Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PEX10	5192	broad.mit.edu	37	1	2340172	2340172	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2340172C>G	uc001ajh.2	-	3	388	c.319G>C	c.(319-321)GAC>CAC	p.D107H	PEX10_uc001ajg.2_Missense_Mutation_p.D107H	NM_002617	NP_002608	O60683	PEX10_HUMAN	peroxisome biogenesis factor 10 isoform 2	107					protein import into peroxisome matrix|protein import into peroxisome matrix	integral to peroxisomal membrane|peroxisomal membrane	protein binding|protein C-terminus binding|zinc ion binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		AGGGCCTTGTCCAGCAGGTAG	0.687													7	22	---	---	---	---	PASS
MTHFR	4524	broad.mit.edu	37	1	11854924	11854924	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11854924G>T	uc001atc.1	-						MTHFR_uc001atb.1_Intron	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase						blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	GGGACGCCTGGGTGAGGATGG	0.597													5	30	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12921252	12921252	+	Missense_Mutation	SNP	C	A	A	rs150748226	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12921252C>A	uc001aum.1	+	4	1130	c.1043C>A	c.(1042-1044)GCT>GAT	p.A348D		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	348	LRR 2.										0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGAAAATTGCTGCCTCTCTC	0.557													45	107	---	---	---	---	PASS
PRAMEF4	400735	broad.mit.edu	37	1	12942116	12942116	+	Missense_Mutation	SNP	C	T	T	rs145911043	byFrequency	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12942116C>T	uc001aun.2	-	3	505	c.434G>A	c.(433-435)GGA>GAA	p.G145E		NM_001009611	NP_001009611	O60810	PRAM4_HUMAN	PRAME family member 4	145										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCTGCCGTCCTCTCATCCT	0.502													61	205	---	---	---	---	PASS
DNAJC16	23341	broad.mit.edu	37	1	15894409	15894409	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15894409G>T	uc001aws.2	+	15	2206	c.2086G>T	c.(2086-2088)GGT>TGT	p.G696C	DNAJC16_uc001awt.2_Missense_Mutation_p.G384C|DNAJC16_uc001awu.2_RNA	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	696	Extracellular (Potential).				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		TGACTACACTGGTTATGTACT	0.443													8	175	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19403254	19403254	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19403254G>A	uc001bbi.2	-	105	15471	c.15467C>T	c.(15466-15468)TCA>TTA	p.S5156L	UBR4_uc001bbe.1_5'Flank|UBR4_uc001bbf.2_Missense_Mutation_p.S51L|UBR4_uc010ocv.1_Missense_Mutation_p.S679L|UBR4_uc009vph.2_Missense_Mutation_p.S811L|UBR4_uc010ocw.1_Missense_Mutation_p.S820L|UBR4_uc001bbg.2_Missense_Mutation_p.S867L|UBR4_uc001bbh.2_Missense_Mutation_p.S865L	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	5156					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GAGGAACTCTGAGAAGGTCTC	0.527													98	237	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19492186	19492186	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19492186T>A	uc001bbi.2	-	30	4179	c.4175A>T	c.(4174-4176)CAG>CTG	p.Q1392L	UBR4_uc001bbm.1_Missense_Mutation_p.Q603L	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1392					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TTTACGAGCCTGGCTACTTTC	0.433													15	46	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19524546	19524546	+	Intron	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19524546G>A	uc001bbi.2	-							NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CCTTCCACCTGAAAAGAAACA	0.433													9	35	---	---	---	---	PASS
MATN1	4146	broad.mit.edu	37	1	31188829	31188829	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31188829C>A	uc001brz.2	-	5	1168	c.1134G>T	c.(1132-1134)AAG>AAT	p.K378N	uc001bsb.1_5'Flank|MATN1_uc001bsa.1_Missense_Mutation_p.K296N	NM_002379	NP_002370	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein precursor	378	VWFA 2.				protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		CAATGCCCACCTTCTGGGCCC	0.562													22	48	---	---	---	---	PASS
ZSCAN20	7579	broad.mit.edu	37	1	33960553	33960553	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33960553C>A	uc001bxj.3	+	8	2776	c.2609C>A	c.(2608-2610)TCA>TAA	p.S870*	ZSCAN20_uc009vui.2_Nonsense_Mutation_p.S869*	NM_145238	NP_660281	P17040	ZSC20_HUMAN	zinc finger protein 31	870					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGCACAAACTCAGGGGAGAAA	0.438													8	265	---	---	---	---	PASS
EIF2C3	192669	broad.mit.edu	37	1	36506013	36506013	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36506013C>A	uc001bzp.2	+	16	2399	c.2143C>A	c.(2143-2145)CGA>AGA	p.R715R	EIF2C3_uc001bzq.2_Silent_p.R481R	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3	715	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACATCACACTCGATTATTTTG	0.368													4	68	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38338764	38338764	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38338764G>C	uc001ccg.1	-	19	2119	c.2025C>G	c.(2023-2025)GAC>GAG	p.D675E	INPP5B_uc009vvk.1_Missense_Mutation_p.D616E|INPP5B_uc001ccf.1_Missense_Mutation_p.D511E	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	755					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CCTCAATTTTGTCTTCACCCG	0.418													40	61	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	41976621	41976621	+	Missense_Mutation	SNP	C	T	T	rs147749727		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41976621C>T	uc001cgz.3	-	9	7935	c.6722G>A	c.(6721-6723)CGA>CAA	p.R2241Q	HIVEP3_uc001cha.3_Missense_Mutation_p.R2240Q|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	2241					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CCAGCGGCCTCGCTCCTGGGC	0.692													15	14	---	---	---	---	PASS
HIVEP3	59269	broad.mit.edu	37	1	42045798	42045798	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42045798C>T	uc001cgz.3	-	4	5884	c.4671G>A	c.(4669-4671)AAG>AAA	p.K1557K	HIVEP3_uc001cha.3_Silent_p.K1557K|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	1557					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CAGGTTGTTCCTTGGAATCTT	0.542													23	54	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43914311	43914311	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43914311G>T	uc001cjk.1	+	55	7763	c.7301G>T	c.(7300-7302)TGG>TTG	p.W2434L	KIAA0467_uc001cjl.1_Missense_Mutation_p.W422L	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	3333						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACGGTCTCCTGGTACCAGAGC	0.572													10	206	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44056897	44056897	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44056897G>A	uc001cjr.2	+	9	1544	c.1204G>A	c.(1204-1206)GAG>AAG	p.E402K	PTPRF_uc001cjs.2_Missense_Mutation_p.E402K|PTPRF_uc001cju.2_5'UTR|PTPRF_uc009vwt.2_5'UTR|PTPRF_uc001cjv.2_5'UTR	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	402	Extracellular (Potential).|Fibronectin type-III 1.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCCGCCCAGCGAGGCAGTGCG	0.697													8	7	---	---	---	---	PASS
TESK2	10420	broad.mit.edu	37	1	45821049	45821049	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45821049G>C	uc001cns.1	-	5	869	c.466C>G	c.(466-468)CTG>GTG	p.L156V	TESK2_uc009vxr.1_Missense_Mutation_p.L156V|TESK2_uc010olo.1_Missense_Mutation_p.L73V|TESK2_uc009vxs.1_5'UTR	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2	156	Protein kinase.				actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					TCATAGGCCAGTTTTACCCTC	0.468													8	26	---	---	---	---	PASS
TTC39A	22996	broad.mit.edu	37	1	51753897	51753897	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51753897C>A	uc001csl.2	-	18	1879	c.1774G>T	c.(1774-1776)GCC>TCC	p.A592S	TTC39A_uc001csk.2_Missense_Mutation_p.A557S|TTC39A_uc010ond.1_Missense_Mutation_p.A529S|TTC39A_uc010one.1_Missense_Mutation_p.A556S|TTC39A_uc010onf.1_Missense_Mutation_p.A560S|TTC39A_uc001csj.2_Missense_Mutation_p.A193S	NM_001080494	NP_001073963	Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A isoform 2	592							binding			skin(1)	1						TGGAGTGTGGCTGCCTGGATT	0.512													5	86	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53554564	53554564	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53554564C>A	uc001cuy.2	-	10	1617	c.1449G>T	c.(1447-1449)CGG>CGT	p.R483R	SLC1A7_uc001cux.2_Silent_p.R136R	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	483						integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	TGCCTGTGTCCCGGGCAAAAT	0.547													17	38	---	---	---	---	PASS
FGGY	55277	broad.mit.edu	37	1	59844452	59844452	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59844452G>A	uc001czi.3	+	5	709	c.497G>A	c.(496-498)GGA>GAA	p.G166E	FGGY_uc001czg.2_Missense_Mutation_p.G54E|FGGY_uc001czh.2_RNA|FGGY_uc009wac.2_Missense_Mutation_p.G166E|FGGY_uc001czj.3_Missense_Mutation_p.G166E|FGGY_uc001czk.3_Missense_Mutation_p.G54E|FGGY_uc001czl.3_Missense_Mutation_p.G78E	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	166					carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					GATAAGGCGGGACATTTCTTT	0.393													12	14	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91778938	91778938	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91778938G>A	uc001doa.3	-	30	3459	c.3359C>T	c.(3358-3360)TCA>TTA	p.S1120L	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Missense_Mutation_p.S799L|HFM1_uc001dob.3_Missense_Mutation_p.S308L|HFM1_uc010osv.1_Missense_Mutation_p.S804L	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1120							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AGATATGTCTGAATGTTTAGA	0.328													7	19	---	---	---	---	PASS
CNN3	1266	broad.mit.edu	37	1	95368960	95368960	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95368960C>A	uc010otw.1	-	3	260	c.178G>T	c.(178-180)GAA>TAA	p.E60*	CNN3_uc010otv.1_Nonsense_Mutation_p.E19*|CNN3_uc001dqz.3_Nonsense_Mutation_p.E60*|CNN3_uc010otx.1_Nonsense_Mutation_p.E60*	NM_001839	NP_001830	Q15417	CNN3_HUMAN	calponin 3	60	CH.				actomyosin structure organization|smooth muscle contraction		actin binding|calmodulin binding|tropomyosin binding|troponin C binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		GTAACTCACTCGCAGAGGATG	0.507													5	56	---	---	---	---	PASS
FNDC7	163479	broad.mit.edu	37	1	109271508	109271508	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109271508G>T	uc001dvx.2	+	8	1624	c.1624G>T	c.(1624-1626)GTG>TTG	p.V542L	FNDC7_uc010ova.1_Missense_Mutation_p.V309L	NM_001144937	NP_001138409	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	543						extracellular region				ovary(1)|skin(1)	2		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		CCTGGAAACAGGTATGTAGCA	0.532													9	16	---	---	---	---	PASS
GSTM4	2948	broad.mit.edu	37	1	110201701	110201701	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110201701C>A	uc001dyf.2	+	7	850	c.536C>A	c.(535-537)CCA>CAA	p.P179Q	GSTM4_uc001dyg.2_Missense_Mutation_p.P75Q|GSTM4_uc009wfj.2_Missense_Mutation_p.P118Q|GSTM4_uc001dyh.2_Missense_Mutation_p.P179Q|GSTM2_uc001dyi.2_Intron	NM_000850	NP_000841	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4 isoform 1	179	GST C-terminal.				xenobiotic metabolic process	endoplasmic reticulum membrane	glutathione transferase activity				0		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	GACGCCTTTCCAAATCTGAAG	0.498													9	367	---	---	---	---	PASS
CSF1	1435	broad.mit.edu	37	1	110460061	110460061	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110460061C>A	uc001dyu.2	+	4	785	c.372C>A	c.(370-372)ACC>ACA	p.T124T	CSF1_uc001dyt.2_Silent_p.T124T|CSF1_uc001dyv.3_Silent_p.T124T|CSF1_uc001dyw.3_Silent_p.T124T	NM_172212	NP_757351	P09603	CSF1_HUMAN	colony stimulating factor 1 isoform a precursor	124	Lumenal (Potential).				cell proliferation|developmental process involved in reproduction|macrophage differentiation|monocyte activation|osteoclast differentiation|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of cellular protein metabolic process|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|positive regulation of macrophage differentiation|positive regulation of monocyte differentiation|positive regulation of mononuclear cell proliferation|positive regulation of protein kinase activity	extracellular space|integral to membrane|perinuclear region of cytoplasm|plasma membrane|receptor complex	cytokine activity|growth factor activity|macrophage colony-stimulating factor receptor binding|protein homodimerization activity			ovary(1)	1		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTGCTTCACCAAGGATTATG	0.557													8	261	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117556285	117556285	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117556285C>G	uc010oxb.1	+	4	1157	c.1099C>G	c.(1099-1101)CTG>GTG	p.L367V	CD101_uc009whd.2_Missense_Mutation_p.L367V|CD101_uc010oxc.1_Missense_Mutation_p.L367V|CD101_uc010oxd.1_Missense_Mutation_p.L305V	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	367	Ig-like C2-type 3.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GATCTTCTCTCTGGGCCCAGA	0.517													14	42	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144873931	144873931	+	Missense_Mutation	SNP	T	C	C	rs137931320	byFrequency	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144873931T>C	uc001elw.3	-	31	5317	c.5026A>G	c.(5026-5028)ATC>GTC	p.I1676V	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.I1632V|PDE4DIP_uc001elv.3_Missense_Mutation_p.I683V	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1676					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGCAAGCTGATGGGGTTGCTG	0.517			T	PDGFRB	MPD								31	248	---	---	---	---	PASS
ITGA10	8515	broad.mit.edu	37	1	145531022	145531022	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145531022G>T	uc001eoa.2	+	7	830	c.754G>T	c.(754-756)GCC>TCC	p.A252S	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Missense_Mutation_p.A121S|ITGA10_uc009wiw.2_Missense_Mutation_p.A109S|ITGA10_uc010oyw.1_Missense_Mutation_p.A197S	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	252	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AATAATGGTGGCCTGGTGAGG	0.458													8	21	---	---	---	---	PASS
ACP6	51205	broad.mit.edu	37	1	147126410	147126410	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147126410C>A	uc001epr.2	-	6	1143	c.679G>T	c.(679-681)GGA>TGA	p.G227*	ACP6_uc009wjj.1_Nonsense_Mutation_p.G184*	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor	227					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					TCTGAGATTCCTGGCTGTAAA	0.353													6	57	---	---	---	---	PASS
FCGR1A	2209	broad.mit.edu	37	1	149761656	149761656	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149761656C>T	uc001esp.3	+	5	656	c.606C>T	c.(604-606)CTC>CTT	p.L202L	HIST2H2BF_uc010pbj.1_Intron|FCGR1A_uc009wlg.2_Intron	NM_000566	NP_000557	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor	202	Extracellular (Potential).|Ig-like C2-type 3.				interferon-gamma-mediated signaling pathway|phagocytosis, engulfment	integral to membrane|plasma membrane	IgG binding|receptor activity|receptor signaling protein activity			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CATCCCCACTCCTGGAGGGGA	0.512													9	21	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149905510	149905510	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149905510C>G	uc001etl.3	-	9	1104	c.853G>C	c.(853-855)GAT>CAT	p.D285H	MTMR11_uc001etm.1_Missense_Mutation_p.D213H|MTMR11_uc010pbm.1_Missense_Mutation_p.D257H|MTMR11_uc010pbn.1_Missense_Mutation_p.D127H	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	285	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CACCTGATATCCTCCTTGTTA	0.542													21	46	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152190884	152190884	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152190884G>T	uc001ezt.1	-	3	3297	c.3221C>A	c.(3220-3222)TCT>TAT	p.S1074Y		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1074	12.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCATGGGTAGAGGAATGACC	0.562													10	360	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285051	152285051	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285051G>T	uc001ezu.1	-	3	2347	c.2311C>A	c.(2311-2313)CAT>AAT	p.H771N	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	771	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTGCTGATGGTGACCAGCC	0.562									Ichthyosis				9	305	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152732412	152732412	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152732412G>T	uc001fal.1	+	2	406	c.348G>T	c.(346-348)GAG>GAT	p.E116D		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	116	Gln-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAATCTGAGGTGTCCTACG	0.502													10	395	---	---	---	---	PASS
PGLYRP4	57115	broad.mit.edu	37	1	153318633	153318633	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153318633C>A	uc001fbo.2	-	3	149	c.84G>T	c.(82-84)CAG>CAT	p.Q28H	PGLYRP4_uc001fbp.2_Missense_Mutation_p.Q28H	NM_020393	NP_065126	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein-I-beta	28					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)|skin(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCTCTGATACCTGTTTAGCTT	0.488													7	190	---	---	---	---	PASS
CLK2	1196	broad.mit.edu	37	1	155239429	155239429	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155239429G>T	uc001fjy.2	-	3	539	c.249C>A	c.(247-249)AGC>AGA	p.S83R	RAG1AP1_uc010pey.1_Intron|CLK2_uc001fjw.2_Missense_Mutation_p.S83R|CLK2_uc001fjx.2_5'UTR|CLK2_uc009wqm.2_Missense_Mutation_p.S83R	NM_003993	NP_003984	P49760	CLK2_HUMAN	CDC-like kinase 2	83						nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCCGATCCCGGCTATAATCGT	0.527								Other_conserved_DNA_damage_response_genes					23	108	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156954202	156954202	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156954202T>C	uc001fqo.2	-	3	1192	c.152A>G	c.(151-153)CAA>CGA	p.Q51R	ARHGEF11_uc001fqn.2_Missense_Mutation_p.Q51R	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	51	PDZ.				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGGTCCTTTTGGATAATGAC	0.557													3	5	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157504393	157504393	+	Intron	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157504393C>T	uc001fqu.2	-						FCRL5_uc009wsm.2_Intron|FCRL5_uc010phv.1_Intron|FCRL5_uc010phw.1_Intron|FCRL5_uc001fqv.1_Nonsense_Mutation_p.W564*|FCRL5_uc010phx.1_Intron	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TGGCAAGAACCCAGCACTTAC	0.493													5	18	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157504490	157504490	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157504490G>A	uc001fqu.2	-	8	1753	c.1595C>T	c.(1594-1596)ACT>ATT	p.T532I	FCRL5_uc009wsm.2_Missense_Mutation_p.T532I|FCRL5_uc010phv.1_Missense_Mutation_p.T532I|FCRL5_uc010phw.1_Missense_Mutation_p.T447I|FCRL5_uc001fqv.1_Missense_Mutation_p.T532I|FCRL5_uc010phx.1_Missense_Mutation_p.T283I	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	532	Extracellular (Potential).|Ig-like C2-type 5.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ATGTCCTTCAGTCAGAGAGAA	0.507													6	15	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158914791	158914791	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158914791C>T	uc001ftb.2	+	7	1563	c.1318C>T	c.(1318-1320)CAG>TAG	p.Q440*	PYHIN1_uc001ftc.2_Nonsense_Mutation_p.Q431*|PYHIN1_uc001ftd.2_Nonsense_Mutation_p.Q440*|PYHIN1_uc001fte.2_Nonsense_Mutation_p.Q431*	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	440					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					CAAGACTCCTCAGATGCCACC	0.488													10	30	---	---	---	---	PASS
OLFML2B	25903	broad.mit.edu	37	1	161967615	161967615	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161967615C>A	uc001gbu.2	-	6	1898	c.1474G>T	c.(1474-1476)GGA>TGA	p.G492*	OLFML2B_uc010pkq.1_Nonsense_Mutation_p.G493*	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	492										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			ATGAACTTACCTATGACATTC	0.542													9	304	---	---	---	---	PASS
ILDR2	387597	broad.mit.edu	37	1	166908752	166908752	+	Silent	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166908752T>A	uc001gdx.1	-	4	611	c.555A>T	c.(553-555)CCA>CCT	p.P185P		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	185	Extracellular (Potential).					integral to membrane				ovary(1)	1						ACCGAATACCTGGCATAATCT	0.413													12	30	---	---	---	---	PASS
SMG7	9887	broad.mit.edu	37	1	183511607	183511607	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183511607G>T	uc001gqg.2	+	14	1934	c.1812G>T	c.(1810-1812)CAG>CAT	p.Q604H	SMG7_uc010pob.1_Intron|SMG7_uc001gqf.2_Intron|SMG7_uc001gqh.2_Intron|SMG7_uc001gqi.2_Intron|SMG7_uc010poc.1_Missense_Mutation_p.Q562H	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	604					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						AAAAGTTACAGGAAACAGGAA	0.383													6	72	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186294905	186294905	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186294905G>C	uc001grv.2	-	42	6400	c.6103C>G	c.(6103-6105)CAA>GAA	p.Q2035E		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2035					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CCACTGTTTTGAGAATCAGCA	0.338			T	NTRK1	papillary thyroid								6	18	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186324872	186324872	+	Silent	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186324872T>C	uc001grv.2	-	16	2214	c.1917A>G	c.(1915-1917)GCA>GCG	p.A639A		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	639					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTGGAGTTGATGCAAGAGAAA	0.393			T	NTRK1	papillary thyroid								22	31	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196882045	196882045	+	Silent	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196882045T>A	uc001gto.2	+	3	501	c.432T>A	c.(430-432)ATT>ATA	p.I144I	CFHR4_uc009wyy.2_Silent_p.I390I|CFHR4_uc001gtp.2_Silent_p.I391I	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	144	Sushi 2.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						CACAACCAATTTGCATTAGTA	0.308													13	23	---	---	---	---	PASS
SHISA4	149345	broad.mit.edu	37	1	201859588	201859588	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201859588G>A	uc001gxa.2	+	3	343	c.252G>A	c.(250-252)AAG>AAA	p.K84K		NM_198149	NP_937792	Q96DD7	SHSA4_HUMAN	shisa homolog 4 precursor	84	Extracellular (Potential).					integral to membrane					0						AAAGCCCCAAGACCATAGCAG	0.562													37	110	---	---	---	---	PASS
SYT2	127833	broad.mit.edu	37	1	202571625	202571625	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202571625C>A	uc001gye.2	-	5	707	c.514G>T	c.(514-516)GGA>TGA	p.G172*	SYT2_uc010pqb.1_Nonsense_Mutation_p.G172*|SYT2_uc009xaf.2_Nonsense_Mutation_p.G2*	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	172	Phospholipid binding (By similarity).|C2 1.|Cytoplasmic (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GAGGTGCCTCCCATGTCCAGG	0.537													6	86	---	---	---	---	PASS
PPFIA4	8497	broad.mit.edu	37	1	203036822	203036822	+	Splice_Site	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203036822G>C	uc001gyz.2	+	13	2126	c.1533_splice	c.e13-1	p.R511_splice	PPFIA4_uc009xaj.2_Splice_Site_p.R1142_splice|PPFIA4_uc010pqf.1_Splice_Site_p.R724_splice|PPFIA4_uc001gza.2_Splice_Site_p.R502_splice|PPFIA4_uc001gzb.1_Splice_Site_p.R197_splice|PPFIA4_uc001gzc.1_Splice_Site_p.R53_splice	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						TGTGCCTGCAGAACCAGTCTT	0.562													19	34	---	---	---	---	PASS
LPGAT1	9926	broad.mit.edu	37	1	211966404	211966404	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211966404G>T	uc001hiu.2	-						LPGAT1_uc001hiv.2_Intron	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		CTGCCTTCAGGGTAGCTTACC	0.333													7	151	---	---	---	---	PASS
TMEM206	55248	broad.mit.edu	37	1	212558649	212558649	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212558649G>A	uc001hjc.3	-	4	630	c.462C>T	c.(460-462)ATC>ATT	p.I154I	TMEM206_uc010pte.1_Silent_p.I215I	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206	154	Extracellular (Potential).					integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		CCGTGTAGTTGATCCTCTGGG	0.577													10	68	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216052233	216052233	+	Missense_Mutation	SNP	G	A	A	rs111033529		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216052233G>A	uc001hku.1	-	42	8818	c.8431C>T	c.(8431-8433)CCT>TCT	p.P2811S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2811	Fibronectin type-III 14.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACATAGGTAGGTAAACTCTCT	0.443										HNSCC(13;0.011)			11	18	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216850693	216850693	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216850693C>A	uc001hkw.1	-	2	363	c.197G>T	c.(196-198)GGG>GTG	p.G66V	ESRRG_uc001hky.1_Missense_Mutation_p.G43V|ESRRG_uc009xdp.1_Missense_Mutation_p.G43V|ESRRG_uc001hkz.1_Missense_Mutation_p.G43V|ESRRG_uc010puc.1_Missense_Mutation_p.G43V|ESRRG_uc001hla.1_Missense_Mutation_p.G43V|ESRRG_uc001hlb.1_Missense_Mutation_p.G43V|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.G43V|ESRRG_uc001hld.1_Missense_Mutation_p.G43V|ESRRG_uc001hkx.1_Missense_Mutation_p.G71V|ESRRG_uc009xdo.1_Missense_Mutation_p.G43V|ESRRG_uc001hle.1_Missense_Mutation_p.G43V	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	66					positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	ACTGTAGCTCCCACTGGCGTC	0.577													10	21	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232607249	232607249	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232607249T>C	uc001hvg.2	-	6	2269	c.2111A>G	c.(2110-2112)AAT>AGT	p.N704S		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	704	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GACGATGTCATTTCCTATGTG	0.383													16	33	---	---	---	---	PASS
KIAA1383	54627	broad.mit.edu	37	1	232942333	232942333	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232942333C>G	uc001hvh.2	+	1	1696	c.1564C>G	c.(1564-1566)CAA>GAA	p.Q522E		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	380										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)				AGCAACTAATCAAACATGTCA	0.378													15	29	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235969397	235969397	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235969397C>A	uc001hxj.2	-	6	3214	c.3039G>T	c.(3037-3039)GAG>GAT	p.E1013D	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Missense_Mutation_p.E1013D	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1013					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTGTATCTCCCTCCTTTTTTC	0.338									Chediak-Higashi_syndrome				5	21	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236727825	236727825	+	Silent	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236727825G>C	uc001hyd.1	-	32	4697	c.4572C>G	c.(4570-4572)CTC>CTG	p.L1524L	HEATR1_uc009xgh.1_Silent_p.L686L	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	1524					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGGAAGACAGGAGCTGAGACA	0.358													12	32	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236917316	236917316	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236917316C>T	uc001hyf.2	+	16	2113	c.1909C>T	c.(1909-1911)CGT>TGT	p.R637C	ACTN2_uc001hyg.2_Missense_Mutation_p.R429C|ACTN2_uc009xgi.1_Missense_Mutation_p.R637C|ACTN2_uc010pxu.1_Missense_Mutation_p.R326C|ACTN2_uc001hyh.2_Missense_Mutation_p.R325C	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	637	Spectrin 4.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGCTAACGAGCGTCTGAGGCG	0.602													22	35	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	236973829	236973829	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236973829C>G	uc001hyi.3	+	5	859	c.436C>G	c.(436-438)CTG>GTG	p.L146V	MTR_uc010pxv.1_RNA|MTR_uc010pxw.1_5'UTR|MTR_uc010pxx.1_Missense_Mutation_p.L146V|MTR_uc010pxy.1_Missense_Mutation_p.L146V|MTR_uc009xgj.1_5'UTR	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	146	Hcy-binding.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GGCAGGGGCTCTGGGTCCGAC	0.373													12	27	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240341241	240341241	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240341241G>T	uc010pyd.1	+	3	2028	c.1803G>T	c.(1801-1803)TGG>TGT	p.W601C	FMN2_uc010pye.1_Missense_Mutation_p.W601C	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	601					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTTATACCTGGGCTGCAGTTA	0.388													14	21	---	---	---	---	PASS
KMO	8564	broad.mit.edu	37	1	241712164	241712164	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241712164G>C	uc009xgp.2	+	2	155	c.90G>C	c.(88-90)AGG>AGC	p.R30S	KMO_uc001hyy.2_Missense_Mutation_p.R30S|KMO_uc009xgo.1_Missense_Mutation_p.R30S	NM_003679	NP_003670	O15229	KMO_HUMAN	kynurenine 3-monooxygenase	30					pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity			ovary(2)	2	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			TTGCAAAGAGGAATTTCCAGA	0.279													9	31	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247592882	247592882	+	Intron	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247592882C>T	uc001icr.2	+						NLRP3_uc001ics.2_Intron|NLRP3_uc001icu.2_Intron|NLRP3_uc001icw.2_Intron|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Intron	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a						detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CCTTCTAATTCCTAGATTGGT	0.498													30	116	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525429	248525429	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525429C>T	uc001ieh.1	+	1	547	c.547C>T	c.(547-549)CTG>TTG	p.L183L		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	183	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTGCTGGTTCCTGGGCTCAGT	0.542													27	77	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685389	248685389	+	Missense_Mutation	SNP	G	A	A	rs138151830		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685389G>A	uc001ien.1	+	1	442	c.442G>A	c.(442-444)GCA>ACA	p.A148T		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGCCGGTGGAGCATGGCTCAG	0.577													9	23	---	---	---	---	PASS
ATP6V1C2	245973	broad.mit.edu	37	2	10912726	10912726	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10912726C>A	uc002ras.2	+	8	737	c.628C>A	c.(628-630)CGA>AGA	p.R210R	ATP6V1C2_uc002rat.2_Silent_p.R210R	NM_001039362	NP_001034451	Q8NEY4	VATC2_HUMAN	vacuolar H+ ATPase C2 isoform a	210					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		GGTGGTCCCTCGATCAACCAA	0.512													7	348	---	---	---	---	PASS
SMC6	79677	broad.mit.edu	37	2	17955679	17955679	+	Intron	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17955679G>C	uc010exo.2	-						GEN1_uc002rct.2_Intron|GEN1_uc010yjs.1_Intron|GEN1_uc002rcu.2_Intron	NM_024624	NP_078900	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GTAATGTAAAGAACTGTATGG	0.348													10	29	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25462032	25462032	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25462032C>T	uc002rgc.2	-	20	2632	c.2375G>A	c.(2374-2376)CGC>CAC	p.R792H	DNMT3A_uc002rgd.2_Missense_Mutation_p.R792H|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.R603H	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	792					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding	p.R792H(1)		haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAGAAGTAGCGGGCCCTGTG	0.557			Mis|F|N|S		AML								6	12	---	---	---	---	PASS
SLC4A1AP	22950	broad.mit.edu	37	2	27900188	27900188	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27900188G>C	uc002rlk.3	+	7	1815	c.1533G>C	c.(1531-1533)AGG>AGC	p.R511S		NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),	511	Potential.					cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)					ATGCTGAAAGGGAACTTTCTG	0.259													4	23	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32738083	32738083	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32738083C>T	uc010ezu.2	+	54	10564	c.10430C>T	c.(10429-10431)CCT>CTT	p.P3477L		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3477					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TACATGTGTCCTAACTCCTCA	0.433													14	31	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32740349	32740349	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32740349G>C	uc010ezu.2	+	55	10995	c.10861G>C	c.(10861-10863)GAA>CAA	p.E3621Q		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3621					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TCAATCTCCTGAAGCTATTAA	0.408													11	40	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32774431	32774431	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32774431C>G	uc010ezu.2	+	65	13161	c.13027C>G	c.(13027-13029)CAG>GAG	p.Q4343E		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4343					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					TGGAGAAGCTCAGTCATCTCA	0.418													3	41	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44099383	44099383	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44099383C>T	uc002rtq.2	+	8	1239	c.1149C>T	c.(1147-1149)ACC>ACT	p.T383T	ABCG8_uc010yoa.1_Silent_p.T382T	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	383	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CACTAGACACCAACTGCCTCC	0.592													6	21	---	---	---	---	PASS
SIX3	6496	broad.mit.edu	37	2	45169910	45169910	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45169910G>C	uc002run.1	+	1	874	c.667G>C	c.(667-669)GAG>CAG	p.E223Q		NM_005413	NP_005404	O95343	SIX3_HUMAN	SIX homeobox 3	223	Homeobox.				visual perception	nucleus					0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCTGTTGCGGGAGTGGTACCT	0.607													12	21	---	---	---	---	PASS
EPCAM	4072	broad.mit.edu	37	2	47612328	47612328	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47612328G>T	uc002rvx.2	+	8	1240	c.882G>T	c.(880-882)ATG>ATT	p.M294I	EPCAM_uc002rvw.2_Missense_Mutation_p.M322I	NM_002354	NP_002345	P16422	EPCAM_HUMAN	epithelial cell adhesion molecule precursor	294	Cytoplasmic (Potential).				positive regulation of cell proliferation	apical plasma membrane|basolateral plasma membrane|integral to membrane|lateral plasma membrane|tight junction	protein binding			skin(1)	1						AGAAGAGAATGGCAAAGTATG	0.353									Lynch_syndrome				8	167	---	---	---	---	PASS
MSH2	4436	broad.mit.edu	37	2	47637275	47637275	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47637275G>T	uc002rvy.1	+	3	477	c.409G>T	c.(409-411)GGT>TGT	p.G137C	MSH2_uc010yoh.1_Missense_Mutation_p.G71C|MSH2_uc002rvz.2_Missense_Mutation_p.G137C|MSH2_uc010fbg.2_5'UTR|MSH2_uc010fbf.1_Intron	NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2	137					B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding			large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			cattctctttggtaacaatga	0.284			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				9	247	---	---	---	---	PASS
CCDC88A	55704	broad.mit.edu	37	2	55529038	55529038	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55529038A>T	uc002ryv.2	-	27	5481	c.4639T>A	c.(4639-4641)TTC>ATC	p.F1547I	CCDC88A_uc010yoz.1_Missense_Mutation_p.F1520I|CCDC88A_uc010ypa.1_Missense_Mutation_p.F1547I|CCDC88A_uc010fbw.2_Intron|CCDC88A_uc002ryu.2_Missense_Mutation_p.F802I|CCDC88A_uc002rys.2_Missense_Mutation_p.F505I|CCDC88A_uc002ryw.2_Missense_Mutation_p.F831I|CCDC88A_uc010fby.1_Missense_Mutation_p.F399I	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	1548					activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						TTGGATCTGAAGCCTGCAGAA	0.393													24	46	---	---	---	---	PASS
CCDC104	112942	broad.mit.edu	37	2	55771501	55771501	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55771501T>C	uc002ryy.2	+	9	1121	c.923T>C	c.(922-924)GTA>GCA	p.V308A	CCDC104_uc002ryx.2_Missense_Mutation_p.V333A	NM_080667	NP_542398	Q96G28	CC104_HUMAN	coiled-coil domain containing 104	308										ovary(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACTGGGGAGGTAGAGGTATGG	0.378													7	19	---	---	---	---	PASS
C2orf86	51057	broad.mit.edu	37	2	63631216	63631216	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63631216T>C	uc002sch.2	-	10	1848	c.1402A>G	c.(1402-1404)AGA>GGA	p.R468G	C2orf86_uc002sce.2_RNA|C2orf86_uc002scf.2_Missense_Mutation_p.R309G|C2orf86_uc010ypu.1_RNA|C2orf86_uc002scg.2_Missense_Mutation_p.R276G|C2orf86_uc002sci.1_Missense_Mutation_p.R444G|C2orf86_uc010fcr.1_Missense_Mutation_p.R358G	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	468					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						AAAGGTCCTCTTTCAAACCTG	0.388													12	32	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73717530	73717530	+	Nonsense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73717530C>G	uc002sje.1	+	12	8558	c.8447C>G	c.(8446-8448)TCA>TGA	p.S2816*	ALMS1_uc002sjf.1_Nonsense_Mutation_p.S2772*|ALMS1_uc002sjg.2_Nonsense_Mutation_p.S2202*|ALMS1_uc002sjh.1_Nonsense_Mutation_p.S2202*	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2814					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TTAGAAAGATCAGATTTTACA	0.378													7	40	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96954772	96954772	+	Intron	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96954772C>G	uc002svu.2	-						SNRNP200_uc002svw.1_Intron	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit							catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						GAGAGGAGCTCACCTTAGCAC	0.468													3	15	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102482990	102482990	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102482990G>T	uc002tbg.2	+	18	2126	c.2071G>T	c.(2071-2073)GGG>TGG	p.G691W	MAP4K4_uc002tbc.2_Missense_Mutation_p.G769W|MAP4K4_uc002tbd.2_Missense_Mutation_p.G661W|MAP4K4_uc002tbe.2_Missense_Mutation_p.G607W|MAP4K4_uc002tbf.2_Missense_Mutation_p.G661W|MAP4K4_uc010yvy.1_Missense_Mutation_p.G684W|MAP4K4_uc002tbh.2_Missense_Mutation_p.G606W|MAP4K4_uc002tbi.2_Missense_Mutation_p.G491W|MAP4K4_uc010yvz.1_Missense_Mutation_p.G664W|MAP4K4_uc002tbk.2_Missense_Mutation_p.G146W|MAP4K4_uc002tbl.2_5'UTR	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	691					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						ATCCCAGCCCGGGTCTCACCC	0.572													4	16	---	---	---	---	PASS
MFSD9	84804	broad.mit.edu	37	2	103353166	103353166	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103353166G>T	uc002tcb.2	-	1	172	c.104C>A	c.(103-105)GCC>GAC	p.A35D	TMEM182_uc002tcc.3_5'Flank|TMEM182_uc002tcd.3_5'Flank|MFSD9_uc010fja.2_RNA	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing	35					transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						ACCGGAGTCGGCAGCCTCCGC	0.657													7	12	---	---	---	---	PASS
NPHP1	4867	broad.mit.edu	37	2	110926116	110926116	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110926116G>T	uc002tfn.3	-	6	631	c.537C>A	c.(535-537)CTC>CTA	p.L179L	NPHP1_uc002tfm.3_Silent_p.L179L|NPHP1_uc002tfl.3_Silent_p.L179L|NPHP1_uc002tfo.3_Silent_p.L117L|NPHP1_uc010ywx.1_Silent_p.L179L|NPHP1_uc010fjv.1_Silent_p.L179L	NM_207181	NP_997064	O15259	NPHP1_HUMAN	nephrocystin 1 isoform 2	179	SH3.				actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2						CAATTACAAGGAGAATTTCCC	0.338													5	29	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133618158	133618158	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133618158C>G	uc002ttp.2	-	11	1088	c.714G>C	c.(712-714)TTG>TTC	p.L238F	NCKAP5_uc002ttq.2_Missense_Mutation_p.L238F	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	238	Potential.						protein binding				0						CTCTTGTTTTCAACTTCACAC	0.393													4	4	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145182360	145182360	+	Intron	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145182360C>T	uc002tvu.2	-						ZEB2_uc002tvv.2_Intron|ZEB2_uc010zbm.1_Intron|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Intron	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b							cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		CAACATAACTCACCTGTACCA	0.453													5	18	---	---	---	---	PASS
STAM2	10254	broad.mit.edu	37	2	152977291	152977291	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152977291G>C	uc002tyc.3	-	14	1725	c.1375C>G	c.(1375-1377)CCT>GCT	p.P459A		NM_005843	NP_005834	O75886	STAM2_HUMAN	signal transducing adaptor molecule 2	459					cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.22)		ATATAAGTAGGATTGGAAACA	0.353													3	30	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155098534	155098534	+	Intron	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155098534C>T	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						CTTCTTTTCTCTTTTTCAGAT	0.333													6	15	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155307068	155307068	+	3'UTR	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155307068C>A	uc002tyr.3	+	13					GALNT13_uc002tyt.3_3'UTR|GALNT13_uc010fod.2_3'UTR|uc002tyu.1_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						ACATGAAGATCATGTCCTCCA	0.403													3	2	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155555379	155555379	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155555379A>T	uc002tyv.1	+	1	287	c.92A>T	c.(91-93)CAG>CTG	p.Q31L	KCNJ3_uc010zce.1_Missense_Mutation_p.Q31L	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	31	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	GGGCCAGGCCAGGACCCTCAG	0.597													5	21	---	---	---	---	PASS
ACVR1	90	broad.mit.edu	37	2	158622653	158622653	+	Silent	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158622653A>G	uc002tzm.3	-	9	1185	c.846T>C	c.(844-846)ATT>ATC	p.I282I	ACVR1_uc002tzn.3_Silent_p.I282I|ACVR1_uc010fog.2_Silent_p.I282I	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN	activin A receptor, type I precursor	282	Cytoplasmic (Potential).|Protein kinase.				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	GATAATGTGTAATTAACCACA	0.408													10	38	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168114356	168114356	+	Intron	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168114356C>G	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc010fpq.2_Intron|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TGTTCTTTTTCTTTTTGGCAG	0.318													4	2	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168114765	168114765	+	3'UTR	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168114765T>A	uc002udx.2	+	10					XIRP2_uc010fpn.2_Missense_Mutation_p.L603Q|XIRP2_uc010fpo.2_Missense_Mutation_p.L570Q|XIRP2_uc010fpp.2_Missense_Mutation_p.L570Q|XIRP2_uc010fpq.2_3'UTR|XIRP2_uc010fpr.2_Missense_Mutation_p.L348Q	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATGACAACCCTGCTATCCCCT	0.408													6	9	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171073828	171073828	+	Splice_Site	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171073828G>T	uc002ufy.2	+	6	670	c.527_splice	c.e6-1	p.G176_splice	MYO3B_uc002ufv.2_Splice_Site_p.G163_splice|MYO3B_uc010fqb.1_Splice_Site_p.G163_splice|MYO3B_uc002ufz.2_Splice_Site_p.G176_splice|MYO3B_uc002ufw.2_Splice_Site|MYO3B_uc002ufx.2_Splice_Site|MYO3B_uc002uga.2_Splice_Site_p.G163_splice	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						TTTCCTTATAGGTGTTTCAGC	0.348													7	133	---	---	---	---	PASS
DIRC1	116093	broad.mit.edu	37	2	189599468	189599468	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189599468G>A	uc002uqi.1	-	2	451	c.180C>T	c.(178-180)ATC>ATT	p.I60I		NM_052952	NP_443184	Q969H9	DIRC1_HUMAN	disrupted in renal carcinoma 1	60											0			OV - Ovarian serous cystadenocarcinoma(117;0.00842)|Epithelial(96;0.102)			TGTCTGAGATGATGGAAGGCT	0.428													7	32	---	---	---	---	PASS
RAPH1	65059	broad.mit.edu	37	2	204305807	204305807	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204305807C>A	uc002vad.2	-	14	2331	c.2106G>T	c.(2104-2106)CTG>CTT	p.L702L		NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains	702					cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						TGGGGGGTACCAGGATCTGAG	0.468													5	30	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210559534	210559534	+	Silent	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210559534A>G	uc002vde.1	+	7	2888	c.2640A>G	c.(2638-2640)CCA>CCG	p.P880P	MAP2_uc002vdc.1_Silent_p.P880P|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.P876P	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	880					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	TCCCATTGCCATCACCTGTTC	0.458													5	21	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218682908	218682908	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218682908G>T	uc002vgt.2	-	24	4233	c.3835C>A	c.(3835-3837)CAC>AAC	p.H1279N	TNS1_uc002vgr.2_Missense_Mutation_p.H1266N|TNS1_uc002vgs.2_Missense_Mutation_p.H1258N|TNS1_uc010zjv.1_Missense_Mutation_p.H1258N	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	1279						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TTGCCTTGGTGAGCCCCAGGG	0.657													6	14	---	---	---	---	PASS
PRKAG3	53632	broad.mit.edu	37	2	219688495	219688495	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219688495A>T	uc002vjb.1	-	13	1479	c.1460T>A	c.(1459-1461)CTC>CAC	p.L487H		NM_017431	NP_059127	Q9UGI9	AAKG3_HUMAN	AMP-activated protein kinase, non-catalytic	487				ALGA -> PSGPEKI (in Ref. 1; CAB65117).	cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding			ovary(1)|lung(1)	2		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCAGGCCCCGAGGGCATCGAT	0.602													29	77	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219878615	219878615	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219878615C>G	uc002vjl.1	-	22	3838	c.3754G>C	c.(3754-3756)GAG>CAG	p.E1252Q		NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	1252						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCATCTGCTCCTGCCCAGGA	0.567													6	25	---	---	---	---	PASS
TUBA4A	7277	broad.mit.edu	37	2	220115077	220115077	+	Silent	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220115077T>C	uc002vkt.1	-	4	1402	c.1344A>G	c.(1342-1344)GAA>GAG	p.E448E	TUBA4A_uc010zkz.1_Silent_p.E433E|TUBA4B_uc002vku.2_5'Flank|TUBA4B_uc002vkv.1_5'Flank	NM_006000	NP_005991	P68366	TBA4A_HUMAN	tubulin, alpha 4a	448					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|platelet activation|platelet degranulation|protein polymerization	cytosol|extracellular region|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)	3		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCTGCTTTATTCTTCTCCCT	0.493													57	157	---	---	---	---	PASS
PAX3	5077	broad.mit.edu	37	2	223066140	223066140	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223066140G>T	uc002vmt.1	-	9	1808	c.1442C>A	c.(1441-1443)CCA>CAA	p.P481Q	PAX3_uc002vmy.1_Missense_Mutation_p.P480Q|PAX3_uc002vmv.1_Missense_Mutation_p.P481Q|PAX3_uc002vmw.1_Missense_Mutation_p.Q399K|PAX3_uc002vmx.1_Missense_Mutation_p.Q399K	NM_181459	NP_852124	P23760	PAX3_HUMAN	paired box 3 isoform PAX3e	Error:Variant_position_missing_in_P23760_after_alignment					apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGCGATATCTGGCTTGAGATA	0.453			T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						16	59	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226446968	226446968	+	Missense_Mutation	SNP	T	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226446968T>G	uc002voe.2	+	4	1010	c.835T>G	c.(835-837)TTG>GTG	p.L279V	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.L49V	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	279										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		CTTTGACGACTTGGGCCAAGA	0.547													27	84	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230678991	230678991	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230678991C>A	uc002vpw.1	-	11	1747	c.1638G>T	c.(1636-1638)TTG>TTT	p.L546F	TRIP12_uc002vpx.1_Missense_Mutation_p.L594F|TRIP12_uc002vpy.1_Missense_Mutation_p.L249F|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Missense_Mutation_p.L552F	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	546					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACAACATCTCCAAGGCAGTCA	0.393													6	61	---	---	---	---	PASS
SP100	6672	broad.mit.edu	37	2	231404037	231404037	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231404037G>T	uc002vqu.1	+	25	2291	c.2150G>T	c.(2149-2151)TGC>TTC	p.C717F	SP100_uc010fxp.1_Missense_Mutation_p.C35F	NM_001080391	NP_001073860	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 1	Error:Variant_position_missing_in_P23497_after_alignment					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CTGTTCTGCTGCGACACTTGT	0.507													16	49	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234356821	234356821	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234356821C>A	uc002vui.1	+	13	1520	c.1508C>A	c.(1507-1509)TCG>TAG	p.S503*	DGKD_uc002vuj.1_Nonsense_Mutation_p.S459*|DGKD_uc010fyh.1_Nonsense_Mutation_p.S370*|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	503					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GTCATCTCCTCGGCCAAGTGA	0.582													4	56	---	---	---	---	PASS
ASB18	401036	broad.mit.edu	37	2	237172907	237172907	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237172907C>G	uc010znh.1	-	1	82	c.82G>C	c.(82-84)GAT>CAT	p.D28H		NM_212556	NP_997721	Q6ZVZ8	ASB18_HUMAN	ankyrin repeat and SOCS box-containing 18	28					intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)		CTCTCCTCATCTTTGGCATCC	0.488													24	47	---	---	---	---	PASS
IL5RA	3568	broad.mit.edu	37	3	3139985	3139985	+	Intron	SNP	A	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3139985A>C	uc011ask.1	-						IL5RA_uc010hbq.2_Intron|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Intron|IL5RA_uc011asl.1_Intron|IL5RA_uc011asm.1_Intron|IL5RA_uc010hbt.2_Intron|IL5RA_uc011asn.1_Intron|IL5RA_uc010hbu.2_Intron	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1						cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		CTAGGTAGTCAAAAGTAAAAA	0.368													4	37	---	---	---	---	PASS
GADL1	339896	broad.mit.edu	37	3	30842474	30842474	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30842474C>T	uc003cep.2	-	12	1204	c.1157G>A	c.(1156-1158)AGA>AAA	p.R386K	GADL1_uc003ceq.1_Missense_Mutation_p.R386K	NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	386					carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	ATCTGGTCTTCTGCTACACTG	0.438													12	14	---	---	---	---	PASS
DYNC1LI1	51143	broad.mit.edu	37	3	32574570	32574570	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32574570C>G	uc003cfb.3	-	8	1076	c.988G>C	c.(988-990)GAT>CAT	p.D330H	DYNC1LI1_uc011axh.1_Missense_Mutation_p.D214H	NM_016141	NP_057225	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain	330					cell division|interspecies interaction between organisms|mitosis|positive regulation of mitotic cell cycle spindle assembly checkpoint|transport	centrosome|condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|plasma membrane|spindle pole	ATP binding|motor activity			ovary(1)	1						ATTTTCTTATCATTATCCCAC	0.303													9	25	---	---	---	---	PASS
CX3CR1	1524	broad.mit.edu	37	3	39306949	39306949	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39306949G>A	uc003cjl.2	-	2	1144	c.1052C>T	c.(1051-1053)GCA>GTA	p.A351V		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	351	Cytoplasmic (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		AAGGAGCAATGCATCTCCATC	0.458													71	86	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51400047	51400047	+	Silent	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51400047G>C	uc011bds.1	+	49	5258	c.5235G>C	c.(5233-5235)CTG>CTC	p.L1745L		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1745	Ser-rich.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CCTCCAGCCTGAGTTCCACTC	0.572													13	20	---	---	---	---	PASS
FAM55C	91775	broad.mit.edu	37	3	101504542	101504542	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101504542C>A	uc003dvn.2	+						FAM55C_uc010hpn.2_Intron	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN	hypothetical protein LOC91775 precursor							extracellular region				ovary(1)|pancreas(1)|skin(1)	3						AGGTGAGTACCCAGTATAATC	0.478													6	71	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113135375	113135375	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113135375G>T	uc003eae.1	-	6	716	c.670C>A	c.(670-672)CGA>AGA	p.R224R		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	224										central_nervous_system(1)	1						GACTCACCTCGAAGGACTCTG	0.313													3	11	---	---	---	---	PASS
ZNF80	7634	broad.mit.edu	37	3	113955552	113955552	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113955552G>C	uc010hqo.2	-	1	874	c.370C>G	c.(370-372)CGC>GGC	p.R124G	ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80	124	C2H2-type 3; atypical.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TGAATCTGGCGGTAGCACAGG	0.562													16	46	---	---	---	---	PASS
NR1I2	8856	broad.mit.edu	37	3	119530414	119530414	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119530414G>C	uc003edj.2	+	4	2199	c.360G>C	c.(358-360)GAG>GAC	p.E120D	NR1I2_uc003edi.2_Missense_Mutation_p.E120D|NR1I2_uc003edk.2_Missense_Mutation_p.E159D|NR1I2_uc003edl.2_Missense_Mutation_p.E8D	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	120	Hinge.				drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	CCGTGGAGGAGAGGCGGGCCT	0.632													8	22	---	---	---	---	PASS
STXBP5L	9515	broad.mit.edu	37	3	120876471	120876471	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120876471C>G	uc003eec.3	+	9	1014	c.874C>G	c.(874-876)CAT>GAT	p.H292D	STXBP5L_uc011bji.1_Missense_Mutation_p.H292D	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	292					exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		CACAATTCCACATGGTAAGAT	0.413													4	27	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122447289	122447289	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122447289G>T	uc003efq.3	+	17	5310	c.5251G>T	c.(5251-5253)GGA>TGA	p.G1751*	PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Nonsense_Mutation_p.G1468*	NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1751	PARP catalytic.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		CTATACACATGGAAATCATTC	0.393													8	117	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130437384	130437384	+	Intron	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130437384G>C	uc003enj.2	-							NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4						fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						GGGGGCTAAAGAGGAAAAGAA	0.388													15	26	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130463401	130463401	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130463401G>A	uc003enj.2	-	2	1243	c.662C>T	c.(661-663)CCG>CTG	p.P221L		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	221	Protein kinase.				fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						GTCTACAAGCGGAGTTGAAGG	0.428													22	73	---	---	---	---	PASS
MRPL3	11222	broad.mit.edu	37	3	131220414	131220414	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131220414G>T	uc003eoh.2	-	2	402	c.238C>A	c.(238-240)CTG>ATG	p.L80M	MRPL3_uc011blo.1_Translation_Start_Site|MRPL3_uc011blp.1_Missense_Mutation_p.L107M	NM_007208	NP_009139	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	80					translation	mitochondrial large ribosomal subunit	RNA binding|structural constituent of ribosome				0						TCATCTTTCAGAGGACACAGT	0.398													8	205	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132185186	132185186	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132185186C>A	uc003eor.2	+	19	2077	c.2012C>A	c.(2011-2013)CCT>CAT	p.P671H	DNAJC13_uc010htq.1_Missense_Mutation_p.P671H	NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	671							heat shock protein binding			ovary(1)|breast(1)	2						GATCTCGTACCTGAGAAGGAT	0.393													6	54	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133478162	133478162	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133478162G>T	uc003epu.1	+	14	2920	c.1192G>T	c.(1192-1194)GCC>TCC	p.A398S	TF_uc011blt.1_Missense_Mutation_p.A271S|TF_uc003epw.1_Intron|TF_uc003epv.1_Missense_Mutation_p.A398S	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	398	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	AGACTGCATCGCCAAGATCAT	0.547													53	64	---	---	---	---	PASS
SLCO2A1	6578	broad.mit.edu	37	3	133666218	133666218	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133666218A>G	uc003eqa.3	-	9	1451	c.1177T>C	c.(1177-1179)TCT>CCT	p.S393P	SLCO2A1_uc003eqb.3_Missense_Mutation_p.S317P|SLCO2A1_uc011blv.1_Missense_Mutation_p.S212P	NM_005630	NP_005621	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family,	393	Helical; Name=9; (Potential).				sodium-independent organic anion transport	integral to plasma membrane|membrane fraction	prostaglandin transmembrane transporter activity|protein binding			central_nervous_system(1)	1						GCTTGTAGAGAGAAAACAAAG	0.507													13	51	---	---	---	---	PASS
MSL2	55167	broad.mit.edu	37	3	135870092	135870092	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135870092C>A	uc003eqx.1	-	2	2364	c.1631G>T	c.(1630-1632)AGT>ATT	p.S544I	MSL2_uc011bmb.1_Missense_Mutation_p.S470I	NM_018133	NP_060603	Q9HCI7	MSL2_HUMAN	ring finger protein 184 isoform 1	544					histone H4-K16 acetylation	MSL complex	zinc ion binding			central_nervous_system(1)	1						ATTTATTACACTGGTGCTGGT	0.473													11	56	---	---	---	---	PASS
A4GNT	51146	broad.mit.edu	37	3	137843236	137843236	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137843236C>T	uc003ers.2	-	3	1095	c.893G>A	c.(892-894)CGG>CAG	p.R298Q		NM_016161	NP_057245	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	298	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity			central_nervous_system(1)	1						AATCACAGCCCGCCCCTCCTG	0.517													16	66	---	---	---	---	PASS
ESYT3	83850	broad.mit.edu	37	3	138183263	138183263	+	Nonsense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138183263C>G	uc003esk.2	+	9	1218	c.992C>G	c.(991-993)TCA>TGA	p.S331*	ESYT3_uc010hug.2_RNA	NM_031913	NP_114119	A0FGR9	ESYT3_HUMAN	family with sequence similarity 62 (C2 domain	331	C2 1.					integral to membrane|plasma membrane					0						CGAGGCAAGTCAGATCCCTAC	0.572													20	37	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141163129	141163129	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141163129G>T	uc003etw.2	+	8	2881	c.1899G>T	c.(1897-1899)TTG>TTT	p.L633F	ZBTB38_uc010hun.2_Missense_Mutation_p.L630F|ZBTB38_uc010huo.2_Missense_Mutation_p.L633F|ZBTB38_uc003ety.2_Missense_Mutation_p.L633F|ZBTB38_uc010hup.2_Missense_Mutation_p.L634F	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	633					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						CCATCCCATTGGAAACATCTG	0.448													7	114	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142116193	142116193	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142116193C>G	uc003eus.2	-	20	2384	c.2317G>C	c.(2317-2319)GAA>CAA	p.E773Q	XRN1_uc010huu.2_Missense_Mutation_p.E239Q|XRN1_uc003eut.2_Missense_Mutation_p.E773Q|XRN1_uc003euu.2_Missense_Mutation_p.E773Q|XRN1_uc003euv.1_Missense_Mutation_p.E634Q	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	773					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						CCTTGTACTTCTTTTGCCCAG	0.358													5	21	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170811686	170811686	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170811686G>T	uc003fhh.2	-	23	3008	c.2663C>A	c.(2662-2664)TCT>TAT	p.S888Y	TNIK_uc003fhi.2_Missense_Mutation_p.S833Y|TNIK_uc003fhj.2_Missense_Mutation_p.S859Y|TNIK_uc003fhk.2_Missense_Mutation_p.S880Y|TNIK_uc003fhl.2_Missense_Mutation_p.S804Y|TNIK_uc003fhm.2_Missense_Mutation_p.S825Y|TNIK_uc003fhn.2_Missense_Mutation_p.S851Y|TNIK_uc003fho.2_Missense_Mutation_p.S796Y|TNIK_uc003fhg.2_Missense_Mutation_p.S66Y	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	888	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GTCCGCATGAGAGGTCTCCAG	0.478													7	88	---	---	---	---	PASS
MRPL47	57129	broad.mit.edu	37	3	179316559	179316559	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179316559C>A	uc003fjz.2	-	4	328	c.306G>T	c.(304-306)TGG>TGT	p.W102C	MRPL47_uc003fka.2_5'UTR|MRPL47_uc003fkb.2_Missense_Mutation_p.W82C	NM_020409	NP_065142	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47 isoform a	102					translation	mitochondrial ribosome	structural constituent of ribosome				0	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			GTAAGACATACCTATACAAAA	0.383													10	62	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183905548	183905548	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183905548C>A	uc003fmz.2	+	5	578	c.445C>A	c.(445-447)CTA>ATA	p.L149I	ABCF3_uc003fna.2_Missense_Mutation_p.L143I|ABCF3_uc003fnb.2_5'Flank	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	149							ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGCAACCCTCTGTGAGTGGG	0.522													6	116	---	---	---	---	PASS
TMEM207	131920	broad.mit.edu	37	3	190165606	190165606	+	Nonsense_Mutation	SNP	G	T	T	rs138370145		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190165606G>T	uc003fsj.2	-	2	153	c.86C>A	c.(85-87)TCG>TAG	p.S29*		NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor	29						integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		TGGTAGGTCCGAGAGCACCAA	0.353													5	96	---	---	---	---	PASS
FGF12	2257	broad.mit.edu	37	3	191888416	191888416	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191888416C>A	uc003fsx.2	-	4	1270	c.444G>T	c.(442-444)AAG>AAT	p.K148N	FGF12_uc003fsy.2_Missense_Mutation_p.K86N	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1	148					cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		ACACAGATTCCTTGAATTTGC	0.373													7	152	---	---	---	---	PASS
