.R506L	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	612	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						AAGATCTGAGCGTTCTGTGAA	0.413													34	224	---	---	---	---	PASS
CCDC159	126075	broad.mit.edu	37	19	11460356	11460356	+	Missense_Mutation	SNP	A	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11460356A>C	uc010xlw.1	+	3	376	c.297A>C	c.(295-297)AAA>AAC	p.K99N	CCDC159_uc010xlr.1_Missense_Mutation_p.K16N|CCDC159_uc010xls.1_Missense_Mutation_p.K16N|CCDC159_uc010xlt.1_Missense_Mutation_p.K16N|CCDC159_uc010xlu.1_Missense_Mutation_p.K15N|CCDC159_uc010xlv.1_Missense_Mutation_p.K15N	NM_001080503	NP_001073972	P0C7I6	CC159_HUMAN	coiled-coil domain-containing-like	131										ovary(1)	1						GCTCTTCCAAAGTCAAAGGTG	0.512													4	36	---	---	---	---	PASS
STX10	8677	broad.mit.edu	37	19	13255227	13255227	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13255227G>C	uc010xnb.1	-	8	747	c.747C>G	c.(745-747)CTC>CTG	p.L249L	STX10_uc002mwn.2_3'UTR|STX10_uc002mwo.2_3'UTR|STX10_uc010xna.1_RNA|STX10_uc010xnc.1_Silent_p.L150L	NM_003765	NP_003756	O60499	STX10_HUMAN	syntaxin 10	249	Helical; Anchor for type IV membrane protein; (Potential).				Golgi vesicle transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane	SNAP receptor activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			GCTGGGGTCAGAGAGAGAATA	0.632													3	38	---	---	---	---	PASS
STX10	8677	broad.mit.edu	37	19	13255242	13255242	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13255242G>C	uc010xnb.1	-	8	732	c.732C>G	c.(730-732)ATC>ATG	p.I244M	STX10_uc002mwn.2_3'UTR|STX10_uc002mwo.2_3'UTR|STX10_uc010xna.1_RNA|STX10_uc010xnc.1_Missense_Mutation_p.I145M	NM_003765	NP_003756	O60499	STX10_HUMAN	syntaxin 10	244	Helical; Anchor for type IV membrane protein; (Potential).				Golgi vesicle transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane	SNAP receptor activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			AGAATAGTAAGATGAGAACGA	0.627													5	39	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17735767	17735767	+	Intron	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17735767G>T	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TCAGGCTGGGGACGAGGGGCA	0.567													16	83	---	---	---	---	PASS
JAK3	3718	broad.mit.edu	37	19	17951112	17951112	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17951112G>A	uc002nhn.3	-	9	1281	c.1181C>T	c.(1180-1182)TCA>TTA	p.S394L	JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Missense_Mutation_p.S394L|JAK3_uc010xpx.1_Missense_Mutation_p.S394L	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	394	SH2; atypical.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						GCCAGGACGTGAGCCCCCAGT	0.537		2	Mis		acute megakaryocytic leukemia|								17	68	---	---	---	---	PASS
ZNF570	148268	broad.mit.edu	37	19	37975043	37975043	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37975043G>A	uc002ogk.1	+	5	1048	c.519G>A	c.(517-519)CAG>CAA	p.Q173Q	ZNF570_uc010efl.1_Silent_p.Q229Q|ZNF570_uc010xtr.1_5'UTR	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570	173					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTTTTCATCAGAACCCACTGC	0.348													65	242	---	---	---	---	PASS
ZNF793	390927	broad.mit.edu	37	19	38028524	38028524	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38028524G>A	uc010efm.2	+	8	1406	c.964G>A	c.(964-966)GAG>AAG	p.E322K	ZNF793_uc010xts.1_Missense_Mutation_p.E322K|ZNF793_uc010efo.2_Intron	NM_001013659	NP_001013681	Q6ZN11	ZN793_HUMAN	zinc finger protein 793	322	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATCGTTTGGTGAGAAGTCATA	0.468													9	65	---	---	---	---	PASS
ECH1	1891	broad.mit.edu	37	19	39307163	39307163	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39307163C>A	uc002oji.2	-	7	674	c.589G>T	c.(589-591)GAG>TAG	p.E197*	ECH1_uc002ojh.2_Nonsense_Mutation_p.E77*	NM_001398	NP_001389	Q13011	ECH1_HUMAN	peroxisomal enoyl-coenzyme A hydratase-like	197		Important for catalytic activity (By similarity).			fatty acid beta-oxidation|generation of precursor metabolites and energy	mitochondrion|peroxisome	enoyl-CoA hydratase activity|isomerase activity|protein binding			ovary(1)	1	all_cancers(60;9.36e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			ACGTCCACCTCCTGGGGGAGG	0.597													5	63	---	---	---	---	PASS
NKPD1	284353	broad.mit.edu	37	19	45655260	45655260	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45655260C>A	uc010xxi.1	-	4	2435	c.2435G>T	c.(2434-2436)GGC>GTC	p.G812V		NM_198478	NP_940880			NTPase, KAP family P-loop domain containing 1												0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		CCATAGCTTGCCCCTGTGGGC	0.701													4	51	---	---	---	---	PASS
SAE1	10055	broad.mit.edu	37	19	47700589	47700589	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47700589A>G	uc002pgc.2	+	7	889	c.833A>G	c.(832-834)GAC>GGC	p.D278G	SAE1_uc002pgd.2_Intron|SAE1_uc010ekx.2_Intron|SAE1_uc010ekw.2_RNA|SAE1_uc010xyk.1_Missense_Mutation_p.D104G|SAE1_uc002pge.2_Missense_Mutation_p.D214G	NM_016402	NP_057486	Q9UBE0	SAE1_HUMAN	SubName: Full=SUMO-1 activating enzyme subunit 1, isoform CRA_b; SubName: Full=cDNA, FLJ96708, Homo sapiens SUMO-1 activating enzyme subunit 1 (SAE1), mRNA;	278					protein sumoylation|protein ubiquitination	nucleus	ATP-dependent protein binding|enzyme activator activity|ligase activity|protein C-terminus binding|protein heterodimerization activity|ubiquitin activating enzyme activity			ovary(1)	1		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		GATGTGCTTGACTCACTGGGT	0.418													59	234	---	---	---	---	PASS
TMEM143	55260	broad.mit.edu	37	19	48845779	48845779	+	Intron	SNP	A	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48845779A>T	uc002pix.1	-						TMEM143_uc002piw.1_Intron|TMEM143_uc002piy.1_Intron|TMEM143_uc010xzn.1_Intron|TMEM143_uc010elw.1_Intron|TMEM143_uc010xzo.1_Intron	NM_018273	NP_060743	Q96AN5	TM143_HUMAN	transmembrane protein 143							integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		TGGCAGGCGCATGCTCACCTT	0.617													4	27	---	---	---	---	PASS
NOSIP	51070	broad.mit.edu	37	19	50058997	50058997	+	3'UTR	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50058997C>G	uc002pok.2	-	10					NOSIP_uc002pol.2_3'UTR	NM_015953	NP_057037	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein						negative regulation of nitric-oxide synthase activity|nitric oxide metabolic process	cytosol|nucleus	protein binding			skin(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		TATTTGGTCTCCCGCACACAC	0.667													21	114	---	---	---	---	PASS
C19orf76	199800	broad.mit.edu	37	19	50193365	50193365	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50193365G>A	uc002pph.2	+	2	1230	c.77G>A	c.(76-78)CGA>CAA	p.R26Q	CPT1C_uc002ppl.3_5'Flank|CPT1C_uc002ppi.2_5'Flank|CPT1C_uc002ppk.2_5'Flank|CPT1C_uc010eng.2_5'Flank|CPT1C_uc010enh.2_5'Flank|CPT1C_uc002ppj.2_5'Flank|CPT1C_uc010ybc.1_5'Flank	NM_001101340	NP_001094810	C9JUS6	ADM5_HUMAN	hypothetical protein LOC199800	26						extracellular region					0						CTCTCCAGGCGAGGCCAGCAC	0.637											OREG0025628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	5	---	---	---	---	PASS
GPR32	2854	broad.mit.edu	37	19	51274865	51274865	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51274865G>A	uc010ycf.1	+	1	1008	c.1008G>A	c.(1006-1008)GCG>GCA	p.A336A		NM_001506	NP_001497	O75388	GPR32_HUMAN	G protein-coupled receptor 32	336	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CTGCCCTGGCGAGGGCGTTTG	0.552													21	190	---	---	---	---	PASS
ZNF175	7728	broad.mit.edu	37	19	52090506	52090506	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52090506G>T	uc002pxb.2	+	5	1300	c.922G>T	c.(922-924)GAA>TAA	p.E308*		NM_007147	NP_009078	Q9Y473	ZN175_HUMAN	zinc finger protein 175	308	C2H2-type 2; atypical.				response to virus	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		AAACCTCCATGAATGTGGCAA	0.438													32	186	---	---	---	---	PASS