FYTTD1	84248	broad.mit.edu	37	3	197501077	197501077	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197501077C>A	uc003fyi.2	+	6	871	c.652C>A	c.(652-654)CGT>AGT	p.R218S	FYTTD1_uc011bui.1_Missense_Mutation_p.R192S|FYTTD1_uc011buj.1_RNA|FYTTD1_uc011buk.1_Missense_Mutation_p.R151S	NM_032288	NP_115664	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1 isoform 1	218					mRNA export from nucleus	nuclear speck	mRNA binding|protein binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		AAAGAGAACTCGTCAGTAAGT	0.383													6	200	---	---	---	---	PASS
EVC	2121	broad.mit.edu	37	4	5733382	5733382	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5733382G>A	uc003gil.1	+	4	799	c.615G>A	c.(613-615)GAG>GAA	p.E205E	EVC_uc003gim.1_RNA	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	205					muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)				TGGCCTGCGAGAGGTAAGGAG	0.517													7	10	---	---	---	---	PASS
SH3TC1	54436	broad.mit.edu	37	4	8226901	8226901	+	Splice_Site	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8226901G>A	uc003gkv.3	+	11	1345	c.1244_splice	c.e11-1	p.D415_splice	SH3TC1_uc003gkw.3_Splice_Site_p.D339_splice|SH3TC1_uc003gkx.3_Splice_Site	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3						TCCCTTGCCAGACTCAGTAGA	0.562													6	8	---	---	---	---	PASS
CLRN2	645104	broad.mit.edu	37	4	17517142	17517142	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17517142A>G	uc003gpg.1	+	1	355	c.253A>G	c.(253-255)ATC>GTC	p.I85V		NM_001079827	NP_001073296	A0PK11	CLRN2_HUMAN	clarin 2	85						integral to membrane					0						CCAATTCACGAGTGAGTATAT	0.488													5	15	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30723409	30723409	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30723409G>T	uc003gsk.1	+	1	1373	c.365G>T	c.(364-366)AGC>ATC	p.S122I	PCDH7_uc011bxw.1_Missense_Mutation_p.S122I|PCDH7_uc011bxx.1_Missense_Mutation_p.S122I	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	122	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						CCCTCGCAGAGCTGGGTGGAC	0.612													7	5	---	---	---	---	PASS
N4BP2	55728	broad.mit.edu	37	4	40123493	40123493	+	Silent	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40123493A>G	uc003guy.3	+	9	4100	c.3762A>G	c.(3760-3762)CTA>CTG	p.L1254L	N4BP2_uc010ifq.2_Silent_p.L1174L|N4BP2_uc010ifr.2_Silent_p.L1174L	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	1254						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						CAGGTATTCTAAAAGCTACTA	0.373													17	15	---	---	---	---	PASS
PHOX2B	8929	broad.mit.edu	37	4	41748342	41748342	+	Intron	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41748342G>A	uc003gwf.3	-							NM_003924	NP_003915	Q99453	PHX2B_HUMAN	paired-like homeobox 2b						positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			autonomic_ganglia(7)|lung(2)|ovary(2)|central_nervous_system(1)	12						AACCACACCTGGCCCAAGACG	0.602			Mis|F		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				5	11	---	---	---	---	PASS
GABRB1	2560	broad.mit.edu	37	4	47408751	47408751	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47408751C>A	uc003gxh.2	+	8	1262	c.888C>A	c.(886-888)ACC>ACA	p.T296T	GABRB1_uc011bze.1_Silent_p.T226T	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	296					synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TCAGGGAGACCCTGCCAAAGA	0.438													6	14	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47765446	47765446	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47765446C>A	uc003gxm.2	-	4	660	c.567G>T	c.(565-567)CTG>CTT	p.L189L	CORIN_uc011bzf.1_Silent_p.L50L|CORIN_uc011bzg.1_Silent_p.L122L|CORIN_uc011bzh.1_Silent_p.L189L|CORIN_uc011bzi.1_Silent_p.L189L|CORIN_uc003gxn.3_Silent_p.L189L	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	189	Extracellular (Potential).|FZ 1.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						TACAGCCAAACAGCATGATAT	0.438													4	7	---	---	---	---	PASS
UGT2B28	54490	broad.mit.edu	37	4	70156481	70156481	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70156481C>T	uc003hej.2	+	5	1264	c.1262C>T	c.(1261-1263)TCG>TTG	p.S421L	UGT2B28_uc010ihr.2_Intron	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	421					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	CACACAATGTCGAGTACAGAC	0.423													7	19	---	---	---	---	PASS
UTP3	57050	broad.mit.edu	37	4	71555257	71555257	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71555257G>T	uc003hfo.2	+	1	1062	c.863G>T	c.(862-864)AGG>ATG	p.R288M		NM_020368	NP_065101	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit processome component	288					brain development|chromatin modification|gene silencing	nucleolus					0			Lung(101;0.235)			CTGAAAGCTAGGAGAGTCCCA	0.433													10	364	---	---	---	---	PASS
MTHFD2L	441024	broad.mit.edu	37	4	75040299	75040299	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75040299T>A	uc003hhn.1	+	5	564	c.46T>A	c.(46-48)TGG>AGG	p.W16R	MTHFD2L_uc011cbj.1_Missense_Mutation_p.W16R|MTHFD2L_uc011cbk.1_Missense_Mutation_p.W74R|MTHFD2L_uc003hho.2_RNA|MTHFD2L_uc003hhs.2_RNA	NM_001144978	NP_001138450	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase 2-like	16					folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity			ovary(1)|central_nervous_system(1)	2			all cancers(17;0.0101)|Lung(101;0.196)			TGTGGAATCATGGGTTTCCCT	0.408													23	9	---	---	---	---	PASS
BTC	685	broad.mit.edu	37	4	75675877	75675877	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75675877G>T	uc003hig.2	-	4	681	c.334C>A	c.(334-336)CTA>ATA	p.L112I		NM_001729	NP_001720	P35070	BTC_HUMAN	betacellulin precursor	112	Extracellular (Potential).				positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity			central_nervous_system(1)|skin(1)	2			Lung(101;0.219)			TCTCCTCTTAGGTAAAACAAG	0.398													8	273	---	---	---	---	PASS
G3BP2	9908	broad.mit.edu	37	4	76582779	76582779	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76582779C>G	uc003hir.2	-	4	478	c.313G>C	c.(313-315)GAA>CAA	p.E105Q	G3BP2_uc003his.2_Missense_Mutation_p.E105Q|G3BP2_uc003hit.2_Missense_Mutation_p.E105Q	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Ras-GTPase activating protein SH3 domain-binding	105	NTF2.				cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AACTTTCTTTCTGGTTGTCCA	0.398													33	390	---	---	---	---	PASS
USO1	8615	broad.mit.edu	37	4	76670076	76670076	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76670076G>T	uc003hiu.2	+							NM_003715	NP_003706	O60763	USO1_HUMAN	USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TACTTGTGATGGTACATGTGC	0.348													6	40	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76782018	76782018	+	Missense_Mutation	SNP	C	A	A	rs148045586		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76782018C>A	uc003hix.2	-	17	2421	c.2064G>T	c.(2062-2064)ATG>ATT	p.M688I	PPEF2_uc003hiy.2_RNA	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	688					detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGTCGATATTCATGTGAGAGC	0.453													23	284	---	---	---	---	PASS
SHROOM3	57619	broad.mit.edu	37	4	77661234	77661234	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77661234C>G	uc011cbx.1	+	5	2861	c.1908C>G	c.(1906-1908)GCC>GCG	p.A636A	SHROOM3_uc011cbz.1_Silent_p.A460A|SHROOM3_uc003hkf.1_Silent_p.A511A|SHROOM3_uc003hkg.2_Silent_p.A414A	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	636					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			ACCACAATGCCAACCTCTGGA	0.567													8	445	---	---	---	---	PASS
AFF1	4299	broad.mit.edu	37	4	88035792	88035792	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88035792C>G	uc003hqj.3	+	11	2193	c.1786C>G	c.(1786-1788)CAA>GAA	p.Q596E	AFF1_uc011ccz.1_Missense_Mutation_p.Q603E|AFF1_uc003hqk.3_Missense_Mutation_p.Q596E|AFF1_uc011cda.1_Missense_Mutation_p.Q234E	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	596						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GGAGCCCCCACAAAGGCAAAC	0.637													16	27	---	---	---	---	PASS
SPP1	6696	broad.mit.edu	37	4	88903701	88903701	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88903701G>A	uc003hra.2	+	7	763	c.598G>A	c.(598-600)GGT>AGT	p.G200S	SPP1_uc003hrb.2_Missense_Mutation_p.G173S|SPP1_uc003hrc.2_Missense_Mutation_p.G186S|SPP1_uc011cde.1_Missense_Mutation_p.G213S|SPP1_uc003hrd.2_Missense_Mutation_p.G159S	NM_001040058	NP_001035147	P10451	OSTP_HUMAN	secreted phosphoprotein 1 isoform a	200					biomineral tissue development|cell adhesion|decidualization|embryo implantation|ossification|response to vitamin D	extracellular space	cytokine activity			ovary(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		GGAGTTGAATGGTGCATACAA	0.507													17	37	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95204388	95204388	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95204388A>T	uc003htc.3	+	22	3098	c.2843A>T	c.(2842-2844)GAT>GTT	p.D948V	SMARCAD1_uc003htb.3_Missense_Mutation_p.D950V|SMARCAD1_uc003htd.3_Missense_Mutation_p.D950V|SMARCAD1_uc010ila.2_Missense_Mutation_p.D813V|SMARCAD1_uc011cdw.1_Missense_Mutation_p.D518V	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	948	Helicase C-terminal.				chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		ATACTTCACGATATTGACTGT	0.333													33	58	---	---	---	---	PASS
UGT8	7368	broad.mit.edu	37	4	115544119	115544119	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115544119C>A	uc003ibs.2	+	2	605	c.83C>A	c.(82-84)CCA>CAA	p.P28Q	UGT8_uc003ibt.2_Missense_Mutation_p.P28Q|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	28					central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		ATCGTGCCGCCAATTATGTTT	0.468													5	17	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141578722	141578722	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141578722C>G	uc010ioj.2	-	12	2438	c.2166G>C	c.(2164-2166)TTG>TTC	p.L722F		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	722						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CCTTGCAGTTCAACAGTTTGT	0.438													38	110	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151604779	151604779	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151604779T>C	uc010ipj.2	-	37	6319	c.5845A>G	c.(5845-5847)ACA>GCA	p.T1949A	LRBA_uc003ilt.3_Missense_Mutation_p.T608A|LRBA_uc003ilu.3_Missense_Mutation_p.T1949A	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	1949						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					TGAGTTGCTGTCACGTGGTCA	0.428													10	28	---	---	---	---	PASS
WWC2	80014	broad.mit.edu	37	4	184233499	184233499	+	Silent	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184233499A>G	uc010irx.2	+	22	3572	c.3390A>G	c.(3388-3390)GAA>GAG	p.E1130E	WWC2_uc003ivk.3_Silent_p.E925E|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_Silent_p.E812E|WWC2_uc003ivn.3_Silent_p.E645E|WWC2_uc010irz.2_Silent_p.E471E|WWC2_uc003ivo.3_Silent_p.E258E	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	1130	Potential.									ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TCCAGGCTGAACAGTCCAAAG	0.458													61	74	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189068016	189068016	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189068016C>G	uc003izm.1	+	6	1012	c.897C>G	c.(895-897)CTC>CTG	p.L299L	TRIML1_uc003izn.1_Silent_p.L23L	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	299	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		ATGCCTATCTCGTGTTGTCGG	0.512													52	83	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1409249	1409249	+	Intron	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1409249G>C	uc003jck.2	-							NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter						cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	CCCTGGAAGAGAGGGGAGCCT	0.557													5	13	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13766275	13766275	+	Missense_Mutation	SNP	G	A	A	rs139821753		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13766275G>A	uc003jfd.2	-	59	9953	c.9911C>T	c.(9910-9912)TCG>TTG	p.S3304L	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3304	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GGCGATGTCCGAAGGCCTGAT	0.527									Kartagener_syndrome				11	28	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13919404	13919404	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13919404C>T	uc003jfd.2	-	7	898	c.856G>A	c.(856-858)GAG>AAG	p.E286K	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	286	Potential.|Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TGCTCCAGCTCCGCTCGTGGC	0.537									Kartagener_syndrome				36	119	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19483619	19483619	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19483619C>A	uc003jgc.2	-	11	2050	c.1673G>T	c.(1672-1674)CGA>CTA	p.R558L	CDH18_uc003jgd.2_Missense_Mutation_p.R558L|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	558	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTGAACAGTTCGACTAAATCT	0.458													6	20	---	---	---	---	PASS
C5orf34	375444	broad.mit.edu	37	5	43487154	43487154	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43487154A>G	uc003jnz.1	-	14	2097	c.1780T>C	c.(1780-1782)TCT>CCT	p.S594P		NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	594										breast(1)	1	Lung NSC(6;2.07e-05)					TGATCAAAAGACTGTTGTTCA	0.333													9	12	---	---	---	---	PASS
C5orf34	375444	broad.mit.edu	37	5	43506193	43506193	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43506193C>T	uc003jnz.1	-	5	906	c.589G>A	c.(589-591)GAG>AAG	p.E197K	C5orf34_uc011cpx.1_Missense_Mutation_p.E83K	NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	197										breast(1)	1	Lung NSC(6;2.07e-05)					CAATGAAACTCATTTTCTTTA	0.363													23	41	---	---	---	---	PASS
PARP8	79668	broad.mit.edu	37	5	50123778	50123778	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50123778C>T	uc003jon.3	+	21	2160	c.1978C>T	c.(1978-1980)CAA>TAA	p.Q660*	PARP8_uc011cpz.1_Nonsense_Mutation_p.Q552*|PARP8_uc003joo.2_Nonsense_Mutation_p.Q660*|PARP8_uc003jop.2_Nonsense_Mutation_p.Q618*	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	660	PARP catalytic.					intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				TAAATGGCAGCAATTGAAGTT	0.338													6	12	---	---	---	---	PASS
ITGA2	3673	broad.mit.edu	37	5	52358679	52358679	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52358679G>T	uc003joy.2	+	13	1665	c.1522G>T	c.(1522-1524)GTG>TTG	p.V508L	ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.V432L|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	508	FG-GAP 5.|Extracellular (Potential).				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				CATTACAGACGTGCTCTTGGT	0.368													13	22	---	---	---	---	PASS
UTP15	84135	broad.mit.edu	37	5	72872776	72872776	+	Splice_Site	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72872776G>T	uc003kcw.1	+	8	1033	c.810_splice	c.e8-1	p.R270_splice	UTP15_uc011cso.1_Splice_Site_p.R251_splice|UTP15_uc011csp.1_Splice_Site_p.R80_splice|UTP15_uc010ize.1_Splice_Site_p.R270_splice	NM_032175	NP_115551	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein,						rRNA processing	cytoplasm|nucleolus					0		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		CTTTTTATTAGGAAGGTGAAA	0.323													6	95	---	---	---	---	PASS
RASGRF2	5924	broad.mit.edu	37	5	80502656	80502656	+	Intron	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80502656T>C	uc003kha.1	+						RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ATTTGATATCTTTTTCAGGGC	0.378													12	46	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112870077	112870077	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112870077G>A	uc003kqn.2	+	6	1101	c.918G>A	c.(916-918)ACG>ACA	p.T306T	YTHDC2_uc010jce.1_Silent_p.T306T|YTHDC2_uc010jcf.1_Silent_p.T6T	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	306	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GAGATAGTACGTTGTCGACTG	0.348													18	34	---	---	---	---	PASS
TRIM36	55521	broad.mit.edu	37	5	114506856	114506856	+	Intron	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114506856T>A	uc003kqs.2	-						TRIM36_uc011cwc.1_5'Flank|TRIM36_uc003kqt.2_Intron|TRIM36_uc003kqu.2_Missense_Mutation_p.T43S	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1							acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TCTGTCGCTGTGGCAAGTTCC	0.483													29	61	---	---	---	---	PASS
PPIC	5480	broad.mit.edu	37	5	122359706	122359706	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122359706G>T	uc003kth.2	-							NM_000943	NP_000934	P45877	PPIC_HUMAN	peptidylprolyl isomerase C						protein folding|signal transduction	cytoplasm	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding			ovary(1)	1		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	TGTCTGGTGAGAGAAAAGTAG	0.463													8	82	---	---	---	---	PASS
SEC24A	10802	broad.mit.edu	37	5	134002525	134002525	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134002525C>A	uc003kzs.2	+	3	866	c.578C>A	c.(577-579)CCT>CAT	p.P193H	SEC24A_uc011cxu.1_5'UTR	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	193	Pro-rich.				COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTTCTGTACCTCCCTTAGTG	0.522													6	100	---	---	---	---	PASS
FAM13B	51306	broad.mit.edu	37	5	137347574	137347574	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137347574G>T	uc003lbz.2	-	5	965	c.431C>A	c.(430-432)CCT>CAT	p.P144H	FAM13B_uc003lcb.2_Missense_Mutation_p.P26H|FAM13B_uc003lca.2_Missense_Mutation_p.P144H	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1	144	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						ATAATTAACAGGTGGAAGCTG	0.313													7	69	---	---	---	---	PASS
KIF20A	10112	broad.mit.edu	37	5	137520077	137520077	+	Nonsense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137520077C>G	uc003lcj.2	+	12	1998	c.1502C>G	c.(1501-1503)TCA>TGA	p.S501*	KIF20A_uc011cyo.1_Nonsense_Mutation_p.S483*	NM_005733	NP_005724	O95235	KI20A_HUMAN	kinesin family member 20A	501					cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GCCAAGTTCTCAGCCATTGCT	0.488													39	119	---	---	---	---	PASS
HARS	3035	broad.mit.edu	37	5	140056260	140056260	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140056260G>T	uc003lgv.2	-	10	1255	c.1173C>A	c.(1171-1173)TCC>TCA	p.S391S	HARS_uc003lgu.2_Silent_p.S322S|HARS_uc011czm.1_Silent_p.S351S|HARS_uc003lgw.2_Silent_p.S371S|HARS_uc011czn.1_Silent_p.S331S|HARS_uc010jfu.2_Silent_p.S391S|HARS_uc011czo.1_Silent_p.S317S|HARS_uc011czp.1_Silent_p.S277S|HARS_uc011czq.1_Silent_p.S281S	NM_002109	NP_002100	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	391					histidyl-tRNA aminoacylation	cytosol	ATP binding|histidine-tRNA ligase activity			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	GTTCCACGATGGAGAAAATCC	0.557													8	184	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140476341	140476341	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476341C>A	uc003lil.2	+	1	2105	c.1967C>A	c.(1966-1968)GCC>GAC	p.A656D	PCDHB2_uc003lim.1_Missense_Mutation_p.A317D	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	656	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGCGCTCGGCCACCGCCACG	0.711													13	15	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140596022	140596022	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140596022C>A	uc003lja.1	+	1	2514	c.2327C>A	c.(2326-2328)CCC>CAC	p.P776H		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	776	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACTTCCCTCCCCAGTGCCCT	0.468													39	65	---	---	---	---	PASS
PCDHGA5	56110	broad.mit.edu	37	5	140746176	140746176	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140746176C>G	uc003lju.1	+	1	2279	c.2279C>G	c.(2278-2280)ACC>AGC	p.T760S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.T760S	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	760	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCTCCCTCACCGCGGACTCG	0.597													56	130	---	---	---	---	PASS
NDST1	3340	broad.mit.edu	37	5	149925029	149925029	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149925029G>A	uc003lsk.3	+	11	2628	c.2126G>A	c.(2125-2127)CGG>CAG	p.R709Q	NDST1_uc011dcj.1_Missense_Mutation_p.R709Q	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	709	Heparan sulfate N-sulfotransferase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCGCGGACCGGGCCTATTCC	0.557													33	92	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168199840	168199840	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168199840G>A	uc003mab.2	-	14	1825	c.1405C>T	c.(1405-1407)CGA>TGA	p.R469*	SLIT3_uc010jjg.2_Nonsense_Mutation_p.R469*|SLIT3_uc010jji.2_Nonsense_Mutation_p.R469*|SLIT3_uc003mac.1_Nonsense_Mutation_p.R266*	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	469	LRRCT 2.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTGGCGAGTCGGCGCGGGCTG	0.602													9	26	---	---	---	---	PASS
STK10	6793	broad.mit.edu	37	5	171517372	171517372	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171517372C>A	uc003mbo.1	-							NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGTCCTGGCCAGGGAAAACC	0.537													47	144	---	---	---	---	PASS
CNOT6	57472	broad.mit.edu	37	5	179991578	179991578	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179991578G>T	uc003mlx.2	+	5	824	c.475G>T	c.(475-477)GGT>TGT	p.G159C	CNOT6_uc010jld.2_Missense_Mutation_p.G159C|CNOT6_uc010jle.2_Missense_Mutation_p.V159F	NM_015455	NP_056270	Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	159					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		TAATTTGTCAGGTACTGCAAA	0.338													6	85	---	---	---	---	PASS
BTNL8	79908	broad.mit.edu	37	5	180374682	180374682	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180374682G>T	uc003mmp.2	+						BTNL8_uc003mmq.2_Nonsense_Mutation_p.G282*|BTNL8_uc011dhg.1_Intron|BTNL8_uc010jll.2_Nonsense_Mutation_p.G282*|BTNL8_uc010jlm.2_Intron|BTNL8_uc011dhh.1_Intron	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor							integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCAGGGACAGGATCAGAGAT	0.488													7	150	---	---	---	---	PASS
TRIM7	81786	broad.mit.edu	37	5	180630491	180630491	+	Intron	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180630491G>C	uc003mmz.1	-						TRIM7_uc003mmv.1_5'Flank|TRIM7_uc003mmw.1_5'UTR|TRIM7_uc003mmx.1_Intron|TRIM7_uc003mmy.1_Intron|TRIM7_uc003mna.2_3'UTR	NM_203293	NP_976038	Q9C029	TRIM7_HUMAN	tripartite motif-containing 7 isoform 1							cytoplasm|nucleus	zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		CCCTGGTGCTGAGTTCTCAGG	0.473													19	41	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12121781	12121781	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12121781C>T	uc003nac.2	+	4	1932	c.1753C>T	c.(1753-1755)CCT>TCT	p.P585S	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	585					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GGATCCCAAGCCTGAACTTTC	0.507													42	25	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	21108660	21108660	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21108660G>T	uc003ndc.1	+	13	1439	c.1265G>T	c.(1264-1266)CGG>CTG	p.R422L	CDKAL1_uc003ndd.1_Missense_Mutation_p.R422L|CDKAL1_uc003nde.1_Intron|CDKAL1_uc003ndf.1_Missense_Mutation_p.R18L	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	422					RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			GATCTTTCTCGGGTGTTTCAT	0.294													3	15	---	---	---	---	PASS
DCDC2	51473	broad.mit.edu	37	6	24178827	24178827	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24178827C>A	uc003ndx.2	-	9	1359	c.1057G>T	c.(1057-1059)GGA>TGA	p.G353*	DCDC2_uc003ndy.2_Nonsense_Mutation_p.G353*|DCDC2_uc003ndw.2_Nonsense_Mutation_p.G104*	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	353					cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				GCCTTCTCTCCATCTTCTTCC	0.433													33	23	---	---	---	---	PASS
ZNF391	346157	broad.mit.edu	37	6	27368847	27368847	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27368847G>A	uc003njf.1	+	3	1216	c.698G>A	c.(697-699)CGT>CAT	p.R233H		NM_001076781	NP_001070249	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	233	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(2)|skin(1)	3						TTCGGTGACCGTTCAACCATA	0.423													17	8	---	---	---	---	PASS
HIST1H3H	8357	broad.mit.edu	37	6	27778110	27778110	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27778110A>T	uc003njm.2	+	1	269	c.259A>T	c.(259-261)AGC>TGC	p.S87C	HIST1H2BL_uc003njl.2_5'Flank	NM_003536	NP_003527	P68431	H31_HUMAN	histone cluster 1, H3h	87					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1						GCGCTTCCAGAGCTCCGCGGT	0.607													38	34	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31911594	31911594	+	5'Flank	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31911594G>T	uc003nyj.3	+						C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_Intron|C2_uc003nyf.2_Intron|C2_uc010jtk.2_Intron|C2_uc011doq.1_Intron|C2_uc003nyg.2_Intron|CFB_uc011dor.1_Intron|C2_uc003nyh.1_Intron|CFB_uc011dos.1_5'Flank|CFB_uc003nyi.2_5'Flank	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein						complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						CAGGTGCCTGGAGTCTGGGAT	0.562													6	77	---	---	---	---	PASS
HLA-DRB5	3127	broad.mit.edu	37	6	32487330	32487330	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32487330C>T	uc003obj.2	-	3	474	c.469G>A	c.(469-471)GAA>AAA	p.E157K	HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Missense_Mutation_p.E157K	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR	157	Ig-like C1-type.|Beta-2.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						CACCTGACTTCAATGCTGCCT	0.552													8	22	---	---	---	---	PASS
HLA-DRB1	3123	broad.mit.edu	37	6	32549517	32549517	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32549517C>T	uc003obp.3	-	3	512	c.469G>A	c.(469-471)GAA>AAA	p.E157K	HLA-DRB1_uc011dqa.1_5'UTR|HLA-DRB5_uc003obk.3_Intron|HLA-DRB6_uc003obo.1_Intron|HLA-DRB1_uc011dqb.1_5'UTR|HLA-DRB1_uc011dqc.1_5'UTR	NM_002124	NP_002115	P01911	2B1F_HUMAN	major histocompatibility complex, class II, DR	157	Ig-like C1-type.|Beta-2.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex				skin(1)	1						CACCTGACTTCAATGCTGCCT	0.547									Rheumatoid_Arthritis|Sj_gren_syndrome	Multiple Myeloma(14;0.17)			14	67	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33139299	33139299	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33139299A>T	uc003ocx.1	-	43	3431	c.3203T>A	c.(3202-3204)GTG>GAG	p.V1068E	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.V982E|COL11A2_uc003ocz.1_Missense_Mutation_p.V961E	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1068	Triple-helical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						AGGAAGCCCCACAGGACCCTG	0.632													8	22	---	---	---	---	PASS
ZBTB9	221504	broad.mit.edu	37	6	33422975	33422975	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33422975C>G	uc003oeq.2	+	2	366	c.98C>G	c.(97-99)TCT>TGT	p.S33C		NM_152735	NP_689948	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	33					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CATAGCTCGTCTCTGCTGGAA	0.582													37	56	---	---	---	---	PASS
FGD2	221472	broad.mit.edu	37	6	36976607	36976607	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36976607C>A	uc010jwp.1	+						FGD2_uc003onf.2_Intron|FGD2_uc011dtu.1_Intron|FGD2_uc003ong.2_Intron|FGD2_uc011dtv.1_Intron	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2						actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						CTCTTCTCCTCAGGACCCCAG	0.612													5	37	---	---	---	---	PASS
PEX6	5190	broad.mit.edu	37	6	42932076	42932076	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42932076G>T	uc003otf.2	-	17	3033	c.2940C>A	c.(2938-2940)TGC>TGA	p.C980*	uc003ote.1_5'Flank|PEX6_uc010jya.2_RNA	NM_000287	NP_000278	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	980					protein import into peroxisome matrix, translocation|protein stabilization	cytosol|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)	1			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GGGGCTCCTAGCAGGCAGCAA	0.637													6	31	---	---	---	---	PASS
AARS2	57505	broad.mit.edu	37	6	44279966	44279966	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44279966C>T	uc010jza.1	-	2	281	c.278G>A	c.(277-279)CGA>CAA	p.R93Q	SPATS1_uc003oxg.2_Intron	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	alanyl-tRNA synthetase 2, mitochondrial	93					alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			ovary(1)	1	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		L-Alanine(DB00160)	CATCTCGCTTCGTGGATCCAC	0.542													24	46	---	---	---	---	PASS
CYP39A1	51302	broad.mit.edu	37	6	46620210	46620210	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46620210G>T	uc003oyf.1	-	1	314	c.110C>A	c.(109-111)CCT>CAT	p.P37H	CYP39A1_uc011dwa.1_Missense_Mutation_p.P37H|CYP39A1_uc010jzd.1_5'UTR|SLC25A27_uc011dwb.1_5'Flank|SLC25A27_uc003oyg.2_5'Flank|SLC25A27_uc003oyh.2_5'Flank|SLC25A27_uc011dwc.1_5'Flank	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,	37					bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						TCCAATCCAAGGAATCCAGCC	0.483													10	381	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49587042	49587042	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49587042C>G	uc003ozk.3	-	2	253	c.191G>C	c.(190-192)GGG>GCG	p.G64A	RHAG_uc010jzl.2_Missense_Mutation_p.G64A|RHAG_uc010jzm.2_Missense_Mutation_p.G64A	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	64	Helical; (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					GAAGCCAAACCCAACAAATAT	0.418													14	12	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51890331	51890331	+	Nonsense_Mutation	SNP	G	T	T	rs149167975		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51890331G>T	uc003pah.1	-	32	4553	c.4277C>A	c.(4276-4278)TCG>TAG	p.S1426*	PKHD1_uc003pai.2_Nonsense_Mutation_p.S1426*	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1426	IPT/TIG 9.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AAAAGGACCCGAGAGGTCAAC	0.542													6	187	---	---	---	---	PASS
HCRTR2	3062	broad.mit.edu	37	6	55128539	55128539	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55128539C>G	uc003pcl.2	+	4	996	c.681C>G	c.(679-681)TTC>TTG	p.F227L	HCRTR2_uc010jzv.2_RNA|HCRTR2_uc010jzw.1_Missense_Mutation_p.F162L	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	227	Helical; Name=5; (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACATCTGTTTCTTTCTGGTGA	0.363													5	5	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56482146	56482146	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56482146G>T	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Missense_Mutation_p.P2040H	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCAGCACTGGGAACTGGGTT	0.403													6	82	---	---	---	---	PASS
PHF3	23469	broad.mit.edu	37	6	64408187	64408187	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64408187G>T	uc003pep.1	+	6	2781	c.2755G>T	c.(2755-2757)GCT>TCT	p.A919S	PHF3_uc010kag.1_Missense_Mutation_p.A831S|PHF3_uc010kah.1_Missense_Mutation_p.A733S|PHF3_uc003pen.2_Missense_Mutation_p.A831S|PHF3_uc011dxs.1_Missense_Mutation_p.A188S	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	919					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TGCTGCTTCTGCTTCCAAGCC	0.348													12	71	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75848583	75848583	+	Silent	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75848583G>C	uc003phs.2	-	28	5218	c.5052C>G	c.(5050-5052)CTC>CTG	p.L1684L	COL12A1_uc003pht.2_Silent_p.L520L	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1684	Fibronectin type-III 12.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTATTCTGTAGAGAGACACAT	0.423													6	24	---	---	---	---	PASS
HTR1B	3351	broad.mit.edu	37	6	78172386	78172386	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78172386G>T	uc003pil.1	-	1	735	c.735C>A	c.(733-735)AAC>AAA	p.N245K		NM_000863	NP_000854	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B	245	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cAMP biosynthetic process|synaptic transmission	integral to plasma membrane	protein binding|serotonin receptor activity				0		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Dexfenfluramine(DB01191)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Naratriptan(DB00952)|Pindolol(DB00960)|Propranolol(DB00571)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Venlafaxine(DB00285)|Zolmitriptan(DB00315)	TGCCGGTCCTGTTGGGCGTCT	0.622													21	28	---	---	---	---	PASS
SLC35A1	10559	broad.mit.edu	37	6	88221170	88221170	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88221170G>T	uc011dzj.1	+	8	1019	c.940G>T	c.(940-942)GGA>TGA	p.G314*	SLC35A1_uc003plx.2_RNA|SLC35A1_uc010kbw.2_Nonsense_Mutation_p.G162*|SLC35A1_uc003plz.2_RNA|SLC35A1_uc011dzi.1_Nonsense_Mutation_p.G180*|SLC35A1_uc003ply.2_RNA|SLC35A1_uc010kbx.2_Nonsense_Mutation_p.G255*|SLC35A1_uc010kby.2_RNA	NM_006416	NP_006407	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid	314	Helical; (Potential).				carbohydrate metabolic process|protein modification process	Golgi membrane|integral to plasma membrane	CMP-N-acetylneuraminate transmembrane transporter activity|sugar:hydrogen symporter activity				0		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		ATATCTCTATGGATTACCCAG	0.383													5	58	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100403965	100403965	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100403965C>T	uc003pqh.1	-	2	374	c.59G>A	c.(58-60)TGG>TAG	p.W20*	MCHR2_uc003pqi.1_Nonsense_Mutation_p.W20*	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	20	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CTCTTTATTCCAGGATTTGTT	0.423													20	41	---	---	---	---	PASS
POPDC3	64208	broad.mit.edu	37	6	105609460	105609460	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105609460G>T	uc003prb.2	-	2	727	c.325C>A	c.(325-327)CAA>AAA	p.Q109K	uc003pqz.2_Intron|POPDC3_uc003pra.2_Intron	NM_022361	NP_071756	Q9HBV1	POPD3_HUMAN	popeye protein 3	109						integral to membrane				skin(3)|ovary(2)	5		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TACAACACTTGGAATTCTCGG	0.423													9	249	---	---	---	---	PASS
FOXO3	2309	broad.mit.edu	37	6	108985287	108985287	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108985287C>A	uc003psk.2	+	3	1567	c.1251C>A	c.(1249-1251)ACC>ACA	p.T417T	FOXO3_uc003psn.2_Intron|FOXO3_uc003psm.2_Silent_p.T417T|FOXO3_uc011ean.1_Silent_p.T197T|FOXO3_uc010kdj.1_Silent_p.T197T	NM_201559	NP_963853	O43524	FOXO3_HUMAN	forkhead box O3A	417					antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			central_nervous_system(4)|lung(2)	6		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		TCCCGTATACCACCAAGGGCT	0.597													6	84	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112462136	112462136	+	Intron	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112462136A>G	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TATTGAGATAAATAATTTTCA	0.323													9	15	---	---	---	---	PASS
NCOA7	135112	broad.mit.edu	37	6	126206390	126206390	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126206390G>T	uc010kes.2	+	10	1234	c.785G>T	c.(784-786)GGG>GTG	p.G262V	NCOA7_uc003qae.3_Missense_Mutation_p.G262V|NCOA7_uc003qah.2_Missense_Mutation_p.G262V|NCOA7_uc003qai.2_Missense_Mutation_p.G262V|NCOA7_uc010ket.2_Missense_Mutation_p.G158V|NCOA7_uc003qag.2_Missense_Mutation_p.G262V	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1	262					cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		ATTGAAAATGGGTGTGAGGAG	0.453													6	87	---	---	---	---	PASS
MOXD1	26002	broad.mit.edu	37	6	132643820	132643820	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132643820G>T	uc003qdf.2	-	8	1402	c.1303C>A	c.(1303-1305)CCA>ACA	p.P435T	MOXD1_uc003qde.2_Missense_Mutation_p.P367T	NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	435	Lumenal (Potential).				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		ATGCATACTGGTAAGATTGTT	0.333													8	16	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143081135	143081135	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143081135C>G	uc003qjd.2	-	9	7033	c.6290G>C	c.(6289-6291)AGA>ACA	p.R2097T		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	2097	10 X 4 AA tandem repeats of S-P-[RGMKC]- [RK].|Arg-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CATCTCTCTTCTCAATGCAGC	0.458													10	16	---	---	---	---	PASS
SASH1	23328	broad.mit.edu	37	6	148869683	148869683	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148869683G>C	uc003qme.1	+	20	4208	c.3733G>C	c.(3733-3735)GAG>CAG	p.E1245Q	SASH1_uc003qmf.1_Missense_Mutation_p.E655Q	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1245							protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GCCAGGCCCTGAGGCCATGTA	0.552													15	43	---	---	---	---	PASS
AKAP12	9590	broad.mit.edu	37	6	151671465	151671465	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151671465G>T	uc011eep.1	+	4	2179	c.1939G>T	c.(1939-1941)GAG>TAG	p.E647*	AKAP12_uc003qoe.2_Nonsense_Mutation_p.E647*|AKAP12_uc003qof.2_Nonsense_Mutation_p.E549*|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Nonsense_Mutation_p.E542*	NM_005100	NP_005091	Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12 isoform 1	647					G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GTCTTCCACCGAGAGCACAGC	0.502													5	89	---	---	---	---	PASS
CNKSR3	154043	broad.mit.edu	37	6	154744078	154744078	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154744078C>T	uc003qpy.2	-	8	1274	c.769G>A	c.(769-771)GAA>AAA	p.E257K		NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	257	PDZ.				negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		TGAATGACTTCGTCACCAGCA	0.328													7	31	---	---	---	---	PASS
TFB1M	51106	broad.mit.edu	37	6	155579120	155579120	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155579120G>C	uc003qqj.3	-	7	955	c.891C>G	c.(889-891)ATC>ATG	p.I297M	TFB1M_uc003qqk.2_Intron|uc003qqi.1_5'Flank	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	297					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		TAAAGTGTGAGATGGAGAGCT	0.463													27	63	---	---	---	---	PASS
TMEM181	57583	broad.mit.edu	37	6	158957791	158957791	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158957791G>C	uc003qrm.3	+	1	324	c.313G>C	c.(313-315)GAG>CAG	p.E105Q	TMEM181_uc010kjr.1_5'UTR	NM_020823	NP_065874	Q9P2C4	TM181_HUMAN	G protein-coupled receptor 178	105					pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		CCCTGCCTTTGAGCCCCCGCT	0.697													3	3	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	160953575	160953575	+	Silent	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160953575A>G	uc003qtl.2	-	39	6069	c.5949T>C	c.(5947-5949)ACT>ACC	p.T1983T		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	4491	Peptidase S1.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GGCAACTGTCAGTGCCTCTGG	0.463													11	27	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161514085	161514085	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161514085C>A	uc003qtn.2	+	14	3487	c.3345C>A	c.(3343-3345)TTC>TTA	p.F1115L	MAP3K4_uc010kkc.1_Missense_Mutation_p.F1115L|MAP3K4_uc003qto.2_Missense_Mutation_p.F1115L|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.F568L|MAP3K4_uc003qtp.2_Missense_Mutation_p.F105L	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1115					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AAGATGACTTCTTGGTATGGA	0.323													4	20	---	---	---	---	PASS
AGPAT4	56895	broad.mit.edu	37	6	161653130	161653130	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161653130C>A	uc003qtr.1	-	2	343	c.116G>T	c.(115-117)TGG>TTG	p.W39L	AGPAT4_uc003qts.1_5'UTR|AGPAT4_uc011egb.1_Missense_Mutation_p.W39L|AGPAT4_uc003qtt.1_RNA|AGPAT4_uc011egc.1_Missense_Mutation_p.W39L|AGPAT4_uc011egd.1_Intron|AGPAT4_uc011ege.1_Missense_Mutation_p.W39L	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	39					phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		GTTAATGGGCCAGAGGAGGAG	0.463													5	52	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168352586	168352586	+	Silent	SNP	C	T	T	rs141139097		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168352586C>T	uc003qwd.2	+	29	4670	c.4528C>T	c.(4528-4530)CTG>TTG	p.L1510L	MLLT4_uc003qwb.1_Silent_p.L1495L|MLLT4_uc003qwc.1_Silent_p.L1511L|MLLT4_uc003qwg.1_Silent_p.L820L	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1511					adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GGGGGACAGTCTGTCCCCCGA	0.602			T	MLL	AL								14	26	---	---	---	---	PASS
SNX8	29886	broad.mit.edu	37	7	2297430	2297430	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2297430C>A	uc003slw.2	-	8	967	c.924G>T	c.(922-924)CAG>CAT	p.Q308H		NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	308					cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CGTTCTCTTCCTGCTTACCCT	0.612													9	346	---	---	---	---	PASS
MMD2	221938	broad.mit.edu	37	7	4959907	4959907	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4959907T>C	uc003sno.3	-	3	381	c.185A>G	c.(184-186)GAT>GGT	p.D62G	MMD2_uc003snl.1_RNA|MMD2_uc003snn.3_Missense_Mutation_p.D62G|MMD2_uc010ksq.2_Missense_Mutation_p.D62G	NM_001100600	NP_001094070	Q8IY49	PAQRA_HUMAN	monocyte to macrophage	62	Extracellular (Potential).					integral to membrane	receptor activity			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		CTCCCAGTCATCGTCCGACAG	0.617													15	5	---	---	---	---	PASS
ZDHHC4	55146	broad.mit.edu	37	7	6628525	6628525	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6628525G>T	uc003sqi.2	+	9	1377	c.1019G>T	c.(1018-1020)AGG>ATG	p.R340M	ZDHHC4_uc003sql.2_Missense_Mutation_p.R340M|ZDHHC4_uc003sqh.2_Missense_Mutation_p.R340M|ZDHHC4_uc003sqj.2_Missense_Mutation_p.R340M|ZDHHC4_uc003sqk.2_Missense_Mutation_p.R340M|ZDHHC4_uc003sqm.2_Missense_Mutation_p.R340M|uc011jwy.1_5'Flank|C7orf26_uc003sqo.1_5'Flank|C7orf26_uc003sqp.1_5'Flank|C7orf26_uc003sqq.1_5'Flank	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	340						integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		TGTCATGAGAGGAAGAAACAA	0.473													10	250	---	---	---	---	PASS
AHR	196	broad.mit.edu	37	7	17378616	17378616	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17378616G>T	uc011jxz.1	+	10	1780	c.1167G>T	c.(1165-1167)GAG>GAT	p.E389D	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	389					apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					TTAGAGATGAGGAAGGAACAG	0.303													6	113	---	---	---	---	PASS
HOXA11	3207	broad.mit.edu	37	7	27224653	27224653	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27224653G>T	uc003syx.2	-	1	183	c.111C>A	c.(109-111)ACC>ACA	p.T37T	HOXA11_uc003syy.2_Intron|HOXA11AS_uc003syz.1_5'Flank	NM_005523	NP_005514	P31270	HXA11_HUMAN	homeobox A11	37					branching involved in ureteric bud morphogenesis|cartilage development involved in endochondral bone morphogenesis|developmental growth|dorsal/ventral pattern formation|mesodermal cell fate specification|positive regulation of cell development|positive regulation of chondrocyte differentiation	protein-DNA complex|transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)	2						GCGAAGACGGGGTCTGGGGCA	0.562			T	NUP98	CML						OREG0003747	type=REGULATORY REGION|Gene=BC025338|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	49	44	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32588535	32588535	+	Intron	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32588535G>A	uc003tcv.1	+						AVL9_uc011kai.1_Intron|AVL9_uc010kwj.1_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						AAGCTGGTAAGAGACGAAGTA	0.343													25	12	---	---	---	---	PASS
MYO1G	64005	broad.mit.edu	37	7	45016187	45016187	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45016187G>T	uc003tmh.2	-	3	518	c.374C>A	c.(373-375)CCA>CAA	p.P125Q	MYO1G_uc003tmg.2_5'Flank|MYO1G_uc010kym.2_Missense_Mutation_p.P10Q|MYO1G_uc003tmi.1_Missense_Mutation_p.P37Q|MYO1G_uc003tmj.2_5'UTR	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG	125	Myosin head-like.					myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						CCTCTGGCTTGGATTGGTGAC	0.597													5	61	---	---	---	---	PASS
SEC61G	23480	broad.mit.edu	37	7	54823496	54823496	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54823496T>C	uc003tqf.2	-	3	264	c.173A>G	c.(172-174)CAT>CGT	p.H58R	SEC61G_uc003tqg.2_Missense_Mutation_p.H58R	NM_001012456	NP_001012474	P60059	SC61G_HUMAN	Sec61 gamma subunit	58	Helical; (Potential).				protein targeting to ER	endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			lung(1)	1	Esophageal squamous(2;7.55e-08)|Breast(14;0.0654)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)			AATAGGAATATGGATCAATTT	0.323													12	113	---	---	---	---	PASS
LANCL2	55915	broad.mit.edu	37	7	55493093	55493093	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55493093G>T	uc003tqp.2	+	7	1733	c.1155G>T	c.(1153-1155)CAG>CAT	p.Q385H		NM_018697	NP_061167	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2	385					negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			GTCTCACGCAGGATAAGAAGT	0.537													10	327	---	---	---	---	PASS
SEPT14	346288	broad.mit.edu	37	7	55863741	55863741	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55863741C>G	uc003tqz.2	-	10	1281	c.1164G>C	c.(1162-1164)GAG>GAC	p.E388D		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	388	Potential.				cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCTTCCTTATCTCCTCCTGTT	0.438													62	24	---	---	---	---	PASS
DBF4	10926	broad.mit.edu	37	7	87526637	87526637	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87526637G>T	uc003ujf.1	+	8	1167	c.663G>T	c.(661-663)AAG>AAT	p.K221N	DBF4_uc003ujh.1_Translation_Start_Site|DBF4_uc003ujg.1_Translation_Start_Site|DBF4_uc011khf.1_Intron	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN	activator of S phase kinase	221					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding			lung(2)	2	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				CTTTTGTAAAGGTGGAAGATA	0.313													9	245	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91726596	91726596	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91726596G>T	uc003ulg.2	+	41	10548	c.10323G>T	c.(10321-10323)CAG>CAT	p.Q3441H	AKAP9_uc003ulf.2_Missense_Mutation_p.Q3433H|AKAP9_uc003uli.2_Missense_Mutation_p.Q3064H|AKAP9_uc003ulj.2_Missense_Mutation_p.Q1211H|AKAP9_uc003ull.2_Missense_Mutation_p.Q337H	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3445	Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GAATCATGCAGGAATTCCAGA	0.393			T	BRAF	papillary thyroid								7	104	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	92098934	92098934	+	IGR	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92098934C>A								GATAD1 (10192 upstream) : PEX1 (17404 downstream)																							gaggagttacccacctgatgc	0.000													8	159	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98508832	98508832	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98508832G>T	uc003upp.2	+	17	2154	c.1945G>T	c.(1945-1947)GAA>TAA	p.E649*	TRRAP_uc011kis.1_Nonsense_Mutation_p.E649*|TRRAP_uc003upr.2_Nonsense_Mutation_p.E341*	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	649					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AACGTTCAAAGAAATCTTCCA	0.403													10	106	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98588092	98588092	+	Missense_Mutation	SNP	G	C	C	rs77396759		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98588092G>C	uc003upp.2	+	63	9827	c.9618G>C	c.(9616-9618)TTG>TTC	p.L3206F	TRRAP_uc011kis.1_Missense_Mutation_p.L3177F|TRRAP_uc003upr.2_Missense_Mutation_p.L2894F	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	3206	FAT.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGTGGCTTTTGAGTTTTGATG	0.473													14	222	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98601931	98601931	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98601931G>T	uc003upp.2	+	67	10595	c.10386G>T	c.(10384-10386)GAG>GAT	p.E3462D	TRRAP_uc011kis.1_Missense_Mutation_p.E3433D|TRRAP_uc003upr.2_Missense_Mutation_p.E3168D	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	3462					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCCTCATAGAGGAAAAGTGCC	0.428													15	588	---	---	---	---	PASS
EPHB4	2050	broad.mit.edu	37	7	100404041	100404041	+	Splice_Site	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100404041C>T	uc003uwn.1	-	14	2975	c.2484_splice	c.e14+1	p.D828_splice	EPHB4_uc003uwm.1_Splice_Site_p.D735_splice|EPHB4_uc010lhj.1_Splice_Site_p.D828_splice	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor						cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGGACACTTACGTCCTGATTG	0.542													23	25	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100679392	100679392	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100679392C>A	uc003uxp.1	+	3	4748	c.4695C>A	c.(4693-4695)ACC>ACA	p.T1565T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1565	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|24.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GCATGCAAACCTCAACTTATA	0.488													8	189	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100683654	100683654	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100683654G>A	uc003uxp.1	+	3	9010	c.8957G>A	c.(8956-8958)AGA>AAA	p.R2986K	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2986	Extracellular (Potential).|Ser-rich.|48.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GGCGAAAGAAGAACTCCATTA	0.517													101	107	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123104992	123104992	+	Silent	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123104992T>C	uc003vkn.2	-	10	2230	c.1653A>G	c.(1651-1653)GGA>GGG	p.G551G	IQUB_uc003vko.2_Silent_p.G551G|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Silent_p.G551G	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	551										ovary(3)|large_intestine(1)	4						GATGTTTGACTCCTCTCATCA	0.323													4	13	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131853105	131853105	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131853105T>C	uc003vra.3	-	22	4473	c.4244A>G	c.(4243-4245)AAG>AGG	p.K1415R		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1415	Cytoplasmic (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						CTCCAGGTTCTTGTCAATGAG	0.607													6	15	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131872233	131872233	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131872233T>C	uc003vra.3	-	15	3219	c.2990A>G	c.(2989-2991)CAC>CGC	p.H997R		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	997	IPT/TIG 2.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						GAGTTACCTGTGGAAGAGACA	0.532													75	106	---	---	---	---	PASS
SLC13A4	26266	broad.mit.edu	37	7	135387595	135387595	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135387595C>A	uc003vta.2	-	6	1317	c.628G>T	c.(628-630)GAG>TAG	p.E210*	SLC13A4_uc003vtb.2_Nonsense_Mutation_p.E211*	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate	210						integral to plasma membrane	sodium:sulfate symporter activity				0						GGCCATACCTCGTTGTGCATC	0.522													5	95	---	---	---	---	PASS
DENND2A	27147	broad.mit.edu	37	7	140301337	140301337	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140301337G>T	uc010lnj.2	-	1	1006	c.861C>A	c.(859-861)ATC>ATA	p.I287I	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Silent_p.I287I|DENND2A_uc003vvw.2_Silent_p.I287I|DENND2A_uc003vvx.2_Silent_p.I287I	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	287										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					TCCTGAAGCCGATGCCAGGCT	0.378													4	50	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148512011	148512011	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148512011G>C	uc003wfd.1	-	14	1818	c.1652C>G	c.(1651-1653)TCA>TGA	p.S551*	EZH2_uc011kug.1_Intron|EZH2_uc003wfb.1_Nonsense_Mutation_p.S556*|EZH2_uc003wfc.1_Nonsense_Mutation_p.S512*|EZH2_uc011kuh.1_Nonsense_Mutation_p.S542*	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	551	Cys-rich.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CTTACACTCTGAACTACATTG	0.373			Mis		DLBCL								8	11	---	---	---	---	PASS
ZNF425	155054	broad.mit.edu	37	7	148801651	148801651	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148801651C>T	uc003wfj.2	-	4	1385	c.1312G>A	c.(1312-1314)GGG>AGG	p.G438R		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	438					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGCCGCTTCCCAATGTGCTGC	0.607													28	26	---	---	---	---	PASS
SMARCD3	6604	broad.mit.edu	37	7	150939642	150939642	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150939642C>A	uc003wjs.2	-	5	605	c.504G>T	c.(502-504)GCG>GCT	p.A168A	SMARCD3_uc003wjt.2_Silent_p.A155A|SMARCD3_uc003wju.2_Silent_p.A155A|SMARCD3_uc011kvh.1_Silent_p.A168A|SMARCD3_uc010lqa.1_Silent_p.A168A	NM_001003801	NP_001003801	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin	168					cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CATCAGGCTTCGCAGGGTTAA	0.577													5	94	---	---	---	---	PASS
SGCZ	137868	broad.mit.edu	37	8	14412436	14412436	+	Splice_Site	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14412436C>T	uc003wwq.2	-	2	700	c.40_splice	c.e2-1	p.M14_splice	SGCZ_uc010lss.2_Splice_Site_p.M1_splice	NM_139167	NP_631906	Q96LD1	SGCZ_HUMAN	sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		CTCGTGTCATCTGaaaaagaa	0.289													6	12	---	---	---	---	PASS
XPO7	23039	broad.mit.edu	37	8	21848343	21848343	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21848343G>T	uc003xaa.3	+	18	2056	c.1954G>T	c.(1954-1956)GGT>TGT	p.G652C	XPO7_uc010lti.2_Missense_Mutation_p.G661C|XPO7_uc010ltk.2_Missense_Mutation_p.G653C	NM_015024	NP_055839	Q9UIA9	XPO7_HUMAN	exportin 7 isoform b	652					mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TTCATTTTTGGGTATTAACAA	0.408													6	99	---	---	---	---	PASS
CHMP7	91782	broad.mit.edu	37	8	23114092	23114092	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23114092C>A	uc003xdc.2	+	5	1425	c.777C>A	c.(775-777)TCC>TCA	p.S259S	CHMP7_uc011kzs.1_RNA|CHMP7_uc003xdd.2_Silent_p.S149S|CHMP7_uc003xde.2_Silent_p.S117S	NM_152272	NP_689485	Q8WUX9	CHMP7_HUMAN	CHMP family, member 7	259	Potential.				cellular membrane organization|late endosome to vacuole transport	cytosol|ESCRT III complex	protein transporter activity				0		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		AGTCCTTATCCCAGGAAGCAG	0.512													8	144	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32617716	32617716	+	Splice_Site	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32617716A>T	uc003xiv.2	+	11	1579	c.1062_splice	c.e11-2	p.S354_splice	NRG1_uc011lbf.1_Splice_Site_p.S351_splice|NRG1_uc010lvo.2_Splice_Site_p.S351_splice|NRG1_uc003xiu.2_Splice_Site_p.S359_splice|NRG1_uc003xiw.2_Splice_Site_p.S351_splice|NRG1_uc003xit.2_Splice_Site_p.S354_splice|NRG1_uc010lvr.2_Splice_Site_p.S96_splice|NRG1_uc010lvs.2_Splice_Site_p.S96_splice|NRG1_uc010lvp.2_Splice_Site_p.S308_splice|NRG1_uc010lvq.2_Splice_Site_p.S291_splice|NRG1_uc011lbg.1_Splice_Site_p.S200_splice|NRG1_uc011lbh.1_Splice_Site_p.S197_splice|NRG1_uc003xja.2_Splice_Site_p.S165_splice	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TTTCCTCCGCAGCTGGAGCAA	0.433													14	24	---	---	---	---	PASS
FUT10	84750	broad.mit.edu	37	8	33246586	33246586	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33246586C>A	uc003xje.2	-	4	1463	c.1107G>T	c.(1105-1107)AGG>AGT	p.R369S	FUT10_uc003xjc.2_Missense_Mutation_p.R376S|FUT10_uc003xjd.2_Missense_Mutation_p.R341S|FUT10_uc011lbi.1_Missense_Mutation_p.R419S|FUT10_uc003xjf.2_Missense_Mutation_p.R307S|FUT10_uc003xjg.2_Missense_Mutation_p.R341S|FUT10_uc003xjh.2_Missense_Mutation_p.R369S	NM_032664	NP_116053	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10	369	Lumenal (Potential).				embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		ATTTCCGTTCCCTGAGAGCTG	0.483													7	67	---	---	---	---	PASS
BAG4	9530	broad.mit.edu	37	8	38067632	38067632	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38067632C>A	uc003xky.1	+	5	1277	c.995C>A	c.(994-996)TCA>TAA	p.S332*	BAG4_uc003xkz.1_Nonsense_Mutation_p.S296*	NM_004874	NP_004865	O95429	BAG4_HUMAN	BCL2-associated athanogene 4	332					anti-apoptosis|apoptosis|protein folding	cytoplasm|nucleus	receptor signaling protein activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				AATGATGATTCAGATCTTTTG	0.458													28	43	---	---	---	---	PASS
AGPAT6	137964	broad.mit.edu	37	8	41467233	41467233	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41467233G>T	uc003xnz.2	+	4	1234	c.295G>T	c.(295-297)GGT>TGT	p.G99C		NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta	99					acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			TCGTCGAAGTGGTAGTAGTAA	0.468													11	219	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41615563	41615563	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41615563G>T	uc003xok.2	-	2	204	c.120C>A	c.(118-120)ACC>ACA	p.T40T	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Silent_p.T40T|ANK1_uc003xoj.2_Silent_p.T40T|ANK1_uc003xol.2_Silent_p.T40T|ANK1_uc003xom.2_Silent_p.T73T	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	40	89 kDa domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCTGGTTACAGGTGTTAATAT	0.498													11	533	---	---	---	---	PASS
KIAA0146	23514	broad.mit.edu	37	8	48614343	48614343	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48614343G>T	uc003xqd.2	+	13	1843	c.1834G>T	c.(1834-1836)GGA>TGA	p.G612*	KIAA0146_uc011ldb.1_Nonsense_Mutation_p.G612*|KIAA0146_uc010lxs.2_Nonsense_Mutation_p.G87*|KIAA0146_uc011ldc.1_Nonsense_Mutation_p.G542*|KIAA0146_uc011ldd.1_Nonsense_Mutation_p.G552*|KIAA0146_uc003xqe.2_Nonsense_Mutation_p.G87*|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc011lde.1_Nonsense_Mutation_p.G301*|KIAA0146_uc010lxt.2_Nonsense_Mutation_p.G301*|KIAA0146_uc011ldf.1_Nonsense_Mutation_p.G117*|KIAA0146_uc011ldg.1_Nonsense_Mutation_p.G102*|KIAA0146_uc010lxv.1_Nonsense_Mutation_p.G106*	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	612											0		Lung NSC(58;0.175)				TCCAAATCTGGGACAAATTGA	0.403													8	187	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55533754	55533754	+	Silent	SNP	C	A	A	rs142600056	byFrequency	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55533754C>A	uc003xsd.1	+	2	376	c.228C>A	c.(226-228)CTC>CTA	p.L76L	RP1_uc011ldy.1_Silent_p.L76L	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	76	Doublecortin 1.				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGGTGCCCCTCCCTTTTGGAG	0.612													31	94	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73848373	73848373	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73848373C>G	uc003xzb.2	+	3	1371	c.783C>G	c.(781-783)TTC>TTG	p.F261L		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	261	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			AATGGAAGTTCTTCAAAGGCC	0.453													6	96	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86050478	86050478	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86050478G>T	uc003ycw.2	+	16	2856	c.2702G>T	c.(2701-2703)AGT>ATT	p.S901I	LRRCC1_uc010maa.1_3'UTR|LRRCC1_uc003ycx.2_Missense_Mutation_p.S808I|LRRCC1_uc003ycy.2_Missense_Mutation_p.S881I	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	901					cell division|mitosis	centriole|nucleus					0						AAAGCTTACAGGTATTATATA	0.289													6	27	---	---	---	---	PASS
RPL30	6156	broad.mit.edu	37	8	99057209	99057209	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99057209C>A	uc003yif.2	-	3	199	c.129G>T	c.(127-129)GCG>GCT	p.A43A	RPL30_uc010mbk.1_Silent_p.A43A|SNORA72_uc003yig.1_5'Flank	NM_000989	NP_000980	P62888	RL30_HUMAN	ribosomal protein L30	43					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			TGACCAATTTCGCTTTGCCTT	0.488													7	303	---	---	---	---	PASS
DCAF13	25879	broad.mit.edu	37	8	104427350	104427350	+	Silent	SNP	G	C	C	rs140179211	byFrequency	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104427350G>C	uc003yln.2	+	1	409	c.132G>C	c.(130-132)ACG>ACC	p.T44T	SLC25A32_uc003yll.2_5'UTR|SLC25A32_uc011lhr.1_5'UTR|DCAF13_uc003ylm.1_5'UTR|DCAF13_uc003ylo.2_5'UTR	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	Error:Variant_position_missing_in_Q9NV06_after_alignment					rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						GGGCAAGAACGGGGCACAGAC	0.657													23	34	---	---	---	---	PASS
KCNV1	27012	broad.mit.edu	37	8	110984530	110984530	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110984530C>G	uc003ynr.3	-	2	1290	c.948G>C	c.(946-948)CTG>CTC	p.L316L	KCNV1_uc010mcw.2_Silent_p.L316L	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	316	Helical; Voltage-sensor; Name=Segment S4; (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			GAGCCCTGAGCAGCCTCAACA	0.507													8	40	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113249469	113249469	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113249469C>A	uc003ynu.2	-	67	10736	c.10577G>T	c.(10576-10578)GGG>GTG	p.G3526V	CSMD3_uc003yns.2_Missense_Mutation_p.G2728V|CSMD3_uc003ynt.2_Missense_Mutation_p.G3486V|CSMD3_uc011lhx.1_Missense_Mutation_p.G3357V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3526	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GTTAACTCTCCCAGTGGAAGC	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			9	34	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113301647	113301647	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113301647G>C	uc003ynu.2	-	57	9254	c.9095C>G	c.(9094-9096)TCA>TGA	p.S3032*	CSMD3_uc003yns.2_Nonsense_Mutation_p.S2234*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.S2992*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.S2863*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3032	Sushi 21.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GCAGGTTCTTGATGACTGGCC	0.443										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			12	15	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113332130	113332130	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113332130C>A	uc003ynu.2	-	46	7405	c.7246G>T	c.(7246-7248)GGT>TGT	p.G2416C	CSMD3_uc003yns.2_Missense_Mutation_p.G1618C|CSMD3_uc003ynt.2_Missense_Mutation_p.G2376C|CSMD3_uc011lhx.1_Missense_Mutation_p.G2312C|CSMD3_uc003ynw.1_Missense_Mutation_p.G127C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2416	Extracellular (Potential).|Sushi 13.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ACAGCTTTACCTATTTCAAAT	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			8	30	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116631517	116631517	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116631517C>T	uc003ynz.2	-	2	1228	c.769G>A	c.(769-771)GAT>AAT	p.D257N	TRPS1_uc011lhy.1_Missense_Mutation_p.D261N|TRPS1_uc003yny.2_Missense_Mutation_p.D270N|TRPS1_uc010mcy.2_Missense_Mutation_p.D257N	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	257					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AGCTCAGCATCTTGCCTGGTG	0.468									Langer-Giedion_syndrome				13	33	---	---	---	---	PASS
GSDMC	56169	broad.mit.edu	37	8	130760735	130760735	+	3'UTR	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130760735A>T	uc003ysr.2	-	14						NM_031415	NP_113603	Q9BYG8	GSDMC_HUMAN	melanoma-derived leucine zipper, extra-nuclear							mitochondrion				ovary(2)|skin(1)	3						CTGACTGCCCATCAGGGAGGG	0.587													19	120	---	---	---	---	PASS
SLC45A4	57210	broad.mit.edu	37	8	142228416	142228416	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142228416C>G	uc003ywd.1	-	4	1478	c.1170G>C	c.(1168-1170)CGG>CGC	p.R390R	SLC45A4_uc003ywc.1_Silent_p.R390R|SLC45A4_uc010meq.1_Silent_p.R388R	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	441					transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CGTTGGCGCGCCGGTAGCGGT	0.687													18	18	---	---	---	---	PASS
FLJ43860	389690	broad.mit.edu	37	8	142500272	142500272	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142500272C>A	uc003ywi.2	-	5	723	c.642G>T	c.(640-642)ACG>ACT	p.T214T	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	214							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GGAAGACGCCCGTCAGGAGCT	0.637													5	21	---	---	---	---	PASS
KCNV2	169522	broad.mit.edu	37	9	2729434	2729434	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2729434C>A	uc003zho.1	+							NM_133497	NP_598004	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(50;0.0257)		TCCTGCTTTCCTTCCTCTACA	0.537													5	19	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8436665	8436665	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8436665G>T	uc003zkk.2	-	34	4724	c.4013C>A	c.(4012-4014)CCC>CAC	p.P1338H	PTPRD_uc003zkp.2_Missense_Mutation_p.P932H|PTPRD_uc003zkq.2_Missense_Mutation_p.P931H|PTPRD_uc003zkr.2_Missense_Mutation_p.P922H|PTPRD_uc003zks.2_Missense_Mutation_p.P931H|PTPRD_uc003zkl.2_Missense_Mutation_p.P1329H|PTPRD_uc003zkm.2_Missense_Mutation_p.P1325H|PTPRD_uc003zkn.2_Missense_Mutation_p.P927H|PTPRD_uc003zko.2_Missense_Mutation_p.P928H	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1338	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTCCAAGATGGGTATTGGAGG	0.338										TSP Lung(15;0.13)			4	12	---	---	---	---	PASS
TYRP1	7306	broad.mit.edu	37	9	12695714	12695714	+	Silent	SNP	A	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12695714A>C	uc003zkv.3	+	3	763	c.585A>C	c.(583-585)TCA>TCC	p.S195S		NM_000550	NP_000541	P17643	TYRP1_HUMAN	tyrosinase-related protein 1 precursor	195	Lumenal, melanosome (Potential).				melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity			lung(1)	1		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		ACTATTACTCAGTCAAAAAGA	0.453									Oculocutaneous_Albinism				10	12	---	---	---	---	PASS
ELAVL2	1993	broad.mit.edu	37	9	23701421	23701421	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23701421G>A	uc003zpu.2	-	5	944	c.669C>T	c.(667-669)AAC>AAT	p.N223N	ELAVL2_uc003zps.2_Silent_p.N223N|ELAVL2_uc003zpt.2_Silent_p.N223N|ELAVL2_uc003zpv.2_Silent_p.N223N|ELAVL2_uc003zpw.2_Silent_p.N223N	NM_004432	NP_004423	Q12926	ELAV2_HUMAN	ELAV (embryonic lethal, abnormal vision,	223					regulation of transcription, DNA-dependent		mRNA 3'-UTR binding|nucleotide binding|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		GATACCTTCTGTTTGGAGACT	0.488													39	50	---	---	---	---	PASS
HINT2	84681	broad.mit.edu	37	9	35813519	35813519	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35813519G>A	uc003zyh.2	-	3	316	c.250C>T	c.(250-252)CAG>TAG	p.Q84*	SPAG8_uc003zye.2_5'Flank|SPAG8_uc003zyf.2_5'Flank|SPAG8_uc003zyg.2_5'Flank|HINT2_uc003zyi.2_Nonsense_Mutation_p.Q80*	NM_032593	NP_115982	Q9BX68	HINT2_HUMAN	PKCI-1-related HIT protein precursor	84	HIT.				apoptosis|steroid biosynthetic process	mitochondrion	hydrolase activity				0	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			ACAGGAGCCTGAGGGGCCACA	0.542											OREG0019179	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	22	---	---	---	---	PASS
ECM2	1842	broad.mit.edu	37	9	95256390	95256390	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95256390G>A	uc004asf.3	-	10	2057	c.1907C>T	c.(1906-1908)TCA>TTA	p.S636L	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron	NM_001393	NP_001384	O94769	ECM2_HUMAN	extracellular matrix protein 2 precursor	Error:Variant_position_missing_in_O94769_after_alignment					cell-matrix adhesion		integrin binding			ovary(1)|skin(1)	2						GGCCACATCTGATCTGTTTGT	0.423													26	60	---	---	---	---	PASS
ZNF484	83744	broad.mit.edu	37	9	95609565	95609565	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95609565C>A	uc004asu.1	-	5	1653	c.1504G>T	c.(1504-1506)GGT>TGT	p.G502C	ANKRD19_uc004asr.3_Intron|ZNF484_uc011lub.1_Missense_Mutation_p.G504C|ZNF484_uc010mrb.1_Missense_Mutation_p.G466C|ZNF484_uc004asv.1_Missense_Mutation_p.G466C	NM_031486	NP_113674	Q5JVG2	ZN484_HUMAN	zinc finger protein 484 isoform a	502	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAGGCCTTACCACACACAGTA	0.378													4	29	---	---	---	---	PASS
KIAA1529	57653	broad.mit.edu	37	9	100124649	100124649	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100124649C>G	uc011lut.1	+	40	5150	c.4377C>G	c.(4375-4377)TTC>TTG	p.F1459L	KIAA1529_uc004axe.1_Missense_Mutation_p.F1254L|KIAA1529_uc004axg.1_Missense_Mutation_p.F1320L|KIAA1529_uc004axh.1_RNA|KIAA1529_uc011luw.1_Missense_Mutation_p.F439L	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				CCAAAGGCTTCAAGCGACATC	0.617													63	47	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104357046	104357046	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104357046G>A	uc004bbr.2	-	1	238	c.167C>T	c.(166-168)CCG>CTG	p.P56L	GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_Intron	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta	53	EF-hand 2.						calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	CCGCACCAACGGGTTGTGGCG	0.562													38	28	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117853072	117853072	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117853072C>A	uc004bjj.3	-	2	588	c.226G>T	c.(226-228)GAC>TAC	p.D76Y	TNC_uc010mvf.2_Missense_Mutation_p.D76Y	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	76					cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GGTGCCAGGTCTTTCTCCCCA	0.547													80	56	---	---	---	---	PASS
BAT2L1	84726	broad.mit.edu	37	9	134305587	134305587	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134305587C>T	uc004can.3	+	1	111	c.56C>T	c.(55-57)TCG>TTG	p.S19L	BAT2L1_uc004cam.1_Missense_Mutation_p.S19L	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	19							protein binding				0						AGCAAGTACTCGACTCTCAGC	0.458													22	20	---	---	---	---	PASS
POMT1	10585	broad.mit.edu	37	9	134393924	134393924	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134393924G>T	uc004cav.2	+	14	1633	c.1431G>T	c.(1429-1431)AAG>AAT	p.K477N	POMT1_uc004cax.2_Missense_Mutation_p.K455N|POMT1_uc011mcj.1_Missense_Mutation_p.K233N|POMT1_uc004cau.2_Missense_Mutation_p.K455N|POMT1_uc004caw.2_Missense_Mutation_p.K401N|POMT1_uc011mck.1_Missense_Mutation_p.K338N|POMT1_uc011mcl.1_Missense_Mutation_p.K303N|POMT1_uc011mcm.1_Missense_Mutation_p.K425N|POMT1_uc011mcn.1_Missense_Mutation_p.K180N	NM_007171	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1 isoform a	477	MIR 3.				multicellular organismal development|protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			upper_aerodigestive_tract(1)	1		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		CTGTCTTAAAGGTAAGGACAC	0.552													9	194	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135204730	135204730	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135204730G>A	uc004cbk.2	-	10	2438	c.2255C>T	c.(2254-2256)ACT>ATT	p.T752I	SETX_uc004cbj.2_Missense_Mutation_p.T371I|SETX_uc010mzt.2_Missense_Mutation_p.T371I	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	752					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CAAAGCATCAGTGCTAGAATC	0.373													36	21	---	---	---	---	PASS
KCNT1	57582	broad.mit.edu	37	9	138642026	138642026	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138642026G>T	uc011mdq.1	+						KCNT1_uc011mdr.1_Intron|KCNT1_uc010nbf.2_Intron	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1							membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AAGATCGAGTGAGTGGGGTGC	0.602													20	16	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	372998	372998	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:372998C>T	uc001ifp.2	-	31	3962	c.3872G>A	c.(3871-3873)CGG>CAG	p.R1291Q		NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	1291						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GCTGACGGCCCGCGGGTGAAG	0.607													10	17	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7608015	7608015	+	Silent	SNP	G	T	T	rs149503594		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608015G>T	uc001ijq.2	-	13	2584	c.2505C>A	c.(2503-2505)TCC>TCA	p.S835S	ITIH5_uc001ijp.2_Silent_p.S621S	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	835					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						GGCAGTTGCTGGAAAGGCCCT	0.557													23	30	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7679442	7679442	+	Splice_Site	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7679442C>G	uc001ijq.2	-	5	481	c.402_splice	c.e5-1	p.G134_splice	ITIH5_uc001ijr.1_Splice_Site_p.G134_splice	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CCCCTTCTCTCTGTCAGGAAA	0.547													19	22	---	---	---	---	PASS
TAF3	83860	broad.mit.edu	37	10	8007024	8007024	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8007024C>A	uc010qbd.1	+	3	1551	c.1551C>A	c.(1549-1551)TCC>TCA	p.S517S		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	517	Lys-rich.				maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						AGCTGCCTTCCTCCGTGGAGG	0.338													5	35	---	---	---	---	PASS
SPAG6	9576	broad.mit.edu	37	10	22675703	22675703	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22675703G>C	uc001iri.2	+	5	635	c.493G>C	c.(493-495)GAT>CAT	p.D165H	SPAG6_uc001irj.2_Missense_Mutation_p.D165H|SPAG6_uc010qct.1_Missense_Mutation_p.D135H|SPAG6_uc009xkh.2_Missense_Mutation_p.D143H	NM_012443	NP_036575	O75602	SPAG6_HUMAN	sperm associated antigen 6 isoform 1	165	ARM 4.				cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1						AGCTGTGGTGGATGCAGGAGC	0.458													6	6	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33552639	33552639	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33552639G>C	uc001iwx.3	-	4	1116	c.593C>G	c.(592-594)TCA>TGA	p.S198*	NRP1_uc001iwv.3_Nonsense_Mutation_p.S198*|NRP1_uc009xlz.2_Nonsense_Mutation_p.S198*|NRP1_uc001iww.3_Nonsense_Mutation_p.S17*|NRP1_uc001iwy.3_Nonsense_Mutation_p.S198*|NRP1_uc001iwz.2_Nonsense_Mutation_p.S198*|NRP1_uc001ixa.2_Nonsense_Mutation_p.S198*|NRP1_uc001ixb.1_Nonsense_Mutation_p.S198*|NRP1_uc001ixc.1_Nonsense_Mutation_p.S198*	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	198	Extracellular (Potential).|CUB 2.				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	TGGAGGATTTGAGTCAGGCTC	0.463													5	32	---	---	---	---	PASS
AGAP7	653268	broad.mit.edu	37	10	51465352	51465352	+	Silent	SNP	C	A	A	rs4043643		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51465352C>A	uc001jio.2	-	7	1230	c.1104G>T	c.(1102-1104)CCG>CCT	p.P368P	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	NM_001077685	NP_001071153	Q5VUJ5	AGAP7_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	368	PH.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						GAGAGGGGGGCGGGTTGAGCT	0.512													83	117	---	---	---	---	PASS
TMEM26	219623	broad.mit.edu	37	10	63212763	63212763	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63212763C>A	uc001jlo.2	-	1	446	c.77G>T	c.(76-78)CGA>CTA	p.R26L	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlq.2_RNA|uc001jlr.2_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	26						integral to membrane					0	Prostate(12;0.0112)					CTCGGTCACTCGCCAGACCCC	0.632													5	71	---	---	---	---	PASS
CH25H	9023	broad.mit.edu	37	10	90966727	90966727	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90966727G>A	uc001kfz.2	-	1	345	c.323C>T	c.(322-324)GCC>GTC	p.A108V		NM_003956	NP_003947	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	108					bile acid biosynthetic process|fatty acid biosynthetic process|sterol biosynthetic process	cytosol|endoplasmic reticulum membrane|integral to membrane	cholesterol 25-hydroxylase activity|iron ion binding				0		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		CGGGCTGCGGGCCCAATGCAG	0.627													15	6	---	---	---	---	PASS
CPEB3	22849	broad.mit.edu	37	10	93841226	93841226	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93841226C>A	uc001khw.1	-	9	1893	c.1720G>T	c.(1720-1722)GGT>TGT	p.G574C	CPEB3_uc001khu.1_Missense_Mutation_p.G583C|CPEB3_uc001khv.1_Missense_Mutation_p.G560C|CPEB3_uc010qnn.1_Missense_Mutation_p.G560C	NM_014912	NP_055727	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding	574	RRM 2.						nucleotide binding|RNA binding				0		Colorectal(252;0.0869)				CAGACACCACCATACAAACGG	0.473													4	45	---	---	---	---	PASS
MARCH5	54708	broad.mit.edu	37	10	94100568	94100568	+	Intron	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94100568A>G	uc001khx.1	+						MARCH5_uc010qno.1_Intron	NM_017824	NP_060294	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5						cell aging|protein autoubiquitination|protein localization in mitochondrion|protein polyubiquitination|regulation of mitochondrial fission	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	GTPase binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						CAGGTTCACTATTTTACCTAT	0.343													8	40	---	---	---	---	PASS
TMEM20	159371	broad.mit.edu	37	10	95661025	95661025	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95661025G>T	uc001kjg.1	+	3	937	c.876G>T	c.(874-876)GGG>GGT	p.G292G	TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Silent_p.G291G|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Silent_p.G275G|TMEM20_uc001kjj.2_Intron	NM_001134658	NP_001128130	Q2M3R5	TMM20_HUMAN	transmembrane protein 20 isoform 1	292	DUF6 2.|Helical; (Potential).					integral to membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)		STAD - Stomach adenocarcinoma(243;0.00345)		TATTCATTGGGCTCTTTGGTT	0.428													12	12	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97170424	97170424	+	Silent	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97170424G>C	uc001kkp.2	-	8	966	c.921C>G	c.(919-921)GTC>GTG	p.V307V	SORBS1_uc001kkl.2_5'UTR|SORBS1_uc001kkn.2_Silent_p.V140V|SORBS1_uc001kkm.2_Silent_p.V163V|SORBS1_uc001kko.2_Silent_p.V307V|SORBS1_uc001kkq.2_Silent_p.V238V|SORBS1_uc001kkr.2_Silent_p.V143V|SORBS1_uc001kks.2_Silent_p.V143V|SORBS1_uc001kkt.2_RNA|SORBS1_uc001kku.2_Silent_p.V184V|SORBS1_uc001kkv.2_Silent_p.V275V|SORBS1_uc001kkw.2_Silent_p.V307V|SORBS1_uc010qoe.1_Silent_p.V152V|SORBS1_uc010qof.1_Silent_p.V505V	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	307					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TAGTAGGATTGACAATCGTTG	0.463													12	26	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97174525	97174525	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97174525G>C	uc001kkp.2	-	7	581	c.536C>G	c.(535-537)CCT>CGT	p.P179R	SORBS1_uc001kkl.2_5'UTR|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Missense_Mutation_p.P179R|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_RNA|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Missense_Mutation_p.P147R|SORBS1_uc001kkw.2_Missense_Mutation_p.P179R|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Missense_Mutation_p.P377R|SORBS1_uc001kkx.1_Missense_Mutation_p.P147R	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	179					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGGTGTTGGAGGTCTGGCAGT	0.582													40	17	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105166544	105166544	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105166544G>A	uc001kwy.1	+	7	954	c.867G>A	c.(865-867)CAG>CAA	p.Q289Q		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	289	S1 motif 3.				mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CTCAGGTACAGAAGGTAAGCT	0.323													6	44	---	---	---	---	PASS
ITPRIP	85450	broad.mit.edu	37	10	106074526	106074526	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106074526G>A	uc001kye.2	-	2	1357	c.1284C>T	c.(1282-1284)CTC>CTT	p.L428L	ITPRIP_uc001kyf.2_Silent_p.L428L|ITPRIP_uc001kyg.2_Silent_p.L428L	NM_033397	NP_203755	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-triphosphate receptor interacting	428						plasma membrane					0						GGTAGCTGCTGAGCCCGCTGG	0.667													9	24	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115381824	115381824	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115381824A>T	uc001laj.2	-	24	2737	c.2573T>A	c.(2572-2574)CTG>CAG	p.L858Q	NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Missense_Mutation_p.L823Q|NRAP_uc001lal.3_Missense_Mutation_p.L858Q	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	858	Nebulin 21.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CTTGTACTCCAGCTCACTCTG	0.517													24	19	---	---	---	---	PASS
DHX32	55760	broad.mit.edu	37	10	127555576	127555576	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127555576G>T	uc001ljf.1	-	2	950	c.459C>A	c.(457-459)ACC>ACA	p.T153T	DHX32_uc001ljg.1_Silent_p.T153T	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32	153	Helicase ATP-binding.					mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTGTTTCGTTGGTACAGCAGT	0.502													6	108	---	---	---	---	PASS
LRRC27	80313	broad.mit.edu	37	10	134175013	134175013	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134175013C>A	uc010quw.1	+	9	1418	c.1223C>A	c.(1222-1224)CCA>CAA	p.P408Q	LRRC27_uc001llg.2_RNA|LRRC27_uc001lli.2_Missense_Mutation_p.P408Q|LRRC27_uc001llj.2_Missense_Mutation_p.P346Q|LRRC27_uc001llk.3_Missense_Mutation_p.P281Q	NM_030626	NP_085129	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27 isoform a	408										ovary(1)	1		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		AGGAAAGTACCACTGAATCCG	0.433													9	227	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1213400	1213400	+	Intron	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1213400G>C	uc009ycr.1	+						uc001lsz.2_RNA	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTCCAGTGCCGAGCCGAGAGC	0.617													17	70	---	---	---	---	PASS
OR51G1	79324	broad.mit.edu	37	11	4945326	4945326	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4945326T>C	uc010qyr.1	-	1	244	c.244A>G	c.(244-246)ACT>GCT	p.T82A		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCCAGCACAGTGGGCAGTGTG	0.493													11	13	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6648290	6648290	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6648290C>A	uc001mem.1	-	14	6390	c.5980G>T	c.(5980-5982)GGT>TGT	p.G1994C		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1994	Cadherin 19.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCATTGGCACCAGCATCACGA	0.622													5	37	---	---	---	---	PASS
OVCH2	341277	broad.mit.edu	37	11	7721834	7721834	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7721834C>A	uc010rbf.1	-							NM_198185	NP_937828			ovochymase 2 precursor												0				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		TGTGTGATGGCTTAGTTACCA	0.483													6	9	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7982058	7982058	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7982058C>G	uc001mfv.1	-	2	1118	c.1101G>C	c.(1099-1101)CAG>CAC	p.Q367H		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	367	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCTCTCCATCTGCCCCTGCA	0.522													19	46	---	---	---	---	PASS
NRIP3	56675	broad.mit.edu	37	11	9007404	9007404	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9007404C>A	uc001mhg.2	-						NRIP3_uc010rbu.1_Intron	NM_020645	NP_065696	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3						proteolysis		aspartic-type endopeptidase activity				0				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		GAGTCTGTACCAAAGAGGAAG	0.478													6	104	---	---	---	---	PASS
MICAL2	9645	broad.mit.edu	37	11	12280014	12280014	+	Splice_Site	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12280014G>T	uc001mjz.2	+	25	3431	c.3143_splice	c.e25-1	p.G1048_splice	MICAL2_uc010rch.1_Splice_Site_p.G858_splice|MICAL2_uc001mka.2_Splice_Site_p.G1048_splice|MICAL2_uc010rci.1_Splice_Site_p.G1027_splice|MICAL2_uc001mkb.2_Splice_Site_p.G822_splice|MICAL2_uc001mkc.2_Splice_Site_p.G801_splice|MICAL2_uc001mkd.2_Splice_Site_p.G630_splice|MICAL2_uc010rcj.1_Splice_Site_p.G260_splice|MICAL2_uc001mkf.2_Splice_Site	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		TCTTTTTACAGGCAAATTTTA	0.408													6	107	---	---	---	---	PASS
C11orf58	10944	broad.mit.edu	37	11	16766187	16766187	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16766187G>A	uc001mmk.2	+	2	281	c.103G>A	c.(103-105)GAA>AAA	p.E35K	C11orf58_uc010rct.1_5'UTR	NM_014267	NP_055082	O00193	SMAP_HUMAN	small acidic protein isoform a	35											0						CTTGGGTAATGAAGAGAGAAA	0.333													10	16	---	---	---	---	PASS
LDHAL6A	160287	broad.mit.edu	37	11	18485500	18485500	+	Intron	SNP	T	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18485500T>G	uc001mop.1	+						LDHAL6A_uc001moq.2_Intron	NM_001144071	NP_001137543	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A						glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	ACTAACAATGTTTTTCAGGGT	0.373													23	46	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	31099473	31099473	+	Splice_Site	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31099473C>T	uc009yjk.1	-	6	651	c.582_splice	c.e6-1	p.R194_splice	uc009yjl.1_Splice_Site_p.R122_splice|DCDC1_uc001msu.1_Splice_Site_p.R365_splice					RecName: Full=Doublecortin domain-containing protein 5;																		TCCACTATGTCTGTAACGAAA	0.368													6	6	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55032762	55032762	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55032762C>A	uc010rid.1	+	2	517	c.431C>A	c.(430-432)CCC>CAC	p.P144H		NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48	128	B box-type.					intracellular	zinc ion binding				0						AGACACTGTCCCGCTGAGTGG	0.493													11	24	---	---	---	---	PASS
OR5D13	390142	broad.mit.edu	37	11	55541450	55541450	+	Silent	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541450T>C	uc010ril.1	+	1	537	c.537T>C	c.(535-537)TTT>TTC	p.F179F		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	179	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				TAAATAATTTTATCTGTGACC	0.418													21	27	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56184925	56184925	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56184925G>C	uc010rji.1	-	1	784	c.784C>G	c.(784-786)CCC>GCC	p.P262A		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	262	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					TTTGATTTGGGCTGTAGGTAC	0.448													23	19	---	---	---	---	PASS
OR5M1	390168	broad.mit.edu	37	11	56380709	56380709	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56380709C>A	uc001nja.1	-	1	270	c.270G>T	c.(268-270)AAG>AAT	p.K90N		NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						AGGAGATGGTCTTCTGTTCTG	0.448													20	55	---	---	---	---	PASS
OR5AR1	219493	broad.mit.edu	37	11	56431846	56431846	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56431846C>T	uc010rjm.1	+	1	685	c.685C>T	c.(685-687)CGT>TGT	p.R229C		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	229	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CATCAGAATGCGTTCAGCTGA	0.478													21	24	---	---	---	---	PASS
ZDHHC5	25921	broad.mit.edu	37	11	57466026	57466026	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57466026C>A	uc001nkx.1	+						ZDHHC5_uc001nky.1_Intron|ZDHHC5_uc001nkz.1_Intron	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC domain containing 5							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1						TACTTTCTTCCTCAGTTGAGT	0.483													8	167	---	---	---	---	PASS
MS4A2	2206	broad.mit.edu	37	11	59857872	59857872	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59857872G>C	uc001nop.2	+	3	352	c.250G>C	c.(250-252)GAT>CAT	p.D84H	MS4A2_uc009ymu.2_Missense_Mutation_p.D84H	NM_000139	NP_000130	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member	84	Extracellular (Potential).				cell proliferation|humoral immune response	integral to plasma membrane	calcium channel activity			ovary(1)	1		all_epithelial(135;0.245)			Omalizumab(DB00043)	CTCTGTACTTGATATTTCACA	0.323													30	38	---	---	---	---	PASS
MS4A13	503497	broad.mit.edu	37	11	60310041	60310041	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60310041C>T	uc001nps.2	+	7	775	c.452C>T	c.(451-453)ACT>ATT	p.T151I	MS4A13_uc009ync.2_Missense_Mutation_p.T111I|MS4A13_uc009ynd.2_Missense_Mutation_p.T92I	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN	membrane-spanning 4-domains, subfamily A, member	151						integral to membrane					0						GCTGAGAGCACTCCTTAAAAA	0.358													3	11	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61895781	61895781	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61895781C>A	uc001nsw.1	+						INCENP_uc009ynv.2_Intron|INCENP_uc009ynw.1_Intron|INCENP_uc001nsx.1_Intron	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa						chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						CAGGTGAAGACGGGCACAGTG	0.567													14	42	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64124516	64124516	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64124516G>T	uc001nzy.2	+	27	4425	c.4381G>T	c.(4381-4383)GAG>TAG	p.E1461*	CCDC88B_uc001oaa.2_Silent_p.L565L|CCDC88B_uc001oab.1_3'UTR|CCDC88B_uc001oac.2_Silent_p.L76L|RPS6KA4_uc001oad.2_5'Flank|RPS6KA4_uc001oae.2_5'Flank|RPS6KA4_uc010rnl.1_5'Flank|RPS6KA4_uc001oaf.2_5'Flank|RPS6KA4_uc009ypp.2_5'Flank	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88	1461					microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						TCTAGGCCCTGAGGTACAGGA	0.637													6	122	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64664289	64664289	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64664289C>T	uc001obx.2	-	38	5318	c.5203G>A	c.(5203-5205)GAC>AAC	p.D1735N	ATG2A_uc001obw.2_Missense_Mutation_p.D500N	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1735							protein binding			ovary(1)|central_nervous_system(1)	2						TTGCGGATGTCCTGCAGCCAC	0.637											OREG0004026	type=REGULATORY REGION|Gene=BC027481|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	10	22	---	---	---	---	PASS
C11orf80	79703	broad.mit.edu	37	11	66555707	66555707	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66555707G>A	uc001ojf.2	+	5	607	c.600G>A	c.(598-600)ATG>ATA	p.M200I	C11orf80_uc001ojg.2_5'UTR|C11orf80_uc001ojh.2_Intron|C11orf80_uc001oji.2_5'UTR|C11orf80_uc010rpk.1_Missense_Mutation_p.M34I	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703	45											0						CTCAGGATATGACAGGGGTAA	0.388													10	55	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70171654	70171654	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70171654G>T	uc001opo.2	+	5	778	c.580G>T	c.(580-582)GAG>TAG	p.E194*	PPFIA1_uc001opn.1_Nonsense_Mutation_p.E194*|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_5'Flank	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	194	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TTTGTTAGAAGAGGAATTAGG	0.373													6	113	---	---	---	---	PASS
ATG16L2	89849	broad.mit.edu	37	11	72539821	72539821	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72539821G>T	uc001otd.2	+	16	1710	c.1670G>T	c.(1669-1671)AGC>ATC	p.S557I	ATG16L2_uc001ote.2_Missense_Mutation_p.S451I|ATG16L2_uc009ytj.1_3'UTR|ATG16L2_uc001otf.2_Missense_Mutation_p.S312I|ATG16L2_uc001otg.2_Missense_Mutation_p.S291I|ATG16L2_uc009ytk.2_Missense_Mutation_p.S312I	NM_033388	NP_203746	Q8NAA4	A16L2_HUMAN	ATG16 autophagy related 16-like 2	557	WD 6.				autophagy|protein transport	cytoplasm	protein binding				0			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			GCTGTGTTCAGGTATGTCCGT	0.587													9	196	---	---	---	---	PASS
SLCO2B1	11309	broad.mit.edu	37	11	74880411	74880411	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74880411C>A	uc001owb.2	+	5	1029	c.642C>A	c.(640-642)ATC>ATA	p.I214I	SLCO2B1_uc010rrq.1_Intron|SLCO2B1_uc010rrr.1_Silent_p.I70I|SLCO2B1_uc010rrs.1_Silent_p.I98I|SLCO2B1_uc001owc.2_Intron|SLCO2B1_uc001owd.2_Silent_p.I192I	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	214	Helical; Name=4; (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	TCTCCTACATCGATGACTTTG	0.602													4	59	---	---	---	---	PASS
AQP11	282679	broad.mit.edu	37	11	77301476	77301476	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77301476C>T	uc001oyj.2	+	1	797	c.439C>T	c.(439-441)CAC>TAC	p.H147Y	AQP11_uc009yuu.2_Intron	NM_173039	NP_766627	Q8NBQ7	AQP11_HUMAN	aquaporin 11	147						cell surface|integral to membrane	transporter activity				0	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			GACCCAGTATCACGTCAGCGA	0.592													19	51	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88780767	88780767	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780767C>A	uc001pcq.2	-	1	474	c.274G>T	c.(274-276)GGC>TGC	p.G92C	GRM5_uc009yvm.2_Missense_Mutation_p.G92C|GRM5_uc009yvn.1_Missense_Mutation_p.G92C	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	92	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	p.G92R(1)		central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	ATCTCACAGCCCAGTGTGATG	0.522													7	16	---	---	---	---	PASS
TRPC6	7225	broad.mit.edu	37	11	101362388	101362388	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101362388C>A	uc001pgk.3	-	3	1452	c.1027G>T	c.(1027-1029)GAG>TAG	p.E343*	TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Nonsense_Mutation_p.E343*	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	343	Cytoplasmic (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AGAATGGCCTCGACTTCTTCA	0.408													6	167	---	---	---	---	PASS
BIRC3	330	broad.mit.edu	37	11	102201750	102201750	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102201750G>A	uc001pgx.2	+	7	1324	c.1102G>A	c.(1102-1104)GAA>AAA	p.E368K		NM_182962	NP_892007	Q13489	BIRC3_HUMAN	baculoviral IAP repeat-containing protein 3	368					anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|skin(1)	4	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TGAACCTGGAGAAGACCATTC	0.333			T	MALT1	MALT								7	45	---	---	---	---	PASS
BIRC3	330	broad.mit.edu	37	11	102201903	102201903	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102201903G>C	uc001pgx.2	+	7	1477	c.1255G>C	c.(1255-1257)GAC>CAC	p.D419H		NM_182962	NP_892007	Q13489	BIRC3_HUMAN	baculoviral IAP repeat-containing protein 3	419					anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|skin(1)	4	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TCTTGTGTTAGACTTACTCAA	0.363			T	MALT1	MALT								11	51	---	---	---	---	PASS
TMPRSS5	80975	broad.mit.edu	37	11	113568023	113568023	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113568023C>A	uc001poc.3	-	5	568	c.446G>T	c.(445-447)TGG>TTG	p.W149L	TMPRSS5_uc009yys.2_Missense_Mutation_p.W140L|TMPRSS5_uc009yyt.2_Missense_Mutation_p.W105L|TMPRSS5_uc001pod.3_5'UTR|TMPRSS5_uc010rww.1_Missense_Mutation_p.W139L|TMPRSS5_uc009yyu.2_5'UTR|TMPRSS5_uc010rwx.1_Missense_Mutation_p.W105L	NM_030770	NP_110397	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	149	SRCR.|Extracellular (Potential).				proteolysis	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)	1		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		CCCAAGGCTCCAGCAGATCTG	0.617													6	76	---	---	---	---	PASS
TMPRSS5	80975	broad.mit.edu	37	11	113570845	113570845	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113570845C>T	uc001poc.3	-	2	171	c.49G>A	c.(49-51)GAG>AAG	p.E17K	TMPRSS5_uc009yys.2_5'UTR|TMPRSS5_uc009yyt.2_Intron|TMPRSS5_uc001pod.3_Intron|TMPRSS5_uc010rww.1_Missense_Mutation_p.E7K|TMPRSS5_uc009yyu.2_Intron|TMPRSS5_uc010rwx.1_Intron	NM_030770	NP_110397	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	17	Cytoplasmic (Potential).				proteolysis	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)	1		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		GGGCCCTCCTCTGCATACTGG	0.602													7	11	---	---	---	---	PASS
SIDT2	51092	broad.mit.edu	37	11	117063911	117063911	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117063911C>A	uc001pqh.1	+	23	2189	c.2148C>A	c.(2146-2148)TCC>TCA	p.S716S	SIDT2_uc010rxe.1_Silent_p.S716S|SIDT2_uc001pqg.2_Silent_p.S737S|SIDT2_uc001pqi.1_Silent_p.S713S|SIDT2_uc001pqj.1_Silent_p.S28S	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor	716	Helical; (Potential).					integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		ATTTCGCTTCCTACTTGTTGG	0.552													13	621	---	---	---	---	PASS
RNF214	257160	broad.mit.edu	37	11	117153509	117153509	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117153509C>G	uc001pqt.2	+	13	1938	c.1893C>G	c.(1891-1893)ATC>ATG	p.I631M	RNF214_uc001pqu.2_Missense_Mutation_p.I631M|RNF214_uc010rxf.1_Missense_Mutation_p.I476M	NM_207343	NP_997226	Q8ND24	RN214_HUMAN	ring finger protein 214	631							zinc ion binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		TGGCCCAAATCAGTACCCCAA	0.478													11	63	---	---	---	---	PASS
VPS11	55823	broad.mit.edu	37	11	118949976	118949976	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118949976C>A	uc010ryx.1	+	15	2446	c.2404C>A	c.(2404-2406)CGT>AGT	p.R802S	VPS11_uc010ryy.1_Missense_Mutation_p.R648S	NM_021729	NP_068375	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11	802	Potential.				protein transport	endocytic vesicle|HOPS complex|late endosome membrane|lysosomal membrane	nucleotide binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		GGAGACCACCCGTATCCGCCA	0.567													4	18	---	---	---	---	PASS
VSIG2	23584	broad.mit.edu	37	11	124617436	124617436	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124617436C>A	uc001qas.2	-	7	1055	c.979G>T	c.(979-981)GTG>TTG	p.V327L		NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	327	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		AGAAGTCACACGACCATAGGG	0.527													27	40	---	---	---	---	PASS
ADAMTS8	11095	broad.mit.edu	37	11	130286835	130286835	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130286835C>G	uc001qgg.3	-	3	1454	c.1096G>C	c.(1096-1098)GGG>CGG	p.G366R		NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	366	Peptidase M12B.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CAAATCTTACCTAGTTCATGG	0.562													49	47	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	1005676	1005676	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1005676A>G	uc001qio.3	+	24	6530	c.6023A>G	c.(6022-6024)AAT>AGT	p.N2008S	WNK1_uc001qip.3_Missense_Mutation_p.N1760S|WNK1_uc001qir.3_Missense_Mutation_p.N1181S	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2008					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TCACATCTAAATGGGCCGTCT	0.502													28	61	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	8975787	8975787	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8975787G>T	uc001quz.3	+	2	170	c.72G>T	c.(70-72)CTG>CTT	p.L24L		NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	Error:Variant_position_missing_in_B3KVV6_after_alignment						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						GAAACTACCTGGTGACATTAC	0.368													5	58	---	---	---	---	PASS
TAS2R42	353164	broad.mit.edu	37	12	11339450	11339450	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11339450A>T	uc001qzr.1	-	1	94	c.94T>A	c.(94-96)TGC>AGC	p.C32S	PRB4_uc001qzf.1_Intron	NM_181429	NP_852094	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	32	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			CCTTCAGAGCAGTTTACCAGT	0.448													14	32	---	---	---	---	PASS
PRB4	5545	broad.mit.edu	37	12	11461631	11461631	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11461631G>C	uc001qzf.1	-	3	320	c.286C>G	c.(286-288)CCA>GCA	p.P96A	PRB4_uc001qzt.2_Missense_Mutation_p.P96A	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	117	4.|9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region				ovary(1)	1						GGCTTTCCTGGATGAGGTGGG	0.597										HNSCC(22;0.051)			16	308	---	---	---	---	PASS
CMAS	55907	broad.mit.edu	37	12	22208428	22208428	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22208428G>A	uc001rfm.2	+	3	522	c.443G>A	c.(442-444)TGT>TAT	p.C148Y	CMAS_uc001rfn.2_RNA	NM_018686	NP_061156	Q8NFW8	NEUA_HUMAN	cytidine monophospho-N-acetylneuraminic acid	148					lipopolysaccharide biosynthetic process	nucleus	N-acylneuraminate cytidylyltransferase activity			ovary(1)|pancreas(1)|skin(1)	3						ACTTCTCCATGTTTACATCCT	0.343													8	18	---	---	---	---	PASS
PRICKLE1	144165	broad.mit.edu	37	12	42853690	42853690	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42853690G>T	uc010skv.1	-	8	2704	c.2417C>A	c.(2416-2418)CCC>CAC	p.P806H	PRICKLE1_uc001rnl.2_Missense_Mutation_p.P806H|PRICKLE1_uc010skw.1_Missense_Mutation_p.P806H|PRICKLE1_uc001rnm.2_Missense_Mutation_p.P806H|PRICKLE1_uc001rnk.1_5'Flank	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1	806					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		CTGAGGGGTGGGAAGTGCAGA	0.433													25	61	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43833468	43833468	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43833468C>A	uc010skx.1	-	18	2550	c.2550G>T	c.(2548-2550)TGG>TGT	p.W850C	ADAMTS20_uc001rno.1_Missense_Mutation_p.W4C|ADAMTS20_uc001rnp.1_Missense_Mutation_p.W4C	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	850	TSP type-1 2.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CATAGGGGTCCCATGTGAACA	0.423													5	48	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49441761	49441761	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49441761C>A	uc001rta.3	-	14	4223	c.4223G>T	c.(4222-4224)TGT>TTT	p.C1408F		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1408	Cys-rich.|PHD-type 3.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCTGTTGACACAGTAAGGGTG	0.552			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			13	24	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49443899	49443899	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49443899C>A	uc001rta.3	-	11	3472	c.3472G>T	c.(3472-3474)GAG>TAG	p.E1158*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1158	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCCAGCTCCTCGGGGTCCAGG	0.602			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	60	---	---	---	---	PASS
SMARCD1	6602	broad.mit.edu	37	12	50481141	50481141	+	Intron	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50481141C>A	uc001rvx.3	+						SMARCD1_uc010smo.1_Intron|SMARCD1_uc001rvy.3_Intron|SMARCD1_uc009zlp.2_Intron	NM_003076	NP_003067	Q96GM5	SMRD1_HUMAN	SWI/SNF-related matrix-associated						chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity			ovary(1)	1						TTCTGCCTTCCTCAGCAAAAA	0.498													12	279	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52162746	52162746	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52162746C>A	uc001ryw.2	+	17	3177	c.2999C>A	c.(2998-3000)TCA>TAA	p.S1000*	SCN8A_uc010snl.1_Nonsense_Mutation_p.S865*	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	1000	II.				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	CTCCAGATCTCAGTGATCCGT	0.537													6	61	---	---	---	---	PASS
MIR148B	442892	broad.mit.edu	37	12	54731020	54731020	+	RNA	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54731020G>T	hsa-mir-148b|MI0000811	+			c.21G>T			COPZ1_uc001sfs.1_Intron|COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron|uc010sou.1_RNA																	0						TAGCATTTGAGGTGAAGTTCT	0.398													10	142	---	---	---	---	PASS
RDH5	5959	broad.mit.edu	37	12	56115129	56115129	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56115129G>C	uc001shk.2	+	2	344	c.161G>C	c.(160-162)CGA>CCA	p.R54P	BLOC1S1_uc001shj.3_Intron|RDH5_uc010spt.1_Missense_Mutation_p.R54P|RDH5_uc010spu.1_5'UTR|RDH5_uc001shl.2_Missense_Mutation_p.R54P	NM_002905	NP_002896	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis and 9-cis)	54	NADP (By similarity).				response to stimulus|visual perception	membrane	binding|retinol dehydrogenase activity			ovary(1)	1					NADH(DB00157)|Vitamin A(DB00162)	AGAGGCTTCCGAGTCCTGGCC	0.662											OREG0021907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	29	---	---	---	---	PASS
DGKA	1606	broad.mit.edu	37	12	56347166	56347166	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56347166G>T	uc001sij.2	+	23	2360	c.2096G>T	c.(2095-2097)GGA>GTA	p.G699V	DGKA_uc001sik.2_Missense_Mutation_p.G699V|DGKA_uc001sil.2_Missense_Mutation_p.G699V|DGKA_uc001sim.2_Missense_Mutation_p.G699V|DGKA_uc001sin.2_Missense_Mutation_p.G699V|DGKA_uc009zof.2_Missense_Mutation_p.G345V|DGKA_uc001sio.2_Missense_Mutation_p.G441V	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	699				G -> V (in Ref. 1; CAA44396).	activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	CAAATTGACGGAGAACCCTGG	0.468													10	338	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56645804	56645804	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56645804G>A	uc001skm.3	-	15	1677	c.1587C>T	c.(1585-1587)GCC>GCT	p.A529A		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	529	ANK 15.						protein binding			ovary(2)	2						CTCACAAGAAGGCCTCCTTCC	0.562													19	30	---	---	---	---	PASS
INHBC	3626	broad.mit.edu	37	12	57843575	57843575	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57843575A>T	uc001snv.1	+	2	956	c.829A>T	c.(829-831)ATA>TTA	p.I277L		NM_005538	NP_005529	P55103	INHBC_HUMAN	inhibin beta C chain preproprotein	277					growth	extracellular region	growth factor activity|hormone activity|transforming growth factor beta receptor binding				0						GAACTTCTGCATAGGGCAGTG	0.542													14	37	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62954451	62954451	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62954451T>C	uc001sre.2	+	26	3981	c.3590T>C	c.(3589-3591)GTT>GCT	p.V1197A	MON2_uc009zqj.2_Missense_Mutation_p.V1197A|MON2_uc010ssl.1_Missense_Mutation_p.V1125A|MON2_uc010ssm.1_Missense_Mutation_p.V1174A|MON2_uc010ssn.1_Missense_Mutation_p.V1197A|MON2_uc001srf.2_Missense_Mutation_p.V960A|MON2_uc001srg.2_Missense_Mutation_p.V72A	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	1198					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		CCTGTGCCTGTTCTTATAGGG	0.448													9	13	---	---	---	---	PASS
SRGAP1	57522	broad.mit.edu	37	12	64519798	64519798	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64519798G>T	uc010ssp.1	+	19	2322	c.2266G>T	c.(2266-2268)GGG>TGG	p.G756W	SRGAP1_uc001srv.2_Missense_Mutation_p.G693W	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	756	SH3.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TGACTATGTTGGGCGGTCTGC	0.507													4	19	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70933760	70933760	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70933760C>A	uc001swb.3	-	22	5013	c.4983G>T	c.(4981-4983)AGG>AGT	p.R1661S	PTPRB_uc010sto.1_Missense_Mutation_p.R1571S|PTPRB_uc010stp.1_Missense_Mutation_p.R1571S|PTPRB_uc001swc.3_Missense_Mutation_p.R1879S|PTPRB_uc001swa.3_Missense_Mutation_p.R1791S	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1661	Cytoplasmic (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATGGTCGATCCCTACGAATGC	0.408													8	17	---	---	---	---	PASS
SLC6A15	55117	broad.mit.edu	37	12	85255533	85255533	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85255533C>A	uc001szv.2	-	12	2564	c.2071G>T	c.(2071-2073)GGT>TGT	p.G691C	SLC6A15_uc010sul.1_Missense_Mutation_p.G584C|SLC6A15_uc001szw.1_3'UTR	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1	691	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						ATATTTTTACCAAAATTTGGA	0.443													8	16	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88449427	88449427	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88449427G>T	uc001tar.2	-	50	7230	c.6886C>A	c.(6886-6888)CTT>ATT	p.L2296I	CEP290_uc001taq.2_Missense_Mutation_p.L1356I|uc001tas.2_Intron	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	2296	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						AGCTGTTTAAGGTCAGTAATG	0.294													4	10	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88479931	88479931	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88479931G>C	uc001tar.2	-	34	4666	c.4322C>G	c.(4321-4323)TCA>TGA	p.S1441*	CEP290_uc001taq.2_Nonsense_Mutation_p.S501*	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	1441	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						GTCAGGGATTGATCCTGTAGC	0.348													13	22	---	---	---	---	PASS
BTG1	694	broad.mit.edu	37	12	92539232	92539232	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92539232C>G	uc001tby.3	-	1	442	c.80G>C	c.(79-81)CGC>CCC	p.R27P	BTG1_uc001tbv.1_5'Flank|BTG1_uc001tbw.1_5'Flank|BTG1_uc001tbx.1_5'Flank|BTG1_uc009zss.1_5'Flank|uc001tca.2_5'Flank	NM_001731	NP_001722	P62324	BTG1_HUMAN	B-cell translocation protein 1	27					cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CCCCTTGGTGCGGAGAAACTT	0.592			T	MYC	BCLL								9	39	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101490328	101490328	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101490328G>C	uc010svm.1	+	19	2325	c.1753G>C	c.(1753-1755)GAG>CAG	p.E585Q	ANO4_uc001thw.2_Missense_Mutation_p.E550Q|ANO4_uc001thx.2_Missense_Mutation_p.E585Q|ANO4_uc001thy.2_Missense_Mutation_p.E105Q	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	585	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GCCTCGCACAGAGTCTGAGTG	0.478										HNSCC(74;0.22)			19	17	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	103988170	103988170	+	Intron	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103988170A>G	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TTTACCCTCCAAGGTACACCT	0.453													8	11	---	---	---	---	PASS
ALDH1L2	160428	broad.mit.edu	37	12	105454748	105454748	+	Intron	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105454748C>T	uc001tlc.2	-						ALDH1L2_uc009zuo.2_Intron|ALDH1L2_uc009zup.2_Intron	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2						10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						TCAATAAGGGCGTGGTTTTAC	0.418													9	108	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120139707	120139707	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120139707G>A	uc001txi.1	-	41	5288	c.5235C>T	c.(5233-5235)CTC>CTT	p.L1745L	CIT_uc001txh.1_Silent_p.L1264L|CIT_uc001txj.1_Silent_p.L1787L	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1745	CNH.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TGGTTCCAATGAGGATACTGT	0.512													39	97	---	---	---	---	PASS
MLEC	9761	broad.mit.edu	37	12	121132899	121132899	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121132899G>T	uc001tyy.1	+	4	744	c.593G>T	c.(592-594)GGG>GTG	p.G198V		NM_014730	NP_055545	Q14165	MLEC_HUMAN	malectin precursor	198	Lumenal (Potential).				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding			ovary(1)	1						TTTTCCTAGGGGTACTATGAC	0.493													9	193	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124177199	124177199	+	Intron	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124177199C>G	uc001ufp.2	+						TCTN2_uc009zya.2_Intron	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1						cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		TATGTTATCTCTTTAGGCATA	0.383													15	31	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124333432	124333432	+	Intron	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124333432G>C	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CGTTCCAGGTGAGACACATGA	0.512													8	20	---	---	---	---	PASS
RAN	5901	broad.mit.edu	37	12	131359125	131359125	+	Silent	SNP	G	T	T	rs1802283		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131359125G>T	uc001uir.2	+	5	347	c.282G>T	c.(280-282)TCG>TCT	p.S94S	RAN_uc010tbk.1_Silent_p.S6S|RAN_uc010tbl.1_Silent_p.S6S|RAN_uc001uis.2_Silent_p.S114S	NM_006325	NP_006316	P62826	RAN_HUMAN	ras-related nuclear protein	94					androgen receptor signaling pathway|cell division|DNA metabolic process|mitosis|mitotic spindle organization|positive regulation of transcription, DNA-dependent|protein export from nucleus|RNA export from nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|melanosome|nuclear pore|nucleoplasm	androgen receptor binding|chromatin binding|GTP binding|GTPase activity|transcription coactivator activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		ATGTAACATCGAGAGTTACTT	0.408													4	40	---	---	---	---	PASS
ZNF10	7556	broad.mit.edu	37	12	133733275	133733275	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133733275G>A	uc009zzb.2	+	5	1890	c.1443G>A	c.(1441-1443)AGG>AGA	p.R481R	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Silent_p.R481R	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	481	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TGCATCAGAGGATACACACTG	0.428													9	27	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23912516	23912516	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23912516G>T	uc001uon.2	-	10	6088	c.5499C>A	c.(5497-5499)TCC>TCA	p.S1833S	SACS_uc001uoo.2_Silent_p.S1686S|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1833					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TCTCACTCAGGGAAAACTTCA	0.478													6	56	---	---	---	---	PASS
MTMR6	9107	broad.mit.edu	37	13	25835837	25835837	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25835837C>G	uc001uqf.3	-	6	1014	c.695G>C	c.(694-696)CGC>CCC	p.R232P	MTMR6_uc001uqe.1_Missense_Mutation_p.R232P	NM_004685	NP_004676	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	232	Myotubularin phosphatase.					cytoplasm|nuclear envelope	calcium-activated potassium channel activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			ovary(2)|skin(2)	4		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		GTACATATAGCGATTGACTGG	0.383													13	29	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28893635	28893635	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28893635T>A	uc001usb.3	-	24	3496	c.3211A>T	c.(3211-3213)ATC>TTC	p.I1071F	FLT1_uc010aap.2_Missense_Mutation_p.I76F|FLT1_uc010aaq.2_Missense_Mutation_p.I196F|FLT1_uc001usa.3_Missense_Mutation_p.I289F	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	1071	Cytoplasmic (Potential).|Protein kinase.				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	TTGTCAAAGATAGATTCAGGA	0.468													10	34	---	---	---	---	PASS
NHLRC3	387921	broad.mit.edu	37	13	39621263	39621263	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39621263C>T	uc001uxc.2	+	6	1087	c.765C>T	c.(763-765)TTC>TTT	p.F255F	NHLRC3_uc001uxd.2_Silent_p.F188F|NHLRC3_uc001uxe.2_Silent_p.F58F	NM_001012754	NP_001012772	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3 isoform a	255						extracellular region				skin(1)	1		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		ATAATTGTTTCACAGAAGAGG	0.393													23	44	---	---	---	---	PASS
LCP1	3936	broad.mit.edu	37	13	46730703	46730703	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46730703C>A	uc001vaz.3	-	5	487	c.361G>T	c.(361-363)GAA>TAA	p.E121*	LCP1_uc001vba.3_Nonsense_Mutation_p.E121*	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin	121	Actin-binding 1.|CH 1.				regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TACTTTTCTTCCTCTGCAAGT	0.373			T	BCL6	NHL 								28	92	---	---	---	---	PASS
SUCLA2	8803	broad.mit.edu	37	13	48563071	48563071	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48563071C>G	uc001vbs.2	-	3	374	c.317G>C	c.(316-318)AGA>ACA	p.R106T	SUCLA2_uc010tgb.1_Missense_Mutation_p.R46T|SUCLA2_uc010tgc.1_5'UTR|SUCLA2_uc010tgd.1_Missense_Mutation_p.R46T|SUCLA2_uc001vbt.1_RNA|SUCLA2_uc001vbu.1_Missense_Mutation_p.R106T	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	106	ATP-grasp.				succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TCCTTTTCCTCTACCACCAGC	0.373													40	81	---	---	---	---	PASS
CAB39L	81617	broad.mit.edu	37	13	49885033	49885033	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49885033C>G	uc001vcw.2	-	9	1429	c.931G>C	c.(931-933)GAA>CAA	p.E311Q	CAB39L_uc001vcx.2_Missense_Mutation_p.E311Q|CAB39L_uc010adf.2_Missense_Mutation_p.E308Q	NM_030925	NP_112187	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	311					cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		TCCGTCCTTTCTTTTTGGAAG	0.473													47	125	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70456634	70456634	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70456634G>T	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TTTCCTGCAGGGAGAAAATAT	0.343													6	7	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70456635	70456635	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70456635G>T	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TTCCTGCAGGGAGAAAATATC	0.338													6	7	---	---	---	---	PASS
SOX1	6656	broad.mit.edu	37	13	112722129	112722129	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112722129C>T	uc001vsb.1	+	1	217	c.157C>T	c.(157-159)CGG>TGG	p.R53W		NM_005986	NP_005977	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	53	HMG box.				chromatin organization	nucleus	core promoter sequence-specific DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		CCGGGTCAAACGGCCCATGAA	0.517													6	7	---	---	---	---	PASS
OR11H12	440153	broad.mit.edu	37	14	19377713	19377713	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19377713C>A	uc010tkp.1	+	1	120	c.120C>A	c.(118-120)ATC>ATA	p.I40I		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	40	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CAATTCAGATCTTCCTCTTCT	0.428													17	15	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21884067	21884067	+	Splice_Site	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21884067C>T	uc001was.1	-	6	974	c.880_splice	c.e6-1	p.K294_splice	CHD8_uc001war.1_Splice_Site_p.K190_splice	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AGCGTCTCTTCTGTAGAGCAA	0.368													21	76	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30105671	30105671	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30105671C>T	uc001wqh.2	-	7	1196	c.1015G>A	c.(1015-1017)GTG>ATG	p.V339M		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	339					cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TCCATGACCACATCAGACTCT	0.458													5	26	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45658053	45658053	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45658053G>A	uc001wwd.3	+	20	4927	c.4828G>A	c.(4828-4830)GAA>AAA	p.E1610K	FANCM_uc010anf.2_Missense_Mutation_p.E1584K|FANCM_uc001wwe.3_Missense_Mutation_p.E1146K|FANCM_uc010ang.2_Missense_Mutation_p.E824K	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1610					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						TTGTGTTGATGAAGAGGAGTC	0.294								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				7	23	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47389363	47389363	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47389363C>A	uc001wwj.3	-	10	2079	c.1883G>T	c.(1882-1884)GGA>GTA	p.G628V	MDGA2_uc001wwi.3_Missense_Mutation_p.G399V|MDGA2_uc010ani.2_Missense_Mutation_p.G188V	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	628					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						ATAGGCCTTTCCTGAAAACAG	0.358													8	43	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47426570	47426570	+	Intron	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47426570A>T	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						AATATCTGGAATCCTACCTGT	0.338													5	10	---	---	---	---	PASS
ACTR10	55860	broad.mit.edu	37	14	58678108	58678108	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58678108G>T	uc001xdf.2	+	5	544	c.441G>T	c.(439-441)CTG>CTT	p.L147L	C14orf37_uc010tro.1_Intron|ACTR10_uc001xdg.2_5'UTR|ACTR10_uc001xdh.2_5'UTR|ACTR10_uc010trp.1_5'Flank|ACTR10_uc010apc.2_5'Flank	NM_018477	NP_060947	Q9NZ32	ARP10_HUMAN	uncharacterized hypothalamus protein HARP11	147						cytoplasm				central_nervous_system(1)	1						GGGAAAGCCTGGTGTTACCCA	0.383													6	95	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64491954	64491954	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64491954C>A	uc001xgm.2	+	41	6297	c.6067C>A	c.(6067-6069)CAG>AAG	p.Q2023K	SYNE2_uc001xgl.2_Missense_Mutation_p.Q2023K	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2023	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGATAGATACCAGACATTACT	0.373													6	41	---	---	---	---	PASS
C14orf50	145376	broad.mit.edu	37	14	65056048	65056048	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65056048C>A	uc001xhl.1	+	12	1357	c.1261C>A	c.(1261-1263)CCT>ACT	p.P421T	C14orf50_uc001xhm.1_Missense_Mutation_p.P151T	NM_172365	NP_758953	Q96LQ0	CN050_HUMAN	hypothetical protein LOC145376	421										skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00382)|all cancers(60;0.00427)|BRCA - Breast invasive adenocarcinoma(234;0.0488)		TACATCATGCCCTAAGTAACC	0.333													16	41	---	---	---	---	PASS
C14orf45	80127	broad.mit.edu	37	14	74516689	74516689	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74516689G>T	uc010tup.1	+	8	1200	c.1077G>T	c.(1075-1077)GTG>GTT	p.V359V	C14orf45_uc001xpm.1_RNA	NM_025057	NP_079333	Q8ND07	CN045_HUMAN	hypothetical protein LOC80127	359	Potential.										0				BRCA - Breast invasive adenocarcinoma(234;0.00351)		GAACAGAAGTGGAAAGATTCT	0.403													6	53	---	---	---	---	PASS
ATXN3	4287	broad.mit.edu	37	14	92549498	92549498	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92549498C>A	uc001yac.3	-	7	649	c.580G>T	c.(580-582)GAA>TAA	p.E194*	ATXN3_uc010aug.2_Nonsense_Mutation_p.E179*|ATXN3_uc001yad.3_Nonsense_Mutation_p.E139*|ATXN3_uc010auh.2_Nonsense_Mutation_p.E128*|ATXN3_uc001yae.3_Nonsense_Mutation_p.E96*|ATXN3_uc010twl.1_RNA	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform	194					cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		GCTAATTCTTCTCCAATAAGT	0.373													22	64	---	---	---	---	PASS
WDR25	79446	broad.mit.edu	37	14	100847918	100847918	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100847918G>T	uc010avx.2	+	2	750	c.657G>T	c.(655-657)GAG>GAT	p.E219D	WDR25_uc001yhm.2_Missense_Mutation_p.E211D|WDR25_uc001yhn.2_Missense_Mutation_p.E219D|WDR25_uc010avy.2_RNA|WDR25_uc001yho.2_5'Flank	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25	219											0		Melanoma(154;0.212)				GAGTGTCTGAGTTTATTCAGC	0.562													11	11	---	---	---	---	PASS
MIR495	574453	broad.mit.edu	37	14	101500125	101500125	+	RNA	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101500125C>T	hsa-mir-495|MI0003135	+			c.34C>T																				0						ATGTTATTTTCGCTTTATATG	0.522													8	45	---	---	---	---	PASS
PPP2R5C	5527	broad.mit.edu	37	14	102276371	102276371	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102276371G>A	uc001yko.2	+	1	232	c.92G>A	c.(91-93)CGA>CAA	p.R31Q	PPP2R5C_uc001ykj.3_Intron|PPP2R5C_uc010txr.1_Intron|PPP2R5C_uc001ykk.2_Intron|PPP2R5C_uc010txt.1_Missense_Mutation_p.R21Q|PPP2R5C_uc001ykn.2_Missense_Mutation_p.R31Q|PPP2R5C_uc001ykp.2_Missense_Mutation_p.R31Q|PPP2R5C_uc010txs.1_Missense_Mutation_p.R21Q	NM_002719	NP_002710	Q13362	2A5G_HUMAN	gamma isoform of regulatory subunit B56, protein	31					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of cell proliferation|proteasomal ubiquitin-dependent protein catabolic process|signal transduction	chromosome, centromeric region|nucleus|protein phosphatase type 2A complex	protein binding|protein binding|protein phosphatase type 2A regulator activity|protein phosphatase type 2A regulator activity			ovary(1)|breast(1)	2						CTCCATATTCGAGGTAAGTTA	0.468													8	26	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102467534	102467534	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102467534G>T	uc001yks.2	+	20	4402	c.4238G>T	c.(4237-4239)TGG>TTG	p.W1413L		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1413	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GACCGCCATTGGAAACAGCTC	0.423													16	581	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102493548	102493548	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102493548G>T	uc001yks.2	+	45	8973	c.8809G>T	c.(8809-8811)GGT>TGT	p.G2937C		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2937	AAA 4 (By similarity).|ATP (Potential).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCTTCTGATTGGTGTTAGTGG	0.463													10	351	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102515002	102515002	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102515002G>T	uc001yks.2	+	74	13532	c.13368G>T	c.(13366-13368)GTG>GTT	p.V4456V		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	4456					cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ACGAGCTAGTGAAAGGTGCGT	0.607													14	39	---	---	---	---	PASS