ZNF578	147660	broad.mit.edu	37	19	53005153	53005153	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53005153C>G	uc002pzp.3	+	4	299	c.55C>G	c.(55-57)CTT>GTT	p.L19V		NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578	Error:Variant_position_missing_in_Q96N58_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AGGCATGGCTCTTCCTCAGGT	0.383													32	187	---	---	---	---	PASS
ZNF578	147660	broad.mit.edu	37	19	53015037	53015037	+	Nonsense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53015037C>G	uc002pzp.3	+	6	1647	c.1403C>G	c.(1402-1404)TCA>TGA	p.S468*		NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578	243	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AGTCAGAAATCAAACCTTGAG	0.393													13	86	---	---	---	---	PASS
CACNG7	59284	broad.mit.edu	37	19	54416138	54416138	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54416138C>A	uc002qcr.1	+	1	68	c.53C>A	c.(52-54)GCG>GAG	p.A18E	CACNG7_uc010era.1_Missense_Mutation_p.A18E	NM_031896	NP_114102	P62955	CCG7_HUMAN	voltage-dependent calcium channel gamma-7	18	Helical; (Potential).				regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(1)	1	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		GTGTTTGGTGCGTGTGGCCTG	0.632													10	70	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57327338	57327338	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57327338G>T	uc002qnu.2	-	7	2823	c.2472C>A	c.(2470-2472)ACC>ACA	p.T824T	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Silent_p.T795T|PEG3_uc002qnv.2_Silent_p.T824T|PEG3_uc002qnw.2_Silent_p.T700T|PEG3_uc002qnx.2_Silent_p.T698T|PEG3_uc010etr.2_Silent_p.T824T	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	824					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTCCTTCAGAGGTGTTCCCTC	0.453													46	207	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58551845	58551845	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58551845C>T	uc002qrc.1	+	4	645	c.398C>T	c.(397-399)CCC>CTC	p.P133L		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	133					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TCGGTCGAACCCCAGGACTGG	0.612													41	458	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58601475	58601475	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58601475C>A	uc002qri.2	-	2	469	c.160G>T	c.(160-162)GAA>TAA	p.E54*	ZSCAN18_uc002qrj.3_Nonsense_Mutation_p.E54*|ZSCAN18_uc010yhs.1_Intron|ZSCAN18_uc002qrh.2_Nonsense_Mutation_p.E54*|ZSCAN18_uc010yht.1_Nonsense_Mutation_p.E110*|ZSCAN18_uc002qrk.1_Nonsense_Mutation_p.E54*|ZSCAN18_uc002qrl.2_Nonsense_Mutation_p.E54*	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	54	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TAGACAAATTCCCGGAAACGC	0.677													4	101	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7886903	7886903	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7886903C>T	uc002wmw.1	-	4	643	c.619G>A	c.(619-621)GCA>ACA	p.A207T	HAO1_uc010gbu.2_Missense_Mutation_p.A207T	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	207	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						GCCACATATGCAGCAAGTCCA	0.373													58	161	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	15480442	15480442	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15480442G>T	uc002wou.2	+	8	859	c.595G>T	c.(595-597)GTC>TTC	p.V199F	MACROD2_uc002wot.2_Missense_Mutation_p.V199F|MACROD2_uc002woz.2_5'UTR	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	199	Macro.										0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GCCTGCTGCAGTCATTGCCCT	0.438													10	68	---	---	---	---	PASS
SUN5	140732	broad.mit.edu	37	20	31590418	31590418	+	Silent	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31590418C>G	uc002wyi.2	-	3	279	c.186G>C	c.(184-186)CTG>CTC	p.L62L		NM_080675	NP_542406	Q8TC36	SUN5_HUMAN	sperm associated antigen 4-like	62					spermatogenesis					skin(1)	1						TGCACTGAGTCAGGCCTAGGG	0.532													22	110	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33876708	33876708	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33876708G>C	uc010zux.1	-	2	685	c.567C>G	c.(565-567)CTC>CTG	p.L189L	FAM83C_uc002xcb.1_Silent_p.L13L	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	189										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			AGGCCTCCATGAGGTCACACA	0.597													68	194	---	---	---	---	PASS
RBM12	10137	broad.mit.edu	37	20	34241396	34241396	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34241396G>A	uc002xdq.2	-	3	2081	c.1849C>T	c.(1849-1851)CAT>TAT	p.H617Y	CPNE1_uc010zvj.1_Intron|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdf.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|RBM12_uc002xdr.2_Missense_Mutation_p.H617Y|RBM12_uc002xds.2_Missense_Mutation_p.H617Y	NM_152838	NP_690051	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	617						nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GTAACTACATGAACAAAAGCT	0.418													79	421	---	---	---	---	PASS
PLCG1	5335	broad.mit.edu	37	20	39794432	39794432	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39794432G>C	uc002xjp.1	+	16	1886	c.1765G>C	c.(1765-1767)GAG>CAG	p.E589Q	PLCG1_uc002xjo.1_Missense_Mutation_p.E589Q|PLCG1_uc010zwe.1_Missense_Mutation_p.E215Q|PLCG1_uc010ggf.2_5'Flank	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	589	SH2 1.				activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				GCGAGAGAGTGAGACCTTCGT	0.582													20	132	---	---	---	---	PASS
GDAP1L1	78997	broad.mit.edu	37	20	42907914	42907914	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42907914T>C	uc002xlq.2	+	6	1145	c.1078T>C	c.(1078-1080)TGG>CGG	p.W360R	GDAP1L1_uc010zwl.1_Missense_Mutation_p.W379R|GDAP1L1_uc010zwm.1_Missense_Mutation_p.W302R|GDAP1L1_uc010zwn.1_Missense_Mutation_p.W168R	NM_024034	NP_076939	Q96MZ0	GD1L1_HUMAN	ganglioside-induced differentiation-associated	360										large_intestine(1)	1		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CTTTGCCTACTGGTACCTCAA	0.562													34	190	---	---	---	---	PASS
WFDC8	90199	broad.mit.edu	37	20	44180702	44180702	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44180702G>C	uc002xow.2	-	6	768	c.689C>G	c.(688-690)TCA>TGA	p.S230*	WFDC8_uc002xox.2_Nonsense_Mutation_p.S230*	NM_181510	NP_852611	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8 precursor	230	WAP 3.					extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				TCCACAATGTGAGCAGCACTT	0.413													46	201	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47587750	47587750	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47587750C>T	uc002xtx.3	+	10	1436	c.1284C>T	c.(1282-1284)TTC>TTT	p.F428F		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	428					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			ACGAGATGTTCATCAATGCAA	0.493													10	291	---	---	---	---	PASS
SYCP2	10388	broad.mit.edu	37	20	58442822	58442822	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58442822C>G	uc002yaz.2	-	38	4208	c.4069G>C	c.(4069-4071)GAG>CAG	p.E1357Q		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1357					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TAAGTCATCTCTATCCCTGCA	0.303													9	44	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60895861	60895861	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60895861G>A	uc002ycq.2	-	49	6649	c.6582C>T	c.(6580-6582)GGC>GGT	p.G2194G		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2194	Domain II and I.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGCATTGATGCCACGCAGTT	0.657													36	91	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60905967	60905967	+	Silent	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60905967C>T	uc002ycq.2	-	30	3751	c.3684G>A	c.(3682-3684)CCG>CCA	p.P1228P		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1228	Domain IV 1 (domain IV B).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGGCTGGGGCGGCTTTGGGA	0.721													4	4	---	---	---	---	PASS