ZNF839	55778	broad.mit.edu	37	14	102800977	102800977	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102800977G>A	uc001ylo.2	+	4	1505	c.1155G>A	c.(1153-1155)CTG>CTA	p.L385L	ZNF839_uc010awk.1_Silent_p.L501L|ZNF839_uc001ylp.2_RNA|ZNF839_uc001ylq.1_Silent_p.L385L|ZNF839_uc001ylr.2_Silent_p.L310L|ZNF839_uc001yls.2_5'UTR|ZNF839_uc001ylt.2_5'Flank	NM_018335	NP_060805	A8K0R7	ZN839_HUMAN	zinc finger protein 839	385						intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2						AGTTTCTTCTGATGAAGGTGA	0.398													13	27	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105410132	105410132	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105410132G>T	uc010axc.1	-	7	11776	c.11656C>A	c.(11656-11658)CTG>ATG	p.L3886M	AHNAK2_uc001ypx.2_Missense_Mutation_p.L3786M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3886						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACCTTGGGCAGGTGTCCTTTG	0.587													9	338	---	---	---	---	PASS
GPR132	29933	broad.mit.edu	37	14	105517538	105517538	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105517538C>T	uc001yqd.2	-	4	1835	c.936G>A	c.(934-936)ACG>ACA	p.T312T	GPR132_uc001yqc.2_Silent_p.T124T|GPR132_uc001yqe.2_Silent_p.T303T	NM_013345	NP_037477	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	312	Cytoplasmic (Potential).				response to stress	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		GGGAATGGTCCGTGGCCAGCA	0.582													12	26	---	---	---	---	PASS
MTA1	9112	broad.mit.edu	37	14	105927231	105927231	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105927231C>A	uc001yqx.2	+	10	1070	c.883C>A	c.(883-885)CTT>ATT	p.L295I	MTA1_uc001yqy.2_RNA|MTA1_uc001yqz.1_Missense_Mutation_p.L209I|MTA1_uc001yra.1_Missense_Mutation_p.L209I|MTA1_uc001yrb.2_Missense_Mutation_p.L56I	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein	295	SANT.				signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		AGAGGCCAACCTTTTCGAGGA	0.587													7	115	---	---	---	---	PASS
KIAA0125	9834	broad.mit.edu	37	14	106361491	106361491	+	Intron	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106361491G>A	uc001ysq.2	+						ADAM6_uc010tyt.1_RNA|KIAA0125_uc001ysr.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0						GTGATGCTGTGGGTATAACGA	0.562													9	10	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24923588	24923588	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24923588G>A	uc001ywo.2	+	1	3048	c.2574G>A	c.(2572-2574)GGG>GGA	p.G858G		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	858					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CTGGTTCTGGGAACACACTAC	0.493													18	49	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33833011	33833011	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33833011G>T	uc001zhi.2	+	7	636	c.566G>T	c.(565-567)GGT>GTT	p.G189V	RYR3_uc010bar.2_Missense_Mutation_p.G189V	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	189	MIR 2.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTATCAAATGGTAACATACAA	0.428													11	23	---	---	---	---	PASS
PGBD4	161779	broad.mit.edu	37	15	34396159	34396159	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34396159C>A	uc001zho.2	+	1	1886	c.1427C>A	c.(1426-1428)CCT>CAT	p.P476H	C15orf24_uc001zhm.2_5'Flank|C15orf24_uc001zhn.2_5'Flank	NM_152595	NP_689808	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	476											0		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		AAGGATAATCCTGAGCACACG	0.433													5	52	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48539204	48539204	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48539204A>T	uc001zwn.3	+	12	1767	c.1551A>T	c.(1549-1551)AAA>AAT	p.K517N	SLC12A1_uc010uew.1_Missense_Mutation_p.K323N|SLC12A1_uc010bem.2_Missense_Mutation_p.K517N|SLC12A1_uc001zwq.3_Missense_Mutation_p.K288N|SLC12A1_uc001zwr.3_Missense_Mutation_p.K244N	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	517	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GCGCACCCAAAGTGTTCCAGG	0.498													29	87	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48782117	48782117	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48782117C>A	uc001zwx.1	-	25	3341	c.3013G>T	c.(3013-3015)GAG>TAG	p.E1005*		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1005	TB 5.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CACAGCTCCTCGTACTCAGGA	0.537													4	54	---	---	---	---	PASS
C15orf33	196951	broad.mit.edu	37	15	49867260	49867260	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49867260G>A	uc001zxl.2	-	8	887	c.593C>T	c.(592-594)TCC>TTC	p.S198F	C15orf33_uc001zxm.2_Missense_Mutation_p.S198F	NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951	198										ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)		AAGAGCAATGGAGGCTTCTGA	0.303													10	15	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63932475	63932475	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63932475C>A	uc002amp.2	-	61	11925	c.11777G>T	c.(11776-11778)TGG>TTG	p.W3926L		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	3926					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						ACATTCTAACCAGGCCCATTC	0.498													20	45	---	---	---	---	PASS
SNX1	6642	broad.mit.edu	37	15	64418374	64418374	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64418374C>G	uc002amv.2	+	6	643	c.607C>G	c.(607-609)CAG>GAG	p.Q203E	SNX1_uc010bgv.2_5'UTR|SNX1_uc010uio.1_Missense_Mutation_p.Q203E|SNX1_uc002amw.2_Missense_Mutation_p.Q203E|SNX1_uc002amx.2_Missense_Mutation_p.Q138E|SNX1_uc002amy.2_Missense_Mutation_p.Q132E|SNX1_uc010bgw.2_Missense_Mutation_p.Q105E	NM_003099	NP_003090	Q13596	SNX1_HUMAN	sorting nexin 1 isoform a	203	PX.				cell communication|early endosome to Golgi transport|endocytosis|intracellular protein transport	early endosome membrane|Golgi apparatus	phosphatidylinositol binding|protein binding|protein transporter activity				0						GAAGCACTCTCAGAATGGCTT	0.443													13	43	---	---	---	---	PASS
ISL2	64843	broad.mit.edu	37	15	76629258	76629258	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76629258G>T	uc002bbw.1	+	1	112	c.34G>T	c.(34-36)GGT>TGT	p.G12C		NM_145805	NP_665804	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	12						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TCCTTTTCTGGGTGCTATGGG	0.468													9	348	---	---	---	---	PASS
IDH3A	3419	broad.mit.edu	37	15	78454050	78454050	+	Missense_Mutation	SNP	T	G	G	rs61752770	byFrequency	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78454050T>G	uc002bdd.2	+	5	444	c.417T>G	c.(415-417)GAT>GAG	p.D139E	IDH3A_uc010umt.1_Missense_Mutation_p.D104E|IDH3A_uc010umu.1_Missense_Mutation_p.D30E|IDH3A_uc002bde.2_Missense_Mutation_p.D89E|IDH3A_uc010umv.1_Missense_Mutation_p.D89E|IDH3A_uc002bdf.2_5'UTR|IDH3A_uc002bdg.2_Missense_Mutation_p.D52E	NM_005530	NP_005521	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	139					carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	CTTACACCGATGTAAATATTG	0.418													41	149	---	---	---	---	PASS
TMC3	342125	broad.mit.edu	37	15	81654635	81654635	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81654635C>T	uc002bgo.1	-	4	320	c.320G>A	c.(319-321)CGG>CAG	p.R107Q	TMC3_uc010blr.1_RNA|TMC3_uc002bgp.2_Missense_Mutation_p.R107Q	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	107	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2						AGCAAATTTCCGCCAGAGCTA	0.468													18	22	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85405880	85405880	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85405880G>A	uc002ble.2	+	10	4917	c.4750G>A	c.(4750-4752)GAG>AAG	p.E1584K	ALPK3_uc010upc.1_5'Flank	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1584					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGAAGAGATTGAGATGACCCC	0.572													30	47	---	---	---	---	PASS
WDR93	56964	broad.mit.edu	37	15	90260146	90260146	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90260146C>T	uc002boj.2	+	7	862	c.761C>T	c.(760-762)TCC>TTC	p.S254F	WDR93_uc010bnr.2_Missense_Mutation_p.S254F	NM_020212	NP_064597	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	254					electron transport chain	mitochondrial inner membrane	oxidoreductase activity, acting on NADH or NADPH			ovary(2)	2	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			TCTCAGAACTCCCTTGGTCCC	0.338													9	58	---	---	---	---	PASS
TTC23	64927	broad.mit.edu	37	15	99761938	99761938	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99761938G>T	uc002bur.2	-						TTC23_uc002bus.2_Intron|TTC23_uc002but.2_Intron|TTC23_uc002buu.2_Intron|TTC23_uc002buv.2_Intron|TTC23_uc002bux.2_Intron|TTC23_uc002buw.2_Intron|TTC23_uc010boq.2_Intron|TTC23_uc002buy.2_Intron|TTC23_uc010bor.2_Intron|TTC23_uc002buz.2_Intron	NM_022905	NP_075056	Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23								binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			AGTCTAAGGCGAGCTTACCTT	0.433													4	32	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100331935	100331935	+	RNA	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100331935G>A	uc010urx.1	-	5		c.2257C>T			C15orf51_uc010ury.1_RNA	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						CCTGCCTTCTGATTTCTCTGG	0.572													7	33	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101970216	101970216	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101970216C>T	uc002bwy.2	-	6	1024	c.710G>A	c.(709-711)CGA>CAA	p.R237Q	PCSK6_uc010bpd.2_Missense_Mutation_p.R107Q|PCSK6_uc010bpe.2_Missense_Mutation_p.R237Q|PCSK6_uc002bxa.2_Missense_Mutation_p.R237Q|PCSK6_uc002bxb.2_Missense_Mutation_p.R237Q|PCSK6_uc002bxc.1_Missense_Mutation_p.R237Q|PCSK6_uc002bxd.1_Missense_Mutation_p.R237Q|PCSK6_uc002bxe.2_Missense_Mutation_p.R237Q|PCSK6_uc002bxg.1_Missense_Mutation_p.R237Q	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	237	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGCATCATATCGTGGAGATGG	0.507													11	77	---	---	---	---	PASS
CHTF18	63922	broad.mit.edu	37	16	847697	847697	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:847697G>C	uc002cke.3	+	21	2800	c.2737G>C	c.(2737-2739)GAG>CAG	p.E913Q	CHTF18_uc002ckf.3_Missense_Mutation_p.E941Q|CHTF18_uc010brf.2_Missense_Mutation_p.E495Q|CHTF18_uc002ckg.3_Missense_Mutation_p.E431Q	NM_022092	NP_071375	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor	913					cell cycle|DNA replication	nucleus	ATP binding|DNA binding|nucleoside-triphosphatase activity			kidney(1)	1		Hepatocellular(780;0.00335)				CCATCAGCCTGAGAAGGACTT	0.612													15	39	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2815495	2815495	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2815495G>T	uc002crk.2	+	11	5515	c.4966G>T	c.(4966-4968)GAG>TAG	p.E1656*	SRRM2_uc002crj.1_Nonsense_Mutation_p.E1560*|SRRM2_uc002crl.1_Nonsense_Mutation_p.E1656*|SRRM2_uc010bsu.1_Nonsense_Mutation_p.E1560*	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1656	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CAGCAGTACCGAGTCCTCTCC	0.572													4	35	---	---	---	---	PASS
ZNF263	10127	broad.mit.edu	37	16	3339825	3339825	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3339825G>T	uc002cuq.2	+	6	1651	c.1319G>T	c.(1318-1320)GGG>GTG	p.G440V	ZNF263_uc010uww.1_Missense_Mutation_p.G88V|ZNF263_uc002cur.2_Missense_Mutation_p.G88V	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	440	C2H2-type 2.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						CTTGAATGTGGGAAATGCTTC	0.532													7	69	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3633448	3633448	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3633448G>T	uc002cvp.2	-	14	5430	c.4803C>A	c.(4801-4803)TAC>TAA	p.Y1601*		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	1601	Interaction with MUS81.|Interaction with PLK1 and TERF2-TERF2IP.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						TCTGGTGAGTGTACTGGAATA	0.597								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				5	126	---	---	---	---	PASS
C16orf68	79091	broad.mit.edu	37	16	8722882	8722882	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8722882G>T	uc002cyz.2	+	3	705	c.429G>T	c.(427-429)AAG>AAT	p.K143N	C16orf68_uc002cza.2_Intron	NM_024109	NP_077014	Q9BUU2	MET22_HUMAN	hypothetical protein LOC79091	143							methyltransferase activity				0						TGAGAGACAAGGTACATCCCA	0.537													8	220	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9857084	9857084	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9857084G>T	uc002czo.3	-	13	4865	c.4317C>A	c.(4315-4317)TAC>TAA	p.Y1439*	GRIN2A_uc010uym.1_Nonsense_Mutation_p.Y1439*|GRIN2A_uc010uyn.1_3'UTR|GRIN2A_uc002czr.3_3'UTR	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1439	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TGGGGGTAGAGTACATATTAT	0.403													11	32	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17292262	17292262	+	Missense_Mutation	SNP	A	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17292262A>C	uc002dfa.2	-	5	1181	c.1096T>G	c.(1096-1098)TAC>GAC	p.Y366D		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	366	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						CGATGCAGGTAATTAGAGCGC	0.587													10	28	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19475265	19475265	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19475265C>G	uc002dgc.3	+	8	2153	c.1404C>G	c.(1402-1404)TTC>TTG	p.F468L	TMC5_uc010vaq.1_Missense_Mutation_p.F468L|TMC5_uc002dgb.3_Missense_Mutation_p.F468L|TMC5_uc010var.1_Missense_Mutation_p.F468L|TMC5_uc002dgd.1_Missense_Mutation_p.F222L|TMC5_uc002dge.3_Missense_Mutation_p.F222L|TMC5_uc002dgf.3_Missense_Mutation_p.F151L|TMC5_uc002dgg.3_Missense_Mutation_p.F109L	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	468	Helical; (Potential).					integral to membrane				skin(1)	1						TCCTGAACTTCAGCTTCATCA	0.458													16	37	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20548587	20548587	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20548587G>A	uc002dhj.3	-	15	1937	c.1727C>T	c.(1726-1728)GCG>GTG	p.A576V	ACSM2B_uc002dhk.3_Missense_Mutation_p.A576V	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	576					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						GCCTCACTGCGCACGGGCTTT	0.463													36	86	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21151983	21151983	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21151983C>A	uc010vbe.1	-	5	570	c.570G>T	c.(568-570)GAG>GAT	p.E190D	DNAH3_uc002die.2_Missense_Mutation_p.E161D	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	190	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ATGTCTTTACCTCCTTCTTCA	0.468													6	72	---	---	---	---	PASS
DCTN5	84516	broad.mit.edu	37	16	23677023	23677023	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23677023C>A	uc002dly.1	+	5	482	c.425C>A	c.(424-426)CCA>CAA	p.P142Q		NM_032486	NP_115875	Q9BTE1	DCTN5_HUMAN	dynactin 5	142						centrosome	transferase activity			upper_aerodigestive_tract(1)	1				GBM - Glioblastoma multiforme(48;0.0156)		GTGGTTCCACCATTCACTGTC	0.393													5	34	---	---	---	---	PASS
PLK1	5347	broad.mit.edu	37	16	23701356	23701356	+	Missense_Mutation	SNP	C	T	T	rs34001032	byFrequency	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23701356C>T	uc002dlz.1	+	10	1837	c.1784C>T	c.(1783-1785)TCG>TTG	p.S595L		NM_005030	NP_005021	P53350	PLK1_HUMAN	polo-like kinase 1	595					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G2/M transition DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic prophase|negative regulation of cyclin-dependent protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|protein localization to chromatin|protein ubiquitination|regulation of mitotic anaphase|regulation of protein binding	centrosome|condensed nuclear chromosome outer kinetochore|cytosol|nucleoplasm|spindle microtubule|spindle midzone|spindle pole	anaphase-promoting complex binding|ATP binding|polo kinase kinase activity|protein kinase binding			lung(1)|skin(1)	2				GBM - Glioblastoma multiforme(48;0.0156)		AGCTCACGCTCGGCCAGCAAC	0.652													5	19	---	---	---	---	PASS
CD19	930	broad.mit.edu	37	16	28943342	28943342	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28943342C>A	uc002drs.2	+	1	83	c.21C>A	c.(19-21)CTC>CTA	p.L7L	uc010vct.1_Intron|CD19_uc010byo.1_Silent_p.L7L	NM_001770	NP_001761	P15391	CD19_HUMAN	CD19 antigen precursor	7					cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity			ovary(2)|central_nervous_system(1)	3						CTCGCCTCCTCTTCTTCCTCC	0.557													6	80	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31425870	31425870	+	Silent	SNP	C	A	A	rs149370240	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31425870C>A	uc002ebv.1	+	17	2144	c.2095C>A	c.(2095-2097)CGA>AGA	p.R699R	ITGAD_uc010cap.1_Silent_p.R700R	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	699	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						CACTTTGACTCGAAGAAAAAC	0.522													8	366	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48212568	48212568	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48212568C>A	uc002eff.1	-	23	3638	c.3288G>T	c.(3286-3288)CGG>CGT	p.R1096R	ABCC11_uc002efg.1_Silent_p.R1096R|ABCC11_uc002efh.1_Silent_p.R1096R|ABCC11_uc010cbg.1_RNA	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	1096	Cytoplasmic (Potential).|ABC transmembrane type-1 2.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				CCAAGCCAATCCGGGCAGTGG	0.582									Cerumen_Type				10	22	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50759418	50759418	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50759418C>G	uc002egm.1	+	10	3006	c.2901C>G	c.(2899-2901)CTC>CTG	p.L967L	NOD2_uc010vgq.1_Silent_p.L12L	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	967	LRR 7.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				AGAACCATCTCCAGGATGAAG	0.413													22	39	---	---	---	---	PASS
SLC6A2	6530	broad.mit.edu	37	16	55719166	55719166	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55719166C>G	uc002eif.2	+	5	867	c.756C>G	c.(754-756)CTC>CTG	p.L252L	SLC6A2_uc010ccd.2_Silent_p.L252L|SLC6A2_uc002eig.2_Silent_p.L252L|SLC6A2_uc002eih.2_Silent_p.L252L|SLC6A2_uc002eii.2_Silent_p.L147L|SLC6A2_uc002eij.2_Silent_p.L11L	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2	252	Helical; Name=4; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)	ATTTTAGCCTCTGGAAAGGGG	0.483													19	67	---	---	---	---	PASS
SLC6A2	6530	broad.mit.edu	37	16	55731808	55731808	+	Splice_Site	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55731808G>T	uc002eif.2	+	10	1372	c.1261_splice	c.e10-1	p.M421_splice	SLC6A2_uc010ccd.2_Splice_Site_p.M421_splice|SLC6A2_uc002eig.2_Splice_Site_p.M421_splice|SLC6A2_uc002eih.2_Splice_Site_p.M421_splice|SLC6A2_uc002eii.2_Splice_Site_p.M316_splice|SLC6A2_uc002eij.2_Splice_Site_p.M135_splice	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2						synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GTTCCCTCCAGATGGGAGGCA	0.597													7	19	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61858997	61858997	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61858997G>A	uc002eog.1	-	5	1006	c.754C>T	c.(754-756)CAC>TAC	p.H252Y	CDH8_uc002eoh.2_Missense_Mutation_p.H21Y	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	252	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CCACCAGAGTGTCCACCCATA	0.453													13	13	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66947191	66947191	+	Intron	SNP	T	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66947191T>G	uc002eql.2	-						CDH16_uc010cdy.2_Intron|CDH16_uc002eqm.2_Intron	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GGTACTGCGGTGGGCAGTAGG	0.622													16	46	---	---	---	---	PASS
TMCO7	79613	broad.mit.edu	37	16	68893908	68893908	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68893908C>A	uc002ewi.3	+	2	228	c.216C>A	c.(214-216)CTC>CTA	p.L72L	TMCO7_uc002ewh.2_Silent_p.L72L	NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7	72						integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		ATCTGAAACTCCTAAGAGATG	0.408													5	48	---	---	---	---	PASS
ZNF23	7571	broad.mit.edu	37	16	71483756	71483756	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71483756C>A	uc002faf.2	-	6	986	c.172G>T	c.(172-174)GAA>TAA	p.E58*	ZNF23_uc002fad.2_5'UTR|ZNF23_uc002fae.2_5'UTR|ZNF23_uc010vmf.1_5'UTR|ZNF23_uc002fag.2_5'UTR|ZNF23_uc002fah.2_Nonsense_Mutation_p.E58*|ZNF23_uc002fai.2_Nonsense_Mutation_p.E97*	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	58					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		TCATACATTTCCTTTGTCAAA	0.333													11	17	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72845851	72845851	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72845851G>C	uc002fck.2	-	6	4289	c.3616C>G	c.(3616-3618)CTC>GTC	p.L1206V	ZFHX3_uc002fcl.2_Missense_Mutation_p.L292V	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1206					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				TTCGAAGAGAGGGGAGACTCT	0.532													48	137	---	---	---	---	PASS
CMIP	80790	broad.mit.edu	37	16	81641237	81641237	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81641237G>T	uc002fgp.2	+	2	438	c.366G>T	c.(364-366)TGG>TGT	p.W122C	CMIP_uc002fgq.1_Missense_Mutation_p.W28C|CMIP_uc010vnq.1_5'Flank	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip	88	PH.					cytoplasm|nucleus					0						TGCTGTCCTGGGAGAATGCCC	0.458													10	122	---	---	---	---	PASS
VPS53	55275	broad.mit.edu	37	17	613825	613825	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:613825C>A	uc002frn.2	-	2	263	c.116G>T	c.(115-117)CGA>CTA	p.R39L	VPS53_uc010cjo.1_Missense_Mutation_p.R39L|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.R39L|VPS53_uc002fro.2_5'UTR|VPS53_uc010cjp.1_Missense_Mutation_p.R39L	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2	39					protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		GAAATCTGCTCGATCTAGAGG	0.328													4	48	---	---	---	---	PASS
SMYD4	114826	broad.mit.edu	37	17	1703966	1703966	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1703966G>T	uc002ftm.3	-	5	890	c.722C>A	c.(721-723)CCT>CAT	p.P241H	SMYD4_uc002ftn.1_Missense_Mutation_p.P96H	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	241							zinc ion binding			skin(3)|kidney(2)	5						ACCTTTTAAAGGATCTACGCA	0.507													6	81	---	---	---	---	PASS
GABARAP	11337	broad.mit.edu	37	17	7144663	7144663	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7144663G>T	uc002gfb.2	-	3	390	c.286C>A	c.(286-288)CAG>AAG	p.Q96K	PHF23_uc002gfa.2_5'Flank|PHF23_uc010vtt.1_5'Flank|PHF23_uc010cma.2_5'Flank	NM_007278	NP_009209	O95166	GBRAP_HUMAN	GABA(A) receptor-associated protein	96	Interaction with GPHN (By similarity).				protein targeting|synaptic transmission	autophagic vacuole membrane|Golgi membrane|microtubule|plasma membrane	beta-tubulin binding|GABA receptor binding				0						CACCATACCTGGTACAGCTGA	0.488													10	339	---	---	---	---	PASS
EIF4A1	1973	broad.mit.edu	37	17	7481668	7481668	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7481668G>T	uc002gho.1	+	19	2410	c.1085G>T	c.(1084-1086)CGA>CTA	p.R362L	EIF4A1_uc002ghr.1_Silent_p.S341S|EIF4A1_uc002ghq.1_Silent_p.S335S|EIF4A1_uc002ghp.1_Missense_Mutation_p.R362L|CD68_uc002ghv.2_5'Flank|CD68_uc002ghu.2_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A	362	Helicase C-terminal.				nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						AGAATCGGTCGAGGTGGACGG	0.507													4	58	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7579494	7579494	+	Nonsense_Mutation	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579494T>A	uc002gim.2	-	4	387	c.193A>T	c.(193-195)AGA>TGA	p.R65*	TP53_uc002gig.1_Nonsense_Mutation_p.R65*|TP53_uc002gih.2_Nonsense_Mutation_p.R65*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.R65*|TP53_uc010cni.1_Nonsense_Mutation_p.R65*|TP53_uc002gij.2_Nonsense_Mutation_p.R65*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Nonsense_Mutation_p.R26*|TP53_uc010cnk.1_Nonsense_Mutation_p.R80*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	65	Interaction with HRMT1L2.		R -> T (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R65*(8)|p.0?(7)|p.G59fs*23(3)|p.264_265insSSGNL(1)|p.D48fs*55(1)|p.R65_P71delRMPEAAP(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGGCATTCTGGGAGCTTCA	0.617		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			55	75	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8738701	8738701	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8738701C>T	uc002glq.1	-	8	774	c.534G>A	c.(532-534)GCG>GCA	p.A178A	PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	178					platelet activation	cytosol					0						GCGCCTGGGCCGCCTCGATCT	0.652													8	17	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10542913	10542913	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10542913G>T	uc002gmq.1	-	22	2966	c.2889C>A	c.(2887-2889)GCC>GCA	p.A963A		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	963	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						TCTCAACCTTGGCCAGGGTCA	0.433													40	78	---	---	---	---	PASS
ELAC2	60528	broad.mit.edu	37	17	12897091	12897091	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12897091C>T	uc002gnz.3	-	23	2261	c.2166G>A	c.(2164-2166)CTG>CTA	p.L722L	ELAC2_uc002gnu.3_Silent_p.L119L|ELAC2_uc002gnv.3_Silent_p.L350L|ELAC2_uc002gnw.3_Silent_p.L378L|ELAC2_uc002gnx.3_Silent_p.L482L|ELAC2_uc010vvo.1_Silent_p.L520L|ELAC2_uc010vvp.1_Silent_p.L703L|ELAC2_uc010vvq.1_Silent_p.L721L|ELAC2_uc010vvr.1_Silent_p.L682L	NM_018127	NP_060597	Q9BQ52	RNZ2_HUMAN	elaC homolog 2 isoform 1	722					tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0						TGAAGTGGTTCAGCATAATGA	0.547									Hereditary_Prostate_Cancer				18	24	---	---	---	---	PASS
FLCN	201163	broad.mit.edu	37	17	17127237	17127237	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17127237T>C	uc002gra.3	-	6	1121	c.617A>G	c.(616-618)AAG>AGG	p.K206R	PLD6_uc010cpn.2_Intron|FLCN_uc002grb.3_Missense_Mutation_p.K206R	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1	206					regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						TGAATTCACCTTGAGCGCCTT	0.622									Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				8	5	---	---	---	---	PASS
SHMT1	6470	broad.mit.edu	37	17	18250933	18250933	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18250933C>A	uc002gta.2	-	5	586	c.396G>T	c.(394-396)GTG>GTT	p.V132V	SHMT1_uc002gtb.2_Silent_p.V132V|SHMT1_uc010cqb.2_Silent_p.V132V|SHMT1_uc010vxt.1_5'UTR|SHMT1_uc002gtd.1_Silent_p.V132V|SHMT1_uc010vxu.1_Silent_p.V132V	NM_004169	NP_004160	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	132					carnitine biosynthetic process|folic acid metabolic process|L-serine catabolic process|one-carbon metabolic process|purine base biosynthetic process	cytosol|nucleus	glycine hydroxymethyltransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					Glycine(DB00145)|Mimosine(DB01055)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	CATGGGGTTCCACCAGGGCAG	0.552													31	22	---	---	---	---	PASS
NEK8	284086	broad.mit.edu	37	17	27064326	27064326	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27064326C>G	uc002hcp.2	+	5	621	c.621C>G	c.(619-621)AAC>AAG	p.N207K		NM_178170	NP_835464	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	207	Protein kinase.					cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6	Lung NSC(42;0.0158)					CTTCACAGAACTTGCCAGCAC	0.547													4	6	---	---	---	---	PASS
AMAC1	146861	broad.mit.edu	37	17	33520358	33520358	+	Silent	SNP	A	G	G	rs74740601	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520358A>G	uc002hjd.2	-	1	1055	c.969T>C	c.(967-969)ATT>ATC	p.I323I		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	323	DUF6 2.|Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		TCTGGGCTGTAATGATGGCAA	0.547													3	72	---	---	---	---	PASS
SRCIN1	80725	broad.mit.edu	37	17	36734771	36734771	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36734771C>A	uc002hqd.2	-	2	521	c.296G>T	c.(295-297)CGA>CTA	p.R99L	SRCIN1_uc002hqh.1_Missense_Mutation_p.R133L	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						CTGCTGGCCTCGCAGGGCCAG	0.706													11	11	---	---	---	---	PASS
NBR1	4077	broad.mit.edu	37	17	41345487	41345487	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41345487G>T	uc010czd.2	+	12	1496	c.1356G>T	c.(1354-1356)GAG>GAT	p.E452D	NBR1_uc010diz.2_Missense_Mutation_p.E452D|NBR1_uc010whu.1_Missense_Mutation_p.E452D|NBR1_uc010whv.1_Missense_Mutation_p.E452D|NBR1_uc010whw.1_Missense_Mutation_p.E431D|NBR1_uc010whx.1_Missense_Mutation_p.E261D	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	452					macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		CAGCCTTGGAGGGAACGTATA	0.517													5	21	---	---	---	---	PASS
KPNB1	3837	broad.mit.edu	37	17	45755688	45755688	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45755688G>T	uc002ilt.1	+	19	2598	c.2262G>T	c.(2260-2262)ATG>ATT	p.M754I	KPNB1_uc010wkw.1_Missense_Mutation_p.M609I|KPNB1_uc010wkx.1_Missense_Mutation_p.M538I	NM_002265	NP_002256	Q14974	IMB1_HUMAN	karyopherin beta 1	754					DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						ACTATGACATGGTGGATTATC	0.438													6	54	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48278790	48278790	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48278790C>T	uc002iqm.2	-	1	211	c.85G>A	c.(85-87)GAG>AAG	p.E29K		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	29					axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	TCTTGGCCCTCGACTTGGCCT	0.587			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						8	22	---	---	---	---	PASS
CA10	56934	broad.mit.edu	37	17	50008392	50008392	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50008392G>T	uc002itw.3	-	3	1223	c.237C>A	c.(235-237)GAC>GAA	p.D79E	CA10_uc002itv.3_Missense_Mutation_p.D85E|CA10_uc002itx.3_Missense_Mutation_p.D79E|CA10_uc002ity.3_Missense_Mutation_p.D79E|CA10_uc002itz.2_Missense_Mutation_p.D79E	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	79					brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			TCAGAAAGGGGTCGAAGATCA	0.498													32	72	---	---	---	---	PASS
HLF	3131	broad.mit.edu	37	17	53392768	53392768	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53392768T>C	uc002iug.1	+	3	1157	c.632T>C	c.(631-633)ATC>ACC	p.I211T	HLF_uc010dce.1_Missense_Mutation_p.I126T|HLF_uc002iuh.2_Missense_Mutation_p.I126T|HLF_uc010wni.1_Missense_Mutation_p.I158T	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor	211					multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						CAGCCCATGATCAAGAAAGCT	0.493			T	TCF3	ALL								4	41	---	---	---	---	PASS
LPO	4025	broad.mit.edu	37	17	56329242	56329242	+	Intron	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56329242C>G	uc002ivt.2	+						LPO_uc010wns.1_Intron|LPO_uc010dcp.2_Intron|LPO_uc010dcq.2_Intron|LPO_uc010dcr.2_5'Flank	NM_006151	NP_006142	P22079	PERL_HUMAN	lactoperoxidase isoform 1 preproprotein						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|breast(1)	2						GTTCCCACCTCGTGTCCTGCT	0.308													11	48	---	---	---	---	PASS
APPBP2	10513	broad.mit.edu	37	17	58538126	58538126	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58538126G>A	uc002iys.1	-	9	1247	c.959C>T	c.(958-960)TCA>TTA	p.S320L	APPBP2_uc010ddl.1_Missense_Mutation_p.S249L	NM_006380	NP_006371	Q92624	APBP2_HUMAN	amyloid beta precursor protein-binding protein	320	TPR 4.				intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			ACCAAACACTGACTGTCTAAT	0.358													8	47	---	---	---	---	PASS
ERN1	2081	broad.mit.edu	37	17	62122851	62122851	+	Intron	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62122851G>A	uc002jdz.2	-							NM_001433	NP_001424	O75460	ERN1_HUMAN	endoplasmic reticulum to nucleus signalling 1						activation of signaling protein activity involved in unfolded protein response|apoptosis|cell cycle arrest|induction of apoptosis|mRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to endoplasmic reticulum membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(4)|lung(2)|stomach(1)|ovary(1)|kidney(1)	9						TCCTGTGAGAGAAACAAGGGC	0.542													12	66	---	---	---	---	PASS
GPRC5C	55890	broad.mit.edu	37	17	72443069	72443069	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72443069G>T	uc002jks.2	+	3	1267	c.1228G>T	c.(1228-1230)GCT>TCT	p.A410S	GPRC5C_uc002jkp.2_Missense_Mutation_p.A455S|GPRC5C_uc002jkq.2_3'UTR|GPRC5C_uc002jkr.2_Missense_Mutation_p.A422S|GPRC5C_uc002jkt.2_Missense_Mutation_p.A410S|GPRC5C_uc002jku.2_Missense_Mutation_p.A165S	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	410	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						GACCCTGCGGGCTGAAGACAT	0.607													8	45	---	---	---	---	PASS
GRIN2C	2905	broad.mit.edu	37	17	72840421	72840421	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72840421G>A	uc002jlt.1	-	12	2733	c.2577C>T	c.(2575-2577)TTC>TTT	p.F859F	GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_Silent_p.F859F	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C	859	Cytoplasmic (Potential).				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)	CCACCCTGCTGAAAGCCAGCA	0.617													10	40	---	---	---	---	PASS
UBE2O	63893	broad.mit.edu	37	17	74394450	74394450	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74394450C>A	uc002jrm.3	-	12	1976	c.1911G>T	c.(1909-1911)GAG>GAT	p.E637D	UBE2O_uc002jrn.3_Missense_Mutation_p.E637D|UBE2O_uc002jrl.3_Missense_Mutation_p.E240D	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	637							ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						TCACATCTTCCTCTTCTCCAA	0.547											OREG0024751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	420	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77077136	77077136	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77077136G>A	uc002jwv.2	+	6	861	c.853G>A	c.(853-855)GAA>AAA	p.E285K	ENGASE_uc002jwu.1_Missense_Mutation_p.E285K|ENGASE_uc010wtz.1_Missense_Mutation_p.E99K|ENGASE_uc002jww.2_5'UTR	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	285						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						ATGGCAAGACGAACTCAACCA	0.652													5	11	---	---	---	---	PASS
ENPP7	339221	broad.mit.edu	37	17	77707323	77707323	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77707323C>G	uc002jxa.2	+	2	291	c.271C>G	c.(271-273)CAC>GAC	p.H91D		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	91					negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TATCGAGAACCACGGGGTGGT	0.617													33	98	---	---	---	---	PASS
GAA	2548	broad.mit.edu	37	17	78093138	78093138	+	3'UTR	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78093138G>T	uc002jxo.2	+	21					GAA_uc002jxp.2_3'UTR|GAA_uc002jxq.2_3'UTR	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein						cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	TAGCCGGGCGGAGTGTGTTAG	0.602													26	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	78282825	78282825	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78282825G>T	uc002jyf.2	+	14	2652	c.2509G>T	c.(2509-2511)GAG>TAG	p.E837*	uc002jyg.1_Nonsense_Mutation_p.E568*	NM_020954	NP_066005			hypothetical protein LOC57714																		CAGGATTCCCGAGGAGGCCTT	0.478													7	94	---	---	---	---	PASS
MYOM1	8736	broad.mit.edu	37	18	3129295	3129295	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3129295G>T	uc002klp.2	-	18	3063	c.2729C>A	c.(2728-2730)CCA>CAA	p.P910Q	MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	910						striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TTTCTGTGGTGGCGGGGTAAG	0.488											OREG0024838	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	91	---	---	---	---	PASS
MYOM1	8736	broad.mit.edu	37	18	3187488	3187488	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3187488G>T	uc002klp.2	-	5	1253	c.919C>A	c.(919-921)CGT>AGT	p.R307S	MYOM1_uc002klq.2_Missense_Mutation_p.R307S	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	307	Ig-like C2-type 1.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CACGTGACACGAGGTTCTGGC	0.438													8	247	---	---	---	---	PASS
AFG3L2	10939	broad.mit.edu	37	18	12358705	12358705	+	Silent	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12358705T>A	uc002kqz.1	-	8	1103	c.990A>T	c.(988-990)CCA>CCT	p.P330P		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	330					cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	GATACTGCTTTGGGTTTTTCA	0.353													6	55	---	---	---	---	PASS
PSMA8	143471	broad.mit.edu	37	18	23731821	23731821	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23731821G>T	uc002kvq.2	+	3	361	c.247G>T	c.(247-249)GGA>TGA	p.G83*	PSMA8_uc002kvo.2_Splice_Site_p.G39_splice|PSMA8_uc002kvp.2_Splice_Site_p.G77_splice|PSMA8_uc002kvr.2_Splice_Site_p.G51_splice	NM_144662	NP_653263	Q8TAA3	PSA7L_HUMAN	proteasome alpha 8 subunit isoform 1	83					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			AATTTTTATAGGACTTACTGC	0.353													7	147	---	---	---	---	PASS
CHST9	83539	broad.mit.edu	37	18	24722673	24722673	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24722673C>A	uc002kwd.2	-	1	299	c.101G>T	c.(100-102)TGG>TTG	p.W34L	C18orf16_uc010xbm.1_Intron|CHST9_uc002kwe.2_Missense_Mutation_p.W34L	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2	34	Lumenal (Potential).				carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)					TTCTTCAATCCAGACTTGCAA	0.348													7	120	---	---	---	---	PASS
TCEB3C	162699	broad.mit.edu	37	18	44555132	44555132	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44555132G>T	uc010xdb.1	-	1	1318	c.1082C>A	c.(1081-1083)TCG>TAG	p.S361*	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	361	Activation domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						TTCAAGAACCGAGTAGGGGAC	0.627													10	453	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56202524	56202524	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56202524A>G	uc002lhj.3	-	5	5109	c.4895T>C	c.(4894-4896)ATA>ACA	p.I1632T	ALPK2_uc002lhk.1_Missense_Mutation_p.I963T	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1632							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						AAGCACCTCTATTTTAGGTTC	0.448													9	29	---	---	---	---	PASS
PHLPP1	23239	broad.mit.edu	37	18	60563036	60563036	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60563036G>T	uc002lis.2	+	7	878	c.700G>T	c.(700-702)GGA>TGA	p.G234*		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	746	LRR 5.				apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						TTTGTTGGATGGAAACTTTCT	0.328													5	63	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74620270	74620270	+	Intron	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74620270C>G	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GTTAATTTTTCTGAAGATATG	0.428													54	145	---	---	---	---	PASS
GALR1	2587	broad.mit.edu	37	18	74962936	74962936	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74962936C>A	uc002lms.3	+	1	929	c.432C>A	c.(430-432)TCC>TCA	p.S144S		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	144	Cytoplasmic (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		GGCGCTCCTCCTCCCTCAGGG	0.667													12	18	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753968	76753968	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753968G>A	uc002lmt.2	+	2	1977	c.1977G>A	c.(1975-1977)TCG>TCA	p.S659S	SALL3_uc010dra.2_Silent_p.S266S	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	659					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		TGCAAACGTCGGAAACCTCGA	0.647													11	11	---	---	---	---	PASS
CIRBP	1153	broad.mit.edu	37	19	1271623	1271623	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1271623C>A	uc002lrr.3	+	5	572	c.423C>A	c.(421-423)TAC>TAA	p.Y141*	C19orf23_uc010xgk.1_5'Flank|CIRBP_uc010dsg.1_Nonsense_Mutation_p.Y130*|CIRBP_uc002lrt.2_Nonsense_Mutation_p.Y141*|CIRBP_uc010xgl.1_Nonsense_Mutation_p.Y107*|CIRBP_uc002lrv.3_Nonsense_Mutation_p.Y141*|CIRBP_uc002lru.2_RNA	NM_001280	NP_001271	Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	141	Gly-rich.				mRNA stabilization|positive regulation of translation|response to cold|response to UV|stress granule assembly	nucleoplasm|stress granule	mRNA 3'-UTR binding|nucleotide binding|protein binding|SSU rRNA binding|translation repressor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGAGACTACTATAGCAGGT	0.642													3	8	---	---	---	---	PASS
TJP3	27134	broad.mit.edu	37	19	3738570	3738570	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3738570C>G	uc010xhv.1	+	11	1401	c.1401C>G	c.(1399-1401)TTC>TTG	p.F467L	TJP3_uc010xhs.1_Missense_Mutation_p.F434L|TJP3_uc010xht.1_Missense_Mutation_p.F398L|TJP3_uc010xhu.1_Missense_Mutation_p.F443L|TJP3_uc010xhw.1_Missense_Mutation_p.F453L	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	448	PDZ 3.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGTGCCATTCCAGAACCTGA	0.577													28	47	---	---	---	---	PASS
TJP3	27134	broad.mit.edu	37	19	3738989	3738989	+	Silent	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3738989C>T	uc010xhv.1	+	12	1587	c.1587C>T	c.(1585-1587)TTC>TTT	p.F529F	TJP3_uc010xhs.1_Silent_p.F496F|TJP3_uc010xht.1_Silent_p.F460F|TJP3_uc010xhu.1_Silent_p.F505F|TJP3_uc010xhw.1_Silent_p.F515F	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	510	SH3.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTGGGCTTCACCCGTGGCG	0.662													18	16	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7675643	7675643	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7675643G>T	uc002mgv.3	+	7	1059	c.958G>T	c.(958-960)GAC>TAC	p.D320Y	KIAA1543_uc002mgu.3_Missense_Mutation_p.D347Y	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	320					epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						GCTCAAGCCCGACTTTGTGCA	0.667													6	87	---	---	---	---	PASS
ZNF559	84527	broad.mit.edu	37	19	9449884	9449884	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9449884G>C	uc002mlg.2	+	5	696	c.49G>C	c.(49-51)GAG>CAG	p.E17Q	ZNF559_uc002mlf.2_5'UTR|ZNF559_uc010dwl.1_5'UTR|ZNF559_uc010xkn.1_Intron|ZNF559_uc010dwm.1_Missense_Mutation_p.E17Q|ZNF559_uc002mle.3_Missense_Mutation_p.E81Q|ZNF559_uc010dwk.1_5'UTR|ZNF559_uc002mld.2_Missense_Mutation_p.E81Q|ZNF559_uc010dwo.1_Missense_Mutation_p.E45Q|ZNF559_uc002mlh.1_RNA|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	17	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGTGACCTTTGAGGATGTGGC	0.478													4	59	---	---	---	---	PASS
ZSWIM4	65249	broad.mit.edu	37	19	13941475	13941475	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13941475G>T	uc002mxh.1	+	13	2770	c.2581G>T	c.(2581-2583)GAG>TAG	p.E861*	ZSWIM4_uc010xng.1_Nonsense_Mutation_p.E784*	NM_023072	NP_075560	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	861							zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GGGCCGGCACGAGCTCTCTGC	0.657													5	118	---	---	---	---	PASS
RLN3	117579	broad.mit.edu	37	19	14141522	14141522	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14141522G>T	uc002mxw.1	+	2	191	c.191G>T	c.(190-192)GGA>GTA	p.G64V	IL27RA_uc002mxx.2_5'Flank|RLN3_uc010dzj.1_Missense_Mutation_p.E101D	NM_080864	NP_543140	Q8WXF3	REL3_HUMAN	relaxin 3 preproprotein	64						extracellular region	hormone activity				0						TCTTTTGCAGGAGATACCTTC	0.567													6	81	---	---	---	---	PASS
BRD4	23476	broad.mit.edu	37	19	15349944	15349944	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15349944C>A	uc002nar.2	-	18	3930	c.3708G>T	c.(3706-3708)GAG>GAT	p.E1236D		NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	1236					interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CCTTCTCACGCTCCTCTTTCT	0.662			T	NUT|C15orf55	lethal midline carcinoma of young people								5	13	---	---	---	---	PASS
TMEM38A	79041	broad.mit.edu	37	19	16791207	16791207	+	Splice_Site	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16791207G>T	uc002nes.2	+	3	373	c.282_splice	c.e3-1	p.W94_splice		NM_024074	NP_076979	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A							integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			central_nervous_system(2)|ovary(1)	3						CTCCCCAAAAGGTACTTGATT	0.547													10	330	---	---	---	---	PASS
ZNF85	7639	broad.mit.edu	37	19	21132556	21132556	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21132556C>A	uc002npg.3	+	4	1363	c.1236C>A	c.(1234-1236)ACC>ACA	p.T412T	ZNF85_uc010ecn.2_Silent_p.T347T|ZNF85_uc010eco.2_Silent_p.T360T|ZNF85_uc002npi.2_Silent_p.T353T	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	412	C2H2-type 10.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						ACTCTTCAACCCTTACTAAAC	0.308													5	13	---	---	---	---	PASS
ZNF43	7594	broad.mit.edu	37	19	21990893	21990893	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21990893G>C	uc002nqj.2	-	4	2076	c.1946C>G	c.(1945-1947)CCC>CGC	p.P649R	ZNF43_uc010ecv.2_Missense_Mutation_p.P643R|ZNF43_uc002nql.2_Missense_Mutation_p.P643R|ZNF43_uc002nqm.2_Missense_Mutation_p.P643R|ZNF43_uc002nqk.2_Missense_Mutation_p.P579R	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	649					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		ACATTTGTAGGGTTTCTCCTC	0.373													4	19	---	---	---	---	PASS
ZNF675	171392	broad.mit.edu	37	19	23836935	23836935	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23836935T>A	uc002nri.2	-	4	982	c.800A>T	c.(799-801)CAG>CTG	p.Q267L		NM_138330	NP_612203	Q8TD23	ZN675_HUMAN	zinc finger protein 675	267	C2H2-type 5.				bone resorption|cytokine-mediated signaling pathway|hemopoiesis|I-kappaB kinase/NF-kappaB cascade|negative regulation of JNK cascade|negative regulation of osteoclast differentiation|negative regulation of protein kinase activity|negative regulation of transcription, DNA-dependent|regulation of ossification|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GTGTGAGGACTGGTTAAAGGC	0.358													6	28	---	---	---	---	PASS
ZNF681	148213	broad.mit.edu	37	19	23927658	23927658	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23927658C>A	uc002nrk.3	-	4	836	c.694G>T	c.(694-696)GGC>TGC	p.G232C	ZNF681_uc002nrl.3_Missense_Mutation_p.G163C|ZNF681_uc002nrj.3_Missense_Mutation_p.G163C	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	232	C2H2-type 3; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CAGGCTTTGCCACATTCTTCA	0.343													5	12	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34818703	34818703	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34818703G>T	uc002nvd.3	+	5	1733	c.874G>T	c.(874-876)GGA>TGA	p.G292*		NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	292										ovary(1)	1	Esophageal squamous(110;0.162)					GGAAAGCTTAGGACACTGTGA	0.383													6	85	---	---	---	---	PASS
SCGBL	284402	broad.mit.edu	37	19	35085114	35085114	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35085114G>T	uc002nvn.2	-	2	234	c.212C>A	c.(211-213)TCC>TAC	p.S71Y		NM_001025591	NP_001020762	Q4G0G5	SCGBL_HUMAN	secretoglobin-like precursor	71						extracellular region	binding				0						TTCTGTCACGGAGACATTGGC	0.547													6	104	---	---	---	---	PASS
LIN37	55957	broad.mit.edu	37	19	36245203	36245203	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36245203G>C	uc002obm.2	+	9	756	c.642G>C	c.(640-642)TGG>TGC	p.W214C	uc002obl.2_5'Flank	NM_019104	NP_061977	Q96GY3	LIN37_HUMAN	lin-37 homolog	214							protein binding				0	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCAGCGCTGGAAACGCATCC	0.637													23	103	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36335228	36335228	+	Silent	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36335228G>C	uc002oby.2	-	15	2064	c.2064C>G	c.(2062-2064)CTC>CTG	p.L688L		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	688	Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CACCTGGACTGAGGCGATAGC	0.697													6	18	---	---	---	---	PASS
ZFP14	57677	broad.mit.edu	37	19	36832139	36832139	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36832139C>T	uc002odx.1	-	4	682	c.589G>A	c.(589-591)GAG>AAG	p.E197K	ZFP14_uc010xtd.1_Missense_Mutation_p.E198K|ZFP14_uc010eex.1_Missense_Mutation_p.E197K	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	197					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					TAAGGTTTCTCACCAGTATGA	0.428													23	78	---	---	---	---	PASS
ZNF420	147923	broad.mit.edu	37	19	37619911	37619911	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37619911A>G	uc002ofl.2	+	5	2233	c.2018A>G	c.(2017-2019)TAT>TGT	p.Y673C		NM_144689	NP_653290	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	673					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCTTTTGAATATAAGGAATGT	0.378													11	36	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39950220	39950220	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39950220C>G	uc002olo.3	+	9	725	c.546C>G	c.(544-546)GTC>GTG	p.V182V	SUPT5H_uc002olp.3_Silent_p.V182V|SUPT5H_uc002olq.3_Silent_p.V178V|SUPT5H_uc002oln.3_Silent_p.V182V|SUPT5H_uc002olr.3_Silent_p.V182V	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a	182	Interaction with SUPT4H1.				cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TGTGGACTGTCAAATGTAAGG	0.557													37	81	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41123067	41123067	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41123067C>A	uc002ooh.1	+	24	3207	c.3207C>A	c.(3205-3207)CCC>CCA	p.P1069P	LTBP4_uc002oog.1_Silent_p.P1032P|LTBP4_uc002ooi.1_Silent_p.P1002P|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc002ook.1_Intron|LTBP4_uc002ool.1_Intron|LTBP4_uc002oom.1_RNA|LTBP4_uc010xvp.1_Intron	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	1069	Cys-rich.|EGF-like 12; calcium-binding (Potential).				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGAACCTGCCCGGCTCCTTCC	0.632													4	18	---	---	---	---	PASS
TEX101	83639	broad.mit.edu	37	19	43922125	43922125	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43922125C>A	uc010xwo.1	+	5	682	c.487C>A	c.(487-489)CGA>AGA	p.R163R	TEX101_uc002owk.2_Silent_p.R181R	NM_001130011	NP_001123483	Q9BY14	TX101_HUMAN	testis expressed 101 isoform 2	163						anchored to membrane|plasma membrane				ovary(1)	1		Prostate(69;0.0199)				TGGTACAACTCGATGCTATCA	0.473													5	83	---	---	---	---	PASS
TEX101	83639	broad.mit.edu	37	19	43922432	43922432	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43922432T>A	uc010xwo.1	+	6	828	c.633T>A	c.(631-633)CAT>CAA	p.H211Q	TEX101_uc002owk.2_Missense_Mutation_p.H229Q	NM_001130011	NP_001123483	Q9BY14	TX101_HUMAN	testis expressed 101 isoform 2	211						anchored to membrane|plasma membrane				ovary(1)	1		Prostate(69;0.0199)				CGTGCCCACATCAGCTGCTCA	0.532													29	64	---	---	---	---	PASS
ZNF45	7596	broad.mit.edu	37	19	44418134	44418134	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44418134G>C	uc002oxu.1	-	4	1553	c.1454C>G	c.(1453-1455)TCA>TGA	p.S485*	ZNF45_uc002oxw.1_Nonsense_Mutation_p.S485*|ZNF45_uc002oxv.1_Nonsense_Mutation_p.S485*	NM_003425	NP_003416	Q02386	ZNF45_HUMAN	zinc finger protein 45	485	C2H2-type 12.				multicellular organismal development	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						ATTAAGATCTGAGCTCCGACT	0.502													11	36	---	---	---	---	PASS
ZNF229	7772	broad.mit.edu	37	19	44934257	44934257	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44934257G>A	uc002oze.1	-	6	1133	c.699C>T	c.(697-699)TTC>TTT	p.F233F	ZNF229_uc010ejk.1_5'UTR|ZNF229_uc010ejl.1_Silent_p.F227F	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	233					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				CTATTTCAGGGAATCTGTGAT	0.378													18	47	---	---	---	---	PASS
PPP1R13L	10848	broad.mit.edu	37	19	45885827	45885827	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45885827C>A	uc002pbn.2	-	12	2483	c.2406G>T	c.(2404-2406)GCG>GCT	p.A802A	PPP1R13L_uc002pbm.2_Silent_p.A381A|PPP1R13L_uc002pbo.2_Silent_p.A802A	NM_006663	NP_006654	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13	802	SH3.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding			skin(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GGCCGTGCAGCGCGGCCCACC	0.697													11	28	---	---	---	---	PASS
LIG1	3978	broad.mit.edu	37	19	48631193	48631193	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48631193G>T	uc002pia.1	-	20	2026	c.1906C>A	c.(1906-1908)CAA>AAA	p.Q636K	LIG1_uc010xze.1_Missense_Mutation_p.Q329K|LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Missense_Mutation_p.Q568K|LIG1_uc010xzg.1_Missense_Mutation_p.Q605K	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I	636					anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	GTGAGCACTTGGAATGGCTGG	0.572								NER					8	181	---	---	---	---	PASS
HRC	3270	broad.mit.edu	37	19	49657014	49657014	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49657014G>C	uc002pmv.2	-	1	1668	c.1481C>G	c.(1480-1482)TCC>TGC	p.S494C		NM_002152	NP_002143	P23327	SRCH_HUMAN	histidine rich calcium binding protein	494					muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			ovary(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TTCCTCATGGGAGCCGGGGTC	0.547													8	53	---	---	---	---	PASS
TRPM4	54795	broad.mit.edu	37	19	49661519	49661519	+	Intron	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49661519G>T	uc002pmw.2	+						TRPM4_uc010emu.2_Intron|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Intron|TRPM4_uc010emv.2_Intron|TRPM4_uc010yal.1_Intron|HRC_uc002pmv.2_5'Flank	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,						dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GATCCGGGGTGAGGAGTTCGC	0.622													7	133	---	---	---	---	PASS
ETFB	2109	broad.mit.edu	37	19	51857558	51857558	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51857558C>A	uc002pwh.2	-	2	154	c.62G>T	c.(61-63)CGA>CTA	p.R21L	ETFB_uc002pwg.2_Missense_Mutation_p.R112L	NM_001985	NP_001976	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide	21					respiratory electron transport chain|transport	mitochondrial matrix	electron carrier activity				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)		AGGCTTCACTCGGATCTGCCC	0.532													4	58	---	---	---	---	PASS
ZNF28	7576	broad.mit.edu	37	19	53302992	53302992	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53302992C>A	uc002qad.2	-	4	2226	c.2106G>T	c.(2104-2106)CAG>CAT	p.Q702H	ZNF28_uc002qac.2_Missense_Mutation_p.Q649H|ZNF28_uc010eqe.2_Missense_Mutation_p.Q648H	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	702	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		GGTTTGACATCTGACTGAAGG	0.413													18	40	---	---	---	---	PASS
KIR3DX1	90011	broad.mit.edu	37	19	55045040	55045040	+	RNA	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55045040C>T	uc010yfa.1	+	3		c.266C>T			KIR3DX1_uc010yfb.1_RNA|KIR3DX1_uc010yfc.1_RNA|KIR3DX1_uc010yfd.1_RNA	NR_026716				Homo sapiens mRNA for FLJ00060 protein, partial cds.											ovary(1)	1				GBM - Glioblastoma multiforme(193;0.099)		TTCCCATCTTCGGTTTGTCAT	0.537													7	53	---	---	---	---	PASS
KIR2DS4	3809	broad.mit.edu	37	19	55349259	55349259	+	Missense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55349259G>A	uc002qhm.1	+	3	345	c.299G>A	c.(298-300)TGC>TAC	p.C100Y	KIR2DS4_uc010yfj.1_Missense_Mutation_p.C93Y|KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Missense_Mutation_p.C100Y|KIR2DS4_uc002qhn.1_Missense_Mutation_p.C47Y	NM_012314	NP_036446	P43632	KI2S4_HUMAN	killer cell immunoglobulin-like receptor, two	100	Extracellular (Potential).|Ig-like C2-type 1.					integral to plasma membrane	receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		ACCTACAGATGCTACGGTTCT	0.507													73	252	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56370258	56370258	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56370258G>T	uc002qmd.3	+	3	1921	c.1499G>T	c.(1498-1500)GGG>GTG	p.G500V	NLRP4_uc002qmf.2_Missense_Mutation_p.G425V|NLRP4_uc010etf.2_Missense_Mutation_p.G331V	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	500							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		ATTTTTTTGGGGTGTTTTCTA	0.408													48	75	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56390162	56390162	+	Missense_Mutation	SNP	T	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56390162T>G	uc002qmd.3	+	9	3121	c.2699T>G	c.(2698-2700)TTG>TGG	p.L900W	NLRP4_uc002qmf.2_Missense_Mutation_p.L825W|NLRP4_uc010etf.2_Missense_Mutation_p.L675W	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	900							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TATTGCAGGTTGGAAGAATGT	0.532													9	18	---	---	---	---	PASS
ZNF8	7554	broad.mit.edu	37	19	58797580	58797580	+	Intron	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58797580C>G	uc002qry.1	+						ZNF8_uc002qrz.2_Intron	NM_021089	NP_066575	P17098	ZNF8_HUMAN	zinc finger protein 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		AGGTGAGAACCCACTATGTGG	0.498													22	13	---	---	---	---	PASS
ESF1	51575	broad.mit.edu	37	20	13756704	13756704	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13756704C>A	uc002woj.2	-	3	958	c.850G>T	c.(850-852)GAG>TAG	p.E284*	ESF1_uc002wok.1_Nonsense_Mutation_p.E284*	NM_016649	NP_057733	Q9H501	ESF1_HUMAN	ABT1-associated protein	284	Asp-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1						tcttcatcctcctcttcatct	0.229													13	30	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16347905	16347905	+	Intron	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16347905G>C	uc002wpg.1	-						KIF16B_uc002wpe.1_Intron|KIF16B_uc002wpf.1_Intron|KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Missense_Mutation_p.F1355L	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						ATGGGGTGGTGAACAACTGGA	0.448													36	83	---	---	---	---	PASS
PCSK2	5126	broad.mit.edu	37	20	17208026	17208026	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17208026G>C	uc002wpm.2	+	1	396	c.76G>C	c.(76-78)GAG>CAG	p.E26Q	PCSK2_uc002wpl.2_Missense_Mutation_p.E7Q|PCSK2_uc010zrm.1_Missense_Mutation_p.E26Q	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	26					enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TGCATCTGCTGAGCGACCGGT	0.527													17	64	---	---	---	---	PASS
SUN5	140732	broad.mit.edu	37	20	31577469	31577469	+	Missense_Mutation	SNP	G	T	T	rs150666576		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31577469G>T	uc002wyi.2	-	9	663	c.570C>A	c.(568-570)CAC>CAA	p.H190Q		NM_080675	NP_542406	Q8TC36	SUN5_HUMAN	sperm associated antigen 4-like	190					spermatogenesis					skin(1)	1						TGTAATCTCCGTGTATCATCT	0.488													14	43	---	---	---	---	PASS
CDK5RAP1	51654	broad.mit.edu	37	20	31967387	31967387	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31967387G>T	uc010gek.2	-	9	1153	c.1029C>A	c.(1027-1029)ACC>ACA	p.T343T	CDK5RAP1_uc002wyy.2_Silent_p.T239T|CDK5RAP1_uc002wyz.2_Silent_p.T329T|CDK5RAP1_uc002wza.2_Silent_p.T329T|CDK5RAP1_uc010gel.2_Silent_p.T238T|CDK5RAP1_uc010gem.2_Intron|CDK5RAP1_uc002wzc.1_Silent_p.T329T	NM_016408	NP_057492	Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	343					brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity			ovary(2)|skin(2)|lung(1)	5						TTTTATAGTTGGTGGTAAAGC	0.463													5	46	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34459591	34459591	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34459591G>T	uc002xek.1	+	9	1233	c.1122G>T	c.(1120-1122)TTG>TTT	p.L374F	PHF20_uc002xei.1_Missense_Mutation_p.L374F|PHF20_uc010gfo.1_Missense_Mutation_p.L374F|PHF20_uc002xej.1_Missense_Mutation_p.L258F	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	374					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					AGTCTGCTTTGGAAGCTGGCC	0.448													6	107	---	---	---	---	PASS
C20orf24	55969	broad.mit.edu	37	20	35240420	35240420	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35240420G>T	uc002xfq.2	+	4	544	c.356G>T	c.(355-357)TGG>TTG	p.W119L	C20orf24_uc002xfo.2_Missense_Mutation_p.W145L|C20orf24_uc002xfp.2_3'UTR|C20orf24_uc002xft.2_RNA|C20orf24_uc002xfr.2_Nonsense_Mutation_p.G76*|C20orf24_uc002xfs.2_Missense_Mutation_p.L128F	NM_018840	NP_061328	Q9BUV8	CT024_HUMAN	RAB5-interacting protein isoform a	119				LFMVCVADSFTTGHLDHLLHCHPL -> IVHGHLLLLFTSH PYSMMVSDSK (in Ref. 6; AAB50849).			protein binding				0	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				TAGGTCATTTGGATCATCTTT	0.463													8	209	---	---	---	---	PASS
C20orf117	140710	broad.mit.edu	37	20	35443568	35443568	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35443568C>A	uc002xgd.1	-	5	1890	c.1563G>T	c.(1561-1563)AAG>AAT	p.K521N	C20orf117_uc002xge.1_RNA	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2	521											0		Myeloproliferative disorder(115;0.00874)				GAAGAATCTCCTTAGAGAGCC	0.463													8	150	---	---	---	---	PASS
TOX2	84969	broad.mit.edu	37	20	42602083	42602083	+	Intron	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42602083C>T	uc002xlf.3	+						TOX2_uc010ggo.2_Intron|TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron|TOX2_uc002xlg.2_Intron	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			GTGGGTGCCTCATCCTCCCTG	0.582													23	33	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43851673	43851673	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43851673C>A	uc010ggz.2	+	2	1457	c.1400C>A	c.(1399-1401)TCA>TAA	p.S467*	SEMG2_uc002xnk.2_Nonsense_Mutation_p.S467*|SEMG2_uc002xnl.2_Intron	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	467	Repeat-rich region.|4 X 60 AA tandem repeats, type I.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				AATAAAATGTCATACCAATCT	0.368													24	37	---	---	---	---	PASS
ZSWIM3	140831	broad.mit.edu	37	20	44505923	44505923	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44505923G>T	uc002xqd.2	+	2	929	c.726G>T	c.(724-726)AAG>AAT	p.K242N	ZSWIM3_uc010zxg.1_Missense_Mutation_p.K236N	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	242							zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)				TGGAGAACAAGGAACGAGAAA	0.527													6	70	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44586512	44586512	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44586512G>C	uc002xqw.2	-	16	2432	c.2309C>G	c.(2308-2310)TCT>TGT	p.S770C	ZNF335_uc010zxk.1_Missense_Mutation_p.S615C	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	770					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				CAGGGTGTCAGAACAGAGCAA	0.597													22	63	---	---	---	---	PASS
SLC13A3	64849	broad.mit.edu	37	20	45192078	45192078	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45192078G>T	uc002xsf.1	-	12	1645	c.1607C>A	c.(1606-1608)TCT>TAT	p.S536Y	SLC13A3_uc010ghn.1_Missense_Mutation_p.S505Y|SLC13A3_uc010zxw.1_Missense_Mutation_p.S486Y|SLC13A3_uc002xsg.1_Missense_Mutation_p.S489Y|SLC13A3_uc010gho.1_Missense_Mutation_p.S454Y|SLC13A3_uc010zxx.1_Missense_Mutation_p.S438Y|SLC13A3_uc002xse.1_Missense_Mutation_p.S27Y|SLC13A3_uc010ghm.1_Missense_Mutation_p.S123Y|SLC13A3_uc010zxv.1_Missense_Mutation_p.S121Y	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a	536	Cytoplasmic (Potential).					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	CAAGTGTCCAGAGGCGAAGGC	0.622													5	38	---	---	---	---	PASS
KCNG1	3755	broad.mit.edu	37	20	49626715	49626715	+	Missense_Mutation	SNP	T	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49626715T>A	uc002xwa.3	-	2	456	c.161A>T	c.(160-162)CAG>CTG	p.Q54L	KCNG1_uc002xwb.2_Missense_Mutation_p.Q54L	NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	54	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						CTGACAGCCCTGGCGGGGCTC	0.706													7	8	---	---	---	---	PASS
RAE1	8480	broad.mit.edu	37	20	55953067	55953067	+	Splice_Site	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55953067A>G	uc002xyg.2	+	12	1362	c.1021_splice	c.e12-2	p.G341_splice	RAE1_uc002xyh.2_Splice_Site_p.G341_splice|RAE1_uc002xyi.2_Splice_Site_p.G341_splice	NM_003610	NP_003601	P78406	RAE1L_HUMAN	RAE1 (RNA export 1, S.pombe) homolog						carbohydrate metabolic process|glucose transport|mRNA export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|cytoskeleton|nuclear outer membrane|nuclear pore	microtubule binding|RNA binding				0	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			TGCTCTCTTTAGGGACATGAA	0.373													11	33	---	---	---	---	PASS
PHACTR3	116154	broad.mit.edu	37	20	58322835	58322835	+	Silent	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58322835C>A	uc002yau.2	+	3	770	c.303C>A	c.(301-303)GGC>GGA	p.G101G	PHACTR3_uc002yat.2_Silent_p.G98G|PHACTR3_uc010zzw.1_Silent_p.G60G|PHACTR3_uc002yav.2_Silent_p.G60G|PHACTR3_uc002yaw.2_Silent_p.G60G|PHACTR3_uc002yax.2_Silent_p.G60G	NM_080672	NP_542403	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	101	RPEL 1.					nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AGATGGCCGGCAGGCAAGGCC	0.607													45	61	---	---	---	---	PASS
TAF4	6874	broad.mit.edu	37	20	60582658	60582658	+	Missense_Mutation	SNP	C	A	A	rs149456775		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60582658C>A	uc002ybs.2	-	6	1919	c.1919G>T	c.(1918-1920)AGG>ATG	p.R640M		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	640	TAFH.				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TCGGTATAACCTGCTTGTGAA	0.438													9	199	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15537643	15537643	+	Missense_Mutation	SNP	A	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15537643A>T	uc002yjm.2	-	6	875	c.865T>A	c.(865-867)TGC>AGC	p.C289S	LIPI_uc010gkw.1_Missense_Mutation_p.C192S	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	268					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		ATAAAATTGCAGTTTGTTTCT	0.353													7	13	---	---	---	---	PASS
RUNX1	861	broad.mit.edu	37	21	36252918	36252918	+	Silent	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36252918G>A	uc002yuh.2	-	2	1941	c.363C>T	c.(361-363)ACC>ACT	p.T121T	RUNX1_uc002yui.2_Silent_p.T121T|RUNX1_uc010gmu.2_Silent_p.T148T|RUNX1_uc010gmv.2_Silent_p.T148T|RUNX1_uc002yuj.3_Silent_p.T16T|RUNX1_uc002yuk.3_Silent_p.T148T|RUNX1_uc002yum.1_Silent_p.T16T|RUNX1_uc010gmw.1_Silent_p.T148T|RUNX1_uc002yuo.1_Silent_p.T121T|RUNX1_uc002yur.1_Silent_p.T16T	NM_001001890	NP_001001890	Q01196	RUNX1_HUMAN	runt-related transcription factor 1 isoform	121	Runt.				myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding	p.L121fs*2(1)|p.A149fs*2(1)		haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						TCATGGCTGCGGTAGCATTTC	0.483			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				7	6	---	---	---	---	PASS
MORC3	23515	broad.mit.edu	37	21	37729032	37729032	+	Intron	SNP	T	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37729032T>G	uc002yvi.2	+							NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3						cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						AGTAAGTACATTTTTAAAACA	0.308													8	2	---	---	---	---	PASS
CCT8L2	150160	broad.mit.edu	37	22	17072852	17072852	+	Missense_Mutation	SNP	T	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17072852T>C	uc002zlp.1	-	1	849	c.589A>G	c.(589-591)AGC>GGC	p.S197G		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	197					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GGCTTGAAGCTGCCGTCTAGT	0.617													12	32	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23135303	23135303	+	RNA	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23135303C>A	uc011aim.1	+	251		c.11945C>A								Parts of antibodies, mostly variable regions.												0						ACTATGTCTCCTGGTACCAAC	0.552													10	331	---	---	---	---	PASS
RFPL2	10739	broad.mit.edu	37	22	32598391	32598391	+	Silent	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32598391G>T	uc003amg.3	-	2	984	c.48C>A	c.(46-48)TCC>TCA	p.S16S	RFPL2_uc003amf.3_5'UTR|RFPL2_uc003amh.3_5'UTR	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2	16							zinc ion binding			skin(1)	1						gacagatcctggattgggaca	0.030													9	23	---	---	---	---	PASS
EIF3L	51386	broad.mit.edu	37	22	38247364	38247364	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38247364A>G	uc003auf.2	+	3	247	c.160A>G	c.(160-162)AAC>GAC	p.N54D	EIF3L_uc003aue.1_Missense_Mutation_p.N54D|EIF3L_uc011ann.1_Missense_Mutation_p.N54D|EIF3L_uc003aug.2_5'UTR	NM_016091	NP_057175	Q9Y262	EIF3L_HUMAN	eukaryotic translation initiation factor 3	54						eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1						GGTGATCAAAAACTTCATCCA	0.433													10	45	---	---	---	---	PASS
L3MBTL2	83746	broad.mit.edu	37	22	41613159	41613159	+	Missense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41613159C>A	uc003azo.2	+	5	607	c.553C>A	c.(553-555)CTG>ATG	p.L185M	L3MBTL2_uc010gyi.1_Missense_Mutation_p.L94M|L3MBTL2_uc003azn.2_RNA|uc003azp.1_RNA	NM_031488	NP_113676	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2	185	MBT 1.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3						GGGGAAGTTCCTGAAGGATCA	0.637													6	83	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42524814	42524814	+	Missense_Mutation	SNP	A	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42524814A>G	uc003bce.2	-	4	728	c.638T>C	c.(637-639)CTG>CCG	p.L213P	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_5'UTR|CYP2D6_uc003bcf.2_Missense_Mutation_p.L162P	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	213							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						CTCCTCCTTCAGTCCCTCCTG	0.672													3	20	---	---	---	---	PASS
ZBED4	9889	broad.mit.edu	37	22	50277561	50277561	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50277561G>T	uc003bix.2	+	2	721	c.251G>T	c.(250-252)GGC>GTC	p.G84V		NM_014838	NP_055653	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	84						cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity			ovary(2)	2		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GATGACTATGGCGCGCTGTTC	0.627													28	57	---	---	---	---	PASS
PIM3	415116	broad.mit.edu	37	22	50356584	50356584	+	Intron	SNP	A	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50356584A>C	uc003bjb.2	+						PIM3_uc011arj.1_Intron	NM_001001852	NP_001001852	Q86V86	PIM3_HUMAN	serine/threonine protein kinase pim-3						cell cycle|negative regulation of apoptosis|regulation of mitotic cell cycle		ATP binding|protein binding|protein serine/threonine kinase activity				0		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		TCCGCTCCGCACAGAGTGCCA	0.706													3	13	---	---	---	---	PASS
RPGR	6103	broad.mit.edu	37	X	38146439	38146439	+	Missense_Mutation	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38146439C>G	uc004ded.1	-	15	1981	c.1813G>C	c.(1813-1815)GAG>CAG	p.E605Q	RPGR_uc004deb.2_Missense_Mutation_p.E605Q|RPGR_uc004dea.2_RNA|RPGR_uc004dec.2_Intron	NM_001034853	NP_001030025	Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator isoform C	605	Glu-rich.				intracellular protein transport|response to stimulus|visual perception	Golgi apparatus|photoreceptor outer segment	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						gcttctacctcttgctcctct	0.204													5	6	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71360443	71360443	+	Silent	SNP	C	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71360443C>G	uc011mqa.1	+	6	3045	c.3045C>G	c.(3043-3045)CTC>CTG	p.L1015L	NHSL2_uc004eak.1_Silent_p.L649L|NHSL2_uc010nli.2_Silent_p.L784L	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2	1015											0	Renal(35;0.156)					ACCTGCCTCTCACTTCTCCCA	0.542													6	11	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177748	89177748	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177748G>T	uc004efe.2	+	2	713	c.664G>T	c.(664-666)GAT>TAT	p.D222Y		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	222						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GCTGCTAGTCGATGCAGCAGT	0.507													13	12	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133967	91133967	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133967G>T	uc004efk.1	+	2	3573	c.2728G>T	c.(2728-2730)GAT>TAT	p.D910Y	PCDH11X_uc004efl.1_Missense_Mutation_p.D910Y|PCDH11X_uc004efo.1_Missense_Mutation_p.D910Y|PCDH11X_uc010nmv.1_Missense_Mutation_p.D910Y|PCDH11X_uc004efm.1_Missense_Mutation_p.D910Y|PCDH11X_uc004efn.1_Missense_Mutation_p.D910Y|PCDH11X_uc004efh.1_Missense_Mutation_p.D910Y|PCDH11X_uc004efj.1_Missense_Mutation_p.D910Y	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	910	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CCTTCCTATTGATCTAGAAGA	0.428													17	14	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100611126	100611126	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100611126G>T	uc004ehg.2	-	15	1673	c.1480C>A	c.(1480-1482)CAG>AAG	p.Q494K	BTK_uc004ehf.2_Intron|BTK_uc010nnh.2_Intron|BTK_uc010nni.2_Intron|BTK_uc004ehe.2_Intron|BTK_uc010nnj.2_RNA|BTK_uc010nnk.2_Intron|BTK_uc010nnl.2_Intron|BTK_uc010nnm.2_Missense_Mutation_p.Q64K|BTK_uc010nnn.2_Intron|BTK_uc010nno.2_Missense_Mutation_p.Q528K|BTK_uc004ehh.1_Intron|BTK_uc004ehi.2_Missense_Mutation_p.Q494K	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	494	Protein kinase.				calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						TGCTGAGTCTGGAAGCGGTGG	0.547									Agammaglobulinemia_X-linked				6	41	---	---	---	---	PASS
IRS4	8471	broad.mit.edu	37	X	107977075	107977075	+	Missense_Mutation	SNP	C	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107977075C>T	uc004eoc.2	-	1	2533	c.2500G>A	c.(2500-2502)GGA>AGA	p.G834R		NM_003604	NP_003595	O14654	IRS4_HUMAN	insulin receptor substrate 4	834						plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity			ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						AGGAACTTTCCAGGTAACATT	0.488													96	71	---	---	---	---	PASS
PAK3	5063	broad.mit.edu	37	X	110439768	110439768	+	Missense_Mutation	SNP	G	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110439768G>C	uc004epa.2	+	13	1379	c.1352G>C	c.(1351-1353)CGA>CCA	p.R451P	PAK3_uc010npt.1_Missense_Mutation_p.R436P|PAK3_uc010npu.1_Missense_Mutation_p.R436P|PAK3_uc004eoy.1_Missense_Mutation_p.R191P|PAK3_uc004eoz.2_Missense_Mutation_p.R436P|PAK3_uc011mst.1_RNA|PAK3_uc010npv.1_Missense_Mutation_p.R472P|PAK3_uc010npw.1_Missense_Mutation_p.R457P	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d	451	Protein kinase.				multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						GTGGTGACTCGAAAAGCTTAT	0.473										TSP Lung(19;0.15)			11	16	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118220998	118220998	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118220998C>A	uc004era.3	-	11	4195	c.4195G>T	c.(4195-4197)GGA>TGA	p.G1399*		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1399										ovary(4)|skin(1)	5						TCATCTCTTCCTAGGAACCAA	0.443													6	86	---	---	---	---	PASS
PHF6	84295	broad.mit.edu	37	X	133512083	133512083	+	Missense_Mutation	SNP	G	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133512083G>T	uc004exj.2	+	3	389	c.187G>T	c.(187-189)GGT>TGT	p.G63C	PHF6_uc004exk.2_Missense_Mutation_p.G63C|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Missense_Mutation_p.G63C|PHF6_uc010nrr.2_Missense_Mutation_p.G63C|PHF6_uc004exi.2_Missense_Mutation_p.G63C	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	63					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TGAAAGTCTTGGTGGATTTTC	0.294													5	25	---	---	---	---	PASS
SRY	6736	broad.mit.edu	37	Y	2655257	2655257	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2655257G>A	uc004fqg.1	-	1	536	c.388C>T	c.(388-390)CGA>TGA	p.R130*		NM_003140	NP_003131	Q05066	SRY_HUMAN	sex determining region Y	130	Sufficient for interaction with EP300.|Required for nuclear localization.|Sufficient for interaction with KPNB1.				cell differentiation|male sex determination|positive regulation of transcription, DNA-dependent|sex differentiation	cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding				0						CGACGAGGTCGATACTTATAA	0.498									Swyer_syndrome				5	1	---	---	---	---	PASS
TP73	7161	broad.mit.edu	37	1	3641583	3641583	+	Intron	DEL	A	-	-	rs79370997		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3641583delA	uc001akp.2	+						TP73_uc001akq.2_Intron|TP73_uc010nzj.1_Intron|TP73_uc001akr.2_Intron|TP73_uc009vlk.1_Intron|TP73_uc001aks.2_Intron|TP73_uc010nzk.1_Intron|TP73_uc010nzl.1_5'Flank	NM_005427	NP_005418	O15350	P73_HUMAN	tumor protein p73 isoform a						cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mismatch repair|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of JUN kinase activity|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|protein tetramerization|response to gamma radiation|response to X-ray	chromatin|cytosol|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|metal ion binding|p53 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|transcription repressor activity			ovary(1)|lung(1)	2	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		actccgtctcaaaaaaaaaaa	0.234													4	2	---	---	---	---	
KIAA0562	9731	broad.mit.edu	37	1	3752869	3752871	+	Intron	DEL	AAA	-	-	rs36013028		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3752869_3752871delAAA	uc001aky.2	-						KIAA0562_uc010nzm.1_Intron|KIAA0562_uc001akz.2_Intron	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,							centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		actccgtctcaaaaaaaaaaaaa	0.167													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	4429641	4429649	+	IGR	DEL	TGGTGATGG	-	-	rs71580263		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4429641_4429649delTGGTGATGG								LOC100133612 (595764 upstream) : LOC284661 (42462 downstream)																							atggtgatgatggtgatggtggtgatggt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	5657676	5657677	+	Intron	INS	-	C	C	rs143432256	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5657676_5657677insC	uc001alp.1	-											Homo sapiens cDNA FLJ43088 fis, clone BRTHA3025826.																		GGAGAGAGAGGCGCTGACAAGA	0.530													4	3	---	---	---	---	
ACOT7	11332	broad.mit.edu	37	1	6417297	6417298	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6417297_6417298insA	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		aactccgcctcaaaaaaaaaaa	0.208													3	4	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7607409	7607410	+	Intron	DEL	CA	-	-	rs35696294		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7607409_7607410delCA	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		gtatcatatGcacacacacaca	0.010													4	2	---	---	---	---	
DFFA	1676	broad.mit.edu	37	1	10527572	10527572	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10527572delT	uc001arj.2	-						DFFA_uc001ark.2_Intron	NM_004401	NP_004392	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		TCttctttcattttttttttt	0.189													5	3	---	---	---	---	
MTOR	2475	broad.mit.edu	37	1	11314203	11314203	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11314203delT	uc001asd.2	-							NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TCAGCTTCAAttttttttttt	0.219													6	3	---	---	---	---	
VPS13D	55187	broad.mit.edu	37	1	12570579	12570580	+	3'UTR	INS	-	TG	TG	rs151053626	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12570579_12570580insTG	uc001atv.2	+	70					VPS13D_uc001atw.2_3'UTR|VPS13D_uc001atx.2_3'UTR|VPS13D_uc009vnl.2_RNA|VPS13D_uc010obd.1_3'UTR	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		gtgtctgtgtctgtgtgtgtgt	0.396													6	4	---	---	---	---	
HNRNPCL1	343069	broad.mit.edu	37	1	12908384	12908385	+	Intron	INS	-	A	A	rs143606605		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12908384_12908385insA	uc010obf.1	-						LOC649330_uc009vno.2_5'Flank	NM_001013631	NP_001013653	O60812	HNRCL_HUMAN	heterogeneous nuclear ribonucleoprotein C-like							ribonucleoprotein complex	nucleotide binding				0						ATTGCATTTAGAAAAAAAATCA	0.356													4	2	---	---	---	---	
LOC440563	440563	broad.mit.edu	37	1	13184079	13184080	+	5'Flank	INS	-	T	T	rs146762683	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13184079_13184080insT	uc010obg.1	-							NM_001136561	NP_001130033	B2RXH8	B2RXH8_HUMAN	heterogeneous nuclear ribonucleoprotein C-like							ribonucleoprotein complex	nucleic acid binding|nucleotide binding				0						GAAAAGCACAACAACATTTTTG	0.342													5	3	---	---	---	---	
EFHD2	79180	broad.mit.edu	37	1	15745345	15745349	+	Intron	DEL	AGCCC	-	-	rs145185336		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15745345_15745349delAGCCC	uc001awh.2	+							NM_024329	NP_077305	Q96C19	EFHD2_HUMAN	EF-hand domain family, member D2							membrane raft					0		Renal(390;0.00145)|Breast(348;0.00173)|Colorectal(325;0.00215)|all_lung(284;0.00366)|Lung NSC(340;0.00395)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)|Hepatocellular(190;0.152)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.59e-07)|COAD - Colon adenocarcinoma(227;3.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000119)|KIRC - Kidney renal clear cell carcinoma(229;0.00251)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		cctggttcagagcccagcgacaccc	0.059													5	3	---	---	---	---	
CTRC	11330	broad.mit.edu	37	1	15772454	15772455	+	Intron	INS	-	ATTT	ATTT	rs150994793	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15772454_15772455insATTT	uc001awi.1	+						CTRC_uc001awj.1_Intron	NM_007272	NP_009203	Q99895	CTRC_HUMAN	chymotrypsin C preproprotein						proteolysis		serine-type endopeptidase activity				0		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ttcactcatgcattcattcatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17015710	17015710	+	IGR	DEL	T	-	-	rs112604834		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17015710delT								MST1P2 (38796 upstream) : ESPNP (2003 downstream)																							acccagctaattttttttttt	0.000													5	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17221879	17221879	+	Intron	DEL	C	-	-	rs67484375		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17221879delC	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TTGCAGTCATCTGAGCAGCCT	0.363													4	2	---	---	---	---	
PADI4	23569	broad.mit.edu	37	1	17637758	17637758	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17637758delA	uc001baj.2	+						PADI4_uc009vpc.2_Intron	NM_012387	NP_036519	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV						chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	actctgtctcaaaaaaaaaaa	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18926614	18926614	+	IGR	DEL	A	-	-	rs11367181		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18926614delA								KLHDC7A (114075 upstream) : PAX7 (30886 downstream)																							CCTCaaaattaaaaaaaaaaa	0.413													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20152171	20152172	+	IGR	INS	-	T	T	rs145180153	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20152171_20152172insT								RNF186 (10400 upstream) : OTUD3 (56716 downstream)																							ttgtccttgtcttttttttttg	0.000													3	3	---	---	---	---	
VWA5B1	127731	broad.mit.edu	37	1	20631073	20631074	+	Intron	DEL	TG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20631073_20631074delTG	uc009vps.2	+						VWA5B1_uc001bdd.2_Intron|VWA5B1_uc010odc.1_Intron	NM_001039500	NP_001034589	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1							extracellular region					0						cgtgcgtgcatgtgtgtgtgtg	0.267													4	2	---	---	---	---	
USP48	84196	broad.mit.edu	37	1	22104635	22104636	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22104635_22104636insA	uc001bfb.2	-						USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfe.1_Intron|USP48_uc001bff.2_Intron	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		gactccgtctgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30923994	30923994	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30923994delG								None (None upstream) : MATN1 (260132 downstream)																							CAGAGGCCCTGGGCAGAACTC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31128558	31128559	+	IGR	INS	-	TGG	TGG	rs150361136	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128558_31128559insTGG								None (None upstream) : MATN1 (55567 downstream)																							ggtggtggtgatggtggtgatg	0.069													7	5	---	---	---	---	
SDC3	9672	broad.mit.edu	37	1	31367508	31367509	+	Intron	INS	-	GA	GA	rs149774413	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31367508_31367509insGA	uc001bse.2	-							NM_014654	NP_055469	O75056	SDC3_HUMAN	syndecan 3							integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		tgtgtgtgggtgagtgtgtgtg	0.054													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33772067	33772067	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33772067delA								ZNF362 (5747 upstream) : PHC2 (17157 downstream)																							GCTCACTGCTAAGCTAAGGGA	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34713058	34713059	+	IGR	DEL	AG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34713058_34713059delAG								C1orf94 (28329 upstream) : MIR552 (422141 downstream)																							agagagaaacagagagagagag	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34993199	34993200	+	IGR	DEL	CT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34993199_34993200delCT								C1orf94 (308470 upstream) : MIR552 (142000 downstream)																							GGCCTTTGCCCTCTCTCTCTCT	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	36140934	36140935	+	IGR	INS	-	T	T	rs665046	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36140934_36140935insT								PSMB2 (33791 upstream) : C1orf216 (38542 downstream)																							ctcaaaaaaaaaTTTTTTAATT	0.178													4	3	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39544860	39544860	+	5'Flank	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39544860delT	uc010ois.1	+						MACF1_uc010oir.1_5'Flank	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATTCTTTGCCTTCGCTTCAGa	0.274													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39687796	39687796	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39687796delA	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc010oit.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTGTAAATTAAAAAAAAAAA	0.184													4	2	---	---	---	---	
HPCAL4	51440	broad.mit.edu	37	1	40149991	40149992	+	Intron	DEL	CC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40149991_40149992delCC	uc001cdr.2	-						HPCAL4_uc010oix.1_Intron	NM_016257	NP_057341	Q9UM19	HPCL4_HUMAN	hippocalcin-like protein 4						central nervous system development	intracellular	calcium ion binding			central_nervous_system(1)	1	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGCCTCGCCTCCCCTCCCACCC	0.757													4	2	---	---	---	---	
KCNQ4	9132	broad.mit.edu	37	1	41256319	41256319	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41256319delA	uc001cgh.1	+						KCNQ4_uc001cgi.1_Intron	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein						sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			CCAGCTCATGAATGGAGCCCA	0.313													4	2	---	---	---	---	
CCDC23	374969	broad.mit.edu	37	1	43272824	43272825	+	3'UTR	INS	-	T	T	rs67367423		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43272824_43272825insT	uc001cib.2	-	3						NM_199342	NP_955374	Q8N300	CCD23_HUMAN	coiled-coil domain containing 23												0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTTTGTGTGTGttttttttttt	0.287													4	2	---	---	---	---	
SLC2A1	6513	broad.mit.edu	37	1	43398095	43398096	+	Intron	INS	-	TTATGCACG	TTATGCACG	rs138624104	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43398095_43398096insTTATGCACG	uc001cik.2	-							NM_006516	NP_006507	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose						carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	GAAACGGCTTCTTATGCACGTA	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	43578430	43578431	+	IGR	DEL	TG	-	-	rs5773799		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43578430_43578431delTG								SLC2A1 (153583 upstream) : FAM183A (35163 downstream)																							catgagccactgtgcctggcca	0.000													3	4	---	---	---	---	
EBNA1BP2	10969	broad.mit.edu	37	1	43699158	43699159	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43699158_43699159insA	uc001cio.2	-							NM_006824	NP_006815	Q99848	EBP2_HUMAN	EBNA1 binding protein 2 isoform 2						ribosome biogenesis	membrane fraction|nucleolus	protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				agactccgtctaaaaaaaaaaa	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	44830071	44830071	+	IGR	DEL	T	-	-	rs77142373		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44830071delT								ERI3 (9132 upstream) : RNF220 (40889 downstream)																							TGACTCTTACTTTTTTTTTTA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	45201472	45201472	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45201472delT								C1orf228 (10209 upstream) : KIF2C (4018 downstream)																							gccCACCttcttttttttttt	0.015													4	3	---	---	---	---	
NASP	4678	broad.mit.edu	37	1	46056354	46056355	+	Intron	INS	-	TT	TT	rs11444638		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46056354_46056355insTT	uc001coi.1	+						NASP_uc010olq.1_Intron|NASP_uc001coh.1_Intron|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Intron	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2						blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					CATAGTGTAACTtttttttttt	0.188													4	2	---	---	---	---	
MOBKL2C	148932	broad.mit.edu	37	1	47083284	47083284	+	5'Flank	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47083284delG	uc001cqf.3	-						MKNK1_uc010omf.1_5'Flank|MOBKL2C_uc001cqe.3_5'Flank	NM_201403	NP_958805	Q70IA8	MOL2C_HUMAN	MOB1, Mps One Binder kinase activator-like 2C								metal ion binding			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					TGCACACCGTGGCCCCCAGGC	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59091427	59091428	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59091427_59091428insA								TACSTD2 (48261 upstream) : MYSM1 (34162 downstream)																							ttgctcagtccaaaacgcatgt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	65541723	65541723	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65541723delT								MIR101-1 (17532 upstream) : AK3L1 (71509 downstream)																							GCACCAGATGTTTCAGAGGCC	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	83256895	83256895	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83256895delA								LPHN2 (798789 upstream) : None (None downstream)																							tcttcataataacctcacact	0.010													4	2	---	---	---	---	
GLMN	11146	broad.mit.edu	37	1	92762672	92762673	+	Intron	INS	-	TT	TT	rs72034203		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92762672_92762673insTT	uc001dor.2	-						RPAP2_uc001dot.2_5'Flank|RPAP2_uc009wdh.2_5'Flank|GLMN_uc009wdg.2_Intron|GLMN_uc001dos.2_Intron	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin						muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		tgtttcttTTCTTTtttttttt	0.005									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				3	3	---	---	---	---	
ABCD3	5825	broad.mit.edu	37	1	94936127	94936127	+	Intron	DEL	T	-	-	rs74328743		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94936127delT	uc001dqn.3	+						ABCD3_uc001dqm.3_Intron|ABCD3_uc010oto.1_Intron|ABCD3_uc010otp.1_Intron|ABCD3_uc009wdr.2_Intron	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		ttggtatgaattttttttttt	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	95555271	95555271	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95555271delG								ALG14 (16764 upstream) : TMEM56 (27623 downstream)																							gagtgcttttgggtgccggca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	105844963	105844964	+	IGR	INS	-	TG	TG	rs138812221	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105844963_105844964insTG								None (None upstream) : None (None downstream)																							tcttatgaaattgtgtgtgtgt	0.000													2	4	---	---	---	---	
SLC6A17	388662	broad.mit.edu	37	1	110694417	110694417	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110694417delT	uc009wfq.2	+							NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17						alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TCCTCTTTCCTTTTTTTTTTT	0.398													4	2	---	---	---	---	
LRIG2	9860	broad.mit.edu	37	1	113625841	113625841	+	Intron	DEL	T	-	-	rs35472831		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113625841delT	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		tactgcacacttttttttttt	0.000													4	3	---	---	---	---	
SYT6	148281	broad.mit.edu	37	1	114665503	114665503	+	Intron	DEL	C	-	-	rs80307303		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114665503delC	uc001eev.2	-							NM_205848	NP_995320	Q5T7P8	SYT6_HUMAN	synaptotagmin VI						acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAAAATTTTCCCCATCAAAG	0.522													4	2	---	---	---	---	
SLC22A15	55356	broad.mit.edu	37	1	116518456	116518457	+	5'Flank	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116518456_116518457insT	uc001egb.3	+						SLC22A15_uc001ega.2_5'Flank	NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15						ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CCCTGCCACGCTTTTTTTTTTT	0.450													3	3	---	---	---	---	
C1orf161	126868	broad.mit.edu	37	1	116657405	116657405	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116657405delA	uc001egc.1	+							NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868												0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GGTAGACCGTAAGGGATGCAG	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	119009074	119009074	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119009074delA								SPAG17 (281226 upstream) : TBX15 (416592 downstream)																							aacaattttgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145037620	145037621	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145037620_145037621insT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		tgttagaaagcttttttttaat	0.005			T	PDGFRB	MPD								8	6	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145045709	145045709	+	Intron	DEL	A	-	-	rs3978574		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145045709delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						gatattgattaaaaaaaaaaa	0.000													4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145112049	145112050	+	Intron	INS	-	GTG	GTG	rs147351886		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145112049_145112050insGTG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						caggctaaagtgtggtggtgtg	0.099													6	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145262809	145262811	+	Intron	DEL	TTC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145262809_145262811delTTC	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TTCCTTTTTTTTCTTTCTTTTTA	0.369													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145683552	145683553	+	Intron	INS	-	AG	AG			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145683552_145683553insAG	uc001emp.3	+						RNF115_uc001eoj.2_Intron|RNF115_uc001eok.2_Intron|RNF115_uc009wiy.2_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CATCTAATGCTGTCTATCTCAT	0.530													4	3	---	---	---	---	
LOC728989	728989	broad.mit.edu	37	1	146492083	146492083	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146492083delA	uc001epd.2	-							NR_024442				SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;												0						ATTAGTTTAGAAAAAAAAAAG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148922065	148922065	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148922065delG								NBPF16 (163754 upstream) : LOC645166 (6221 downstream)																							ATACTGGGGTGGGGGTGTTCC	0.353													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149033769	149033769	+	IGR	DEL	G	-	-	rs76428388		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149033769delG								LOC645166 (80715 upstream) : LOC388692 (245707 downstream)																							atgattacatgtgagtccatt	0.000													4	2	---	---	---	---	
SLC27A3	11000	broad.mit.edu	37	1	153747649	153747649	+	5'Flank	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153747649delG	uc001fcz.2	+						SLC27A3_uc009won.2_5'Flank	NM_024330	NP_077306	Q5K4L6	S27A3_HUMAN	solute carrier family 27 member 3						fatty acid metabolic process	integral to membrane|mitochondrial membrane	ligase activity|nucleotide binding			ovary(1)	1	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTGGGATTCAGGGAAGGCGCG	0.647													4	2	---	---	---	---	
TMEM79	84283	broad.mit.edu	37	1	156262168	156262175	+	3'UTR	DEL	GTGTGTGT	-	-	rs142199776		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156262168_156262175delGTGTGTGT	uc010phi.1	+	4					TMEM79_uc001fod.2_3'UTR|TMEM79_uc009wrw.2_3'UTR|C1orf85_uc001fof.3_Intron|C1orf85_uc001fog.1_Intron	NM_032323	NP_115699	Q9BSE2	TMM79_HUMAN	transmembrane protein 79							integral to membrane				central_nervous_system(1)	1	Hepatocellular(266;0.158)					TGTTAACCTAgtgtgtgtgtgtgtgtgt	0.394													4	2	---	---	---	---	
RHBG	57127	broad.mit.edu	37	1	156350044	156350044	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156350044delG	uc010pho.1	+						RHBG_uc010phm.1_Intron|RHBG_uc010phn.1_Intron|RHBG_uc001fos.2_Intron|RHBG_uc009wrz.2_Intron|RHBG_uc001for.2_Intron	NM_020407	NP_065140	Q9H310	RHBG_HUMAN	Rhesus blood group, B glycoprotein						transepithelial ammonium transport	anchored to plasma membrane|basolateral plasma membrane|cytoplasmic vesicle membrane|integral to plasma membrane|spectrin-associated cytoskeleton	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			ovary(2)	2	Hepatocellular(266;0.158)					tgggattacaggagtgtgcca	0.000													4	2	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157787751	157787751	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157787751delC	uc001frg.2	-						FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			tgaaatattaccccataccta	0.000													4	2	---	---	---	---	
CCDC19	25790	broad.mit.edu	37	1	159891161	159891163	+	Intron	DEL	AAC	-	-	rs72007288		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159891161_159891163delAAC	uc001ful.2	-						TAGLN2_uc001fum.1_5'Flank|TAGLN2_uc001fun.1_Intron|TAGLN2_uc001fuo.1_Intron|TAGLN2_uc010piy.1_Intron	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1							mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			tgggagaagtaacaacaacaaca	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	167180179	167180179	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167180179delT								DUSP27 (81777 upstream) : POU2F1 (9964 downstream)																							tgttttttggttttttttttt	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	167385485	167385485	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167385485delA								POU2F1 (143 upstream) : CD247 (14393 downstream)																							TTTTTTTCTTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
RABGAP1L	9910	broad.mit.edu	37	1	174164792	174164792	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174164792delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						ccttccttcctttcctttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	175189446	175189449	+	IGR	DEL	CACC	-	-	rs112688417		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175189446_175189449delCACC								KIAA0040 (27217 upstream) : TNR (102486 downstream)																							cacacacacacacCCCTGCTtctg	0.127													4	2	---	---	---	---	
FAM5B	57795	broad.mit.edu	37	1	177139530	177139531	+	5'Flank	DEL	GT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177139530_177139531delGT	uc001glf.2	+							NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GGTCTCTGGGgtgtgtgtgtgt	0.356													4	2	---	---	---	---	
RALGPS2	55103	broad.mit.edu	37	1	178721269	178721269	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178721269delT	uc001glz.2	+						RALGPS2_uc001gly.1_Intron|RALGPS2_uc010pnb.1_Intron	NM_152663	NP_689876	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0						TGTGTAGTAAttttttttttt	0.174													4	2	---	---	---	---	
CEP350	9857	broad.mit.edu	37	1	179961369	179961369	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179961369delA	uc001gnt.2	+						CEP350_uc001gnr.1_Intron|CEP350_uc009wxl.2_Intron	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350							centrosome|nucleus|spindle				ovary(4)	4						TAGTATTGAGAAAAAAAAAAG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189482937	189482937	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189482937delA								None (None upstream) : FAM5C (583860 downstream)																							ctattaaaagaaaagcaagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	190865245	190865246	+	IGR	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190865245_190865246delTC								FAM5C (418486 upstream) : None (None downstream)																							tctctctctgtctctgtctgtc	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	195898838	195898838	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195898838delT								None (None upstream) : KCNT2 (296075 downstream)																							tggaatagtatttttttcaca	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	202081360	202081360	+	IGR	DEL	G	-	-	rs35189904		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202081360delG								ELF3 (95054 upstream) : GPR37L1 (10669 downstream)																							Agccggtcgtgggtggctcat	0.035													4	2	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202236026	202236027	+	Intron	INS	-	CG	CG	rs146385093	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202236026_202236027insCG	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						tctctctctaacgcgcgcacac	0.000													3	3	---	---	---	---	
PPFIA4	8497	broad.mit.edu	37	1	203000642	203000643	+	5'Flank	INS	-	T	T	rs142845847	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203000642_203000643insT	uc009xaj.2	+									O75335	LIPA4_HUMAN	SubName: Full=Liprin alpha4;						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						ACTAATGCACATTTTTTATGAT	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203498670	203498670	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203498670delT								OPTC (20593 upstream) : ATP2B4 (97258 downstream)																							GTTTCCTTGCTGCCCCCATGC	0.602													3	3	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203773280	203773280	+	Intron	DEL	G	-	-	rs66529830		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203773280delG	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ctgtatatgtgtttttttttt	0.000													4	3	---	---	---	---	
RASSF5	83593	broad.mit.edu	37	1	206679137	206679137	+	5'Flank	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206679137delG	uc001hed.2	+						RASSF5_uc001hec.1_5'Flank|RASSF5_uc001hee.2_5'Flank	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			GGAGAGGGAAGAGGAAAGGTA	0.373													4	2	---	---	---	---	
HHAT	55733	broad.mit.edu	37	1	210827438	210827439	+	Intron	INS	-	TA	TA			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210827438_210827439insTA	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_Intron	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TAGTGTGACAGGAATAGTGTGA	0.450													4	3	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217308784	217308784	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217308784delG	uc001hlc.1	-						ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AGAAATCAAAGGGGGAGGAGG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222607112	222607112	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222607112delA								DUSP10 (691651 upstream) : HHIPL2 (88490 downstream)																							tggtagaggcaaaccagcttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223220745	223220746	+	IGR	INS	-	AGTC	AGTC	rs138535020	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223220745_223220746insAGTC								DISP1 (41410 upstream) : TLR5 (62838 downstream)																							GGACTtgtattagggttctcca	0.238													3	3	---	---	---	---	
WDR26	80232	broad.mit.edu	37	1	224586837	224586837	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224586837delT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc010pvh.1_Intron	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		TAGTAACAGGTTTTTTTTTTT	0.294													4	2	---	---	---	---	
CNIH3	149111	broad.mit.edu	37	1	224841616	224841617	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224841616_224841617insT	uc001hos.1	+							NM_152495	NP_689708	Q8TBE1	CNIH3_HUMAN	cornichon homolog 3						intracellular signal transduction|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic shaft|postsynaptic membrane					0	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		ccctgtctctattaaaaaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225861449	225861449	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225861449delC								ENAH (20604 upstream) : SRP9 (104066 downstream)																							ACAATATCCTCCCCAAGCATT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225873431	225873432	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225873431_225873432insA								ENAH (32586 upstream) : SRP9 (92083 downstream)																							gaccctgtctcaaaaaaaaaTT	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225890516	225890519	+	Intron	DEL	TTTT	-	-	rs112105705		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225890516_225890519delTTTT	uc001hpe.1	+											Homo sapiens cDNA FLJ42062 fis, clone SYNOV2005673.																		cagctaattctttttttttttttt	0.000													4	2	---	---	---	---	
C1orf95	375057	broad.mit.edu	37	1	226777789	226777789	+	Intron	DEL	C	-	-	rs11366807		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226777789delC	uc010pvn.1	+							NM_001003665	NP_001003665	Q69YW2	CA095_HUMAN	hypothetical protein LOC375057							integral to membrane				ovary(1)	1	Breast(184;0.133)	Prostate(94;0.0885)		GBM - Glioblastoma multiforme(131;0.113)		TGGATCCCTTCCCCCCACCAT	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228261885	228261885	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228261885delT								WNT3A (12924 upstream) : ARF1 (8476 downstream)																							CCTGGCATAGTCCCACCCACC	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230176274	230176274	+	IGR	DEL	T	-	-	rs35257435		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230176274delT								URB2 (380328 upstream) : GALNT2 (17262 downstream)																							actgaatgtctttttttctgt	0.000													3	4	---	---	---	---	
PGBD5	79605	broad.mit.edu	37	1	230497139	230497139	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230497139delA	uc010pwb.1	-						PGBD5_uc001htv.2_Intron	NM_024554	NP_078830	Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GGCTAGGATGAAGGGTTGTGC	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232492722	232492722	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232492722delT								DISC1 (315706 upstream) : SIPA1L2 (40992 downstream)																							gccatatctgttttcattctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234922359	234922360	+	IGR	DEL	TT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234922359_234922360delTT								IRF2BP2 (177088 upstream) : TOMM20 (350300 downstream)																							tgtagttaacttttttttttta	0.000													4	4	---	---	---	---	
HEATR1	55127	broad.mit.edu	37	1	236760425	236760426	+	Intron	INS	-	AA	AA	rs66463182		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236760425_236760426insAA	uc001hyd.1	-							NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			tccatgtctccaaaaaaaaaaa	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242949751	242949752	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242949751_242949752insA								PLD5 (261753 upstream) : CEP170 (337979 downstream)																							actaaaaatacaaaaattagcc	0.000													4	2	---	---	---	---	
C1orf100	200159	broad.mit.edu	37	1	244542155	244542157	+	Intron	DEL	GGA	-	-	rs67899905		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244542155_244542157delGGA	uc001iah.2	+						C1orf100_uc001iai.2_Intron	NM_001012970	NP_001012988	Q5SVJ3	CA100_HUMAN	hypothetical protein LOC200159												0	all_cancers(71;3.94e-05)|all_epithelial(71;0.000138)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|all_lung(81;0.0736)|Ovarian(71;0.0761)|Lung NSC(105;0.103)		all cancers(7;8.19e-08)|GBM - Glioblastoma multiforme(7;2.05e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.000984)			GAGACTTCAGGGAGGATGGAAAT	0.399													4	2	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246586598	246586599	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246586598_246586599insA	uc001ibl.2	-							NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		gactccaactcaaaaaaaaaaa	0.074													4	2	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246594518	246594519	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246594518_246594519insA	uc001ibl.2	-							NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		GTATCTTAATCAAAAAAAAGAA	0.277													4	2	---	---	---	---	
C1orf150	148823	broad.mit.edu	37	1	247727037	247727037	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247727037delG	uc001idf.2	+						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823												0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			ATAACAGATTGGAGAAGAGGC	0.313													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	640987	640990	+	IGR	DEL	ACAT	-	-	rs151199583		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:640987_640990delACAT								FAM150B (352679 upstream) : TMEM18 (26985 downstream)																							acatgcacacacatacacactttt	0.044													4	3	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	1073995	1073995	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1073995delG	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		tagggagaaagataaagctgg	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2956242	2956245	+	Intron	DEL	CACA	-	-	rs72061924		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2956242_2956245delCACA	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																		cacgcacatgcacacacacacaca	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4852360	4852361	+	IGR	INS	-	A	A	rs138612410		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4852360_4852361insA								None (None upstream) : SOX11 (980438 downstream)																							aaaaaacacacacaaaaaaaac	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8669572	8669572	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8669572delC								LOC339788 (552595 upstream) : ID2 (149768 downstream)																							TGCCTTCTTTCCTGGGGAGGC	0.348													4	2	---	---	---	---	
HPCAL1	3241	broad.mit.edu	37	2	10524151	10524152	+	Intron	INS	-	CACACC	CACACC			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10524151_10524152insCACACC	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron|HPCAL1_uc010exf.2_Intron	NM_002149	NP_002140	P37235	HPCL1_HUMAN	hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)		GTacacacacacacccacacac	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11121262	11121262	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11121262delT								KCNF1 (66912 upstream) : C2orf50 (151917 downstream)																							cacctggggcttttaaaactc	0.194													4	2	---	---	---	---	
GREB1	9687	broad.mit.edu	37	2	11776918	11776923	+	Intron	DEL	GGGCAG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11776918_11776923delGGGCAG	uc002rbk.1	+						GREB1_uc002rbp.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		gcacgggcatgggcaggggcagaggc	0.068													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12948291	12948291	+	IGR	DEL	T	-	-	rs67656155		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12948291delT								TRIB2 (65435 upstream) : None (None downstream)																							CAAGAAATTCTTTTAGTTCAT	0.279													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16582032	16582032	+	IGR	DEL	A	-	-	rs67785176		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16582032delA								MYCN (494904 upstream) : FAM49A (151869 downstream)																							TTGCAGTGACAGGGGGTGGCG	0.398													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16676295	16676296	+	IGR	INS	-	GA	GA			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16676295_16676296insGA								MYCN (589167 upstream) : FAM49A (57605 downstream)																							CTCAAACGAGGGAGAGTGAGGT	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20070615	20070616	+	Intron	DEL	AC	-	-	rs138765081		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20070615_20070616delAC	uc002rdd.1	+						uc002rde.1_Intron|uc002rdf.2_Intron					Homo sapiens cDNA FLJ12334 fis, clone MAMMA1002209.																		tagattagatacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	22342600	22342600	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22342600delC								None (None upstream) : None (None downstream)																							tttgttaattcatttaaagcc	0.000													4	2	---	---	---	---	
KIF3C	3797	broad.mit.edu	37	2	26192594	26192594	+	Intron	DEL	T	-	-	rs112949241		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26192594delT	uc002rgu.2	-						KIF3C_uc010eyj.1_Intron|KIF3C_uc010ykr.1_Intron	NM_002254	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C						blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGGtttttgttttttttttt	0.119													4	2	---	---	---	---	
RASGRP3	25780	broad.mit.edu	37	2	33694529	33694530	+	Intron	INS	-	T	T	rs113071930		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33694529_33694530insT	uc002rox.2	+						RASGRP3_uc002row.1_Intron	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and						MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					TTTGTATGTGAttttttttttt	0.134													3	3	---	---	---	---	
SLC8A1	6546	broad.mit.edu	37	2	40402646	40402647	+	Intron	INS	-	TG	TG	rs146364894	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40402646_40402647insTG	uc002rrx.2	-						uc002rrw.2_Intron|SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	acatacgtatatgtgtgtgtgt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	48141065	48141065	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48141065delT								FBXO11 (8251 upstream) : FOXN2 (400730 downstream)																							GCTTTGATGAttttttttttc	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	53645355	53645355	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53645355delC								None (None upstream) : ASB3 (251763 downstream)																							gtactgctttccgcaatggct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	56338982	56338982	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56338982delA	uc002rzk.2	+											Homo sapiens, clone IMAGE:3873411, mRNA.																		gtctcaaaagaaaaaaaaaaa	0.100													4	2	---	---	---	---	
FANCL	55120	broad.mit.edu	37	2	58454799	58454800	+	Intron	DEL	TG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58454799_58454800delTG	uc002rzw.3	-						FANCL_uc002rzx.3_Intron|FANCL_uc010fce.2_Intron|FANCL_uc010fcf.1_Intron	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform						DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						tccagccacttgtgtgtgtgtg	0.000								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64505175	64505175	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64505175delC								PELI1 (133570 upstream) : HSPC159 (176152 downstream)																							ccctttttttcttccttttac	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	66817148	66817148	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66817148delT								MEIS1 (17258 upstream) : ETAA1 (807294 downstream)																							GGACAGACAATAAGCCACAAA	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	70367031	70367032	+	IGR	INS	-	T	T	rs67316353		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70367031_70367032insT								LOC100133985 (14583 upstream) : C2orf42 (9987 downstream)																							ACTCGtttttgttttttttttt	0.094													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71118846	71118847	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71118846_71118847delAC								CD207 (55893 upstream) : VAX2 (8873 downstream)																							CGacacacaaacacacacacac	0.465													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73954658	73954659	+	IGR	DEL	AC	-	-	rs56126707		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73954658_73954659delAC								NAT8B (26191 upstream) : TPRKB (2298 downstream)																							ataataaaaaacaaaacaaaac	0.045													4	3	---	---	---	---	
BOLA3	388962	broad.mit.edu	37	2	74364158	74364158	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74364158delA	uc002skc.1	-						BOLA3_uc002skd.1_Intron	NM_212552	NP_997717	Q53S33	BOLA3_HUMAN	bolA-like 3 isoform 1							extracellular region					0						CTTTTATACTAGGCCAAAATC	0.393													2	4	---	---	---	---	
TCF7L1	83439	broad.mit.edu	37	2	85490442	85490443	+	Intron	INS	-	G	G	rs142307693	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85490442_85490443insG	uc002soy.2	+							NM_031283	NP_112573	Q9HCS4	TF7L1_HUMAN	HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3						GGTAGGGTGGAGGGGGGGAAGT	0.554													4	3	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87069713	87069714	+	Intron	INS	-	T	T	rs149970450	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87069713_87069714insT	uc002srs.3	+						CD8B_uc002srw.2_Intron|CD8B_uc002srx.2_Intron|CD8B_uc002sry.2_Intron|CD8B_uc010fgt.2_Intron|CD8B_uc002srz.2_Intron|CD8B_uc002ssa.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						atctaagagaatcacaaattta	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89868506	89868515	+	IGR	DEL	CTTGGGTTGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89868506_89868515delCTTGGGTTGA								FLJ40330 (762381 upstream) : None (None downstream)																							ttccatttcgcttgggttgattccattcca	0.000													4	2	---	---	---	---	
FER1L5	90342	broad.mit.edu	37	2	97329243	97329243	+	Frame_Shift_Del	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97329243delA	uc010fia.2	+	13	1088	c.1088delA	c.(1087-1089)CAGfs	p.Q363fs		NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	363	C2 3.					integral to membrane				ovary(1)	1						TTCCGGATTCAGGTATGGCTC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	100822146	100822146	+	5'Flank	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100822146delA	uc002taj.1	+											Homo sapiens cDNA FLJ32078 fis, clone OCBBF1000192.																		GACAGCAAATAAGAAACCTAG	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103732330	103732331	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103732330_103732331delAC								TMEM182 (298194 upstream) : None (None downstream)																							TTGAATacaaacacacacacac	0.302													3	3	---	---	---	---	
FBLN7	129804	broad.mit.edu	37	2	112909344	112909344	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112909344delG	uc002tho.1	+						FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Intron|FBLN7_uc010fkj.1_Intron	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1						cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2						TGTGTACCTAGGAGGGGATTG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114132522	114132522	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114132522delG								PAX8 (96024 upstream) : CBWD2 (62746 downstream)																							ttacagtcatgggggagggca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	119574835	119574836	+	IGR	INS	-	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119574835_119574836insC								INSIG2 (707239 upstream) : EN1 (24912 downstream)																							tccctgcctttgcacatgctgt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121339122	121339122	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121339122delT								LOC84931 (115197 upstream) : GLI2 (154077 downstream)																							gttcaattgctggtgcaaccc	0.000													4	2	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121680673	121680674	+	Intron	INS	-	AC	AC			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121680673_121680674insAC	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				cacagcaacatacacaccatat	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	126557290	126557291	+	IGR	INS	-	CAG	CAG	rs140128028	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126557290_126557291insCAG								CNTNAP5 (884429 upstream) : GYPC (856393 downstream)																							tgcatcaatatcagcagcagca	0.000													4	3	---	---	---	---	
MYO7B	4648	broad.mit.edu	37	2	128333776	128333776	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128333776delA	uc002top.2	+							NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		cttctctcggaaaaaaaaaaa	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	129506015	129506016	+	IGR	DEL	GT	-	-	rs71903052		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129506015_129506016delGT								HS6ST1 (429844 upstream) : None (None downstream)																							ACAAGTAGGGgtgtgtgtgtgt	0.391													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130725823	130725823	+	RNA	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130725823delG	uc002tpw.1	-	6		c.802delC								Homo sapiens cDNA FLJ41458 fis, clone BRSTN2014490.																		GCAAGCTTGTGGACATCCTCA	0.458													17	9	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133012034	133012035	+	Intron	INS	-	G	G	rs111573516		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133012034_133012035insG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						gctgacccagcgggctgatccg	0.000													4	3	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133012634	133012635	+	Intron	INS	-	TT	TT	rs140113063		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133012634_133012635insTT	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						aacccaaagactggtttcttgg	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133022610	133022611	+	IGR	INS	-	AAAC	AAAC			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133022610_133022611insAAAC								NCRNA00164 (7068 upstream) : GPR39 (151536 downstream)																							ctccctctcagaaacaaaCACA	0.223													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133026488	133026488	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133026488delG								NCRNA00164 (10946 upstream) : GPR39 (147659 downstream)																							agcctcccaagtagctggcat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133055010	133055011	+	IGR	INS	-	T	T	rs139949484	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133055010_133055011insT								NCRNA00164 (39468 upstream) : GPR39 (119136 downstream)																							TAATGGATGCAATTGCTGAAGG	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134765657	134765672	+	IGR	DEL	AGGAAGGAAGGAAGGA	-	-	rs67928694	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134765657_134765672delAGGAAGGAAGGAAGGA								NCKAP5 (439626 upstream) : MGAT5 (246158 downstream)																							ggagggagggaggaaggaaggaaggaaggaaggaag	0.097													6	4	---	---	---	---	
SPOPL	339745	broad.mit.edu	37	2	139302559	139302559	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139302559delC	uc002tvh.2	+							NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like							nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		cttcttccttcccacggtttt	0.000													4	2	---	---	---	---	