BTG3	10950	broad.mit.edu	37	21	18981390	18981390	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18981390C>G	uc002ykk.2	-	2	333	c.73G>C	c.(73-75)GAG>CAG	p.E25Q	BTG3_uc002ykl.2_Missense_Mutation_p.E25Q	NM_006806	NP_006797	Q14201	BTG3_HUMAN	B-cell translocation gene 3 isoform b	25					negative regulation of cell proliferation|negative regulation of mitotic cell cycle	cytoplasm					0				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		TCAACTGCCTCTTTTTTCAAC	0.358													33	176	---	---	---	---	PASS
N6AMT1	29104	broad.mit.edu	37	21	30254502	30254502	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30254502G>C	uc002ymo.1	-	3	318	c.292C>G	c.(292-294)CAA>GAA	p.Q98E	N6AMT1_uc002ymp.1_Missense_Mutation_p.Q98E|N6AMT1_uc002ymq.1_RNA	NM_013240	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1	98					positive regulation of cell growth	protein complex	nucleic acid binding|protein binding|protein methyltransferase activity				0						ATAACTGGTTGAATGTGAACT	0.353													29	97	---	---	---	---	PASS
KRTAP21-1	337977	broad.mit.edu	37	21	32127524	32127524	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32127524T>C	uc011adi.1	-	1	173	c.173A>G	c.(172-174)TAT>TGT	p.Y58C		NM_181619	NP_853650	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	58						intermediate filament				breast(1)	1						GCCAGagccatatccacagcc	0.219													4	209	---	---	---	---	PASS
SLC5A3	6526	broad.mit.edu	37	21	35467886	35467886	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35467886C>G	uc002yto.2	+	2	901	c.389C>G	c.(388-390)TCT>TGT	p.S130C	MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864	P53794	SC5A3_HUMAN	solute carrier family 5 (inositol transporters),	130	Helical; (Potential).					integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2						GCAGCCTTGTCTCTGATTCTC	0.443													70	343	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37581181	37581181	+	Silent	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37581181G>T	uc002yvg.2	+	5	739	c.660G>T	c.(658-660)CTG>CTT	p.L220L	DOPEY2_uc011aeb.1_Silent_p.L220L	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	220					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						AGTACATGCTGGGGACCAATC	0.637													9	73	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22735507	22735507	+	RNA	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22735507C>G	uc011aim.1	+	46		c.5303C>G								Parts of antibodies, mostly variable regions.												0						GCTCCAACATCGGAAGTAATA	0.582													44	225	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23214155	23214155	+	RNA	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23214155C>T	uc011aim.1	+	326		c.14232C>T								Parts of antibodies, mostly variable regions.												0						TCCAGTCTGACGATGAGGCTG	0.582													26	96	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26694977	26694977	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26694977G>A	uc003acb.2	+	5	1346	c.1190G>A	c.(1189-1191)CGC>CAC	p.R397H	SEZ6L_uc003acc.2_Missense_Mutation_p.R397H|SEZ6L_uc011akc.1_Missense_Mutation_p.R397H|SEZ6L_uc003acd.2_Missense_Mutation_p.R397H|SEZ6L_uc011akd.1_Missense_Mutation_p.R397H|SEZ6L_uc003ace.2_Missense_Mutation_p.R397H|SEZ6L_uc003acf.1_Missense_Mutation_p.R170H|SEZ6L_uc010gvc.1_Missense_Mutation_p.R170H	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	397	Sushi 1.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						AACTTTCCCCGCCGGCCTGAC	0.587													23	70	---	---	---	---	PASS
MFNG	4242	broad.mit.edu	37	22	37882168	37882168	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37882168G>C	uc003ass.1	-	1	218	c.48C>G	c.(46-48)CTC>CTG	p.L16L	MFNG_uc011ani.1_5'UTR|MFNG_uc011anj.1_Silent_p.L16L|CARD10_uc003ast.1_Intron	NM_002405	NP_002396	O00587	MFNG_HUMAN	O-fucosylpeptide	16	Helical; Signal-anchor for type II membrane protein; (Potential).				pattern specification process	extracellular space|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity			lung(1)	1	Melanoma(58;0.0574)					CCATGCACAGGAGGGTGAGGA	0.687													5	64	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41521907	41521907	+	Missense_Mutation	SNP	T	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41521907T>G	uc003azl.3	+	3	1164	c.769T>G	c.(769-771)TAT>GAT	p.Y257D		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	257					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						TGGTTCACCATATACTCAGAA	0.358			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				29	153	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41565575	41565575	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41565575A>G	uc003azl.3	+	26	4636	c.4241A>G	c.(4240-4242)TAT>TGT	p.Y1414C		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	1414					apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						ACTGCAGTCTATCATGAAATC	0.333			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				12	55	---	---	---	---	PASS
PHF21B	112885	broad.mit.edu	37	22	45316381	45316381	+	Intron	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45316381C>A	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron|PHF21B_uc011aqm.1_Intron	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN	PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		CTGAAACATACAGGAGGGCAA	0.607													4	22	---	---	---	---	PASS
SHANK3	85358	broad.mit.edu	37	22	51137207	51137207	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51137207A>G	uc003bne.1	+	13	1636	c.1636A>G	c.(1636-1638)ATG>GTG	p.M546V	SHANK3_uc003bnf.1_Missense_Mutation_p.M1V	NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3	546										central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		GGAAGTGCAGATGAGGCAGCA	0.637													7	85	---	---	---	---	PASS
ATXN3L	92552	broad.mit.edu	37	X	13337077	13337077	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13337077C>G	uc010ned.2	-	1	1442	c.977G>C	c.(976-978)AGT>ACT	p.S326T		NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	326					protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity			lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						GATGTCATCACTGAGATCACT	0.433													33	118	---	---	---	---	PASS
PIR	8544	broad.mit.edu	37	X	15509309	15509309	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15509309G>C	uc004cwu.2	-	2	310	c.72C>G	c.(70-72)GTC>GTG	p.V24V	PIR_uc004cwv.2_Silent_p.V24V|BMX_uc004cww.2_Intron	NM_003662	NP_003653	O00625	PIR_HUMAN	pirin	24				V -> D (in Ref. 2; CAG46621).	transcription from RNA polymerase II promoter	cytoplasm|nucleus	metal ion binding|protein binding|quercetin 2,3-dioxygenase activity|transcription cofactor activity			ovary(1)	1	Hepatocellular(33;0.183)					TGCTTCTCCGGACCCTCGCTC	0.522													62	142	---	---	---	---	PASS
PHEX	5251	broad.mit.edu	37	X	22095795	22095795	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22095795A>G	uc004dah.2	+	5	841	c.638A>G	c.(637-639)AAA>AGA	p.K213R	PHEX_uc011mjr.1_Missense_Mutation_p.K213R|PHEX_uc011mjs.1_Missense_Mutation_p.K116R	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	213	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						CCTGATGACAAAGCATCCAAT	0.448													58	114	---	---	---	---	PASS
PTCHD1	139411	broad.mit.edu	37	X	23411489	23411489	+	Silent	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23411489G>A	uc004dal.3	+	3	1862	c.1854G>A	c.(1852-1854)CTG>CTA	p.L618L		NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	618					cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						ATTCCTTTCTGAAAGCCCCTC	0.388													50	76	---	---	---	---	PASS
ZNF81	347344	broad.mit.edu	37	X	47774728	47774728	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47774728C>T	uc010nhy.1	+	6	1051	c.683C>T	c.(682-684)ACC>ATC	p.T228I		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	228						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)				CAAGTTTTTACCCAGAACTCT	0.368													20	43	---	---	---	---	PASS