GTDC1	79712	broad.mit.edu	37	2	144861120	144861120	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144861120delA	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron|GTDC1_uc002tvt.1_Intron	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		AAAACTGGTTAGTGAGGGCTA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	151369863	151369863	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151369863delA								RND3 (25683 upstream) : RBM43 (734866 downstream)																							gaagtcaaagaaggacagctg	0.144													4	2	---	---	---	---	
PKP4	8502	broad.mit.edu	37	2	159515008	159515008	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159515008delT	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron|PKP4_uc002uaa.2_Intron|uc002uab.1_RNA	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						ACTTGTGGCCTTAAAGAAGTT	0.358										HNSCC(62;0.18)			4	2	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	160072419	160072421	+	Intron	DEL	ATG	-	-	rs112978217		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160072419_160072421delATG	uc002uag.2	+						TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc010fon.2_Intron	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						aagcttgctaatgatgatgatga	0.000													4	2	---	---	---	---	
PDK1	5163	broad.mit.edu	37	2	173489412	173489412	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173489412delA	uc010zea.1	+							NM_002610		Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase 1 precursor						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|small GTPase mediated signal transduction	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(3)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.12)			aatggagaggaaggcagagct	0.045									Autosomal_Dominant_Polycystic_Kidney_Disease				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174602618	174602619	+	IGR	INS	-	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174602618_174602619insG								CDCA7 (368900 upstream) : SP3 (170640 downstream)																							gaagataggaagaaataaggaa	0.000													3	3	---	---	---	---	
OSBPL6	114880	broad.mit.edu	37	2	179060986	179060986	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179060986delT	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			GATTGGTGGATTTTATTATTA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	187386725	187386725	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187386725delC								ZC3H15 (12640 upstream) : ITGAV (68065 downstream)																							tcctgctcatcccctgggcaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	191671254	191671254	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191671254delA								NAB1 (113763 upstream) : GLS (74293 downstream)																							GGTGAAGAGCAAAAAAAATTA	0.373													4	2	---	---	---	---	
C2orf69	205327	broad.mit.edu	37	2	200778356	200778357	+	Intron	DEL	GA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200778356_200778357delGA	uc010zhb.1	+							NM_153689	NP_710156	Q8N8R5	CB069_HUMAN	hypothetical protein LOC205327 precursor							extracellular region				central_nervous_system(1)	1						ATAAAAACTGGAGAAAAAAAAA	0.248													4	2	---	---	---	---	
BMPR2	659	broad.mit.edu	37	2	203286034	203286035	+	Intron	DEL	AA	-	-	rs35984037		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203286034_203286035delAA	uc002uzf.3	+						BMPR2_uc010ftr.2_Intron|BMPR2_uc002uze.2_Intron	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II						anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						CTCCAAAAGGAAAAAAAAAAAA	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204639792	204639793	+	IGR	DEL	AG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204639792_204639793delAG								CD28 (37236 upstream) : CTLA4 (92716 downstream)																							gacactaaaaagagagagtcac	0.149													4	2	---	---	---	---	
KLF7	8609	broad.mit.edu	37	2	208008805	208008805	+	Intron	DEL	T	-	-	rs35011297		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208008805delT	uc002vbz.1	-						KLF7_uc002vca.1_Intron	NM_003709	NP_003700	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			central_nervous_system(1)|skin(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		AGGCAACTGCTTGTGTAAGCG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	209714048	209714048	+	IGR	DEL	G	-	-	rs66734329		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209714048delG								PTH2R (9230 upstream) : MAP2 (574723 downstream)																							gtgagctaccgcgcccggccG	0.025													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216726564	216726567	+	IGR	DEL	CCTT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216726564_216726567delCCTT								FN1 (425773 upstream) : MREG (80748 downstream)																							cctttccttcccttccttccttcc	0.010													4	2	---	---	---	---	
PLCD4	84812	broad.mit.edu	37	2	219482318	219482318	+	Intron	DEL	A	-	-	rs74432522		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219482318delA	uc002vij.1	+						PLCD4_uc010zkj.1_Intron	NM_032726	NP_116115	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4						intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)	3		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		aaaataaaacaaaaaaaaaaT	0.159													4	2	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224858248	224858251	+	Intron	DEL	TGTG	-	-	rs140305794		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224858248_224858251delTGTG	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CTCAAATATAtgtgtgtgtgtgtg	0.235													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	225310757	225310758	+	IGR	INS	-	T	T	rs147040465	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225310757_225310758insT								FAM124B (44046 upstream) : CUL3 (24111 downstream)																							cttcctctctctttttttctct	0.010													4	2	---	---	---	---	
IRS1	3667	broad.mit.edu	37	2	227631736	227631736	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227631736delA	uc002voh.3	-							NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1						fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		AAATCAAGTTAAAAAAAAAAA	0.313													4	3	---	---	---	---	
CAB39	51719	broad.mit.edu	37	2	231659558	231659559	+	Intron	INS	-	C	C	rs150356278	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231659558_231659559insC	uc002vqx.2	+						CAB39_uc010fxr.2_Intron|CAB39_uc010fxq.2_Intron	NM_016289	NP_057373	Q9Y376	CAB39_HUMAN	calcium binding protein 39						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		acatgacatcactcagtatgca	0.000													4	2	---	---	---	---	
SPATA3	130560	broad.mit.edu	37	2	231869879	231869881	+	Intron	DEL	CAT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231869879_231869881delCAT	uc010zmd.1	+						SPATA3_uc002vri.3_Intron|SPATA3_uc002vrk.2_Intron	NM_139073	NP_620712	Q8NHX4	SPTA3_HUMAN	testis and spermatogenesis cell apoptosis						apoptosis|spermatogenesis						0						tcaccatcaccatcatcaccatc	0.000													4	2	---	---	---	---	
ARMC9	80210	broad.mit.edu	37	2	232079361	232079361	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232079361delG	uc002vrq.3	+						ARMC9_uc002vrp.3_Intron	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9								binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GCAAAGGTGTGGGAAACCAGG	0.433													4	2	---	---	---	---	
INPP5D	3635	broad.mit.edu	37	2	234085451	234085454	+	Intron	DEL	TGGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234085451_234085454delTGGA	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		ggtgggtaggtggatggatggatg	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237709970	237709971	+	IGR	INS	-	G	G	rs142501061	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237709970_237709971insG								CXCR7 (218978 upstream) : COPS8 (284113 downstream)																							acatatattttggggaacataa	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	238823122	238823123	+	IGR	DEL	GC	-	-	rs61254193		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238823122_238823123delGC								RAMP1 (2369 upstream) : UBE2F (52577 downstream)																							gtgtgtgtgtgcgcgcgcgtgt	0.203													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239643796	239643797	+	IGR	DEL	AT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239643796_239643797delAT								ASB1 (282906 upstream) : TWIST2 (112876 downstream)																							ttcttgacacatgttatttact	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239675873	239675873	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239675873delG								ASB1 (314983 upstream) : TWIST2 (80800 downstream)																							CACATTGATTGCTCCTCTGTT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241119321	241119321	+	IGR	DEL	A	-	-	rs72252302		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241119321delA								OTOS (39248 upstream) : GPC1 (255794 downstream)																							GAGATTTATGAAAAAGCTGTT	0.453													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241248401	241248402	+	IGR	DEL	TG	-	-	rs151325053		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241248401_241248402delTG								OTOS (168328 upstream) : GPC1 (126713 downstream)																							tgtgtgtgcctgtgtgtgtgtg	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241592742	241592743	+	IGR	DEL	AG	-	-	rs61480584		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241592742_241592743delAG								GPR35 (22067 upstream) : AQP12B (23093 downstream)																							aaaaaaaaaaagaaagaaagaa	0.059													4	2	---	---	---	---	
C3orf32	51066	broad.mit.edu	37	3	8712354	8712354	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8712354delA	uc003bqz.2	-						C3orf32_uc003bqx.2_Intron|C3orf32_uc003bqy.2_Intron	NM_015931	NP_057015	Q9Y2M2	CC032_HUMAN	hypothetical protein LOC51066											skin(1)	1						atcatatcagagggtgtacat	0.000													4	2	---	---	---	---	
SRGAP3	9901	broad.mit.edu	37	3	9151654	9151654	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9151654delT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GGAAAGGGCCTTTAACTCTCA	0.274			T	RAF1	pilocytic astrocytoma								4	2	---	---	---	---	
FBLN2	2199	broad.mit.edu	37	3	13670820	13670820	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13670820delG	uc011avb.1	+						FBLN2_uc011auz.1_Intron|FBLN2_uc011ava.1_Intron|FBLN2_uc011avc.1_Intron	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CAGGACCCCTGGGGAACACCT	0.662													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14359958	14359959	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14359958_14359959insT								LSM3 (120122 upstream) : SLC6A6 (84147 downstream)																							TGCTGCTTTTCTTTTTTTCCTG	0.426													4	2	---	---	---	---	
GADL1	339896	broad.mit.edu	37	3	30803213	30803214	+	Intron	INS	-	AG	AG	rs139745557	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30803213_30803214insAG	uc003cep.2	-							NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	GGGAAGTAGACAAAGTAACATC	0.342													4	2	---	---	---	---	
OXSR1	9943	broad.mit.edu	37	3	38207437	38207437	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38207437delG	uc003chy.2	+	1	412	c.70delG	c.(70-72)GGGfs	p.G24fs	OXSR1_uc010hhb.2_5'UTR|OXSR1_uc010hha.1_5'UTR	NM_005109	NP_005100	O95747	OXSR1_HUMAN	oxidative-stress responsive 1	24	Protein kinase.|ATP (By similarity).				intracellular protein kinase cascade|response to oxidative stress		ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GGAGGTGATCGGTGAGAGCAG	0.716													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	43948398	43948398	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43948398delA								ABHD5 (184182 upstream) : MIR138-1 (207306 downstream)																							ctagagtgacaaaaggagaaa	0.000													4	2	---	---	---	---	
SLC6A20	54716	broad.mit.edu	37	3	45824151	45824154	+	Intron	DEL	CCAA	-	-	rs78047736		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45824151_45824154delCCAA	uc011bai.1	-						SLC6A20_uc011baj.1_Intron	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1						cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		atccatccatccaaccatccatcc	0.074													4	5	---	---	---	---	
CHDH	55349	broad.mit.edu	37	3	53865980	53865980	+	Intron	DEL	A	-	-	rs113683840		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53865980delA	uc003dgz.2	-							NM_018397	NP_060867	Q8NE62	CHDH_HUMAN	choline dehydrogenase precursor						alcohol metabolic process		choline dehydrogenase activity|flavin adenine dinucleotide binding			ovary(1)|central_nervous_system(1)	2		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	actccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SYNPR	132204	broad.mit.edu	37	3	63341380	63341381	+	Intron	INS	-	C	C	rs145600863	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63341380_63341381insC	uc003dlp.2	+						SYNPR_uc011bfk.1_Intron|SYNPR_uc011bfl.1_Intron	NM_001130003	NP_001123475	Q8TBG9	SYNPR_HUMAN	synaptoporin isoform 1							cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	transporter activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		cagtactctggcccccccagcc	0.069													2	4	---	---	---	---	
FOXP1	27086	broad.mit.edu	37	3	71495697	71495698	+	Intron	INS	-	A	A	rs142468658	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71495697_71495698insA	uc003dop.2	-						FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GCCACACACTGAAAAAAAAAAT	0.470			T	PAX5	ALL								3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99094887	99094888	+	IGR	DEL	AC	-	-	rs63649062		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99094887_99094888delAC								DCBLD2 (474354 upstream) : COL8A1 (262566 downstream)																							atacacacagacacacacacac	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	102386091	102386091	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102386091delC								ZPLD1 (187406 upstream) : None (None downstream)																							GCCTCCTCCTCCCTCAAGACC	0.418													2	5	---	---	---	---	
WDR52	55779	broad.mit.edu	37	3	113020789	113020789	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113020789delC	uc003ead.1	-						WDR52_uc010hqj.1_Intron|WDR52_uc010hqk.1_Intron			Q96MT7	WDR52_HUMAN	RecName: Full=WD repeat protein 52.; Flags: Fragment;											central_nervous_system(1)	1						cagcccacaaccacagaccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117525779	117525780	+	IGR	INS	-	GA	GA			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117525779_117525780insGA								None (None upstream) : None (None downstream)																							atacacctggcgagagccttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	118261258	118261259	+	Intron	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118261258_118261259delTC	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																		tctctctctttctctctctctc	0.163													4	4	---	---	---	---	
GSK3B	2932	broad.mit.edu	37	3	119638837	119638837	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119638837delG	uc003edo.2	-						GSK3B_uc003edn.2_Intron	NM_001146156	NP_001139628	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta isoform 2						axon guidance|epithelial to mesenchymal transition|ER overload response|glycogen metabolic process|hippocampus development|negative regulation of apoptosis|negative regulation of protein binding|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|positive regulation of cell-matrix adhesion|positive regulation of protein complex assembly|positive regulation of protein export from nucleus|positive regulation of Rac GTPase activity|regulation of microtubule-based process|superior temporal gyrus development	Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|nucleus|plasma membrane	ATP binding|beta-catenin binding|NF-kappaB binding|p53 binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|RNA polymerase II transcription factor binding|tau-protein kinase activity|ubiquitin protein ligase binding			lung(2)	2				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	ttttaaaaatggtaggataaa	0.000													4	2	---	---	---	---	
SEMA5B	54437	broad.mit.edu	37	3	122628129	122628130	+	3'UTR	INS	-	GT	GT	rs138842108	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122628129_122628130insGT	uc003efz.1	-	23					SEMA5B_uc011bju.1_3'UTR|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003efy.1_3'UTR	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		tgcgtgtgtgagtgtgtgtgtg	0.361													4	2	---	---	---	---	
MYLK	4638	broad.mit.edu	37	3	123605217	123605224	+	5'Flank	DEL	TTCTTTCC	-	-	rs10618294		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123605217_123605224delTTCTTTCC	uc003ego.2	-						MYLK_uc003egp.2_5'Flank|MYLK_uc003egq.2_5'Flank|MYLK_uc003egr.2_5'Flank|MYLK_uc003egs.2_5'Flank	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ttttctttctttctttccttctttcctt	0.005													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124397848	124397848	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124397848delA	uc003ehg.2	+						KALRN_uc003ehk.2_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TGGACAATGGAAACTAGACAC	0.373													4	2	---	---	---	---	
TMCC1	23023	broad.mit.edu	37	3	129435173	129435174	+	Intron	DEL	TT	-	-	rs140894473		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129435173_129435174delTT	uc003emz.3	-						TMCC1_uc011blc.1_Intron|TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1						acctggcAAAtttttttttttt	0.000													4	2	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131435089	131435090	+	Intron	INS	-	GAGGCA	GAGGCA	rs144941024	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131435089_131435090insGAGGCA	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						GCAGCCTTCAGGAGGCAGACTC	0.381													5	3	---	---	---	---	
TMEM108	66000	broad.mit.edu	37	3	132796117	132796117	+	Intron	DEL	A	-	-	rs67952049		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132796117delA	uc003eph.2	+						TMEM108_uc003epi.2_Intron	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4						TGCAGAGAGGAAAAAGGGCCC	0.408													3	4	---	---	---	---	
TF	7018	broad.mit.edu	37	3	133466777	133466777	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133466777delA	uc003epu.1	+						TF_uc011bls.1_Intron|TF_uc011blt.1_Intron|TF_uc003epw.1_Intron|TF_uc010htv.1_Intron|TF_uc003epv.1_Intron	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor						cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	accttgggttaaaaaaaaaaa	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	135964357	135964358	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135964357_135964358delAC								MSL2 (49669 upstream) : PCCB (4809 downstream)																							acacacacatacacacacacac	0.094													4	2	---	---	---	---	
CLSTN2	64084	broad.mit.edu	37	3	140191552	140191553	+	Intron	INS	-	C	C	rs149061224	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140191552_140191553insC	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GTCTTTTTTTTCTCTCTCTCTT	0.446										HNSCC(16;0.037)			3	3	---	---	---	---	
SPSB4	92369	broad.mit.edu	37	3	140819997	140819998	+	Intron	INS	-	C	C	rs145996740	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140819997_140819998insC	uc003ett.2	+						SPSB4_uc010hum.2_Intron	NM_080862	NP_543138	Q96A44	SPSB4_HUMAN	splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm	protein binding				0						CAGTGAAGGAGCCCCCCGAGGA	0.559													3	3	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149288201	149288202	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149288201_149288202insA	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			actaaaaatacaaaaattagct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151411873	151411874	+	IGR	INS	-	T	T	rs148740602		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151411873_151411874insT								IGSF10 (235376 upstream) : AADACL2 (39830 downstream)																							ATGATAAAttcttttttttttt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152539648	152539649	+	IGR	DEL	AC	-	-	rs35207668		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152539648_152539649delAC								MBNL1 (356080 upstream) : P2RY1 (13087 downstream)																							ATATAAGTATacacacacacac	0.223													3	3	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169885973	169885974	+	Intron	INS	-	CAAAGG	CAAAGG	rs147945976	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169885973_169885974insCAAAGG	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron|PHC3_uc011bpr.1_Intron|PHC3_uc003fgm.2_Intron|PHC3_uc003fgo.1_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			aaaggcaaagtcaaagggaaag	0.104													3	5	---	---	---	---	
EIF5A2	56648	broad.mit.edu	37	3	170613126	170613126	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170613126delA	uc003fhd.2	-							NM_020390	NP_065123	Q9GZV4	IF5A2_HUMAN	eIF-5A2 protein						mRNA transport|peptidyl-lysine modification to hypusine|polyamine homeostasis|positive regulation of cell proliferation|positive regulation of translational elongation|positive regulation of translational termination|post-translational protein modification|protein transport|spermatogenesis|translational frameshifting|transmembrane transport	cytosol|endoplasmic reticulum membrane|nuclear pore	protein binding|ribosome binding|translation elongation factor activity				0	all_cancers(22;1.61e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;9.8e-16)|Lung(28;4.28e-15)			AACATTAGTGAAAAAAAAAAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	171679175	171679178	+	IGR	DEL	GTGT	-	-	rs68076147		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171679175_171679178delGTGT								TMEM212 (102067 upstream) : FNDC3B (78240 downstream)																							TATATTAAACgtgtgtgtgtgtgt	0.279													4	2	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171865100	171865101	+	Intron	INS	-	A	A	rs77973840		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171865100_171865101insA	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		tgtctccaaacaaaaaaaaaaa	0.183													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177495926	177495927	+	IGR	DEL	GG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177495926_177495927delGG								TBL1XR1 (580878 upstream) : KCNMB2 (758297 downstream)																							CTTAGGACTTGGGGTAATTTAT	0.411													4	2	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179130104	179130105	+	Intron	INS	-	AAAC	AAAC	rs138332882	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179130104_179130105insAAAC	uc003fjv.3	-						GNB4_uc003fju.3_Intron	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			aagattaaaaaaaacaaacaaa	0.000													5	3	---	---	---	---	
USP13	8975	broad.mit.edu	37	3	179501649	179501649	+	Intron	DEL	A	-	-	rs72449152		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179501649delA	uc003fkh.2	+							NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			cttgtctcttaaaaaaaaaaa	0.159													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180578082	180578085	+	Intron	DEL	AGGA	-	-	rs113077171		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180578082_180578085delAGGA	uc003fko.2	-											Homo sapiens mRNA; cDNA DKFZp434A128 (from clone DKFZp434A128).																		gaaggagaggaggaaggaaggaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181624895	181624895	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181624895delA								SOX2OT (165892 upstream) : ATP11B (886396 downstream)																							actgtgtctgaaaaaaaaaaa	0.085													6	3	---	---	---	---	
ATP11B	23200	broad.mit.edu	37	3	182569146	182569146	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182569146delT	uc003flb.2	+							NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B						aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			attttgtgtattttttttctc	0.015													4	2	---	---	---	---	
HTR3C	170572	broad.mit.edu	37	3	183775522	183775526	+	Intron	DEL	CAAAA	-	-	rs143285687		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183775522_183775526delCAAAA	uc003fmk.2	+							NM_130770	NP_570126	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine receptor 3 subunit C							integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			gactccgtctcaaaacaaaacaaaa	0.132													4	2	---	---	---	---	
LIPH	200879	broad.mit.edu	37	3	185227732	185227734	+	Intron	DEL	TTC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185227732_185227734delTTC	uc003fpm.2	-						LIPH_uc010hyh.2_Intron	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor						lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			Tttttttgttttctttttttttt	0.118													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186130004	186130005	+	IGR	INS	-	C	C	rs151015841	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186130004_186130005insC								DGKG (49981 upstream) : CRYGS (126228 downstream)																							tggagggactgcccctccctgg	0.030													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186416266	186416267	+	IGR	INS	-	A	A	rs139858021	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186416266_186416267insA								HRG (20244 upstream) : KNG1 (18853 downstream)																							ttacatccttcatccaatcaag	0.124													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186612165	186612166	+	IGR	INS	-	T	T	rs35663004		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186612165_186612166insT								ADIPOQ (35915 upstream) : ST6GAL1 (36350 downstream)																							tgtcttcttcAttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187652957	187652958	+	IGR	DEL	AC	-	-	rs59924794		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187652957_187652958delAC								BCL6 (189482 upstream) : LPP (218761 downstream)																							CTCTCTTATAacacacacacac	0.292													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189219001	189219002	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189219001_189219002insA								TPRG1 (177731 upstream) : TP63 (130214 downstream)																							ttccttccttccttccttcctt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189293382	189293382	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189293382delC								TPRG1 (252112 upstream) : TP63 (55834 downstream)																							ctacttttctcctcaccctgg	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189982241	189982242	+	IGR	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189982241_189982242delTC								LEPREL1 (142015 upstream) : CLDN1 (41261 downstream)																							accaaaaggttctaagaactcc	0.000													4	2	---	---	---	---	
UTS2D	257313	broad.mit.edu	37	3	191011913	191011914	+	Intron	INS	-	AAAC	AAAC	rs140118152	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191011913_191011914insAAAC	uc003fsu.2	-							NM_198152	NP_937795	Q765I0	UTS2B_HUMAN	urotensin 2 domain containing precursor							extracellular region	hormone activity				0	all_cancers(143;1.77e-09)|Ovarian(172;0.103)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000214)		aacaaaaacaaaaacaaacaaa	0.188													3	3	---	---	---	---	
C3orf59	151963	broad.mit.edu	37	3	192595766	192595767	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192595766_192595767insA	uc011bsp.1	-							NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963												0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		TATTGaaaaagaaaaaaaaaaa	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193516311	193516312	+	IGR	DEL	AC	-	-	rs145897160		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193516311_193516312delAC								OPA1 (100712 upstream) : LOC100128023 (194572 downstream)																							TCAATATGGTacacacacacac	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193765684	193765685	+	IGR	INS	-	T	T	rs68148953		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193765684_193765685insT								LOC100128023 (53657 upstream) : HES1 (88249 downstream)																							TGTTTGTGCACTTTTTTTTTTT	0.396													4	2	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194823389	194823390	+	Intron	DEL	TG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194823389_194823390delTG	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc003fuk.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		tattccgttttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194851814	194851815	+	Intron	DEL	AC	-	-	rs58120378		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194851814_194851815delAC	uc003fum.3	-						C3orf21_uc003ful.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		CAGAAATGGGACCCAAACAGTG	0.545													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195427029	195427029	+	RNA	DEL	T	-	-	rs75389211		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195427029delT	uc011btd.1	+	1		c.208delT			uc003fux.1_RNA					Homo sapiens cDNA FLJ46488 fis, clone THYMU3026869.																		gcaacaggaattttttcaggc	0.015													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195437481	195437484	+	Intron	DEL	AGTT	-	-	rs145565379	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195437481_195437484delAGTT	uc003fux.1	+											Homo sapiens cDNA FLJ46488 fis, clone THYMU3026869.																		CTGGTGAGTGAGTTAATTGAGATG	0.520													13	6	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195473757	195473758	+	3'UTR	DEL	GT	-	-	rs71634711		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195473757_195473758delGT	uc011bto.1	-	26					MUC4_uc010hzq.2_3'UTR|MUC4_uc003fuz.2_3'UTR|MUC4_uc003fva.2_3'UTR|MUC4_uc003fvb.2_3'UTR|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_3'UTR|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_3'UTR|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_3'UTR|MUC4_uc011bti.1_3'UTR|MUC4_uc011btj.1_3'UTR|MUC4_uc011btk.1_3'UTR|MUC4_uc011btl.1_3'UTR|MUC4_uc011btm.1_3'UTR|MUC4_uc011btn.1_3'UTR|MUC4_uc003fvo.2_3'UTR|MUC4_uc003fvp.2_3'UTR	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TTATGAACTCgtgtgtgtgtgt	0.401													11	11	---	---	---	---	
TCTEX1D2	255758	broad.mit.edu	37	3	196046142	196046142	+	5'Flank	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196046142delT	uc003fwi.2	-						TM4SF19_uc003fwj.2_Intron|uc003fwk.1_Intron	NM_152773	NP_689986	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2								protein binding			ovary(1)|breast(1)	2	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		caggGATTCCttttttttttt	0.070													8	4	---	---	---	---	
TM4SF19	116211	broad.mit.edu	37	3	196050060	196050061	+	Intron	INS	-	CAGA	CAGA	rs150633312	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196050060_196050061insCAGA	uc010iad.1	-						TM4SF19_uc003fwj.2_Intron|uc003fwk.1_Intron			Q96DZ7	T4S19_HUMAN	Homo sapiens tetraspan membrane protein OCTM4 (OCTM4) mRNA, complete cds.							integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		gagttcaagaccagactgggca	0.000													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196263216	196263217	+	IGR	INS	-	T	T	rs150807618	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196263216_196263217insT								C3orf43 (20979 upstream) : WDR53 (17844 downstream)																							gctttgtagcctaggctggtgt	0.084													2	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3601952	3601952	+	IGR	DEL	T	-	-	rs67516442		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3601952delT								LRPAP1 (67728 upstream) : ADRA2C (166123 downstream)																							CATTCCTTACTTTTTTTTAGC	0.562													2	4	---	---	---	---	
AFAP1	60312	broad.mit.edu	37	4	7772264	7772264	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7772264delG	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron|LOC84740_uc003gkd.3_Intron	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						caagaacgcagggcaagggga	0.000													4	2	---	---	---	---	
LDB2	9079	broad.mit.edu	37	4	16780113	16780113	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16780113delT	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0						atctctccgcttatcacaacc	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33675225	33675226	+	IGR	DEL	TT	-	-	rs112650505		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33675225_33675226delTT								None (None upstream) : None (None downstream)																							AGCCAAGCTCtttttttttttt	0.168													4	2	---	---	---	---	
TBC1D1	23216	broad.mit.edu	37	4	38053789	38053792	+	Intron	DEL	TGTG	-	-	rs67391834		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38053789_38053792delTGTG	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1						GCAGAGCCACtgtgtgtgtgtgtg	0.333													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	40257875	40257875	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40257875delT								RHOH (11594 upstream) : CHRNA9 (79594 downstream)																							TGTATTTACCTTACTTCTCTG	0.338													4	2	---	---	---	---	
NFXL1	152518	broad.mit.edu	37	4	47916234	47916234	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47916234delA	uc010igh.2	-						uc003gxr.1_5'Flank|NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TGCAAAGGAGAAAAAAAAAAA	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49220204	49220204	+	IGR	DEL	G	-	-	rs73152053	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49220204delG								CWH43 (156111 upstream) : None (None downstream)																							agaacctcttggaaaacctct	0.030													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49534603	49534604	+	IGR	INS	-	T	T	rs143333563		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49534603_49534604insT								CWH43 (470510 upstream) : None (None downstream)																							ATACTAAGTAATTAAAAAAAAA	0.129													8	6	---	---	---	---	
PDCL2	132954	broad.mit.edu	37	4	56438437	56438437	+	Intron	DEL	G	-	-	rs71931431		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56438437delG	uc003hbb.2	-							NM_152401	NP_689614	Q8N4E4	PDCL2_HUMAN	phosducin-like 2												0	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			aacttaatatggggggaatta	0.075													5	4	---	---	---	---	
KIAA1211	57482	broad.mit.edu	37	4	57069838	57069838	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57069838delA	uc003hbk.2	+							NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					ggtccagtgcaaaatgaaaat	0.154													4	2	---	---	---	---	
AASDH	132949	broad.mit.edu	37	4	57228419	57228420	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57228419_57228420insT	uc003hbn.2	-						AASDH_uc010ihb.2_Intron|AASDH_uc011caa.1_Intron|AASDH_uc003hbo.2_Intron|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Intron|AASDH_uc003hbp.2_Intron	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase						fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GTTTTGACAGCtttttttttct	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57409266	57409267	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57409266_57409267insT								ARL9 (19208 upstream) : HOPX (104887 downstream)																							ttatgttttgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57506870	57506871	+	IGR	INS	-	TT	TT			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57506870_57506871insTT								ARL9 (116812 upstream) : HOPX (7283 downstream)																							aacaacaaacatttatgatatc	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57645732	57645733	+	IGR	INS	-	C	C	rs145892606	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57645732_57645733insC								HOPX (97860 upstream) : SPINK2 (30301 downstream)																							gatcacttgagccagaagtcca	0.104													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	59685196	59685197	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59685196_59685197insA								None (None upstream) : None (None downstream)																							caacaacgaccaaaaaaaaaaa	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	67731335	67731338	+	IGR	DEL	TGTC	-	-	rs76474299		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67731335_67731338delTGTC								MIR1269 (588689 upstream) : CENPC1 (606651 downstream)																							tctgtgcgtgtgtctgtctgtctg	0.127													4	2	---	---	---	---	
ANKRD17	26057	broad.mit.edu	37	4	74075354	74075355	+	Intron	INS	-	A	A	rs146783324	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74075354_74075355insA	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ttcccttacgcaaaaaagatca	0.000													2	4	---	---	---	---	
SDAD1	55153	broad.mit.edu	37	4	76877561	76877561	+	Intron	DEL	T	-	-	rs11315314		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76877561delT	uc003hje.3	-						SDAD1_uc003hjf.3_Intron|SDAD1_uc011cbr.1_Intron	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1						protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			tttttttttgttttttttttt	0.000													8	6	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79323280	79323281	+	Intron	INS	-	TG	TG	rs149671535	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79323280_79323281insTG	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ggaattaaaactgtggaaatag	0.000													0	8	---	---	---	---	
COPS4	51138	broad.mit.edu	37	4	83955801	83955802	+	5'Flank	INS	-	G	G	rs142043277	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83955801_83955802insG	uc003hoa.2	+						COPS4_uc003hob.2_5'Flank|COPS4_uc010ijw.2_5'Flank|COPS4_uc010ijx.2_5'Flank	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4						cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				cccggccgaaaggggggatatt	0.050													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	100581322	100581323	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100581322_100581323insA								MTTP (36169 upstream) : DAPP1 (156658 downstream)																							attatgatagcaaaaaaaaaaa	0.089													4	2	---	---	---	---	
ALPK1	80216	broad.mit.edu	37	4	113242053	113242054	+	Intron	INS	-	T	T	rs147308484		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113242053_113242054insT	uc003iap.3	+						ALPK1_uc003iam.2_Intron|ALPK1_uc011cfw.1_Intron|ALPK1_uc003ian.3_Intron|ALPK1_uc011cfx.1_Intron|ALPK1_uc003iao.3_Intron	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1								ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		ccatttctttcttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	147131767	147131768	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147131767_147131768insA								LSM6 (20555 upstream) : SLC10A7 (43369 downstream)																							tgtctcaaaagaaaaaaaaaaG	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	150916298	150916299	+	IGR	INS	-	AC	AC	rs147657037	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150916298_150916299insAC								None (None upstream) : DCLK2 (83781 downstream)																							gaaagaaagagagagagagaga	0.005													6	3	---	---	---	---	
LRBA	987	broad.mit.edu	37	4	151501447	151501448	+	Intron	INS	-	T	T	rs141248817	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151501447_151501448insT	uc003ils.3	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron|LRBA_uc010ipj.2_Intron|uc003ilv.1_3'UTR|MAB21L2_uc003ilw.2_5'Flank			P50851	LRBA_HUMAN	SubName: Full=Putative uncharacterized protein DKFZp686K03100;							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					ATCCGAGATAGTTTTTTTTTAA	0.446													3	3	---	---	---	---	
FHDC1	85462	broad.mit.edu	37	4	153889445	153889446	+	Intron	INS	-	T	T	rs75046217		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153889445_153889446insT	uc003inf.2	+							NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1						actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					AGCCTGATATATTTTTTTTTTT	0.223													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	155475497	155475498	+	IGR	DEL	GT	-	-	rs72142897		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155475497_155475498delGT								PLRG1 (3974 upstream) : FGB (8634 downstream)																							TGGTCtgtgagtgtgtgtgtgt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165693425	165693426	+	Intron	INS	-	C	C	rs139523389	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165693425_165693426insC	uc003iqu.1	+											Homo sapiens cDNA FLJ37936 fis, clone CTONG2005468.																		aacacccagattcatgagaact	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165967473	165967473	+	IGR	DEL	A	-	-	rs150476538		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165967473delA								TRIM60 (4577 upstream) : TMEM192 (29758 downstream)																							ACTTACAGCCAAAAAAAAAAa	0.224													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173608777	173608780	+	Intron	DEL	AAAA	-	-	rs72264037		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173608777_173608780delAAAA	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						agactgtctcaaaaaaaaaaaaaa	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184377090	184377090	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184377090delT								CDKN2AIP (8041 upstream) : ING2 (49130 downstream)																							GTTCCTGTGGTTTTCATTCTA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187454806	187454806	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187454806delC								F11 (243971 upstream) : MTNR1A (3 downstream)																							CGAGGCCTTGCGCAGCGTGTC	0.493													29	24	---	---	---	---	
FAT1	2195	broad.mit.edu	37	4	187547872	187547875	+	Intron	DEL	GAAT	-	-	rs80055485		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187547872_187547875delGAAT	uc003izf.2	-							NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TCAGCCCACAgaatgaatgaatga	0.358										HNSCC(5;0.00058)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	188467842	188467843	+	IGR	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188467842_188467843delTC								FAT1 (819992 upstream) : ZFP42 (449082 downstream)																							TTTGAATTGATCTCTCTCTCTC	0.450													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190526400	190526401	+	IGR	DEL	AC	-	-	rs149727932		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190526400_190526401delAC								None (None upstream) : FRG1 (335573 downstream)																							ACATCACATTacacacacacac	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190596438	190596439	+	IGR	INS	-	TCCTTGG	TCCTTGG	rs140220951		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190596438_190596439insTCCTTGG								None (None upstream) : FRG1 (265535 downstream)																							GTGCTGAGATAAAATTAAATTC	0.332													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190598370	190598371	+	IGR	DEL	GT	-	-	rs13135329		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190598370_190598371delGT								None (None upstream) : FRG1 (263603 downstream)																							TGTTACAGCAGTGTGTCAGTGT	0.381													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2545480	2545480	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2545480delT								IRX4 (662600 upstream) : IRX2 (200801 downstream)																							TTGGGATTCCTTTCCAGGCGA	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3275696	3275697	+	IGR	INS	-	A	A	rs149066322	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3275696_3275697insA								C5orf38 (520184 upstream) : IRX1 (320471 downstream)																							TGGACATTCTGATAATGATGAG	0.455													4	2	---	---	---	---	
IRX1	79192	broad.mit.edu	37	5	3598631	3598631	+	Intron	DEL	A	-	-	rs71582390		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3598631delA	uc003jde.2	+							NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						CTTTTGTATTAAAAAAAAAAA	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26661773	26661774	+	IGR	INS	-	AC	AC	rs149227510	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26661773_26661774insAC								None (None upstream) : CDH9 (218935 downstream)																							ATTCATTTGTAacacacacaca	0.228													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35826223	35826224	+	IGR	INS	-	A	A	rs144565528		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35826223_35826224insA								SPEF2 (11511 upstream) : IL7R (30767 downstream)																							gactccatctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
LMBRD2	92255	broad.mit.edu	37	5	36142818	36142818	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36142818delC	uc003jkb.1	-							NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2							integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATGCTTTAttctttttttttt	0.144													9	5	---	---	---	---	
NDUFS4	4724	broad.mit.edu	37	5	52963523	52963523	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52963523delA	uc003jpe.2	+							NM_002495	NP_002486	O43181	NDUS4_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 4						brain development|cAMP-mediated signaling|mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|positive regulation of fibroblast proliferation|reactive oxygen species metabolic process|regulation of protein phosphorylation|response to cAMP|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			central_nervous_system(1)	1		Lung NSC(810;8.27e-05)|Breast(144;0.0848)			NADH(DB00157)	TAAGGCATTTAAAAAAAAAAG	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55869352	55869352	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55869352delG								ANKRD55 (340166 upstream) : MAP3K1 (241548 downstream)																							ctgacaacatggtctctgaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	72911344	72911344	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72911344delA								UTP15 (33550 upstream) : RGNEF (10639 downstream)																							TAGTTTTTTTAAATACACAGA	0.398													4	2	---	---	---	---	
RGNEF	64283	broad.mit.edu	37	5	73142411	73142412	+	Intron	INS	-	T	T	rs142259999	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73142411_73142412insT	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		CATATGAACTATTTTTTTGAGA	0.287													4	2	---	---	---	---	
ELL2	22936	broad.mit.edu	37	5	95297907	95297907	+	5'Flank	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95297907delG	uc003klr.3	-							NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2						regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CCCCGCCCCTGTGGGGGATAG	0.602													4	2	---	---	---	---	
ERAP1	51752	broad.mit.edu	37	5	96145052	96145052	+	5'Flank	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96145052delG	uc003kmm.2	-						ERAP1_uc003kml.2_5'Flank|ERAP1_uc010jbm.1_Intron|ERAP1_uc003kmn.2_Intron	NM_001040458	NP_001035548	Q9NZ08	ERAP1_HUMAN	type 1 tumor necrosis factor receptor shedding						angiogenesis|antigen processing and presentation of endogenous peptide antigen via MHC class I|fat cell differentiation|membrane protein ectodomain proteolysis|regulation of blood pressure|regulation of innate immune response|response to bacterium	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|integral to membrane	aminopeptidase activity|interleukin-1, Type II receptor binding|interleukin-6 receptor binding|metalloexopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		gagttgctctggttcaaacgt	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123651052	123651052	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123651052delA								CSNK1G3 (698590 upstream) : ZNF608 (321558 downstream)																							ATCACACAGTAAAAAAAAAGC	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	131591340	131591340	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131591340delG	uc003kwm.3	-						PDLIM4_uc003kwn.2_5'Flank|PDLIM4_uc003kwp.2_5'Flank|PDLIM4_uc003kwo.2_5'Flank					Homo sapiens cDNA clone IMAGE:5207811.																		GGGAATGACTGGCCTGGACCC	0.493													4	2	---	---	---	---	
SPATA24	202051	broad.mit.edu	37	5	138733907	138733907	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138733907delG	uc003lel.3	-						SPATA24_uc003lek.2_Intron	NM_194296	NP_919272	Q86W54	SPA24_HUMAN	spermatogenesis associated 24						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleolus|nucleoplasm	DNA binding				0						tttcaaagatggggaaagaga	0.308													4	2	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142165713	142165713	+	Intron	DEL	T	-	-	rs72451056		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142165713delT	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ttaaaaaacattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	151541377	151541378	+	Intron	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151541377_151541378delAC	uc003luu.1	+											Homo sapiens cDNA FLJ10720 fis, clone NT2RP3001116.																		TTGAGTATGTACAAAAAAAATC	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	151603441	151603441	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151603441delT	uc003luu.1	+											Homo sapiens cDNA FLJ10720 fis, clone NT2RP3001116.																		tcaatgagtgtttttagagtg	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159093708	159093710	+	IGR	DEL	CTT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159093708_159093710delCTT								LOC285627 (200424 upstream) : ADRA1B (250030 downstream)																							gttcctattccttgaaacTTGCC	0.128													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166981854	166981857	+	Intron	DEL	TCTC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166981854_166981857delTCTC	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CAAAGGAGCTTCTCTCTCTCTCTG	0.368													4	3	---	---	---	---	
KCNIP1	30820	broad.mit.edu	37	5	170028374	170028374	+	Intron	DEL	G	-	-	rs80159243		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170028374delG	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGAGAAGGAGGCAGAAGCTG	0.527													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170931999	170932000	+	IGR	DEL	GA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170931999_170932000delGA								FGF18 (47837 upstream) : FBXW11 (356556 downstream)																							aggctcagaggagagagagagA	0.050													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170949803	170949805	+	IGR	DEL	GTC	-	-	rs112668940		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170949803_170949805delGTC								FGF18 (65641 upstream) : FBXW11 (338751 downstream)																							ttcttgctctgtcgtcacccaag	0.182													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	171205452	171205453	+	IGR	DEL	CA	-	-	rs111574298	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171205452_171205453delCA								FGF18 (321290 upstream) : FBXW11 (83103 downstream)																							gggaaaatttcacacacacaca	0.000													4	2	---	---	---	---	
STK10	6793	broad.mit.edu	37	5	171505952	171505953	+	Intron	DEL	CA	-	-	rs6149346		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171505952_171505953delCA	uc003mbo.1	-							NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTATAAGTCcacacacacaca	0.455													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172876558	172876558	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172876558delA								STC2 (120052 upstream) : LOC285593 (130088 downstream)																							AGCAGACTGGAAAAAAAATTC	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175342347	175342348	+	IGR	DEL	CA	-	-	rs72421292		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175342347_175342348delCA								CPLX2 (31324 upstream) : THOC3 (44188 downstream)																							tgttttctttcagttttggttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	177389899	177389900	+	IGR	INS	-	A	A	rs149942187	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177389899_177389900insA								LOC728554 (78632 upstream) : PROP1 (29336 downstream)																							tataagctagcataattttaga	0.040													3	3	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177843091	177843094	+	Intron	DEL	CATT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177843091_177843094delCATT	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TAAACCCTCCcattcattcattca	0.324													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178183046	178183047	+	IGR	INS	-	GGTGGTGGG	GGTGGTGGG			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178183046_178183047insGGTGGTGGG								ZNF354A (25343 upstream) : AACSL (8819 downstream)																							gtgatgatggtggtggtggtga	0.059													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178944765	178944766	+	IGR	INS	-	A	A	rs141977954	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178944765_178944766insA								ADAMTS2 (172436 upstream) : RUFY1 (32805 downstream)																							ACACCAAGGTGAAAAAAATCAA	0.272													4	2	---	---	---	---	
MAML1	9794	broad.mit.edu	37	5	179165216	179165217	+	Intron	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179165216_179165217delTC	uc003mkm.2	+						MAML1_uc003mkn.1_Intron	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			tctgcctctttctctctctctc	0.005													4	3	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	693566	693566	+	5'Flank	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:693566delA	uc003mtd.2	-						EXOC2_uc003mte.2_5'Flank|EXOC2_uc011dho.1_5'Flank	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GCACCAGGTCAGGGGGGCTGC	0.607													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3760461	3760462	+	IGR	INS	-	AG	AG	rs148813101	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3760461_3760462insAG								C6orf145 (8215 upstream) : FAM50B (89170 downstream)																							CTATCATGAGCAGAGTTAGTGA	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6728709	6728709	+	Intron	DEL	A	-	-	rs78580952		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6728709delA	uc003mxa.2	+											Homo sapiens, clone IMAGE:5189615, mRNA.																		ATAGAAGGGCAAAAAAAAAAG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	10093139	10093139	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10093139delT	uc010joj.1	-						uc003myp.1_Intron					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																		tcttaactcattccagcatta	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11148117	11148118	+	IGR	DEL	AA	-	-	rs78184342		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11148117_11148118delAA								LOC221710 (9153 upstream) : NEDD9 (35413 downstream)																							gcagtgagccaagagtgtgcca	0.069													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12242609	12242610	+	IGR	INS	-	GACC	GACC	rs151108762	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12242609_12242610insGACC								HIVEP1 (77378 upstream) : EDN1 (47919 downstream)																							GAGTGAGTAGTGACCTCTGaag	0.267													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14395029	14395030	+	IGR	INS	-	C	C	rs151158867	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14395029_14395030insC								CD83 (257883 upstream) : JARID2 (850704 downstream)																							tggaagctccgccccccttctc	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14591076	14591077	+	IGR	INS	-	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14591076_14591077insC								CD83 (453930 upstream) : JARID2 (654657 downstream)																							AGTGCCACTTTCCCCTGGTTCT	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14947625	14947626	+	IGR	DEL	AA	-	-	rs71792916		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14947625_14947626delAA								CD83 (810479 upstream) : JARID2 (298108 downstream)																							actctgtctcaaaaaaaaaaaa	0.158													4	2	---	---	---	---	
JARID2	3720	broad.mit.edu	37	6	15278116	15278117	+	Intron	INS	-	T	T	rs147171929	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15278116_15278117insT	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AAAAGAAATCCTTTTTTTTGGA	0.327													2	4	---	---	---	---	
SLC17A3	10786	broad.mit.edu	37	6	25857417	25857417	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25857417delA	uc003nfi.3	-						SLC17A3_uc003nfk.3_Intron|SLC17A3_uc011djz.1_Intron|SLC17A3_uc011dka.1_Intron	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),						glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						accttatctcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	26353543	26353544	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26353543_26353544insT								HIST1H4H (67781 upstream) : BTN3A2 (11854 downstream)																							gtttttttttgttttttttttt	0.000													4	2	---	---	---	---	
ZNF204P	7754	broad.mit.edu	37	6	27342164	27342165	+	Intron	INS	-	GTGT	GTGT	rs138929711	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27342164_27342165insGTGT	uc011dkv.1	-							NR_024553				Homo sapiens C2H2 zinc finger protein pseudogene, mRNA sequence.												0						CACGAAAACTCgtgtgtgtgtg	0.381													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28941038	28941039	+	IGR	INS	-	TTTGGTTGGT	TTTGGTTGGT	rs142894602	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28941038_28941039insTTTGGTTGGT								TRIM27 (49270 upstream) : ZNF311 (21555 downstream)																							GTttttgtttgtttgttttgtt	0.069													3	3	---	---	---	---	
MOG	4340	broad.mit.edu	37	6	29635626	29635626	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29635626delA	uc003nnf.2	+						MOG_uc003nmy.1_Intron|MOG_uc003nmz.2_Intron|MOG_uc011dlt.1_Intron|MOG_uc003nna.2_Intron|MOG_uc011dlu.1_Intron|MOG_uc011dlv.1_Intron|MOG_uc003nnd.2_Intron|MOG_uc003nne.2_Intron|MOG_uc003nng.2_Intron|MOG_uc003nnh.2_Intron|MOG_uc003nni.2_Intron|MOG_uc003nnj.2_Intron|MOG_uc003nnk.2_Intron	NM_206809	NP_996532	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein isoform						cell adhesion|central nervous system development|positive regulation of MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)	1						GACTCAGGATAAAAGATCCTT	0.418													20	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29783197	29783198	+	IGR	DEL	AC	-	-	rs139285400		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29783197_29783198delAC								HCG4 (22347 upstream) : HLA-G (11558 downstream)																							aaaaaaaaaaacaaaaccctaa	0.000													3	5	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29909633	29909634	+	Intron	INS	-	T	T	rs141035764	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29909633_29909634insT	uc011dmb.1	+						HCG4P6_uc003nog.1_Intron|HLA-A_uc010jrq.2_5'Flank|HLA-A_uc003nok.2_5'Flank|HLA-A_uc003nol.2_5'Flank|HLA-A_uc003non.2_5'Flank|HLA-A_uc003noo.2_5'Flank|HLA-A_uc010jrr.2_5'Flank|HLA-A_uc003nom.2_5'Flank|HLA-A_uc010klp.2_5'Flank|HLA-A_uc011dmc.1_5'Flank|HLA-A_uc011dmd.1_5'Flank	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						CCAAAGTCACATTTTTTACCTA	0.381													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	31482915	31482915	+	IGR	DEL	A	-	-	rs34367461		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31482915delA								MICB (4017 upstream) : MCCD1 (13824 downstream)																							ctacccagccaaaaaaacaag	0.000													2	4	---	---	---	---	
BAK1	578	broad.mit.edu	37	6	33541613	33541623	+	Frame_Shift_Del	DEL	GCCCAACAGAA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33541613_33541623delGCCCAACAGAA	uc003oes.2	-	6	893_903	c.593_603delTTCTGTTGGGC	c.(592-603)GTTCTGTTGGGCfs	p.V198fs	BAK1_uc003oer.2_Frame_Shift_Del_p.V128fs|BAK1_uc003oet.2_RNA|BAK1_uc010jvb.2_Frame_Shift_Del_p.V198fs|BAK1_uc003oeu.2_Frame_Shift_Del_p.V139fs	NM_001188	NP_001179	Q16611	BAK_HUMAN	BCL2-antagonist/killer 1	198_201	Helical; (Potential).				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|cellular response to UV|establishment or maintenance of transmembrane electrochemical gradient|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|release of cytochrome c from mitochondria	integral to mitochondrial outer membrane|pore complex	metal ion binding|protein heterodimerization activity			ovary(1)	1						CCACAAACTGGCCCAACAGAACCACACCCAG	0.559													12	20	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34025880	34025880	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34025880delT	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc003oio.2_Intron|GRM4_uc003oip.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	GGTGTGGATGTGGGGGGACAG	0.622													3	6	---	---	---	---	
UHRF1BP1	54887	broad.mit.edu	37	6	34817921	34817921	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34817921delA	uc003oju.3	+						UHRF1BP1_uc010jvm.1_Intron|UHRF1BP1_uc010jvn.2_Intron	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1											ovary(3)	3						actcggtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	36916435	36916449	+	IGR	DEL	TCCCTCCTTCCTCCC	-	-	rs140233175		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36916435_36916449delTCCCTCCTTCCTCCC								C6orf89 (19697 upstream) : PI16 (5760 downstream)																							cctccctccttccctccttcctccctccctccttc	0.023													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37515793	37515793	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37515793delG								C6orf129 (48093 upstream) : MDGA1 (84491 downstream)																							TGGGGGTTGAGGCTGCTCTGG	0.557													4	2	---	---	---	---	
MDGA1	266727	broad.mit.edu	37	6	37611054	37611054	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37611054delT	uc003onu.1	-						MDGA1_uc003onv.1_Intron	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing						brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						ttctttttccttttttttttt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	39935302	39935302	+	IGR	DEL	C	-	-	rs1923478	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39935302delC								MOCS1 (33048 upstream) : TDRG1 (410861 downstream)																							caaaaaaaaacaaaaaacaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40318050	40318051	+	Intron	DEL	CA	-	-	rs72296535		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40318050_40318051delCA	uc003opf.1	-											Homo sapiens cDNA FLJ41649 fis, clone FEBRA2024343.																		ctggcacactcacacatgcaca	0.064													3	3	---	---	---	---	