CLCN5	1184	broad.mit.edu	37	X	49854835	49854835	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49854835G>C	uc004dos.1	+	10	1845	c.1597G>C	c.(1597-1599)GAA>CAA	p.E533Q	CLCN5_uc004dor.1_Missense_Mutation_p.E603Q|CLCN5_uc004doq.1_Missense_Mutation_p.E603Q|CLCN5_uc004dot.1_Missense_Mutation_p.E533Q	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	533					excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					TGGTGGCTTAGAATACATCGT	0.502													5	222	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54784061	54784061	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54784061G>A	uc004dtj.2	-	8	2476	c.2446C>T	c.(2446-2448)CAG>TAG	p.Q816*		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	816	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						TTGGGAACCTGAAGTGTAGAG	0.562													49	73	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67937404	67937404	+	Silent	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67937404G>C	uc004dxa.2	+	5	780	c.408G>C	c.(406-408)CTG>CTC	p.L136L	STARD8_uc004dxb.2_Silent_p.L216L|STARD8_uc004dxc.3_Silent_p.L136L	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	136					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						TTGAATCTCTGAGGCGGAAGG	0.592													28	41	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67937591	67937591	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67937591G>T	uc004dxa.2	+	5	967	c.595G>T	c.(595-597)GAG>TAG	p.E199*	STARD8_uc004dxb.2_Nonsense_Mutation_p.E279*|STARD8_uc004dxc.3_Nonsense_Mutation_p.E199*	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	199					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						GAAGGCCTGGGAGGCCTGGCC	0.632													16	40	---	---	---	---	PASS
OGT	8473	broad.mit.edu	37	X	70777517	70777517	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70777517G>C	uc004eaa.1	+	12	1814	c.1597G>C	c.(1597-1599)GAT>CAT	p.D533H	BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Missense_Mutation_p.D523H|OGT_uc004eac.2_Missense_Mutation_p.D394H|OGT_uc004ead.2_Missense_Mutation_p.D152H	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1	533					cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					CCTGTGCTTAGATAAGGTGTG	0.269													15	31	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73069127	73069127	+	RNA	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73069127G>C	uc004ebm.1	-	1		c.3462C>G				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						AATTGGGACTGAGCATTTTAA	0.453													8	30	---	---	---	---	PASS
CPXCR1	53336	broad.mit.edu	37	X	88008729	88008729	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88008729C>A	uc004efd.3	+	3	573	c.314C>A	c.(313-315)CCC>CAC	p.P105H	CPXCR1_uc004efc.3_Missense_Mutation_p.P105H	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	105						intracellular	zinc ion binding			ovary(3)	3						TCTCACAAGCCCTTAAATGAT	0.398													11	24	---	---	---	---	PASS
CENPI	2491	broad.mit.edu	37	X	100382613	100382613	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100382613C>G	uc004egx.2	+	10	1303	c.1033C>G	c.(1033-1035)CAA>GAA	p.Q345E	CENPI_uc011mrg.1_Missense_Mutation_p.Q345E|CENPI_uc004egy.2_Missense_Mutation_p.Q345E	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	345					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						AGAACAACTTCAAAGCTTCCC	0.373													41	84	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101096040	101096040	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101096040C>T	uc011mrk.1	-	8	788	c.428G>A	c.(427-429)CGA>CAA	p.R143Q	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	143					mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						GCAGTTTCTTCGATTCAGGAT	0.522													28	79	---	---	---	---	PASS
CHRDL1	91851	broad.mit.edu	37	X	110035413	110035413	+	5'UTR	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110035413G>C	uc004eou.3	-	2					CHRDL1_uc004eov.2_5'UTR|CHRDL1_uc004eow.2_5'UTR|CHRDL1_uc010nps.2_5'UTR|CHRDL1_uc004eot.2_5'UTR|CHRDL1_uc011mss.1_5'UTR|CHRDL1_uc004eox.3_5'UTR	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor						BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						TTCTCATTTGGACCACTGCAA	0.393													13	26	---	---	---	---	PASS
FAM127A	8933	broad.mit.edu	37	X	134166519	134166519	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134166519G>C	uc004eyd.2	+	1	187	c.106G>C	c.(106-108)GAT>CAT	p.D36H	uc004eye.1_RNA	NM_001078171	NP_001071639	A6ZKI3	F127A_HUMAN	family with sequence similarity 127, member A	36											0	Acute lymphoblastic leukemia(192;0.000127)					GTTTGACGGCGATACCGACCG	0.622													41	120	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135958712	135958712	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135958712C>G	uc004fae.1	-	5	701	c.491G>C	c.(490-492)AGA>ACA	p.R164T	RBMX_uc004fac.1_5'Flank|RBMX_uc011mwf.1_Intron|RBMX_uc004fad.1_Missense_Mutation_p.R164T|RBMX_uc011mwg.1_Missense_Mutation_p.R125T|RBMX_uc004faf.1_Missense_Mutation_p.R25T|RBMX_uc010nsf.1_Missense_Mutation_p.R125T|RBMX_uc004fag.1_Missense_Mutation_p.R36T	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	164						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					AGGTGCAGATCTCTTAGGAGG	0.463													46	86	---	---	---	---	PASS
SLITRK2	84631	broad.mit.edu	37	X	144904016	144904016	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144904016G>C	uc004fcd.2	+	5	1063	c.73G>C	c.(73-75)GCC>CCC	p.A25P	SLITRK2_uc010nsp.2_Missense_Mutation_p.A25P|SLITRK2_uc010nso.2_Missense_Mutation_p.A25P|SLITRK2_uc011mwq.1_Missense_Mutation_p.A25P|SLITRK2_uc011mwr.1_Missense_Mutation_p.A25P|SLITRK2_uc011mws.1_Missense_Mutation_p.A25P|SLITRK2_uc004fcg.2_Missense_Mutation_p.A25P|SLITRK2_uc011mwt.1_Missense_Mutation_p.A25P	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	25	Extracellular (Potential).					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					TCGCAAAACTGCCAAAGACAT	0.478													22	43	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	42010370	42010371	+	Intron	INS	-	CAC	CAC	rs148567263	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42010370_42010371insCAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				actgctaccatcaccaccacca	0.000													4	2	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	147778126	147778126	+	Intron	DEL	T	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147778126delT	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						ccttccttccttcctcccttc	0.005													4	2	---	---	---	---	
CDC42SE1	56882	broad.mit.edu	37	1	151028108	151028111	+	Intron	DEL	TAAC	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151028108_151028111delTAAC	uc001ewo.2	-						CDC42SE1_uc001ewp.2_Intron	NM_001038707	NP_001033796	Q9NRR8	C42S1_HUMAN	CDC42 small effector 1						phagocytosis|regulation of cell shape|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase inhibitor activity				0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGCACACAGTAACTGACTGCTCT	0.529													18	8	---	---	---	---	
ILDR2	387597	broad.mit.edu	37	1	166919963	166919964	+	Intron	INS	-	AC	AC	rs139216289	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166919963_166919964insAC	uc001gdx.1	-							NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor							integral to membrane				ovary(1)	1						TGATCTAAAATacacacacaca	0.257													4	3	---	---	---	---	
LAX1	54900	broad.mit.edu	37	1	203742885	203742891	+	Intron	DEL	TTTTTTT	-	-	rs10714327		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203742885_203742891delTTTTTTT	uc001haa.2	+						LAX1_uc010pql.1_Intron|LAX1_uc001hab.2_Intron	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1 isoform a						B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GTTGCTCttcttttttttttttttttt	0.367													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204152602	204152602	+	IGR	DEL	G	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204152602delG								REN (17137 upstream) : KISS1 (6868 downstream)																							TTCTGAAGGTGGAAAAGGCAA	0.333													4	2	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766820	206766823	+	Intron	DEL	GAGC	-	-	rs141098886		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766820_206766823delGAGC	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagagagagcgcgagagaga	0.211													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215677181	215677182	+	IGR	INS	-	GT	GT	rs150877664	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215677181_215677182insGT								KCNK2 (266746 upstream) : KCTD3 (63553 downstream)																							ccacgcaccacgtgtgtgtgtg	0.000													3	3	---	---	---	---	