KIAA0240	23506	broad.mit.edu	37	6	42823439	42823439	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42823439delT	uc003osn.1	+						KIAA0240_uc011duw.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			TGTGTACTGGTTTTTTTTTTT	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	43680896	43680897	+	IGR	INS	-	C	C	rs147271968		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43680896_43680897insC								MRPS18A (25368 upstream) : VEGFA (57056 downstream)																							acgtggtggaaccccatctcta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50452069	50452069	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50452069delG	uc003pae.1	+											full-length cDNA clone CS0DD007YH13 of Neuroblastoma Cot 50-normalized of Homo sapiens (human).																		acagaacaatggtgttcataa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57517526	57517529	+	IGR	DEL	CATA	-	-	rs146081336		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57517526_57517529delCATA								PRIM2 (4151 upstream) : GUSBL2 (728630 downstream)																							ccaccttctccatacatccaaatc	0.034													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57563746	57563746	+	IGR	DEL	C	-	-	rs113591131		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57563746delC								PRIM2 (50371 upstream) : GUSBL2 (682413 downstream)																							tctttgtcttccctgccatgc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66930477	66930480	+	IGR	DEL	CTTA	-	-	rs66843346		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66930477_66930480delCTTA								MCART3P (431102 upstream) : None (None downstream)																							ccttccttttcttactttctttct	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88534712	88534714	+	Intron	DEL	CAT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88534712_88534714delCAT	uc003pmm.2	+											Homo sapiens mRNA sequence.																		tcaccactaccatcatcatcatc	0.222													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88539733	88539747	+	Intron	DEL	CTCCTCTCCCTTCTC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88539733_88539747delCTCCTCTCCCTTCTC	uc003pmm.2	+											Homo sapiens mRNA sequence.																		cttcctccttctcctctcccttctcctcctctccc	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88578461	88578461	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88578461delT	uc003pmm.2	+											Homo sapiens mRNA sequence.																		tctgcaaccctttggcatgtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	100042472	100042472	+	IGR	DEL	T	-	-	rs71702474		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100042472delT								CCNC (25782 upstream) : PRDM13 (12178 downstream)																							taccttcttcttttttttttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107289891	107289891	+	IGR	DEL	T	-	-	rs111532264		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107289891delT								MIR587 (57796 upstream) : C6orf203 (59516 downstream)																							CTCAGTATCCTTTTTTTTTTT	0.224													4	2	---	---	---	---	
SLC35F1	222553	broad.mit.edu	37	6	118236629	118236629	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118236629delG	uc003pxx.3	+							NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		ATTTGTCCTTGGCAATGAAAG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	121881144	121881145	+	IGR	INS	-	C	C			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121881144_121881145insC								GJA1 (110272 upstream) : HSF2 (839551 downstream)																							cttccttccttccttccttcct	0.099													4	2	---	---	---	---	
PKIB	5570	broad.mit.edu	37	6	122998602	122998602	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122998602delG	uc003pyz.2	+						PKIB_uc003pza.2_Intron|PKIB_uc003pzb.2_Intron|PKIB_uc003pzc.2_Intron	NM_181794	NP_861459	Q9C010	IPKB_HUMAN	cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)		ATATGGATGAGGGGTTGTAGT	0.393													4	2	---	---	---	---	
HDDC2	51020	broad.mit.edu	37	6	125622589	125622590	+	Intron	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125622589_125622590delAC	uc003qaa.1	-						HDDC2_uc003qab.1_Intron	NM_016063	NP_057147	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2								metal ion binding|phosphoric diester hydrolase activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		GCCGCGCTTTacacacacacac	0.411													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127754229	127754230	+	IGR	INS	-	TTAAC	TTAAC	rs138703409		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127754229_127754230insTTAAC								ECHDC1 (89475 upstream) : C6orf174 (5322 downstream)																							TTACTTGATAATTAAAGTCTAT	0.257													4	2	---	---	---	---	
SASH1	23328	broad.mit.edu	37	6	148683689	148683689	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148683689delT	uc003qme.1	+							NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1								protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		ATTATATGCCTTTTTTTTTTT	0.438													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	154934441	154934441	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154934441delT								CNKSR3 (102688 upstream) : RBM16 (120071 downstream)																							gcttttgtgcttttcctcatg	0.169													4	2	---	---	---	---	
SYTL3	94120	broad.mit.edu	37	6	159126716	159126719	+	Intron	DEL	AGTG	-	-	rs5881282		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159126716_159126719delAGTG	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		ACAGGGTGACAGTGAGGGCTGTAA	0.583											OREG0017758	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
QKI	9444	broad.mit.edu	37	6	163987933	163987933	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163987933delT	uc003qui.2	+						QKI_uc003que.2_3'UTR|QKI_uc003quf.2_3'UTR|QKI_uc003qug.2_3'UTR|QKI_uc003quh.2_3'UTR|QKI_uc003quj.2_Intron	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		CTGCACACAGTTTTTTTTCCT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	2292618	2292625	+	IGR	DEL	CCTGTTCT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2292618_2292625delCCTGTTCT								NUDT1 (1838 upstream) : SNX8 (2016 downstream)																							ctcccttacccctgttctcctgttctcc	0.077													6	7	---	---	---	---	
SNX8	29886	broad.mit.edu	37	7	2316522	2316523	+	Intron	DEL	GT	-	-	rs142945453		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2316522_2316523delGT	uc003slw.2	-							NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8						cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		tgaggctgtagtgagctatgat	0.050													0	7	---	---	---	---	
EIF3B	8662	broad.mit.edu	37	7	2400168	2400168	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2400168delC	uc003slx.2	+						EIF3B_uc003sly.2_Intron|EIF3B_uc003slz.1_Intron|EIF3B_uc003sma.2_5'Flank	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GAGTTCCAGTCCCCCCAGCTG	0.393													1	5	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4057751	4057751	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4057751delC	uc003smx.2	+						SDK1_uc010kso.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCTACAGCAGCCCAAATCCTT	0.443													4	2	---	---	---	---	
AIMP2	7965	broad.mit.edu	37	7	6052639	6052640	+	Intron	DEL	AA	-	-	rs143685042		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6052639_6052640delAA	uc003spo.2	+							NM_006303	NP_006294	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting						apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding			ovary(1)	1						ttaagcaaacaagagaagaagg	0.079													0	7	---	---	---	---	
DAGLB	221955	broad.mit.edu	37	7	6489237	6489237	+	5'Flank	DEL	T	-	-	rs35661590		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6489237delT	uc003sqa.2	-						DAGLB_uc011jwu.1_5'Flank|DAGLB_uc003sqb.2_5'Flank|DAGLB_uc003sqc.2_5'Flank|DAGLB_uc011jwv.1_5'Flank|DAGLB_uc003sqd.3_Intron|DAGLB_uc011jww.1_5'Flank	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1						lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		tctactaaaatttaaaaaaaa	0.000													2	4	---	---	---	---	
ZDHHC4	55146	broad.mit.edu	37	7	6626679	6626680	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6626679_6626680insT	uc003sqi.2	+						ZDHHC4_uc003sql.2_Intron|ZDHHC4_uc003sqh.2_Intron|ZDHHC4_uc003sqj.2_Intron|ZDHHC4_uc003sqk.2_Intron|ZDHHC4_uc003sqm.2_Intron	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4							integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		catatggtaacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	6708098	6708098	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6708098delT	uc003sqr.1	+											Homo sapiens cDNA FLJ41306 fis, clone BRAMY2042549.																		aagtgtttcatttttttttga	0.000													4	2	---	---	---	---	
MIOS	54468	broad.mit.edu	37	7	7606262	7606262	+	5'Flank	DEL	A	-	-	rs36111613		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7606262delA	uc003srf.2	+						MIOS_uc010ktp.1_5'Flank	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog												0						CATCATTTGCAAAAAAAAAAA	0.284													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	19148353	19148360	+	IGR	DEL	GTGTGTGT	-	-	rs147796633		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19148353_19148360delGTGTGTGT								HDAC9 (111369 upstream) : TWIST1 (6733 downstream)																							AATAGTAGGGgtgtgtgtgtgtgtgtgt	0.341													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20984145	20984146	+	IGR	INS	-	G	G	rs139960010	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20984145_20984146insG								RPL23P8 (116706 upstream) : SP4 (483543 downstream)																							tcagggcataagggggggctgt	0.000													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22060940	22060940	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22060940delA								CDCA7L (75398 upstream) : RAPGEF5 (96969 downstream)																							TGCTACAAGGAAGAAGAGAAA	0.313													4	2	---	---	---	---	
C7orf46	340277	broad.mit.edu	37	7	23741877	23741877	+	3'UTR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23741877delT	uc003swo.3	+	7					C7orf46_uc003swq.3_3'UTR|C7orf46_uc003swr.3_3'UTR|C7orf46_uc003swp.3_RNA|C7orf46_uc010kup.2_RNA	NM_199136	NP_954587	A4D161	CG046_HUMAN	hypothetical protein LOC340277 isoform 1												0						AATTATTTACTTTTTTTTTTT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24024578	24024579	+	IGR	INS	-	G	G	rs143723146	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24024578_24024579insG								STK31 (80213 upstream) : NPY (299230 downstream)																							tacctcatcaaggagcaccccg	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27255639	27255639	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27255639delT								HOXA13 (15914 upstream) : EVX1 (26525 downstream)																							GTGACCTGAGTTTTTGGCTTA	0.438													4	2	---	---	---	---	
JAZF1	221895	broad.mit.edu	37	7	28159796	28159796	+	Intron	DEL	T	-	-	rs68126733		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28159796delT	uc003szn.2	-							NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131						TGTTTGGTGGTTTTTTTTTTT	0.373			T	SUZ12	endometrial stromal tumours								3	5	---	---	---	---	
ADCYAP1R1	117	broad.mit.edu	37	7	31115951	31115951	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31115951delC	uc003tca.1	+						ADCYAP1R1_uc003tcb.1_Intron|ADCYAP1R1_uc003tcc.1_Intron|ADCYAP1R1_uc003tcd.1_Intron|ADCYAP1R1_uc003tce.1_Intron	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						aggacagagtcagagaagcag	0.174													4	2	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	34107683	34107684	+	Intron	INS	-	CAG	CAG	rs144530982	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34107683_34107684insCAG	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						GTAGTACCCACCAGCAGCAGCA	0.158													2	4	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37345615	37345615	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37345615delG	uc003tfk.1	-						ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						CTCCAAAAGTGGGGCTACAGT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41366572	41366572	+	IGR	DEL	T	-	-	rs11290129		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41366572delT								C7orf10 (466215 upstream) : INHBA (362031 downstream)																							TATTTGGGTATTTTTTTTTTA	0.333													4	2	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47544591	47544591	+	Intron	DEL	A	-	-	rs75052215		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47544591delA	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						TGAACCAAAGAATTCAATCCC	0.463													1	6	---	---	---	---	
HUS1	3364	broad.mit.edu	37	7	48018809	48018809	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48018809delA	uc003tod.1	-						HUS1_uc003toe.1_Intron|HUS1_uc011kce.1_Intron	NM_004507	NP_004498	O60921	HUS1_HUMAN	HUS1 checkpoint protein						DNA damage checkpoint|DNA replication	Golgi apparatus|nucleolus|nucleoplasm	protein binding			ovary(2)|lung(2)|kidney(1)	5		Breast(660;0.00139)				GCTTTTTTTTAAAGCCACGTG	0.433								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52660330	52660331	+	IGR	DEL	CA	-	-	rs71557951		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52660330_52660331delCA								None (None upstream) : POM121L12 (443018 downstream)																							CGTGCGCGTGCACACACACACA	0.337													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	52755272	52755272	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52755272delC								None (None upstream) : POM121L12 (348077 downstream)																							accaccttttccccacatttg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53372862	53372863	+	IGR	INS	-	T	T	rs150313351	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53372862_53372863insT								POM121L12 (268245 upstream) : HPVC1 (896054 downstream)																							ACATTTCTACATTTTTTCCCAA	0.337													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53936496	53936497	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53936496_53936497insA								POM121L12 (831879 upstream) : HPVC1 (332420 downstream)																							gactccatctcaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	54048728	54048731	+	IGR	DEL	CACA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54048728_54048731delCACA								POM121L12 (944111 upstream) : HPVC1 (220186 downstream)																							aaacacacaccacacacacacaca	0.000													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55526766	55526767	+	IGR	INS	-	T	T	rs148052287	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55526766_55526767insT								LANCL2 (25333 upstream) : VOPP1 (11540 downstream)																							tttgttgagagtttttttttat	0.000													3	3	---	---	---	---	
VOPP1	81552	broad.mit.edu	37	7	55550176	55550183	+	Intron	DEL	TTTTTTTT	-	-	rs71949845		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55550176_55550183delTTTTTTTT	uc003tqs.2	-						VOPP1_uc003tqq.2_Intron|VOPP1_uc010kzh.2_Intron|VOPP1_uc010kzi.2_Intron|VOPP1_uc011kcr.1_Intron	NM_030796	NP_110423	Q96AW1	VOPP1_HUMAN	EGFR-coamplified and overexpressed protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity				0						acctggctaatttttttttttttttttt	0.000													4	3	---	---	---	---	
VOPP1	81552	broad.mit.edu	37	7	55586499	55586500	+	Intron	INS	-	G	G	rs140729282	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55586499_55586500insG	uc003tqs.2	-						VOPP1_uc003tqq.2_Intron|VOPP1_uc010kzh.2_Intron|VOPP1_uc010kzi.2_Intron|VOPP1_uc011kcr.1_Intron	NM_030796	NP_110423	Q96AW1	VOPP1_HUMAN	EGFR-coamplified and overexpressed protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity				0						TACTGTTAAAAGGCATTGTTCC	0.277													2	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55729487	55729487	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55729487delA								LOC442308 (14845 upstream) : FKBP9L (19281 downstream)																							agacctagagaagaataatga	0.020													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57075617	57075617	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57075617delC								DKFZp434L192 (510640 upstream) : ZNF479 (111711 downstream)																							CTGCCGGCCGCCCCAACCTGC	0.612													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57701293	57701300	+	IGR	DEL	AAGACCTC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57701293_57701300delAAGACCTC								ZNF716 (168028 upstream) : None (None downstream)																							GACATAAGCAAAGACCTCTGGTGTCCAG	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57976562	57976562	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57976562delT								ZNF716 (443297 upstream) : None (None downstream)																							gaaaaggaaatatcttcacat	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61831385	61831385	+	IGR	DEL	T	-	-	rs113433766		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61831385delT								None (None upstream) : LOC643955 (920287 downstream)																							tgcggcagtattcacaatagc	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63635253	63635253	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63635253delA								ZNF727 (96328 upstream) : ZNF735 (32328 downstream)																							CCCTTTTTTTACCCTTGTCCT	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64522341	64522342	+	Intron	DEL	TG	-	-	rs71567899		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64522341_64522342delTG	uc003ttt.1	+						uc010kzt.1_Intron					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																		aTTGAGAAACTGTTACTTGATT	0.045													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65952421	65952421	+	IGR	DEL	A	-	-	rs112842055		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65952421delA								NCRNA00174 (87026 upstream) : LOC493754 (41025 downstream)																							tctctcaaagaaaaaaaaaaa	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	66429663	66429663	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66429663delA								C7orf42 (6126 upstream) : SBDS (23027 downstream)																							agGCTCCTTTAAAAAAAAAAA	0.035													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	66973300	66973300	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66973300delG								STAG3L4 (186788 upstream) : None (None downstream)																							CTTTCTCAGTGGACTCAGCAG	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67927885	67927886	+	IGR	INS	-	ATTCCCT	ATTCCCT			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67927885_67927886insATTCCCT								None (None upstream) : None (None downstream)																							cttcccctccccccctcctgtt	0.005													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71552857	71552858	+	Intron	DEL	GA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71552857_71552858delGA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TCTAAAAATTGAGAGTGTACgc	0.183													4	2	---	---	---	---	
LIMK1	3984	broad.mit.edu	37	7	73508247	73508248	+	Intron	INS	-	GGGGCA	GGGGCA	rs3082562		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73508247_73508248insGGGGCA	uc003uaa.1	+						RFC2_uc011kfa.1_Intron|LIMK1_uc010lbl.1_Intron|LIMK1_uc003uab.2_Intron	NM_002314	NP_002305	P53667	LIMK1_HUMAN	LIM domain kinase 1						actin cytoskeleton organization|axon guidance|negative regulation of ubiquitin-protein ligase activity|positive regulation of actin filament bundle assembly|positive regulation of axon extension|Rho protein signal transduction	cytosol|growth cone|nucleus	ATP binding|heat shock protein binding|protein serine/threonine kinase activity|zinc ion binding			stomach(2)|ovary(1)	3		Lung NSC(55;0.137)				GGGTGAGGGGCGGGGCAGGGGC	0.658													4	3	---	---	---	---	
CLIP2	7461	broad.mit.edu	37	7	73729522	73729523	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73729522_73729523insT	uc003uam.2	+						CLIP2_uc003uan.2_Intron	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2							microtubule associated complex				skin(3)	3						aggagaatggcttgaacctggg	0.000													4	2	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	73964583	73964584	+	Intron	INS	-	AT	AT	rs140689418	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73964583_73964584insAT	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						tcatgatagacatatagcccat	0.000													4	3	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	73974113	73974114	+	Intron	INS	-	T	T	rs112974956		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73974113_73974114insT	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CCCTGCCtttcttttttttttt	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	76017235	76017236	+	IGR	INS	-	AAAC	AAAC	rs145891488	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76017235_76017236insAAAC								YWHAG (28893 upstream) : SRCRB4D (1411 downstream)																							actgcatctcaaaacaaacaaa	0.000													5	3	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76626342	76626344	+	Intron	DEL	GTG	-	-	rs36027405		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76626342_76626344delGTG	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						gtgtggaggtgtggggtgtatgg	0.000													4	4	---	---	---	---	
PHTF2	57157	broad.mit.edu	37	7	77564895	77564895	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77564895delT	uc003ugs.3	+						PHTF2_uc003ugp.2_Intron|PHTF2_uc003ugq.3_Intron|PHTF2_uc010ldv.2_Intron|PHTF2_uc003ugt.3_Intron|PHTF2_uc003ugu.3_Intron|PHTF2_uc003ugv.2_Intron|PHTF2_uc010ldw.1_Intron	NM_001127357	NP_001120829	Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1						CTCTTTTGCCTTTTGGCATTC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	88983733	88983734	+	IGR	DEL	CA	-	-	rs111877237		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88983733_88983734delCA								ZNF804B (17389 upstream) : DPY19L2P4 (764980 downstream)																							caagcacacgcacacacacaca	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	94474377	94474377	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94474377delG								PEG10 (175373 upstream) : PPP1R9A (62572 downstream)																							tctcccatttgaaatagctgt	0.000													4	2	---	---	---	---	
TECPR1	25851	broad.mit.edu	37	7	97872289	97872290	+	Intron	DEL	CC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97872289_97872290delCC	uc003upg.2	-						TECPR1_uc003uph.1_Intron	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1							integral to membrane	protein binding			pancreas(1)	1						tccacccacacccatccatcca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98308917	98308917	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98308917delC								NPTX2 (49736 upstream) : TMEM130 (135195 downstream)																							cccgtctctactaaaaataca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98379561	98379562	+	IGR	INS	-	AG	AG			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98379561_98379562insAG								NPTX2 (120380 upstream) : TMEM130 (64550 downstream)																							cagaaattgtcagagtggataa	0.000													4	2	---	---	---	---	
TRRAP	8295	broad.mit.edu	37	7	98578011	98578012	+	Intron	INS	-	AA	AA	rs148988478	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98578011_98578012insAA	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTTCTAATCACAGAGATGTTTG	0.307													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98823207	98823214	+	IGR	DEL	TTATTTTT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98823207_98823214delTTATTTTT								KPNA7 (18118 upstream) : MYH16 (47710 downstream)																							gcccagcttattatttttttatttttgt	0.101													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100117838	100117839	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100117838_100117839insT								C7orf51 (25416 upstream) : AGFG2 (18995 downstream)																							ttagctcttggttttttttttc	0.000													4	2	---	---	---	---	
ORAI2	80228	broad.mit.edu	37	7	102085744	102085745	+	Intron	INS	-	T	T	rs150433550		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102085744_102085745insT	uc010lhz.1	+						ORAI2_uc003uzj.2_Intron|ORAI2_uc003uzk.2_Intron|ORAI2_uc011kks.1_Intron	NM_001126340	NP_001119812	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator							integral to membrane	protein binding			ovary(1)|kidney(1)	2						TCCGTTTTTTGttttttttttt	0.248													4	3	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													4	2	---	---	---	---	
FLJ43663	378805	broad.mit.edu	37	7	130685289	130685289	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130685289delT	uc011kpk.1	-						FLJ43663_uc003vqo.1_Intron|FLJ43663_uc003vqp.2_Intron|FLJ43663_uc003vqq.2_Intron	NR_024153				Homo sapiens cDNA FLJ43663 fis, clone SYNOV4005989.												0						ACGGTCATACTTCTAGGTGTC	0.443													4	2	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	148027195	148027198	+	Intron	DEL	GATA	-	-	rs116537013		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148027195_148027198delGATA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ggaatggatggatagatggagtgg	0.103										HNSCC(39;0.1)			5	3	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152103075	152103075	+	Intron	DEL	G	-	-	rs66994474		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152103075delG	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ctctgtctcagaaaaaaaaaa	0.114			N		medulloblastoma								4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155919928	155919928	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155919928delC								SHH (314961 upstream) : C7orf4 (413257 downstream)																							GTGCTCGAGGCCGTGGATGTG	0.502													4	2	---	---	---	---	
RNF32	140545	broad.mit.edu	37	7	156453904	156453905	+	Intron	INS	-	ATA	ATA	rs143784370	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156453904_156453905insATA	uc003wmo.2	+						RNF32_uc010lqm.2_Intron|RNF32_uc003wmq.2_Intron|RNF32_uc003wmr.2_Intron|RNF32_uc003wmu.2_Intron	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32							aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		aaggagtgggcataaggggcat	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	157313566	157313566	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157313566delG								DNAJB6 (103434 upstream) : PTPRN2 (18185 downstream)																							GTTATCTACTGGGGGCTTCCT	0.224													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157580339	157580339	+	Intron	DEL	G	-	-	rs150920506	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157580339delG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CACACTGACCGGGGCCTCCCT	0.622													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157939938	157939939	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157939938_157939939insA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGCCACGTGTCTTTCCCCTTCA	0.574													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158261748	158261749	+	Intron	DEL	CC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158261748_158261749delCC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		ACTATGCACACCCACACACACT	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	967526	967527	+	Intron	INS	-	TG	TG	rs138535174		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:967526_967527insTG	uc003wpj.1	+						uc003wpk.2_Intron					Homo sapiens cDNA clone IMAGE:4824304.																		GACGCCTCCACTGTGTGTGACC	0.604													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1758820	1758821	+	IGR	INS	-	CT	CT	rs142935004	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1758820_1758821insCT								CLN8 (24085 upstream) : MIR596 (6576 downstream)																							ggtgtgaactcgtgtgtctcac	0.104													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	18081633	18081633	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18081633delT								NAT1 (436 upstream) : NAT2 (167122 downstream)																							TGTACTGGCCTTTTCCAGCTC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	18318419	18318419	+	IGR	DEL	A	-	-	rs111714358		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18318419delA								NAT2 (59696 upstream) : PSD3 (66395 downstream)																							actctgtctcaaaaaaaaaac	0.134													1	5	---	---	---	---	
SCARA5	286133	broad.mit.edu	37	8	27776170	27776171	+	Intron	INS	-	AGG	AGG	rs140132210	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27776170_27776171insAGG	uc003xgj.2	-						SCARA5_uc010luz.2_Intron|SCARA5_uc003xgk.2_Intron|SCARA5_uc003xgl.2_Intron	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5						cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		ggaggaggaaaaggaagatgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	28495167	28495170	+	IGR	DEL	ATCT	-	-	rs57668676		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28495167_28495170delATCT								FZD3 (73208 upstream) : EXTL3 (63983 downstream)																							aaaacaaTCAATCTGTGGATTGGC	0.260													4	2	---	---	---	---	
IDO2	169355	broad.mit.edu	37	8	39800150	39800151	+	Intron	DEL	CT	-	-	rs151135243		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39800150_39800151delCT	uc010lwy.1	+						IDO2_uc003xno.1_Intron	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1						tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						cagaatgagactctgtataaca	0.010													0	6	---	---	---	---	
IKBKB	3551	broad.mit.edu	37	8	42173213	42173213	+	Intron	DEL	T	-	-	rs67859732		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42173213delT	uc003xow.1	+						IKBKB_uc003xov.2_Intron|IKBKB_uc010lxh.1_Intron|IKBKB_uc011lco.1_Intron|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_Intron|IKBKB_uc011lcp.1_Intron|IKBKB_uc011lcq.1_Intron|IKBKB_uc010lxi.1_Intron|IKBKB_uc011lcr.1_Intron	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta						anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	agtctccctcttgtcacccag	0.095													4	2	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48389181	48389181	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48389181delC	uc003xqd.2	+						KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				GCCTGGACCACCCCAACCCAG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49489500	49489502	+	IGR	DEL	GGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49489500_49489502delGGA								UBE2V2 (515048 upstream) : EFCAB1 (133849 downstream)																							GAAATGTGCTGGAGGACATCTGA	0.414													4	2	---	---	---	---	
PCMTD1	115294	broad.mit.edu	37	8	52731615	52731616	+	3'UTR	INS	-	AAAG	AAAG	rs145243473	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52731615_52731616insAAAG	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				ATTAGGAAAACAAACAAACAAT	0.297													3	3	---	---	---	---	
ST18	9705	broad.mit.edu	37	8	53028243	53028243	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53028243delA	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				aaaattgcctaaggacacatt	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61840239	61840240	+	IGR	DEL	TG	-	-	rs112084379		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61840239_61840240delTG								CHD7 (60776 upstream) : CLVS1 (360285 downstream)																							CAGCTCAGCTtgtgtgtgtgtg	0.312													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64260525	64260526	+	IGR	INS	-	C	C	rs140599986	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64260525_64260526insC								YTHDF3 (135180 upstream) : None (None downstream)																							cttttctttttcttccttcctt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	67128140	67128141	+	IGR	INS	-	A	A	rs139406300	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67128140_67128141insA								CRH (37442 upstream) : RRS1 (213122 downstream)																							CATTTTGGAAGAAAAAAATCAA	0.386													3	3	---	---	---	---	
RALYL	138046	broad.mit.edu	37	8	85701135	85701135	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85701135delG	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron|RALYL_uc003ycu.3_Intron|RALYL_uc003ycv.3_Intron	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						TGAGCAATCAGGAATGTGTGC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	94402457	94402458	+	IGR	INS	-	A	A	rs141181054	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94402457_94402458insA								C8orf83 (372556 upstream) : FAM92A1 (310315 downstream)																							TTTAATAGACTTTTACTGATAA	0.441													2	4	---	---	---	---	
CDH17	1015	broad.mit.edu	37	8	95203381	95203382	+	Intron	INS	-	T	T	rs146639781	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95203381_95203382insT	uc003ygh.2	-						CDH17_uc011lgo.1_Intron|CDH17_uc011lgp.1_Intron	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor							integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			catattcctgattttaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96363955	96363955	+	IGR	DEL	T	-	-	rs71569122		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96363955delT								C8orf37 (82518 upstream) : GDF6 (790605 downstream)																							ttttgttttgttttttttttt	0.353													4	2	---	---	---	---	
PTDSS1	9791	broad.mit.edu	37	8	97335916	97335916	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97335916delA	uc003yht.1	+						PTDSS1_uc003yhu.1_Intron	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1						phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	ctgtgatgggaggggcagcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	102461853	102461854	+	IGR	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102461853_102461854delCA								NACAP1 (76918 upstream) : GRHL2 (42814 downstream)																							atggagaaaccacacacacaca	0.000													4	2	---	---	---	---	
NCALD	83988	broad.mit.edu	37	8	103116321	103116322	+	Intron	DEL	CC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103116321_103116322delCC	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718	P61601	NCALD_HUMAN	neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			CAAACTATATCCGCACGCGTGA	0.312													4	2	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106360286	106360286	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106360286delG	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TTTAAATGTTGGGACAAAATC	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	107832731	107832735	+	IGR	DEL	CCCTC	-	-	rs72412226	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107832731_107832735delCCCTC								ABRA (50259 upstream) : ANGPT1 (428976 downstream)																							cccttcccttccctcccctcccctc	0.083													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117847767	117847767	+	IGR	DEL	A	-	-	rs11367619		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117847767delA								UTP23 (60848 upstream) : RAD21 (10407 downstream)																							actccatctcaaaaaaaaaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122822646	122822647	+	IGR	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122822646_122822647delCA								HAS2AS (165713 upstream) : ZHX2 (971254 downstream)																							TTTGCATACCCACACACACACA	0.356													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	123521894	123521894	+	IGR	DEL	T	-	-	rs141106183		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123521894delT								HAS2AS (864961 upstream) : ZHX2 (272007 downstream)																							tgctcaattgttttTTTtttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125930810	125930812	+	5'Flank	DEL	TTT	-	-	rs76996014		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125930810_125930812delTTT	uc003yrm.1	-											DQ589438																		gttgttcccattttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128744520	128744520	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128744520delT	uc003ysg.2	-											Homo sapiens, clone IMAGE:5554747, mRNA.																		tcttcttttcttttttttttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128762350	128762351	+	IGR	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128762350_128762351delTC								MYC (8672 upstream) : PVT1 (44428 downstream)																							cttccttccttctctctctctc	0.025													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	132557819	132557819	+	IGR	DEL	T	-	-	rs36107153		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132557819delT								ADCY8 (504984 upstream) : EFR3A (358540 downstream)																							ctttcctcccttttcttgtgg	0.000													4	2	---	---	---	---	
EFR3A	23167	broad.mit.edu	37	8	132928873	132928873	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132928873delT	uc003yte.2	+							NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			AACATGTTTATTTAAAGATGG	0.378													4	2	---	---	---	---	
TMEM71	137835	broad.mit.edu	37	8	133737292	133737293	+	Intron	INS	-	T	T	rs149085173		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133737292_133737293insT	uc003ytp.2	-						TMEM71_uc003ytm.1_Intron|TMEM71_uc003ytn.2_Intron|TMEM71_uc003yto.2_Intron	NM_144649	NP_653250	Q6P5X7	TMM71_HUMAN	transmembrane protein 71 isoform 1							integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			tcttttttttcttttttttttt	0.183													4	2	---	---	---	---	
WISP1	8840	broad.mit.edu	37	8	134230943	134230943	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134230943delT	uc003yub.2	+						WISP1_uc003yuc.2_Intron|WISP1_uc010meb.2_Intron|WISP1_uc010mec.2_Intron|WISP1_uc010med.2_Intron|WISP1_uc003yud.2_Intron	NM_003882	NP_003873	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1						cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CCACTCATGATGTCCGGGGCT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134727695	134727695	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134727695delT								ST3GAL1 (143512 upstream) : ZFAT (762338 downstream)																							tctctccccctctcccttttc	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140140435	140140435	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140140435delA								COL22A1 (214199 upstream) : KCNK9 (472647 downstream)																							ttgggggaagaatgggagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140427030	140427031	+	IGR	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140427030_140427031delCA								COL22A1 (500794 upstream) : KCNK9 (186051 downstream)																							cagaaaTATGcacacacacaca	0.158													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	140769188	140769188	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140769188delA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						GGGTTGGGGTATAAGGACAGC	0.627													7	5	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143413834	143413835	+	Intron	INS	-	ATAA	ATAA	rs140979752	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143413834_143413835insATAA	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron|TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					attttagaattagtggtgatta	0.000													3	3	---	---	---	---	
LOC100133669	100133669	broad.mit.edu	37	8	144078054	144078054	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144078054delC	uc011ljz.1	-							NR_026913				Homo sapiens, clone IMAGE:3342869, mRNA.												0						GAGACAAGGTCCATAGGTATG	0.373													4	2	---	---	---	---	
GLIS3	169792	broad.mit.edu	37	9	3829318	3829318	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3829318delC	uc003zhw.1	-	9	2377	c.2183delG	c.(2182-2184)GGCfs	p.G728fs	GLIS3_uc003zhx.1_Frame_Shift_Del_p.G883fs|GLIS3_uc010mhf.1_Frame_Shift_Del_p.G277fs|GLIS3_uc003zhv.1_RNA	NM_152629	NP_689842	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3 isoform b	728					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		ACCTGTAATGCCCGAGTGAGT	0.552													16	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	19279680	19279680	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19279680delA								PLIN2 (152107 upstream) : DENND4C (11022 downstream)																							ttctcaagacaaaaaaaaaaa	0.000													6	4	---	---	---	---	
PLAA	9373	broad.mit.edu	37	9	26908166	26908166	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26908166delT	uc003zqd.2	-						PLAA_uc003zqe.2_Intron	NM_001031689	NP_001026859	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein						phospholipid metabolic process|signal transduction		phospholipase A2 activator activity				0		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		GAGCtttgtcttttttttttt	0.169													5	3	---	---	---	---	
CNTNAP3	79937	broad.mit.edu	37	9	39149853	39149853	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39149853delC	uc004abi.2	-	10	1838	c.1599delG	c.(1597-1599)GCGfs	p.A533fs	CNTNAP3_uc004abj.2_Frame_Shift_Del_p.A533fs|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Frame_Shift_Del_p.A533fs|CNTNAP3_uc011lqs.1_Intron|CNTNAP3_uc004abl.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	533	Extracellular (Potential).|Laminin G-like 2.				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AACTCCCCAGCGCCCCCTGCT	0.542													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68439331	68439331	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68439331delT								FAM27B (645142 upstream) : MIR1299 (562908 downstream)																							AGCATAGTAAttttttttttt	0.209													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68484587	68484587	+	IGR	DEL	A	-	-	rs144201555	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68484587delA								FAM27B (690398 upstream) : MIR1299 (517652 downstream)																							tgtagaaatgagggtttcatt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69001402	69001403	+	IGR	INS	-	T	T	rs142560516		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69001402_69001403insT								None (None upstream) : MIR1299 (836 downstream)																							cagaacactgctgctggaatct	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70188644	70188645	+	Intron	DEL	TA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70188644_70188645delTA	uc004afw.2	-											Homo sapiens COBW domain containing 5, mRNA (cDNA clone IMAGE:5287337), complete cds.																		tttttttttttaatatccttac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70839054	70839055	+	IGR	DEL	GT	-	-	rs11143007	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70839054_70839055delGT								CBWD3 (338991 upstream) : FOXD4L3 (78728 downstream)																							atccacagaggtgtaagaggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74423276	74423276	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74423276delT								TMEM2 (39476 upstream) : FAM108B1 (54094 downstream)																							TTCATTCACCTTAAAACACTC	0.413													4	2	---	---	---	---	
GNA14	9630	broad.mit.edu	37	9	80163864	80163864	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80163864delT	uc004aku.2	-							NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						tttttttttctttttttttct	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	85812147	85812148	+	IGR	DEL	GG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85812147_85812148delGG								RASEF (134104 upstream) : FRMD3 (45757 downstream)																							AGGTTATTATGGGCATGTTGAT	0.441													4	2	---	---	---	---	
KIF27	55582	broad.mit.edu	37	9	86453156	86453157	+	Intron	INS	-	T	T	rs77059662		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86453156_86453157insT	uc004ana.2	-						KIF27_uc010mpw.2_Intron|KIF27_uc010mpx.2_Intron	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27						cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						Gttttttgttgttttttttttg	0.158													3	3	---	---	---	---	
SPTLC1	10558	broad.mit.edu	37	9	94870033	94870034	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94870033_94870034insA	uc004arl.1	-						SPTLC1_uc011ltv.1_Intron|SPTLC1_uc004arm.1_Intron|SPTLC1_uc004arn.1_Intron	NM_006415	NP_006406	O15269	SPTC1_HUMAN	serine palmitoyltransferase subunit 1 isoform a							integral to membrane|SPOTS complex	protein binding|pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			ovary(1)|breast(1)	2					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	gactctgtctcaaaaaaaaaaG	0.139													4	2	---	---	---	---	
HABP4	22927	broad.mit.edu	37	9	99220909	99220909	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99220909delT	uc010msg.2	+						HABP4_uc010msh.2_Intron	NM_014282	NP_055097	Q5JVS0	HABP4_HUMAN	hyaluronan binding protein 4						platelet activation|platelet degranulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|extracellular region|nucleus	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				tctttctttcttttttttttt	0.199													7	4	---	---	---	---	
ABCA1	19	broad.mit.edu	37	9	107585866	107585866	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107585866delA	uc004bcl.2	-							NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	actacctgagaaccaaggagg	0.015													4	2	---	---	---	---	
ABCA1	19	broad.mit.edu	37	9	107628767	107628767	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107628767delT	uc004bcl.2	-						ABCA1_uc004bcm.2_Intron	NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	tttttgtgacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110873004	110873005	+	IGR	INS	-	A	A	rs150825364	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110873004_110873005insA								KLF4 (620957 upstream) : ACTL7B (743866 downstream)																							ctccacaTTATAAAAAAAAAAT	0.109													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	116419911	116419912	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116419911_116419912delAC								RGS3 (59894 upstream) : ZNF618 (218650 downstream)																							gtgcacacagacacacacacac	0.183													4	2	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119722277	119722279	+	Intron	DEL	CTG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119722277_119722279delCTG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TAAGTCATGTCTGCTGGTGCTGC	0.562													4	2	---	---	---	---	
DBC1	1620	broad.mit.edu	37	9	122057594	122057594	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122057594delA	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						agtggacaggaatacattctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	124101276	124101276	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124101276delG								GSN (6156 upstream) : STOM (78 downstream)																							CAGAACCGGAGGATCTAATGT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	126971153	126971153	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126971153delC								LHX2 (175711 upstream) : NEK6 (48733 downstream)																							ccatctctctcaataggtaac	0.000													4	2	---	---	---	---	
NEK6	10783	broad.mit.edu	37	9	127017141	127017142	+	5'Flank	DEL	TT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127017141_127017142delTT	uc004bof.2	+							NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2						apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						TCCATCAAACtttttttttttt	0.287													4	2	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128091914	128091915	+	Intron	DEL	TT	-	-	rs34021614		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128091914_128091915delTT	uc010mwx.2	+						GAPVD1_uc011lzs.1_Intron|GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc010mwy.1_Intron	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AATTTGGTGGTTTTTTTTTTTT	0.267													3	3	---	---	---	---	
FAM129B	64855	broad.mit.edu	37	9	130328411	130328411	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130328411delA	uc004brh.2	-						FAM129B_uc004bri.2_Intron|FAM129B_uc004brj.3_Intron	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1								protein binding				0						accttgtctcaaaaaaaaaaa	0.204													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	130898303	130898303	+	IGR	DEL	T	-	-	rs66745605		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130898303delT								LOC389791 (5392 upstream) : LCN2 (13429 downstream)																							TCTAGGGCCCTTGTGCACAGG	0.408													4	4	---	---	---	---	
LRRC8A	56262	broad.mit.edu	37	9	131647115	131647117	+	Intron	DEL	CAC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131647115_131647117delCAC	uc004bwl.3	+						CCBL1_uc004bwh.2_5'Flank|CCBL1_uc010myn.2_5'Flank|CCBL1_uc004bwj.2_5'Flank|CCBL1_uc011mbl.1_5'Flank|CCBL1_uc004bwi.2_5'Flank|CCBL1_uc010myo.2_5'Flank|CCBL1_uc004bwk.2_5'Flank|LRRC8A_uc010myp.2_Intron|LRRC8A_uc010myq.2_Intron	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member						pre-B cell differentiation	integral to membrane					0						ACTGCCTAGTCACCACCACCCCG	0.552													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132155265	132155266	+	IGR	INS	-	AT	AT	rs147572369	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132155265_132155266insAT								C9orf106 (70383 upstream) : C9orf50 (219240 downstream)																							agggcccacacgtcaggggtgg	0.228													4	2	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135303001	135303002	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135303001_135303002insA	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						gactctgtctcaaaaaaaaaca	0.000													4	2	---	---	---	---	
RALGDS	5900	broad.mit.edu	37	9	135993964	135993964	+	Intron	DEL	A	-	-	rs35779155		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135993964delA	uc004cco.2	-						RALGDS_uc004ccp.2_Intron|RALGDS_uc004ccq.2_Intron|RALGDS_uc004ccr.2_Intron|RALGDS_uc011mcv.1_Intron|RALGDS_uc004ccs.2_Intron|RALGDS_uc011mcw.1_Intron	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator						nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		GGACCTCCCCAAAACCTGCTG	0.328			T	CIITA	PMBL|Hodgkin Lymphona|								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137514189	137514189	+	IGR	DEL	T	-	-	rs35603257		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137514189delT								RXRA (181758 upstream) : COL5A1 (19463 downstream)																							CAGGTACTTCTTCCTACGCAA	0.303													3	6	---	---	---	---	
SOHLH1	402381	broad.mit.edu	37	9	138591080	138591080	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138591080delG	uc004cgl.2	-						KCNT1_uc011mdq.1_5'Flank|KCNT1_uc011mdr.1_5'Flank|KCNT1_uc010nbf.2_5'Flank|SOHLH1_uc010nbe.2_Intron	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic						cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			breast(1)|central_nervous_system(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		AGCCAAGACTGGGTCACGTAG	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	1851904	1851905	+	IGR	DEL	TG	-	-	rs34009654		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1851904_1851905delTG								ADARB2 (72186 upstream) : None (None downstream)																							ggtgtgtgtatgtgtgtgtgtg	0.371													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6109422	6109423	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6109422_6109423insA								IL2RA (5150 upstream) : RBM17 (21526 downstream)																							ATTGAATGCAGAAAAAAAAAGG	0.376													4	2	---	---	---	---	
CAMK1D	57118	broad.mit.edu	37	10	12543859	12543859	+	Intron	DEL	A	-	-	rs67067474		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12543859delA	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		TGTGGTCCCCAAAAGCCATTT	0.353													3	3	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14610334	14610336	+	Intron	DEL	GGG	-	-	rs10612412		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14610334_14610336delGGG	uc001ina.1	-						FAM107B_uc010qbu.1_Intron|FAM107B_uc009xjg.1_Intron|FAM107B_uc001imy.1_Intron|FAM107B_uc001imz.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						tgaagATACTGGGGGAGGAGGAG	0.300													4	2	---	---	---	---	
ACBD7	414149	broad.mit.edu	37	10	15059240	15059240	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15059240delG	uc010qby.1	-	6	442	c.133delC	c.(133-135)CAAfs	p.Q45fs				Q8N6N7	ACBD7_HUMAN	SubName: Full=cDNA FLJ52263, highly similar to Artemis protein (EC 3.1.-.-);	Error:Variant_position_missing_in_Q8N6N7_after_alignment							fatty-acyl-CoA binding				0						CTTGGAATTTGGTAAAATCTT	0.368													31	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	21652878	21652878	+	IGR	DEL	A	-	-	rs67260557		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21652878delA								NEBL (189762 upstream) : C10orf114 (130544 downstream)																							AAGAGGGAATAAAAAAAAAAA	0.393													4	2	---	---	---	---	
MASTL	84930	broad.mit.edu	37	10	27472199	27472201	+	Intron	DEL	TTG	-	-	rs147321879		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27472199_27472201delTTG	uc001itm.2	+						MASTL_uc001itl.2_Intron|MASTL_uc009xkw.1_Intron|MASTL_uc009xkx.1_Intron	NM_032844	NP_116233	Q96GX5	GWL_HUMAN	microtubule associated serine/threonine						cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						TAAAATTCTTttgttgttgttgt	0.163													2	5	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32329483	32329483	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32329483delA	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				AGAAAAGGTTAAAAAAAAAAT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	32550251	32550252	+	IGR	DEL	GT	-	-	rs140770107		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32550251_32550252delGT								KIF5B (204880 upstream) : EPC1 (7607 downstream)																							gtgtatgtgcgtgtgtgtgtgt	0.000													4	3	---	---	---	---	
C10orf68	79741	broad.mit.edu	37	10	33014843	33014843	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33014843delA	uc001iwn.3	+						C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Intron|C10orf68_uc010qei.1_Intron|C10orf68_uc001iwo.3_5'Flank	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68											skin(2)|ovary(1)	3						aaaccatatcaaatatgtaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34225331	34225331	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34225331delA								NRP1 (601325 upstream) : PARD3 (174767 downstream)																							gtctcaaaagaaaaaaaaaaa	0.174													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38894457	38894457	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38894457delA								LOC399744 (153377 upstream) : None (None downstream)																							tattttgtctacAGCAGACAG	0.313													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42658919	42658919	+	IGR	DEL	T	-	-	rs143364099		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42658919delT								None (None upstream) : LOC441666 (168396 downstream)																							TATTTGTGCATTTTTTTCCTA	0.239													2	4	---	---	---	---	
ZNF487	642819	broad.mit.edu	37	10	43936105	43936106	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43936105_43936106insA	uc010qfb.1	+							NR_026693				SubName: Full=cDNA FLJ52643, weakly similar to Zinc finger protein 11B;												0						gactctgtctcaaaaaaaaaaa	0.030													5	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47018723	47018728	+	Intron	DEL	AAAACA	-	-	rs71223641		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47018723_47018728delAAAACA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						aaaacaaaacaaaacaaaaaaacaac	0.000													2	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47141632	47141632	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47141632delT	uc001jed.3	-						uc001jef.2_Intron			P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						aacctctgtctttacacacac	0.000													4	3	---	---	---	---	
ANTXRL	195977	broad.mit.edu	37	10	47670794	47670795	+	Intron	DEL	CT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47670794_47670795delCT	uc001jel.2	+							NR_003601				Homo sapiens cDNA FLJ32754 fis, clone TESTI2001671.												0						GAGGACATTACTAGGCCCTTAG	0.619													4	2	---	---	---	---	
ARHGAP22	58504	broad.mit.edu	37	10	49813847	49813848	+	5'Flank	INS	-	TA	TA			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49813847_49813848insTA	uc001jgt.2	-						ARHGAP22_uc001jgu.2_5'Flank|ARHGAP22_uc010qgl.1_5'Flank|ARHGAP22_uc010qgm.1_Intron|ARHGAP22_uc001jgv.2_Intron	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						gaagcaggtgctatatatatag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50406268	50406269	+	IGR	INS	-	A	A	rs34325446		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50406268_50406269insA								C10orf128 (9861 upstream) : C10orf71 (100918 downstream)																							gactctgtctcaaaaaaaaaaa	0.119													4	3	---	---	---	---	
CCDC6	8030	broad.mit.edu	37	10	61641897	61641898	+	Intron	DEL	CG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61641897_61641898delCG	uc001jks.3	-							NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		aaaggaaagccgcggggagaag	0.109													4	2	---	---	---	---	
ZNF365	22891	broad.mit.edu	37	10	64038964	64038965	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64038964_64038965insA	uc001jly.3	+							NM_014951	NP_055766	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform A											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					gattacgaggcaaggagatcga	0.045													4	2	---	---	---	---	
DDX50	79009	broad.mit.edu	37	10	70689871	70689871	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70689871delT	uc001jou.2	+						DDX50_uc010qjc.1_Intron	NM_024045	NP_076950	Q9BQ39	DDX50_HUMAN	nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1						tttcctttccttttttttttt	0.000													4	2	---	---	---	---	
HK1	3098	broad.mit.edu	37	10	71078860	71078860	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71078860delG	uc001jpl.3	+						HK1_uc009xqc.1_Intron|HK1_uc001jpg.3_Intron|HK1_uc001jph.3_Intron|HK1_uc001jpi.3_Intron|HK1_uc001jpj.3_Intron|HK1_uc001jpk.3_Intron|HK1_uc009xqd.2_Intron	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI						glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						TCCGGCGCCCGGCCTTCTCCG	0.667													4	2	---	---	---	---	
CBARA1	10367	broad.mit.edu	37	10	74216705	74216706	+	Intron	DEL	GT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74216705_74216706delGT	uc001jtb.1	-						CBARA1_uc010qjw.1_Intron|CBARA1_uc010qjx.1_Intron|CBARA1_uc009xqo.1_Intron	NM_006077	NP_006068	Q9BPX6	MICU1_HUMAN	calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1						tattgcccaggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
MYOZ1	58529	broad.mit.edu	37	10	75398664	75398664	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75398664delT	uc001jur.2	-							NM_021245	NP_067068	Q9NP98	MYOZ1_HUMAN	myozenin 1						myofibril assembly	nucleus|pseudopodium	FATZ binding			ovary(2)	2	Prostate(51;0.0112)					cctcagatgattggcccacct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	85686694	85686694	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85686694delA								NRG3 (939759 upstream) : GHITM (212491 downstream)																							CCTGTCAAAGAAGGAAAAAGG	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86535359	86535360	+	IGR	INS	-	TT	TT	rs138295367	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535359_86535360insTT								FAM190B (257083 upstream) : GRID1 (823952 downstream)																							cgctctttttctttttcttttt	0.000													4	2	---	---	---	---	
EXOC6	54536	broad.mit.edu	37	10	94661839	94661840	+	Intron	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94661839_94661840delAC	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				acacacacatacacacacacac	0.089													4	2	---	---	---	---	
PDE6C	5146	broad.mit.edu	37	10	95386775	95386775	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95386775delT	uc001kiu.3	+							NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C						visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)				atcccagcactttgggaggct	0.100													4	2	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97226198	97226198	+	Intron	DEL	A	-	-	rs74936427		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97226198delA	uc001kkw.2	-						SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron|SORBS1_uc001kkx.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ctccatctccaaaaaaaaaaa	0.104													3	3	---	---	---	---	
FBXW4	6468	broad.mit.edu	37	10	103372580	103372581	+	Intron	INS	-	CA	CA	rs149791990	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103372580_103372581insCA	uc001kto.2	-							NM_022039	NP_071322	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4						ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	ubiquitin ligase complex				skin(1)	1		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		acatgcacatgcacacacacac	0.465													4	2	---	---	---	---	
TAF5	6877	broad.mit.edu	37	10	105131699	105131699	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105131699delT	uc001kwv.2	+						TAF5_uc010qqq.1_Intron	NM_006951	NP_008882	Q15542	TAF5_HUMAN	TBP-associated factor 5						histone acetylation|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|transcription factor TFIID complex|transcription factor TFTC complex	protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)	2		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		CTTGTTATTGttttttttttt	0.159													4	2	---	---	---	---	
NEURL	9148	broad.mit.edu	37	10	105326739	105326740	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105326739_105326740insT	uc001kxh.2	+							NM_004210	NP_004201	O76050	NEU1A_HUMAN	neuralized-like						nervous system development	perinuclear region of cytoplasm	zinc ion binding				0				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		ttctttctttcttttttttttt	0.074													3	3	---	---	---	---	
SORCS1	114815	broad.mit.edu	37	10	108487797	108487798	+	Intron	INS	-	T	T	rs145580471		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108487797_108487798insT	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		gTAAGCAAGACttttttttttt	0.020													2	5	---	---	---	---	