CEP170	9859	broad.mit.edu	37	1	243327520	243327520	+	Intron	DEL	A	-	-	rs1815604	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243327520delA	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron|CEP170_uc001hzv.1_Intron	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			ttttttttttaaaaaaaaaaa	0.383													5	3	---	---	---	---	
PPPDE1	51029	broad.mit.edu	37	1	244849565	244849568	+	Intron	DEL	TGTA	-	-	rs72146207		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244849565_244849568delTGTA	uc001iao.2	+						PPPDE1_uc001iap.2_Intron	NM_016076	NP_057160	Q9BSY9	PPDE1_HUMAN	PPPDE peptidase domain containing 1											breast(3)	3						tgtgtgtgtgtgtatgtgtgtgtg	0.319													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66955302	66955303	+	IGR	DEL	TG	-	-	rs141332560		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66955302_66955303delTG								MEIS1 (155412 upstream) : ETAA1 (669139 downstream)																							CCCTAATCATtgtgtgtgtgtg	0.203													4	2	---	---	---	---	
SNRNP27	11017	broad.mit.edu	37	2	70129479	70129479	+	Intron	DEL	G	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70129479delG	uc002sfw.2	+						SNRNP27_uc002sfv.2_Intron|SNRNP27_uc002sfx.2_Intron	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa						mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						tgctgctgctgctcttgctgc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764888	91764903	+	IGR	DEL	TGTGTGTGTGTGTGTG	-	-	rs139523492		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764888_91764903delTGTGTGTGTGTGTGTG								None (None upstream) : LOC654342 (40289 downstream)																							tgtacgtatatgtgtgtgtgtgtgtgtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91940399	91940399	+	IGR	DEL	C	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91940399delC								LOC654342 (92424 upstream) : GGT8P (22969 downstream)																							GGAGCAGGTGCAGCCCAACTC	0.607													24	11	---	---	---	---	
RABL2A	11159	broad.mit.edu	37	2	114392866	114392868	+	Intron	DEL	CTT	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114392866_114392868delCTT	uc002tkn.3	+						RABL2A_uc010flb.2_Intron|RABL2A_uc002tkl.3_Intron|RABL2A_uc002tkm.3_Intron|RABL2A_uc002tks.3_Intron|RABL2A_uc002tkr.2_Intron|RABL2A_uc002tkp.3_Intron	NM_007082	NP_009013	Q9UBK7	RBL2A_HUMAN	RAB, member of RAS oncogene family-like 2A						small GTPase mediated signal transduction		GTP binding|GTPase activity			skin(1)	1						CTCCCCAGAGCTTCTTAGTGAGA	0.581													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132586836	132586837	+	IGR	INS	-	G	G			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132586836_132586837insG								C2orf27B (27602 upstream) : NCRNA00164 (318327 downstream)																							CTGGGGCAGTAGGCGTCGAAGG	0.658													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	203044993	203044994	+	Intron	DEL	AA	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203044993_203044994delAA	uc002uyy.1	+											RecName: Full=Uncharacterized protein KIAA2012;																		aaactcctccaaaaaaaaaaaa	0.119													3	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225719572	225719579	+	Intron	DEL	CCAACCAA	-	-	rs72305904		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225719572_225719579delCCAACCAA	uc010fwz.1	-						DOCK10_uc002vob.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		aaccaactagccaaccaaccaaccaacc	0.236													4	2	---	---	---	---	
GPR128	84873	broad.mit.edu	37	3	100330087	100330088	+	Intron	INS	-	TTTCCTTC	TTTCCTTC	rs71981038		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100330087_100330088insTTTCCTTC	uc003duc.2	+							NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						GTTTGTTTGTTTttccttcctt	0.149													0	15	---	---	---	---	
C3orf1	51300	broad.mit.edu	37	3	119217940	119217940	+	Intron	DEL	T	-	-	rs34000460		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119217940delT	uc003ecn.2	+						C3orf1_uc003eco.2_Intron|C3orf1_uc003ecp.2_Intron	NM_016589	NP_057673	Q9NPL8	TIDC1_HUMAN	hypothetical protein LOC51300							integral to membrane|mitochondrial inner membrane	protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.186)		tttttctttcttttttttttt	0.184													4	2	---	---	---	---	
SH3TC1	54436	broad.mit.edu	37	4	8219843	8219844	+	Intron	DEL	AT	-	-	rs1281137	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8219843_8219844delAT	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3						CTGGGCAGGCAtgtgtgtgtgt	0.584													4	4	---	---	---	---	
CLOCK	9575	broad.mit.edu	37	4	56314760	56314761	+	Intron	DEL	CA	-	-	rs72445552		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56314760_56314761delCA	uc003haz.1	-						CLOCK_uc003hba.1_Intron|CLOCK_uc010igu.1_Intron	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			TGCGCGCGCGCACGCGCGCgtg	0.134													4	2	---	---	---	---	
C4orf37	285555	broad.mit.edu	37	4	98909178	98909181	+	Intron	DEL	CACA	-	-	rs3047311		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98909178_98909181delCACA	uc003htt.1	-							NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		gtctgaatgtcacacacacacaca	0.000													5	3	---	---	---	---	
ELF2	1998	broad.mit.edu	37	4	139983329	139983329	+	Intron	DEL	T	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139983329delT	uc003ihp.1	-						ELF2_uc003ihm.1_Intron|ELF2_uc003ihn.1_Intron|ELF2_uc003iho.1_Intron|ELF2_uc011chc.1_5'UTR	NM_201999	NP_973728	Q15723	ELF2_HUMAN	E74-like factor 2 (ets domain transcription						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)					TTGTTTCTACttttttttttt	0.109													4	2	---	---	---	---	
FAM160A1	729830	broad.mit.edu	37	4	152333726	152333730	+	Intron	DEL	CTTTC	-	-	rs144769022		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152333726_152333730delCTTTC	uc003imj.2	+							NM_001109977	NP_001103447	Q05DH4	F16A1_HUMAN	hypothetical protein LOC729830												0						ttctttctttctttcctttctttcc	0.112													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187396516	187396517	+	Intron	INS	-	AA	AA	rs75413796	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187396516_187396517insAA	uc003izb.1	-						uc003izc.2_Intron					Homo sapiens coagulation factor XI (plasma thromboplastin antecedent), mRNA (cDNA clone IMAGE:4831055).																		aagaaagaaagaaagaaagaaa	0.000													3	4	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31775772	31775773	+	Intron	DEL	GT	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31775772_31775773delGT	uc003jhl.2	+							NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CTCACAGAGCgtgtgtgtgtgt	0.401													4	2	---	---	---	---	
EGFLAM	133584	broad.mit.edu	37	5	38438225	38438225	+	Intron	DEL	A	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38438225delA	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron|EGFLAM_uc003jle.1_Intron|EGFLAM_uc003jlf.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					ctccatctccaaaaaaaaaaa	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475765	90475772	+	IGR	DEL	GAAGGAAG	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475765_90475772delGAAGGAAG								GPR98 (15733 upstream) : ARRDC3 (188769 downstream)																							aaggaaggaagaaggaaggaaggaagga	0.029													7	5	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	69810769	69810770	+	Intron	INS	-	GAGCGAGGGAGGGAAGGAAGGAGC	GAGCGAGGGAGGGAAGGAAGGAGC	rs150514603	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69810769_69810770insGAGCGAGGGAGGGAAGGAAGGAGC	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				aaggaagaaggaagggagggaa	0.054													4	2	---	---	---	---	
GOPC	57120	broad.mit.edu	37	6	117903436	117903437	+	Intron	INS	-	AC	AC	rs148429862	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117903436_117903437insAC	uc003pxu.2	-						GOPC_uc003pxv.2_Intron	NM_020399	NP_065132	Q9HD26	GOPC_HUMAN	golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		cctccccccctacacacacaca	0.000			O	ROS1	glioblastoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127439005	127439005	+	Intron	DEL	G	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127439005delG	uc003qaq.1	-						RSPO3_uc003qar.2_5'Flank|RSPO3_uc003qas.1_5'Flank					Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																		aaggaaggaaggaaggaagga	0.139													4	2	---	---	---	---	
KATNA1	11104	broad.mit.edu	37	6	149954237	149954238	+	Intron	DEL	TT	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149954237_149954238delTT	uc003qmr.1	-						KATNA1_uc003qms.2_Intron|KATNA1_uc003qmt.2_Intron|KATNA1_uc011eed.1_Intron	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1						cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		TCAATTGCAAtttttttttttt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1320766	1320771	+	IGR	DEL	AGCAGC	-	-	rs66672762		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1320766_1320771delAGCAGC								UNCX (44154 upstream) : MICALL2 (153225 downstream)																							gaagaagaGAagcagcagcagcagca	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	38385227	38385227	+	Intron	DEL	A	-	-	rs79129934	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38385227delA	uc003tgp.1	+											Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		AGGAGCTGGTATTCCTGAGAC	0.527													4	2	---	---	---	---	
CDC14C	168448	broad.mit.edu	37	7	48964307	48964307	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48964307delC	uc010kyv.1	+	1	151	c.39delC	c.(37-39)GACfs	p.D13fs		NR_003595				SubName: Full=Putative uncharacterized protein MGC26484;												0						GCCGCCGGGACCCCCAGGACG	0.607													94	43	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63023116	63023116	+	IGR	DEL	C	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63023116delC								LOC100287704 (210965 upstream) : ZNF727 (482705 downstream)																							GTCCAGCCATCCCCCACCCTG	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64532452	64532452	+	Intron	DEL	T	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64532452delT	uc003ttt.1	+						uc010kzt.1_Intron					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																		atgcccagccttttttttttt	0.119													4	2	---	---	---	---	
TMEM130	222865	broad.mit.edu	37	7	98468195	98468196	+	5'Flank	INS	-	TGCTGC	TGCTGC	rs139424382	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98468195_98468196insTGCTGC	uc003upo.2	-						TMEM130_uc011kiq.1_5'Flank|TMEM130_uc011kir.1_5'Flank|TMEM130_uc003upn.2_5'Flank	NM_001134450	NP_001127922	Q8N3G9	TM130_HUMAN	transmembrane protein 130 isoform a							Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GAAATTCCTCTtgctgctgctg	0.292													5	4	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102197784	102197784	+	Intron	DEL	T	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102197784delT	uc011kkx.1	+						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron|POLR2J3_uc011kkw.1_Intron|SPDYE2_uc003vaa.1_Intron	NM_001031618	NP_001026789	Q495Y8	SPDE2_HUMAN	speedy homolog E2												0						TCCTACAGtcttttttttttt	0.289													7	7	---	---	---	---	
ATXN7L1	222255	broad.mit.edu	37	7	105302458	105302465	+	Intron	DEL	TTTCTTTC	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105302458_105302465delTTTCTTTC	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1												0						GATTCTTTCTTttctttctttctttctt	0.202													2	4	---	---	---	---	
WNT16	51384	broad.mit.edu	37	7	120965187	120965188	+	5'Flank	DEL	CA	-	-	rs57114926	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120965187_120965188delCA	uc003vjv.2	+							NM_016087	NP_057171	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|keratinocyte differentiation|keratinocyte proliferation|negative regulation of cell death|optic cup formation involved in camera-type eye development|oxidative stress-induced premature senescence|positive regulation of gene expression|positive regulation of JNK cascade|positive regulation of phosphatidylinositol 3-kinase cascade|replicative senescence|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			lung(2)|ovary(2)|large_intestine(1)	5	all_neural(327;0.117)					TGCGCGCGCGcacacacacaca	0.426													3	3	---	---	---	---	
ASB10	136371	broad.mit.edu	37	7	150878702	150878702	+	Intron	DEL	T	-	-	rs112543142		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150878702delT	uc003wjm.1	-						ASB10_uc003wjl.1_Intron|ASB10_uc003wjn.1_Intron	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10						intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGTGCCCttcttttttttttt	0.284													6	3	---	---	---	---	
MYOM2	9172	broad.mit.edu	37	8	2047898	2047899	+	Intron	INS	-	T	T	rs149139233	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2047898_2047899insT	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		tccttccttccttctttccttc	0.030													4	2	---	---	---	---	
NAA35	60560	broad.mit.edu	37	9	88576798	88576799	+	Intron	INS	-	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88576798_88576799insT	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						TCTAACGTGTCTTTTTTTTTTA	0.332													4	2	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113128845	113128845	+	Intron	DEL	A	-	-	rs72033846		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113128845delA	uc010mtz.2	-						SVEP1_uc010mty.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						CTTTTCCTGGAAAAAAAAAAA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116500478	116500481	+	IGR	DEL	TTCC	-	-	rs149346601	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116500478_116500481delTTCC								RGS3 (140461 upstream) : ZNF618 (138081 downstream)																							ctttccttctttccttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	126056196	126056207	+	IGR	DEL	CCCCCTCCAATG	-	-	rs71026080	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126056196_126056207delCCCCCTCCAATG								CHST15 (202990 upstream) : OAT (29665 downstream)																							acctccttccccccctccaatgcctccatgcc	0.127													4	2	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16043877	16043878	+	Intron	INS	-	TTCC	TTCC			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16043877_16043878insTTCC	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						tccttccttctttccttccttc	0.129													7	4	---	---	---	---	
CSTF3	1479	broad.mit.edu	37	11	33107692	33107693	+	Intron	INS	-	AG	AG	rs150981668	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33107692_33107693insAG	uc001muh.2	-						TCP11L1_uc001muf.1_Intron	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1						mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						GTGGGTGAGACAGCAGTCTCAA	0.436													2	4	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47788664	47788669	+	In_Frame_Del	DEL	GGTGGT	-	-	rs59413596		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47788664_47788669delGGTGGT	uc009ylv.2	-	1	325_330	c.172_177delACCACC	c.(172-177)ACCACCdel	p.TT58del	FNBP4_uc001ngj.2_5'UTR|FNBP4_uc001ngl.2_RNA	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	58_59										ovary(1)	1						CAGTCACCGCGGTGGTGGTGGTCGTC	0.748													5	3	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67831874	67831875	+	Intron	INS	-	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67831874_67831875insA	uc001onj.2	-						CHKA_uc001onk.2_Intron	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	gactctgtctcaaaaaaaaaaa	0.129													6	3	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73795752	73795753	+	Intron	INS	-	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73795752_73795753insA	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					atctttaaactaaaAAAAAAAA	0.153													4	2	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99072082	99072082	+	Intron	DEL	T	-	-	rs151051937	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99072082delT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		cttcctttcctttccttcctt	0.000													7	4	---	---	---	---	
GRIA4	2893	broad.mit.edu	37	11	105505081	105505081	+	Intron	DEL	A	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105505081delA	uc001pix.2	+						GRIA4_uc001piu.1_Intron|GRIA4_uc001piw.2_Intron|GRIA4_uc001piv.2_Intron|GRIA4_uc009yxk.1_Intron	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	ctccgtctccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	114982353	114982354	+	IGR	DEL	AC	-	-	rs10549809		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114982353_114982354delAC								FAM55B (404701 upstream) : CADM1 (57599 downstream)																							ATCTATCTAGacacacacacac	0.337													4	2	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													11	6	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104131353	104131354	+	Intron	DEL	TC	-	-	rs141425461		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104131353_104131354delTC	uc001tjw.2	+						STAB2_uc009zug.2_Intron	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						ATTGACTGTTtctctctctctc	0.322													15	8	---	---	---	---	
SLC24A6	80024	broad.mit.edu	37	12	113747851	113747852	+	Intron	INS	-	A	A	rs144628302		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113747851_113747852insA	uc001tvc.2	-						SLC24A6_uc001tuz.2_Intron|SLC24A6_uc001tva.2_Intron|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						aagctattaccaaaaaAAAAAA	0.173													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965094	117965107	+	Intron	DEL	ACACACACACACAG	-	-	rs59836858		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965094_117965107delACACACACACACAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGacacacacacacacacacacagacacacacac	0.234													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31652513	31652520	+	IGR	DEL	AAGAAAGA	-	-	rs7986217		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31652513_31652520delAAGAAAGA								C13orf26 (103362 upstream) : HSPH1 (58245 downstream)																							ggaaggaaggaagaaagaaagaaagaaa	0.192													10	5	---	---	---	---	
ZIC5	85416	broad.mit.edu	37	13	100622194	100622195	+	Intron	INS	-	A	A			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100622194_100622195insA	uc001vom.1	-							NM_033132	NP_149123	Q96T25	ZIC5_HUMAN	zinc finger protein of the cerebellum 5						cell differentiation	nucleus	DNA binding|zinc ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTTATTCATAGAAAAAAAAAAG	0.535													4	2	---	---	---	---	
LTB4R	1241	broad.mit.edu	37	14	24785994	24786002	+	3'UTR	DEL	GGGCGTGGA	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24785994_24786002delGGGCGTGGA	uc001wos.2	+	2					LTB4R_uc010alp.2_3'UTR|LTB4R_uc001wou.2_3'UTR	NM_001143919	NP_001137391	Q15722	LT4R1_HUMAN	leukotriene B4 receptor						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular component movement|immune response|inflammatory response|muscle contraction	integral to plasma membrane	nucleotide binding				0				GBM - Glioblastoma multiforme(265;0.018)		ggaggagcaggggcgtggagggcgtggag	0.330													5	3	---	---	---	---	
FUT8	2530	broad.mit.edu	37	14	66042294	66042300	+	Intron	DEL	CTTCCTT	-	-	rs72086384	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66042294_66042300delCTTCCTT	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		tctttccttccttccttcttccttcct	0.126													1	5	---	---	---	---	
DYNC1H1	1778	broad.mit.edu	37	14	102504685	102504686	+	Intron	INS	-	G	G	rs140348429	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102504685_102504686insG	uc001yks.2	+							NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ACGCAAGTGGCGGGTGGCTTTT	0.277													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20561581	20561598	+	IGR	DEL	TGTGTGTGTGTGTGTGTG	-	-	rs71225089	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20561581_20561598delTGTGTGTGTGTGTGTGTG								None (None upstream) : GOLGA6L6 (175496 downstream)																							ctcactaatatgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22440158	22440159	+	3'UTR	INS	-	T	T	rs146439979	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22440158_22440159insT	uc001yug.2	-	1										full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																		CTCTGTTTCTCTTTTTTTTTTG	0.238													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45754119	45754121	+	Intron	DEL	CAC	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45754119_45754121delCAC	uc001zvi.1	+											Homo sapiens cDNA FLJ32124 fis, clone PEBLM1000180.																		ccaccaccatcaccaccaccacc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45756124	45756128	+	Intron	DEL	CTCCA	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45756124_45756128delCTCCA	uc001zvi.1	+											Homo sapiens cDNA FLJ32124 fis, clone PEBLM1000180.																		ccatcaccatctccacaccatcacc	0.078													4	2	---	---	---	---	
RNF111	54778	broad.mit.edu	37	15	59341945	59341945	+	Intron	DEL	T	-	-	rs145601625		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59341945delT	uc002afv.2	+						RNF111_uc002afs.2_Intron|RNF111_uc002aft.2_Intron|RNF111_uc002afu.2_Intron|RNF111_uc002afw.2_Intron	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		tctttctttcttttttttttt	0.164													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63763040	63763047	+	IGR	DEL	AAGCAAGC	-	-	rs62011269		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63763040_63763047delAAGCAAGC								CA12 (88965 upstream) : USP3 (33763 downstream)																							ggaaggaaggaagcaagcaagCcagcca	0.014													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	89504350	89504351	+	IGR	DEL	GA	-	-	rs77820859		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89504350_89504351delGA								MFGE8 (47687 upstream) : ABHD2 (127030 downstream)																							TCATTGGTCTGaaaaaaaaaaa	0.243													4	2	---	---	---	---	
CACNA1H	8912	broad.mit.edu	37	16	1255041	1255041	+	Intron	DEL	C	-	-	rs56412134		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1255041delC	uc002cks.2	+						CACNA1H_uc002ckt.2_Intron	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,						aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	CGGGTGGGGGCCCCAGATCAG	0.736													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	13966971	13966973	+	IGR	DEL	TGG	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13966971_13966973delTGG								SHISA9 (632699 upstream) : ERCC4 (47041 downstream)																							gtggtggtgatggtggtggtggt	0.177													13	7	---	---	---	---	
LOC283867	283867	broad.mit.edu	37	16	65446090	65446091	+	Intron	INS	-	GAGGAAA	GAGGAAA			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65446090_65446091insGAGGAAA	uc010cdp.1	-						LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)		aaggaaggaagggagggaggga	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	72711719	72711720	+	Intron	INS	-	CA	CA	rs139659538	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72711719_72711720insCA	uc002fcj.1	+											Homo sapiens cDNA FLJ11501 fis, clone HEMBA1002100.																		ccaaaagaatccacacacacac	0.000													4	2	---	---	---	---	
CTU2	348180	broad.mit.edu	37	16	88779617	88779618	+	Intron	DEL	CT	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88779617_88779618delCT	uc002flm.2	+						CTU2_uc002fln.2_Intron|CTU2_uc010chz.2_Intron|CTU2_uc010cia.2_Intron	NM_001012759	NP_001012777	Q2VPK5	CTU2_HUMAN	cytoplasmic tRNA 2-thiolation protein 2 isoform						tRNA thio-modification|tRNA wobble uridine modification	cytoplasm|protein complex|soluble fraction	protein binding			skin(1)	1						ACTCATACCCCTGAGAGCCCCC	0.644													4	2	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10439843	10439843	+	Intron	DEL	T	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10439843delT	uc010coi.2	-						uc002gml.1_Intron|MYH2_uc002gmp.3_Intron|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						AATTTCTTCCTTACTCTGAAA	0.308													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	14319103	14319104	+	IGR	INS	-	TCCT	TCCT			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14319103_14319104insTCCT								HS3ST3B1 (69611 upstream) : PMP22 (813993 downstream)																							ccttccttccttccctccttcc	0.059													4	2	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	15948314	15948314	+	Intron	DEL	A	-	-	rs112069615		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15948314delA	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpl.2_Intron|NCOR1_uc002gpm.2_Intron|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TGAACTTAAGAAAAAAAAAAA	0.363													4	2	---	---	---	---	
MMP28	79148	broad.mit.edu	37	17	34097733	34097734	+	Intron	INS	-	TG	TG	rs142756793	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34097733_34097734insTG	uc002hjy.1	-						MMP28_uc002hjw.1_Intron|MMP28_uc002hjz.1_Intron	NM_024302	NP_077278	Q9H239	MMP28_HUMAN	matrix metalloproteinase 28 isoform 1						proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		tgaataataaatgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	43294946	43294949	+	IGR	DEL	TCGA	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43294946_43294949delTCGA								HEXIM2 (47540 upstream) : FMNL1 (4343 downstream)																							cttccttccttcgagatggagtct	0.064													3	3	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72427995	72428010	+	5'UTR	DEL	AGGACGAAGGTGACAA	-	-	rs3840057		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72427995_72428010delAGGACGAAGGTGACAA	uc002jkp.2	+	1					GPRC5C_uc002jkq.2_5'UTR|GPRC5C_uc002jkr.2_5'Flank	NM_022036	NP_071319	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						CGGGAGGGCCAGGACGAAGGTGACAAAGGCTAGGTG	0.676													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72533200	72533202	+	IGR	DEL	AAG	-	-	rs145845283	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72533200_72533202delAAG								CD300LB (5587 upstream) : CD300C (4045 downstream)																							aaaagaagaaaaggaggaggagg	0.039													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	76346799	76346802	+	IGR	DEL	CTTC	-	-	rs72267370		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76346799_76346802delCTTC								LOC283999 (109732 upstream) : SOCS3 (6057 downstream)																							ttcctcccttcttccttccttcct	0.127													3	3	---	---	---	---	
KCNG2	26251	broad.mit.edu	37	18	77623691	77623692	+	In_Frame_Ins	INS	-	GGC	GGC	rs71338073		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77623691_77623692insGGC	uc010xfl.1	+	1	24_25	c.24_25insGGC	c.(22-27)insGGC	p.13_14insG		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	13_14	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCTGCTccccgggcggcggcgg	0.614													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5802702	5802703	+	IGR	DEL	TG	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5802702_5802703delTG								DUS3L (11453 upstream) : NRTN (21115 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.431													4	2	---	---	---	---	
TRIP10	9322	broad.mit.edu	37	19	6745157	6745158	+	Intron	INS	-	GGGCA	GGGCA	rs150026713	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6745157_6745158insGGGCA	uc002mfs.2	+						TRIP10_uc010dux.1_Intron|TRIP10_uc002mfr.2_Intron|TRIP10_uc010duy.2_Intron|TRIP10_uc010duz.2_Intron	NM_004240	NP_004231	Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10						actin cytoskeleton organization|cell communication|endocytosis|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell projection|cytoskeleton|cytosol|Golgi apparatus|lysosome|perinuclear region of cytoplasm|phagocytic cup	GTPase activator activity|identical protein binding|lipid binding			ovary(1)	1						GGAAGGAAGGCGGCCGATTGGC	0.673													4	2	---	---	---	---	
KDELR1	10945	broad.mit.edu	37	19	48893549	48893549	+	Intron	DEL	C	-	-	rs36034010		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48893549delC	uc002pjb.1	-						KDELR1_uc002pja.1_Intron	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum						intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		agagtccaggcccccggcccc	0.000													1	8	---	---	---	---	
SHANK1	50944	broad.mit.edu	37	19	51165815	51165815	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51165815delC	uc002psx.1	-	23	5912	c.5893delG	c.(5893-5895)GCCfs	p.A1965fs	SHANK1_uc002psw.1_Frame_Shift_Del_p.A1349fs	NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1965					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GCCCCTGGGGCCGCAGCGGCT	0.692													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56289284	56289285	+	IGR	INS	-	C	C	rs138922796	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56289284_56289285insC								RFPL4A (14745 upstream) : NLRP11 (7485 downstream)																							TAAATGTCTTTCCGTTCAATAC	0.426													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25733507	25733508	+	IGR	INS	-	T	T			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25733507_25733508insT								ZNF337 (56038 upstream) : FAM182B (10594 downstream)																							ctgacttgctgtttttgctacc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31551795	31551800	+	IGR	DEL	TTCTCC	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31551795_31551800delTTCTCC								MAPRE1 (113585 upstream) : SUN5 (19782 downstream)																							ccttcctcctttctccttctccttct	0.000													4	2	---	---	---	---	
ELMO2	63916	broad.mit.edu	37	20	45053236	45053237	+	Intron	INS	-	TG	TG	rs147908598	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45053236_45053237insTG	uc010zxs.1	-						uc002xry.2_Intron			Q96JJ3	ELMO2_HUMAN	SubName: Full=ELMO2 protein; SubName: Full=Engulfment and cell motility 2;						apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				tacttaaagtttgtgtgtgtgt	0.005													4	2	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47537666	47537667	+	Intron	INS	-	G	G	rs147763046	by1000genomes	TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47537666_47537667insG	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TCACTGAGCCTGGGCCTCACAG	0.649													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20188920	20188931	+	Intron	DEL	CCTTCCTTCCTT	-	-	rs71987686		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20188920_20188931delCCTTCCTTCCTT	uc002zrs.1	-											Homo sapiens cDNA FLJ35233 fis, clone PROST2001540.																		ccctccctacccttccttccttccttccttcc	0.085													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49153040	49153042	+	IGR	DEL	AGA	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49153040_49153042delAGA								FAM19A5 (5298 upstream) : C22orf34 (655134 downstream)																							AAggaggaggagaagggaggagg	0.069													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	380951	380959	+	IGR	DEL	TTCCTTCCT	-	-			TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:380951_380959delTTCCTTCCT								PPP2R3B (33324 upstream) : SHOX (204120 downstream)																							cttccttcccttccttccttcccttcctt	0.010													4	2	---	---	---	---	
NR0B1	190	broad.mit.edu	37	X	30328920	30328923	+	5'Flank	DEL	TTCC	-	-	rs12841421		TCGA-37-3783-01A-01D-1267-08	TCGA-37-3783-10A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30328920_30328923delTTCC	uc004dcf.3	-							NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1						adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	cttccttcctttccttccttcctt	0.103													4	2	---	---	---	---	