ATRNL1	26033	broad.mit.edu	37	10	117561600	117561601	+	Intron	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117561600_117561601delCA	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CCCCCACCACCACACACACACA	0.168													4	2	---	---	---	---	
HSPA12A	259217	broad.mit.edu	37	10	118485536	118485537	+	Intron	INS	-	CGCG	CGCG	rs72496747		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118485536_118485537insCGCG	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)		acacacacacacgcacacacac	0.351													4	5	---	---	---	---	
CASC2	255082	broad.mit.edu	37	10	119943316	119943317	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119943316_119943317insT	uc001ldm.3	+						CASC2_uc009xzc.2_Intron	NR_026939				Homo sapiens mRNA for IGM1 protein.												0						TACCTCTCAGATTGTGATTATT	0.421													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	120127237	120127238	+	IGR	INS	-	T	T	rs72398107		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120127237_120127238insT								C10orf84 (25398 upstream) : PRLHR (225678 downstream)																							ACTATATTGACttttttttttt	0.183													4	2	---	---	---	---	
TACC2	10579	broad.mit.edu	37	10	123978534	123978535	+	Intron	DEL	AA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123978534_123978535delAA	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron|TACC2_uc001lfy.2_Intron|TACC2_uc001lfz.2_Intron|TACC2_uc001lga.2_Intron|TACC2_uc009xzy.2_Intron|TACC2_uc001lgb.2_Intron|TACC2_uc010qtw.1_Intron	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				gactcgtctcaaaaaaaaaaaa	0.114													4	2	---	---	---	---	
CHST15	51363	broad.mit.edu	37	10	125825562	125825562	+	Intron	DEL	T	-	-	rs11300716		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125825562delT	uc001lhm.2	-						CHST15_uc001lhn.2_Intron|CHST15_uc010que.1_Intron|CHST15_uc001lho.2_Intron	NM_015892	NP_056976	Q7LFX5	CHSTF_HUMAN	B cell RAG associated protein						hexose biosynthetic process	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity			ovary(1)	1						TCTTTTTGTCTTTTTTTTCTT	0.373													3	3	---	---	---	---	
NKX1-2	390010	broad.mit.edu	37	10	126140478	126140478	+	5'Flank	DEL	T	-	-	rs113067300		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126140478delT	uc010quf.1	-							NM_001146340	NP_001139812	Q9UD57	NKX12_HUMAN	NK1 homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCATGtttacttttttttttt	0.209													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	126905451	126905451	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126905451delA								CTBP2 (55827 upstream) : LOC100169752 (357489 downstream)																							ACAGAGAGGGAAAAGGCACCA	0.522											OREG0002831	type=REGULATORY REGION|Gene=CTBP2-C10orf137|Dataset=Vista Enhancers|EvidenceSubtype=In-vivo LacZ Expression Assay	4	2	---	---	---	---	
ADAM12	8038	broad.mit.edu	37	10	127876899	127876900	+	Intron	INS	-	C	C	rs144567217	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127876899_127876900insC	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GCTCTAATTCTTTGGCCACATC	0.441													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132350463	132350463	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132350463delG								GLRX3 (367679 upstream) : TCERG1L (540193 downstream)																							GCTGTGGGCTGGGGAGGTGGA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133859437	133859438	+	IGR	INS	-	AA	AA	rs111450929		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133859437_133859438insAA								BNIP3 (64002 upstream) : JAKMIP3 (58875 downstream)																							gatcctgtcttaaaaaaaaaaa	0.035													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134878179	134878180	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134878179_134878180delAC								C10orf93 (122115 upstream) : GPR123 (6253 downstream)																							TGCTGGACGAACACACACACAC	0.609													3	3	---	---	---	---	
PRAP1	118471	broad.mit.edu	37	10	135166102	135166102	+	3'UTR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135166102delC	uc001lmp.2	+	5					PRAP1_uc001lmr.2_3'UTR|PRAP1_uc001lmq.1_3'UTR	NM_145202	NP_660203	Q96NZ9	PRAP1_HUMAN	proline-rich acidic protein 1 isoform 1							extracellular region					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)		ccgaggcaggcggatcacctg	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135167469	135167469	+	IGR	DEL	T	-	-	rs71474730		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135167469delT								PRAP1 (1282 upstream) : C10orf125 (1189 downstream)																							TGTTTGTGGCTTTTTTTTTTT	0.423													4	4	---	---	---	---	
LOC619207	619207	broad.mit.edu	37	10	135289251	135289251	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135289251delG	uc001lni.1	+											Homo sapiens cDNA FLJ41380 fis, clone BRCAN2011254.												0						Cctgggctgagggactgcctg	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	383220	383221	+	IGR	DEL	CT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:383220_383221delCT								B4GALNT4 (1104 upstream) : PKP3 (10996 downstream)																							ctctctctccctctctccctca	0.000													3	3	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2436344	2436345	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2436344_2436345insT	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		ACGGAGCCCCCGCTCACCGCCC	0.738													4	2	---	---	---	---	
DNHD1	144132	broad.mit.edu	37	11	6517069	6517070	+	5'Flank	INS	-	AACT	AACT	rs142298595	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6517069_6517070insAACT	uc001mdw.3	+						DNHD1_uc001mdp.2_5'Flank	NM_144666	NP_653267	Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1 isoform 1						microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		aggtagcaggcagttatcagca	0.000													3	3	---	---	---	---	
SYT9	143425	broad.mit.edu	37	11	7434993	7434993	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7434993delT	uc001mfe.2	+						SYT9_uc001mfd.2_Intron|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TGTTTGTTCCTTTtttttttt	0.060													4	4	---	---	---	---	
SWAP70	23075	broad.mit.edu	37	11	9772230	9772230	+	3'UTR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9772230delT	uc001mhw.2	+	12					SWAP70_uc001mhx.2_3'UTR	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		AGCTCTTTCCTTTGGCAGCGT	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	17630007	17630008	+	Intron	DEL	GT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17630007_17630008delGT	uc001mnh.1	+											SubName: Full=Putative uncharacterized protein OTOG;																		GTGTGCACTAGTGTGTGTGTGC	0.545													4	2	---	---	---	---	
KCNC1	3746	broad.mit.edu	37	11	17761221	17761222	+	Intron	DEL	TG	-	-	rs144535999		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17761221_17761222delTG	uc001mnk.3	+						KCNC1_uc009yhc.1_Intron	NM_004976	NP_004967	P48547	KCNC1_HUMAN	Shaw-related voltage-gated potassium channel							voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)	1						tgtgtgagtctgtgtgtgtgtg	0.411													4	2	---	---	---	---	
SERGEF	26297	broad.mit.edu	37	11	17940173	17940174	+	Intron	DEL	AC	-	-	rs34623550		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17940173_17940174delAC	uc001mnm.2	-						SERGEF_uc009yhd.2_Intron|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron	NM_012139	NP_036271	Q9UGK8	SRGEF_HUMAN	deafness locus associated putative guanine						negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1						GCAGGAacagacacacacacac	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23506647	23506647	+	IGR	DEL	C	-	-	rs56145931		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23506647delC								SVIP (655265 upstream) : None (None downstream)																							caaaaaaaaacaaaacaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27286864	27286865	+	IGR	INS	-	A	A	rs142359287		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27286864_27286865insA								BBOX1 (137510 upstream) : CCDC34 (73196 downstream)																							cactctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27505351	27505352	+	IGR	INS	-	AAAA	AAAA	rs11030023	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27505351_27505352insAAAA								LGR4 (11017 upstream) : LIN7C (10619 downstream)																							aacaaacaaacaaaaaaacaCA	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42010502	42010503	+	IGR	INS	-	AAG	AAG			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42010502_42010503insAAG								LRRC4C (529179 upstream) : None (None downstream)																							aaagaaagaaagaaagaaagaa	0.149													6	3	---	---	---	---	
C11orf49	79096	broad.mit.edu	37	11	47019521	47019521	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47019521delT	uc001ndp.2	+						C11orf49_uc001nds.2_Intron|C11orf49_uc001ndq.2_Intron|C11orf49_uc001ndr.2_Intron|C11orf49_uc010rgx.1_Intron|C11orf49_uc010rgy.1_Intron|C11orf49_uc010rgz.1_Intron	NM_024113	NP_077018	Q9H6J7	CK049_HUMAN	hypothetical protein LOC79096 isoform 3												0						agtcggcccctactgggaggt	0.000													4	2	---	---	---	---	
MTCH2	23788	broad.mit.edu	37	11	47657241	47657242	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47657241_47657242insT	uc010rho.1	-						MTCH2_uc001nge.2_Intron|MTCH2_uc010rhp.1_Intron	NM_014342	NP_055157	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2						transport	integral to membrane|mitochondrial inner membrane					0						TAAAGTTTTTGTTTTTTTTTTT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50748777	50748777	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50748777delA								LOC646813 (368974 upstream) : OR4A5 (662671 downstream)																							cacacatcacaaaaaagtttc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56892947	56892947	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56892947delA								OR5AK2 (135631 upstream) : LRRC55 (56274 downstream)																							GCAAAAAGGGAAAACTGGCAT	0.413													4	2	---	---	---	---	
GIF	2694	broad.mit.edu	37	11	59602620	59602621	+	Intron	INS	-	T	T	rs113602045		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59602620_59602621insT	uc001noi.2	-							NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)						cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						Atttcttttccttttttttttt	0.223													4	2	---	---	---	---	
CD6	923	broad.mit.edu	37	11	60784624	60784626	+	Intron	DEL	CTT	-	-	rs151198834		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60784624_60784626delCTT	uc001nqq.2	+						CD6_uc001nqp.2_Intron|CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						AACATCTGTCCTTCTCCTGCCCA	0.542													3	3	---	---	---	---	
CD6	923	broad.mit.edu	37	11	60786153	60786154	+	Intron	INS	-	GTA	GTA	rs143620549	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60786153_60786154insGTA	uc001nqq.2	+						CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						attagccaagggtagcacgtgc	0.000													6	3	---	---	---	---	
CD5	921	broad.mit.edu	37	11	60866950	60866951	+	5'Flank	INS	-	CA	CA	rs28971954		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60866950_60866951insCA	uc009ynk.2	+							NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor						cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		aacatggagatcacacacacat	0.089													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	60937714	60937717	+	IGR	DEL	GTGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60937714_60937717delGTGA								VPS37C (8798 upstream) : PGA3 (33267 downstream)																							CTCAAACCCCGTGAAAGTGCAAGC	0.407													2	4	---	---	---	---	
CPSF7	79869	broad.mit.edu	37	11	61189269	61189269	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61189269delT	uc001nrq.2	-						CPSF7_uc001nro.2_Intron|CPSF7_uc001nrp.2_Intron|CPSF7_uc001nrr.2_Intron|CPSF7_uc001nrs.1_Intron|CPSF7_uc009ynp.2_Intron	NM_001136040	NP_001129512	Q8N684	CPSF7_HUMAN	pre-mRNA cleavage factor I, 59 kDa subunit						mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	mRNA cleavage factor complex	nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						CTTATGTACATTTTTTTCCCC	0.358													4	2	---	---	---	---	
AHNAK	79026	broad.mit.edu	37	11	62218556	62218556	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62218556delT	uc001ntk.1	-							NM_024060	NP_076965	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 2						nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TCCTGGAAtcttttttttttt	0.254													4	2	---	---	---	---	
MARK2	2011	broad.mit.edu	37	11	63611352	63611352	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63611352delT	uc001nxw.2	+						MARK2_uc001nxx.2_Intron|MARK2_uc001nxy.2_Intron|MARK2_uc001nxv.3_Intron	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2						cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						TGGATAAATATTTTTTTTTTG	0.239													4	2	---	---	---	---	
SLC22A20	440044	broad.mit.edu	37	11	65009245	65009246	+	Intron	DEL	AG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65009245_65009246delAG	uc010roc.1	+						SLC22A20_uc001odi.3_Intron	NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						GCCAGCTGCAAGACCCCAGGGA	0.579													4	2	---	---	---	---	
POLA2	23649	broad.mit.edu	37	11	65042147	65042147	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65042147delA	uc001odj.2	+						POLA2_uc009yqf.1_Intron|POLA2_uc010rod.1_Intron	NM_002689	NP_002680	Q14181	DPOA2_HUMAN	DNA-directed DNA polymerase alpha 2						DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding				0					Dacarbazine(DB00851)	actccatctcaaaaaaaaaaa	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	65525688	65525688	+	IGR	DEL	T	-	-	rs112838264		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65525688delT								RNASEH2C (37279 upstream) : DKFZp761E198 (17692 downstream)																							ctTTTTTGTCttttttttttt	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	65707634	65707634	+	IGR	DEL	A	-	-	rs35260775		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65707634delA								DRAP1 (18603 upstream) : TSGA10IP (5481 downstream)																							actccatctcaaaaaaaaaaa	0.199													4	2	---	---	---	---	
PELI3	246330	broad.mit.edu	37	11	66237262	66237263	+	Intron	INS	-	TTT	TTT	rs34461329		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66237262_66237263insTTT	uc001oic.3	+						PELI3_uc001oib.2_Intron|PELI3_uc001oid.3_Intron|PELI3_uc001oie.3_Intron	NM_145065	NP_659502	Q8N2H9	PELI3_HUMAN	pellino 3 alpha isoform 1							cytosol	protein binding			ovary(1)	1						cagggaatctgttttttttttt	0.000													5	3	---	---	---	---	
RBM4	5936	broad.mit.edu	37	11	66398449	66398449	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66398449delT	uc009yrj.2	+						RBM4_uc009yrk.2_Intron	NM_002896	NP_002887	Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4						circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|negative regulation of translation in response to stress|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|positive regulation of muscle cell differentiation|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of nucleocytoplasmic transport|RNA splicing|stress-activated MAPK cascade	nuclear speck|nucleolus|stress granule	miRNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|zinc ion binding			ovary(1)	1				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		TAGCTAtttcttttttttttt	0.095													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	67480266	67480266	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67480266delT								ALDH3B2 (31581 upstream) : LOC645332 (78974 downstream)																							ttcttttttcttttttttttt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68003219	68003220	+	IGR	INS	-	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68003219_68003220insG								SUV420H1 (22151 upstream) : C11orf24 (25585 downstream)																							aagaaaaaaaaggaagcacctc	0.000													4	2	---	---	---	---	
MTL5	9633	broad.mit.edu	37	11	68478774	68478775	+	Intron	DEL	GT	-	-	rs34698323		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68478774_68478775delGT	uc001ooc.2	-							NM_004923	NP_004914	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific isoform						cell differentiation|cellular metal ion homeostasis|multicellular organismal development|response to metal ion|spermatogenesis	cytoplasm|nucleus|soluble fraction	metal ion binding			ovary(2)|breast(1)	3	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			gtgtatatgagtgtgtgtgggg	0.000													6	4	---	---	---	---	
CPT1A	1374	broad.mit.edu	37	11	68526863	68526864	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68526863_68526864insA	uc001oog.3	-						CPT1A_uc001oof.3_Intron|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform						carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	actgtgtctccaaaaaaaaaaa	0.124													6	3	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68924059	68924060	+	Intron	INS	-	GT	GT	rs139902896	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68924059_68924060insGT	uc001oot.2	+							NM_139075		Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CAtgtgtatgcgtgtgtgtgtg	0.416													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69236252	69236253	+	IGR	INS	-	A	A	rs72118103		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69236252_69236253insA								MYEOV (79803 upstream) : CCND1 (219620 downstream)																							gactctgtctcaaaaaaaaaaa	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69848584	69848586	+	IGR	DEL	CAC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69848584_69848586delCAC								FGF3 (214392 upstream) : ANO1 (75822 downstream)																							aaaaaaaaaacaccaaaaaaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	70299084	70299085	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70299084_70299085insT								CTTN (16395 upstream) : SHANK2 (14877 downstream)																							tacttatttacttttttttttc	0.223													4	2	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70529895	70529895	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70529895delT	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CTCCtttttgttttttttttt	0.045													4	2	---	---	---	---	
FCHSD2	9873	broad.mit.edu	37	11	72552419	72552420	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72552419_72552420insT	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|ATG16L2_uc009ytj.1_Intron	NM_014824	NP_055639	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			agcaaaTGCAGTTTTTTTTTGC	0.248													13	6	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73031128	73031129	+	Intron	INS	-	ACTCCCTC	ACTCCCTC	rs141970435	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73031128_73031129insACTCCCTC	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						GAAGGAAAGAAACCCCATGTTC	0.604													3	3	---	---	---	---	
GDPD5	81544	broad.mit.edu	37	11	75157391	75157391	+	Intron	DEL	G	-	-	rs11328124		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75157391delG	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001own.3_Intron|GDPD5_uc009yuc.2_Intron|GDPD5_uc009yud.2_Intron|GDPD5_uc009yue.1_Intron	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						CAGGACTCCAGGAAGGCCCCA	0.552													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	75887860	75887861	+	IGR	DEL	GG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75887860_75887861delGG								UVRAG (32579 upstream) : WNT11 (9510 downstream)																							CGAGGAACCTGGGATACAACTG	0.609													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	75991509	75991510	+	IGR	INS	-	A	A	rs141115429	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75991509_75991510insA								WNT11 (69706 upstream) : PRKRIR (69494 downstream)																							CACCACTTGTTAAAAAATATTC	0.337													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	76479391	76479392	+	IGR	INS	-	GCCTTCCT	GCCTTCCT	rs147459948	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76479391_76479392insGCCTTCCT								GUCY2E (46558 upstream) : TSKU (14893 downstream)																							aactccacacagccttcctgcc	0.248													8	4	---	---	---	---	
TSKU	25987	broad.mit.edu	37	11	76497312	76497312	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76497312delG	uc001oxt.2	+							NM_015516	NP_056331	Q8WUA8	TSK_HUMAN	tsukushin precursor							extracellular region					0	Ovarian(111;0.112)					CCACAGAAGTGGGCCAGTACC	0.328													2	4	---	---	---	---	
C11orf67	28971	broad.mit.edu	37	11	77565040	77565041	+	Intron	DEL	TT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77565040_77565041delTT	uc001oyq.2	+						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron	NM_024684	NP_078960	Q9H7C9	CK067_HUMAN	hypothetical protein LOC28971												0	all_cancers(14;5.69e-19)|all_epithelial(13;2.15e-21)|Breast(9;1.16e-15)|Ovarian(111;0.152)		Epithelial(5;1.37e-49)|all cancers(3;5.58e-46)|BRCA - Breast invasive adenocarcinoma(5;7.26e-31)			ctccaaattctttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89384422	89384423	+	5'Flank	INS	-	T	T	rs111346566		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89384422_89384423insT	uc001pcz.2	+											Homo sapiens mRNA for hypothetical protein, partial cds, clone:Hsa11-digit35-15-11-R.																		TATTGTTGTTCTTTTTTTTttt	0.168													4	2	---	---	---	---	
PANX1	24145	broad.mit.edu	37	11	93905072	93905073	+	Intron	INS	-	T	T	rs140887813	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93905072_93905073insT	uc001per.2	+						PANX1_uc001peq.2_Intron	NM_015368	NP_056183	Q96RD7	PANX1_HUMAN	pannexin 1						positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGAGAACTGGCTTTTTTTTTTC	0.475											OREG0021292	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CWF19L2	143884	broad.mit.edu	37	11	107268577	107268578	+	Intron	INS	-	A	A	rs141496084	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107268577_107268578insA	uc010rvp.1	-						CWF19L2_uc001pjh.3_Intron|CWF19L2_uc009yxo.2_Intron	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control								catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		aggactctgtgaaaaccccccg	0.000													3	4	---	---	---	---	
ALG9	79796	broad.mit.edu	37	11	111737514	111737514	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111737514delA	uc001pmb.2	-						ALG9_uc001ply.2_Intron|ALG9_uc001plz.2_Intron|ALG9_uc010rwm.1_Intron|ALG9_uc010rwn.1_Intron|ALG9_uc010rwo.1_Intron|ALG9_uc009yyh.1_Intron	NM_001077690	NP_001071158	Q9H6U8	ALG9_HUMAN	asparagine-linked glycosylation 9 protein						dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		TGACAAGTTCAAAAAAAAAAA	0.169													4	2	---	---	---	---	
DIXDC1	85458	broad.mit.edu	37	11	111886846	111886846	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111886846delA	uc001pml.2	+						DIXDC1_uc001pmm.2_Intron|DIXDC1_uc001pmn.2_Intron|DIXDC1_uc010rwq.1_Intron	NM_001037954	NP_001033043	Q155Q3	DIXC1_HUMAN	DIX domain containing 1 isoform a						multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity			ovary(1)	1		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		ACCCTGTCTTAAAAAAAAAAA	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112667781	112667782	+	IGR	INS	-	AG	AG	rs138920811	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112667781_112667782insAG								PTS (527104 upstream) : NCAM1 (164213 downstream)																							AGGCAAGACATGTTAGCACTAC	0.297													6	4	---	---	---	---	
ZW10	9183	broad.mit.edu	37	11	113622985	113622986	+	Intron	DEL	TG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113622985_113622986delTG	uc001poe.2	-						ZW10_uc009yyv.2_Intron	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10						cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		atgaacaagAtgtgtgtgtgtg	0.045													4	2	---	---	---	---	
ZBTB16	7704	broad.mit.edu	37	11	113951168	113951169	+	Intron	DEL	CT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113951168_113951169delCT	uc001pop.2	+						ZBTB16_uc001poo.1_Intron|ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997	Q05516	ZBT16_HUMAN	promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		CTGGTGctccctctctctctct	0.391													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116145687	116145688	+	IGR	DEL	GT	-	-	rs7121267		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116145687_116145688delGT								CADM1 (770446 upstream) : BUD13 (473200 downstream)																							CAGAGCAGGGgtgtgtgtgtgt	0.485													4	2	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118388110	118388111	+	Intron	INS	-	A	A	rs11436622		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118388110_118388111insA	uc001pta.2	+						MLL_uc001ptb.2_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		gactctgtctcaaaaaaaaaaa	0.109			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								5	3	---	---	---	---	
PVRL1	5818	broad.mit.edu	37	11	119579148	119579148	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119579148delT	uc001pwv.2	-						PVRL1_uc001pwu.1_Intron|PVRL1_uc001pww.2_Intron	NM_002855	NP_002846	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 1						adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		CACTGACGCCTTTTAAGCAAA	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119929345	119929345	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119929345delG								PVRL1 (329910 upstream) : TRIM29 (52650 downstream)																							CTGCAGACCTGGGGGAAAGCT	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	120057668	120057668	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120057668delC								TRIM29 (48805 upstream) : OAF (24079 downstream)																							AGGTGGCGGGCCCCGACTGGC	0.602													5	3	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120704973	120704976	+	Intron	DEL	GTGT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120704973_120704976delGTGT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	CACTTTATAGgtgtgtgtgtgtgt	0.162													5	4	---	---	---	---	
OR10S1	219873	broad.mit.edu	37	11	123848637	123848639	+	5'Flank	DEL	ATT	-	-	rs34866186		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123848637_123848639delATT	uc001pzm.1	-							NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GACTGTAAGAATTATTTGCAGAA	0.310													2	4	---	---	---	---	
SLC37A2	219855	broad.mit.edu	37	11	124958851	124958852	+	3'UTR	INS	-	GCTCT	GCTCT	rs147623714	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124958851_124958852insGCTCT	uc001qbn.2	+	18					SLC37A2_uc010sau.1_3'UTR|SLC37A2_uc001qbp.2_3'UTR	NM_001145290	NP_001138762	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glycerol-3-phosphate						carbohydrate transport|transmembrane transport	integral to membrane				ovary(2)	2	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		ACTATATGCCAGCTCTAGGAAT	0.465													6	3	---	---	---	---	
PKNOX2	63876	broad.mit.edu	37	11	125240213	125240213	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125240213delT	uc001qbu.2	+						PKNOX2_uc010saz.1_Intron|PKNOX2_uc010sba.1_Intron|PKNOX2_uc010sbb.1_Intron	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TCCAAAGCCCTTCTCACAATC	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	125304056	125304057	+	IGR	INS	-	A	A	rs145353876	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125304056_125304057insA								PKNOX2 (773 upstream) : FEZ1 (11593 downstream)																							GGTAGAGGAAGAAAATCTTAAG	0.500											OREG0021476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
STT3A	3703	broad.mit.edu	37	11	125466826	125466828	+	Intron	DEL	TTA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125466826_125466828delTTA	uc001qcd.2	+						STT3A_uc009zbm.2_Intron|STT3A_uc001qce.2_Intron|STT3A_uc010sbg.1_Intron	NM_152713	NP_689926	P46977	STT3A_HUMAN	integral membrane protein 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity				0	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		GATAAAGACTTTATTCAGGGATT	0.340													4	2	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126481409	126481409	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126481409delC	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TTTCACATTTCCCACTTCATC	0.468													4	2	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	235711	235712	+	Intron	DEL	GT	-	-	rs72291583		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:235711_235712delGT	uc001qhu.1	+						IQSEC3_uc001qht.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		TTGATGGAAGgtgtgtgtgtgt	0.287													5	4	---	---	---	---	
WNT5B	81029	broad.mit.edu	37	12	1710700	1710700	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1710700delT	uc009zdq.2	+							NM_032642	NP_116031	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family,						angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			AAAAAATTTGTTTTAGTCAGC	0.398													4	2	---	---	---	---	
PRMT8	56341	broad.mit.edu	37	12	3621945	3621948	+	Intron	DEL	GAAT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3621945_3621948delGAAT	uc001qmf.2	+						PRMT8_uc009zed.2_Intron	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4						regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			GATGTTGGTGgaatgaatgaatga	0.466													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5629671	5629671	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5629671delA								NTF3 (25208 upstream) : ANO2 (42146 downstream)																							CTCGAGAGATAATAGAGAGAT	0.458													4	2	---	---	---	---	
VWF	7450	broad.mit.edu	37	12	6202913	6202913	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6202913delA	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	GTCTTGCCCCACATAAAGCAT	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6292425	6292426	+	IGR	DEL	CT	-	-	rs10568270		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6292425_6292426delCT								VWF (58589 upstream) : CD9 (16447 downstream)																							tcccatgtggcttcagagggca	0.094													4	3	---	---	---	---	
LOC642846	642846	broad.mit.edu	37	12	9457996	9457997	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9457996_9457997insT	uc010sgp.1	+						LOC642846_uc001qvp.2_Intron	NR_024374				Homo sapiens cDNA FLJ60280 complete cds, highly similar to Probable ATP-dependent RNA helicase DDX11 (EC 3.6.1.-).												0						ATAGAAGTTCCTTTGTTTTAAC	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13005005	13005006	+	IGR	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13005005_13005006delCA								DDX47 (22096 upstream) : RPL13AP20 (23405 downstream)																							gcttggagttcactgagctgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14366941	14366941	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14366941delC								GRIN2B (233919 upstream) : ATF7IP (151670 downstream)																							CCTGCCCCAGCCCCAGGATAG	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	25603704	25603705	+	IGR	INS	-	A	A	rs144581135	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25603704_25603705insA								KRAS (199841 upstream) : IFLTD1 (25311 downstream)																							aaatttacaagaaaaaaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	26056383	26056383	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26056383delT								IFLTD1 (254895 upstream) : RASSF8 (55586 downstream)																							TTCAAACCCCTTTTTAAATAT	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	26446479	26446479	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26446479delG								SSPN (40626 upstream) : ITPR2 (41808 downstream)																							aagtgatggagggaaaaaaaa	0.000													3	3	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31227176	31227178	+	Intron	DEL	CAG	-	-	rs67241714		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31227176_31227178delCAG	uc001rjt.1	+						uc001rjq.1_5'Flank|DDX11_uc010sjw.1_Intron|DDX11_uc010sjx.1_Intron|DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TGGGCATTAACAGCAGCCGCGTG	0.552										Multiple Myeloma(12;0.14)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	32226998	32226998	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32226998delT								C12orf35 (80967 upstream) : BICD1 (33187 downstream)																							gggattgaggttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34846633	34846633	+	IGR	DEL	G	-	-	rs61920768		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34846633delG								ALG10 (665399 upstream) : None (None downstream)																							ttaacctttcgtttgatagag	0.000													4	2	---	---	---	---	
DIP2B	57609	broad.mit.edu	37	12	51135182	51135183	+	Intron	INS	-	TT	TT			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51135182_51135183insTT	uc001rwv.2	+						DIP2B_uc009zlt.2_Intron	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						ACATTTCTCTCTTTTTCTTTCT	0.292													26	17	---	---	---	---	
ACVR1B	91	broad.mit.edu	37	12	52371850	52371850	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52371850delT	uc001rzn.2	+						ACVR1B_uc001rzl.2_Intron|ACVR1B_uc001rzm.2_Intron|ACVR1B_uc010snn.1_Intron	NM_004302	NP_004293	P36896	ACV1B_HUMAN	activin A receptor, type IB isoform a precursor						G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding			pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	CTGTGACATCTCCTGAATTTC	0.408													4	2	---	---	---	---	
ANKRD52	283373	broad.mit.edu	37	12	56634510	56634510	+	3'UTR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56634510delC	uc001skm.3	-	28						NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52								protein binding			ovary(2)	2						GGCTGCTTGTCCCCCAGGCTT	0.607													4	2	---	---	---	---	
TIMELESS	8914	broad.mit.edu	37	12	56831829	56831829	+	Intron	DEL	T	-	-	rs113700259		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56831829delT	uc001slf.2	-						TIMELESS_uc001slg.2_Intron	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog						cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						ttgataaacAttttttttttt	0.000													2	4	---	---	---	---	
OS9	10956	broad.mit.edu	37	12	58087178	58087181	+	5'Flank	DEL	ATGT	-	-	rs10573974		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58087178_58087181delATGT	uc001spj.2	+						OS9_uc010srx.1_5'Flank|OS9_uc001spk.2_5'Flank|OS9_uc001spl.2_5'Flank|OS9_uc001spm.2_5'Flank|OS9_uc001spn.2_5'Flank|OS9_uc010sry.1_5'Flank|OS9_uc010srz.1_5'Flank	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum						ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CCatgtatgcatgtatgtatgtat	0.103													4	3	---	---	---	---	
MON2	23041	broad.mit.edu	37	12	62867900	62867900	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62867900delT	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srd.1_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		ttttcttttcttttttttttt	0.174													4	2	---	---	---	---	
TBK1	29110	broad.mit.edu	37	12	64857650	64857651	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64857650_64857651insT	uc001ssc.1	+							NM_013254	NP_037386	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1						I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5				GBM - Glioblastoma multiforme(28;0.0386)		ttttttttttgttttttttttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76357054	76357057	+	IGR	DEL	AGAG	-	-	rs5799248		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76357054_76357057delAGAG								KRR1 (451636 upstream) : PHLDA1 (62171 downstream)																							acacacgcacaGAGAGAGAGAGAG	0.309													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	94467698	94467701	+	IGR	DEL	AGAG	-	-	rs112749919		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94467698_94467701delAGAG								CRADD (179082 upstream) : PLXNC1 (74798 downstream)																							agagagagacagagagagagagag	0.343													1	5	---	---	---	---	
TMCC3	57458	broad.mit.edu	37	12	94966993	94966994	+	Intron	INS	-	TCA	TCA	rs144598193	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94966993_94966994insTCA	uc001tdj.2	-						TMCC3_uc001tdi.2_Intron	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3							integral to membrane				ovary(1)|skin(1)	2						tgatacccttctcatccaaccc	0.000													5	4	---	---	---	---	
IGF1	3479	broad.mit.edu	37	12	102794996	102794996	+	3'UTR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102794996delT	uc001tjm.2	-	5					IGF1_uc001tjn.2_3'UTR|IGF1_uc001tjo.2_3'UTR	NM_001111283	NP_001104753	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 1						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						attgcccccattttgcagatg	0.085													4	2	---	---	---	---	
LOC253724	253724	broad.mit.edu	37	12	104299642	104299646	+	Intron	DEL	AGGGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104299642_104299646delAGGGA	uc010swf.1	-							NR_027249				Homo sapiens cDNA FLJ56788 complete cds, moderately similar to Mus musculus 5'-nucleotidase domain containing 3 (Nt5dc3), transcript variant 2, mRNA.												0						ggaagaaaggagggaaggaaggaag	0.000													6	3	---	---	---	---	
TXNRD1	7296	broad.mit.edu	37	12	104671177	104671178	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104671177_104671178insA	uc010swk.1	+							NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
RIC8B	55188	broad.mit.edu	37	12	107200239	107200239	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107200239delG	uc001tlx.2	+						RIC8B_uc001tlw.2_Intron|RIC8B_uc001tly.2_Intron|RIC8B_uc001tlz.2_Intron	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8						regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						actgagtggtggcatctttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	107615569	107615569	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107615569delA								CRY1 (127971 upstream) : BTBD11 (96628 downstream)																							acgtgcctgtaatcccagcta	0.000													4	2	---	---	---	---	
SSH1	54434	broad.mit.edu	37	12	109196839	109196840	+	Intron	INS	-	AA	AA	rs148378823	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109196839_109196840insAA	uc001tnm.2	-						SSH1_uc001tnl.2_Intron|SSH1_uc010sxg.1_Intron|SSH1_uc001tnn.3_Intron	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1						actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						aaaaaaattttaagagaggagg	0.000													1	5	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109692901	109692902	+	Intron	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109692901_109692902delAC	uc001tob.2	+						ACACB_uc001toc.2_Intron|ACACB_uc010sxl.1_Intron|ACACB_uc001tod.2_Intron|ACACB_uc010sxm.1_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	TTCTATACCTacacacacacac	0.109													4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109857679	109857679	+	Intron	DEL	A	-	-	rs10533849		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109857679delA	uc010sxn.1	+							NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H							myosin complex	motor activity				0						CCCCCAACTTAAAAAAAAAAA	0.159													4	4	---	---	---	---	
C12orf76	400073	broad.mit.edu	37	12	110507535	110507535	+	5'Flank	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110507535delC	uc001tqd.1	-						C12orf76_uc001tqe.1_Intron|uc001tqf.1_Intron	NM_207435	NP_997318	Q8N812	CL076_HUMAN	hypothetical protein LOC400073											large_intestine(1)	1						atggagggaacccccagatgc	0.040													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	111281326	111281327	+	IGR	INS	-	T	T	rs150559227	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111281326_111281327insT								PPP1CC (100569 upstream) : CCDC63 (3484 downstream)																							AAttttttttattttttatttt	0.233													3	3	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114266809	114266809	+	Intron	DEL	T	-	-	rs71922551		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114266809delT	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GGGCTGTGCCttttttttttt	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115869143	115869143	+	IGR	DEL	A	-	-	rs75044456		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115869143delA								TBX3 (747174 upstream) : MED13L (527240 downstream)																							agtgaaagataaaaaaaaaaa	0.000													2	4	---	---	---	---	
FBXO21	23014	broad.mit.edu	37	12	117589144	117589144	+	Intron	DEL	G	-	-	rs74829496		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117589144delG	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		CATCCCATTAGGGTTTAGGTG	0.448											OREG0022165	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121062623	121062624	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121062623_121062624insT								POP5 (43422 upstream) : CABP1 (15798 downstream)																							TATGTCATCAAttttttttttg	0.015													4	2	---	---	---	---	
MLEC	9761	broad.mit.edu	37	12	121127008	121127009	+	Intron	DEL	GT	-	-	rs144359015		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121127008_121127009delGT	uc001tyy.1	+							NM_014730	NP_055545	Q14165	MLEC_HUMAN	malectin precursor						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding			ovary(1)	1						GATGCAGGTGgtgtgtgtgtgt	0.386													4	2	---	---	---	---	
KDM2B	84678	broad.mit.edu	37	12	121876057	121876057	+	Intron	DEL	A	-	-	rs144925153		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121876057delA	uc001uat.2	-						KDM2B_uc001uaq.2_Intron|KDM2B_uc010szy.1_Intron|KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron|KDM2B_uc001uao.2_Intron|KDM2B_uc010szx.1_Intron|KDM2B_uc001uap.2_Intron	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						gctccatctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
WDR66	144406	broad.mit.edu	37	12	122402052	122402054	+	Intron	DEL	TTG	-	-	rs66521550		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122402052_122402054delTTG	uc009zxk.2	+							NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66								calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CACCCGGGATttgttgttgttgt	0.374													4	2	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	125053485	125053485	+	5'Flank	DEL	T	-	-	rs1798869	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125053485delT	uc001ugj.1	-							NM_006312	NP_006303	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GGATGCTGGGTTTGCCGGGCT	0.672													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	125068396	125068397	+	IGR	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125068396_125068397delCA								NCOR2 (16386 upstream) : SCARB1 (193778 downstream)																							ctgccatcttcagtgctgaccc	0.000													4	2	---	---	---	---	
SCARB1	949	broad.mit.edu	37	12	125279968	125279968	+	Intron	DEL	G	-	-	rs3215351		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125279968delG	uc001ugo.3	-						SCARB1_uc001ugn.3_Intron|SCARB1_uc001ugm.3_Intron|SCARB1_uc010tbd.1_Intron|SCARB1_uc010tbe.1_Intron|SCARB1_uc001ugp.3_Intron	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1						adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	GCCACAGGCTGGGGGGGGTCA	0.542													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128674118	128674119	+	IGR	DEL	GT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128674118_128674119delGT								None (None upstream) : TMEM132C (225172 downstream)																							gaatgtgagggtgtgtgagggc	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130791450	130791450	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130791450delT								FZD10 (141166 upstream) : PIWIL1 (31164 downstream)																							ggaattctaattgtctctcac	0.000													4	2	---	---	---	---	
GPR133	283383	broad.mit.edu	37	12	131511116	131511116	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131511116delG	uc001uit.3	+						GPR133_uc010tbm.1_Intron|uc001uiu.1_RNA	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TTGGCCTTTTGAAGTTGGCTT	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131887437	131887437	+	IGR	DEL	A	-	-	rs60425958		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131887437delA								LOC116437 (189962 upstream) : SFRS8 (308198 downstream)																							GGAGACTCATAGGGCAAGGCT	0.602													6	3	---	---	---	---	
SACS	26278	broad.mit.edu	37	13	23955576	23955577	+	Intron	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23955576_23955577delCA	uc001uon.2	-							NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin						cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAAGCGCGCGCACACACACACA	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	59723494	59723495	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59723494_59723495insT								None (None upstream) : DIAPH3 (516230 downstream)																							ttaaattcaagttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	73725335	73725336	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73725335_73725336delAC								KLF5 (73660 upstream) : KLF12 (534814 downstream)																							TCCTCCAAGTacacacacacac	0.312													3	3	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74347031	74347033	+	Intron	DEL	AGA	-	-	rs143966443		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74347031_74347033delAGA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		GGGAGGAGTGAGAAGAAGATGGA	0.502													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	85721508	85721508	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85721508delA								None (None upstream) : SLITRK6 (645414 downstream)																							GCTAAAGTTTAAAAAAAAAAA	0.174													4	4	---	---	---	---	
ABCC4	10257	broad.mit.edu	37	13	95755192	95755193	+	Intron	INS	-	T	T	rs149951624	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95755192_95755193insT	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	ATCTAATCTTATTCACAGTAGC	0.129													3	3	---	---	---	---	
UBAC2	337867	broad.mit.edu	37	13	100035997	100035998	+	Intron	INS	-	C	C	rs145163053	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100035997_100035998insC	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron|UBAC2_uc001voh.2_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CATGGGCGGCACCCCCCGTTTG	0.589													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	101593942	101593943	+	IGR	INS	-	T	T	rs9557557	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101593942_101593943insT								TMTC4 (266839 upstream) : NALCN (112187 downstream)																							TGATGATTACATTTTTTTTTTC	0.376													4	2	---	---	---	---	
COL4A1	1282	broad.mit.edu	37	13	110908249	110908250	+	Intron	INS	-	A	A	rs148501894	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110908249_110908250insA	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			ggcaggaagggagggggaaggc	0.104													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	111229509	111229509	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111229509delT								RAB20 (15438 upstream) : CARKD (38372 downstream)																							ctttttttccttttttttttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112220395	112220396	+	IGR	DEL	AT	-	-	rs67112505		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112220395_112220396delAT								C13orf16 (223802 upstream) : SOX1 (501517 downstream)																							GTATCTTTCAATACACACTGGA	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114995629	114995629	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114995629delG								RASA3 (97534 upstream) : CDC16 (4733 downstream)																							tcccgtccctggcctttccca	0.050													4	2	---	---	---	---	
SALL2	6297	broad.mit.edu	37	14	22000859	22000859	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22000859delA	uc001wbe.2	-						SALL2_uc010tma.1_Intron|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2								DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		gcactttgggaggccaaagtg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22109461	22109464	+	5'Flank	DEL	AAGT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22109461_22109464delAAGT	uc001wbk.3	+											SubName: Full=Putative uncharacterized protein ENSP00000374930;																		tttaattctaaAGTAAGAAAATGT	0.191													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23116322	23116322	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23116322delT								ABHD4 (35065 upstream) : OXA1L (119409 downstream)																							gacatcatccttttttttttt	0.020													4	2	---	---	---	---	
THTPA	79178	broad.mit.edu	37	14	24021498	24021498	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24021498delT	uc001wkb.3	+						uc001wkf.1_5'Flank			Q9BU02	THTPA_HUMAN	Homo sapiens thiamine triphosphatase mRNA, complete cds.						dephosphorylation|generation of precursor metabolites and energy|thiamine metabolic process	cytosol|nucleolus|soluble fraction	thiamin-triphosphatase activity				0	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)	Thiamine(DB00152)	TGCTCCTGAAttttttttttt	0.264													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34476517	34476517	+	IGR	DEL	G	-	-	rs150604220	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34476517delG								EGLN3 (56230 upstream) : C14orf147 (425628 downstream)																							ggagtgggccgagtgggctgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	39611502	39611503	+	IGR	INS	-	G	G			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39611502_39611503insG								SIP1 (5327 upstream) : TRAPPC6B (5512 downstream)																							ctggacatggtggtgggtgcct	0.000													4	2	---	---	---	---	
FAM179B	23116	broad.mit.edu	37	14	45486610	45486611	+	Intron	DEL	AC	-	-	rs62000265		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45486610_45486611delAC	uc001wvv.2	+						FAM179B_uc001wvw.2_Intron|FAM179B_uc010anc.2_Intron	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116								binding			skin(2)|upper_aerodigestive_tract(1)	3						tgcacacaaaacacacacacac	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56571040	56571041	+	IGR	DEL	GT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56571040_56571041delGT								C14orf34 (307648 upstream) : PELI2 (14052 downstream)																							gagtgtgagagtgtgtgtgtgt	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57506125	57506125	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57506125delA								OTX2 (228941 upstream) : EXOC5 (163071 downstream)																							agagtgagggaaaagggagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	59453519	59453519	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59453519delT								DACT1 (338483 upstream) : DAAM1 (201880 downstream)																							ctgtgacttctttttcctctt	0.000													4	2	---	---	---	---	
DAAM1	23002	broad.mit.edu	37	14	59664925	59664926	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59664925_59664926insT	uc001xdz.1	+						DAAM1_uc001xea.1_Intron|DAAM1_uc001xeb.1_Intron|DAAM1_uc001xdy.2_Intron	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of						actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		tcttttctttcttttttttttt	0.183													4	3	---	---	---	---	
PRKCH	5583	broad.mit.edu	37	14	61898304	61898305	+	Intron	INS	-	T	T	rs137967421	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61898304_61898305insT	uc001xfn.2	+						PRKCH_uc010tsa.1_Intron	NM_006255	NP_006246	P24723	KPCL_HUMAN	protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		TGCCATTTGGATTTTTTTTTCT	0.223													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	69230772	69230773	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69230772_69230773insT								RAD51L1 (33837 upstream) : ZFP36L1 (23602 downstream)																							GATTCAAAACCTGGCTGAgacc	0.257													4	2	---	---	---	---	
ACTN1	87	broad.mit.edu	37	14	69411988	69411988	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69411988delA	uc001xkl.2	-						ACTN1_uc010ttb.1_Intron|ACTN1_uc001xkm.2_Intron|ACTN1_uc001xkn.2_Intron|ACTN1_uc001xko.1_Intron|ACTN1_uc010ttd.1_Intron	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b						focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CAAAAAACTGAAAAAAAAAAA	0.393													3	3	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72997330	72997330	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72997330delT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		acccgtgaggtggaggttgca	0.025													4	2	---	---	---	---	
DPF3	8110	broad.mit.edu	37	14	73110542	73110543	+	Intron	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73110542_73110543delTC	uc001xnc.2	-							NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ACTCACCTTGTCTAAGAAAGGA	0.490													4	2	---	---	---	---	
FAM161B	145483	broad.mit.edu	37	14	74401307	74401307	+	Intron	DEL	T	-	-	rs77040630		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74401307delT	uc001xpd.1	-							NM_152445	NP_689658			hypothetical protein LOC145483											ovary(1)	1						acccagctaattttttttttt	0.000													5	3	---	---	---	---	
C14orf179	112752	broad.mit.edu	37	14	76469975	76469975	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76469975delA	uc010asm.1	+						C14orf179_uc001xsf.2_Intron|C14orf179_uc010asl.1_Intron|C14orf179_uc001xsg.2_Intron|C14orf179_uc010tve.1_Intron|C14orf179_uc001xse.2_Intron	NM_001102564	NP_001096034	Q96FT9	IFT43_HUMAN	hypothetical protein LOC112752 isoform 2						cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)		actccgtttcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CCDC88C	440193	broad.mit.edu	37	14	91824650	91824651	+	Intron	INS	-	G	G	rs147502610	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91824650_91824651insG	uc010aty.2	-						CCDC88C_uc010twk.1_Intron	NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE						microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				ACGCCAACAGAGGAAGCCCGAG	0.515													3	3	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92817578	92817579	+	Intron	INS	-	CGCGCG	CGCGCG			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92817578_92817579insCGCGCG	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		acacacatacacgcacacacac	0.079													3	4	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92954321	92954323	+	Intron	DEL	CTC	-	-	rs113190696	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92954321_92954323delCTC	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_Intron|SLC24A4_uc001yan.2_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		cctcctcctgctcctcctcctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	93159580	93159580	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93159580delC								RIN3 (4248 upstream) : LGMN (10577 downstream)																							gacctgggctccagcccagct	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	94460382	94460382	+	IGR	DEL	G	-	-	rs35333141		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94460382delG								ASB2 (17306 upstream) : C14orf48 (3234 downstream)																							GAGTGAGGCTGGGGAAGGGGG	0.517													7	11	---	---	---	---	
C14orf139	79686	broad.mit.edu	37	14	95874114	95874115	+	3'UTR	DEL	AC	-	-	rs71707189		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95874114_95874115delAC	uc001yeh.3	-	1						NR_026779				RecName: Full=Uncharacterized protein C14orf139;												0						acacacacagacacacacacac	0.312													3	3	---	---	---	---	
BCL11B	64919	broad.mit.edu	37	14	99670250	99670251	+	Intron	INS	-	C	C	rs148280853	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99670250_99670251insC	uc001yga.2	-						BCL11B_uc001ygb.2_Intron	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1							nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GCGCCCCTGAACCCCCCGCTCT	0.644			T	TLX3	T-ALL								4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101701423	101701424	+	IGR	DEL	AT	-	-	rs5811029		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101701423_101701424delAT								MIR656 (168285 upstream) : DIO3OS (317136 downstream)																							gtctgtgtacatgtgtgagtat	0.188											OREG0022934	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101760513	101760513	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101760513delA								MIR656 (227375 upstream) : DIO3OS (258047 downstream)																							gtttttaaagaaaaaaaagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	101822355	101822355	+	IGR	DEL	T	-	-	rs5811030		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101822355delT								MIR656 (289217 upstream) : DIO3OS (196205 downstream)																							TCTTTTCTTATTTTTTTTTTA	0.289													2	4	---	---	---	---	
RAGE	5891	broad.mit.edu	37	14	102738814	102738815	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102738814_102738815insA	uc001ylm.2	-						RAGE_uc010txv.1_Intron|RAGE_uc001yln.2_Intron	NM_014226	NP_055041	Q9UQ07	MOK_HUMAN	MAPK/MAK/MRK overlapping kinase						signal transduction	Golgi apparatus	ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						actccatcacgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	105867260	105867260	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105867260delC	uc010axk.1	+											Homo sapiens cDNA clone IMAGE:40132624.																		GCTTCACCTGCCCAGAGCCAC	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20105569	20105570	+	IGR	INS	-	G	G	rs150211308		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20105569_20105570insG								None (None upstream) : GOLGA6L6 (631524 downstream)																							AAAGATCCCCCTGGAAATTAGG	0.381													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20441424	20441424	+	IGR	DEL	T	-	-	rs71399652		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20441424delT								None (None upstream) : GOLGA6L6 (295670 downstream)																							tactacctaatttcagaacat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21904917	21904917	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21904917delT								NF1P1 (770292 upstream) : LOC646214 (27597 downstream)																							tcaggcaatgtaaccccaata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	24276835	24276836	+	IGR	DEL	GA	-	-	rs112409142		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24276835_24276836delGA								NDN (344385 upstream) : PWRN2 (133090 downstream)																							tggaaagggggagagagagaga	0.000													3	3	---	---	---	---	
FAM189A1	23359	broad.mit.edu	37	15	29474252	29474252	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29474252delG	uc010azk.1	-						FAM189A1_uc001zcn.2_Intron	NM_015307	NP_056122	O60320	F1891_HUMAN	hypothetical protein LOC23359							integral to membrane					0						cccagatgatggaaccctcta	0.000													4	2	---	---	---	---	
FMN1	342184	broad.mit.edu	37	15	33352366	33352367	+	Intron	INS	-	GAAA	GAAA	rs138032693	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33352366_33352367insGAAA	uc001zhf.3	-							NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CAGGGGTCTATGAAAGATAGTA	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	38304725	38304726	+	Intron	DEL	GT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38304725_38304726delGT	uc001zjx.1	+											Homo sapiens, clone IMAGE:5755094, mRNA.																		AGGAGTAGTCgtgtgtgtgtgt	0.356													4	3	---	---	---	---	
C15orf52	388115	broad.mit.edu	37	15	40623729	40623730	+	3'UTR	DEL	AG	-	-	rs79661697		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40623729_40623730delAG	uc001zlh.3	-	11					C15orf52_uc010ucn.1_3'UTR	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115											large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		ctgttaagacagagTCCAACTC	0.178													0	6	---	---	---	---	
GNB5	10681	broad.mit.edu	37	15	52460895	52460895	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52460895delC	uc002abt.1	-						GNB5_uc002abr.1_Intron|GNB5_uc002abs.1_Intron|GNB5_uc002abu.3_Intron	NM_016194	NP_057278	O14775	GBB5_HUMAN	guanine nucleotide-binding protein, beta-5							heterotrimeric G-protein complex	GTPase activity|signal transducer activity			lung(1)	1				all cancers(107;0.0163)		ctggaggcatcaggctaccca	0.000													4	2	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53832683	53832683	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53832683delA	uc002acj.2	-						WDR72_uc010bfh.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		aattcagctcaaaagggaaat	0.015													4	2	---	---	---	---	
LOC283663	283663	broad.mit.edu	37	15	57592489	57592490	+	5'Flank	INS	-	T	T	rs34541403		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57592489_57592490insT	uc010ugs.1	+						LOC283663_uc010ugt.1_5'Flank	NR_024433				Homo sapiens cDNA FLJ39764 fis, clone SPLEN2000143.												0						GGTGGGGGAAAttttttttttt	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60007783	60007784	+	IGR	DEL	TT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60007783_60007784delTT								BNIP2 (26141 upstream) : FOXB1 (288637 downstream)																							CTTGCTGGAATTTTTTTTTTTT	0.327													4	2	---	---	---	---	
RORA	6095	broad.mit.edu	37	15	61440435	61440435	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61440435delA	uc002agx.2	-							NM_134261	NP_599023	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						AGTGGAAGGGAAACAGGAAGT	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63894619	63894619	+	5'Flank	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63894619delA	uc002amj.2	-						uc002amk.2_5'Flank|uc002aml.2_5'Flank					Homo sapiens cDNA FLJ35758 fis, clone TESTI2004734.																		cgtctgtactaaaaaaaaata	0.000													4	2	---	---	---	---	
DAPK2	23604	broad.mit.edu	37	15	64325525	64325525	+	Intron	DEL	A	-	-	rs150809859	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64325525delA	uc002amr.2	-						DAPK2_uc010uim.1_Intron|DAPK2_uc010bgu.1_Intron	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		ggaaggaaggaaAAAAAAAAT	0.015													2	4	---	---	---	---	
FAM96A	84191	broad.mit.edu	37	15	64368668	64368668	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64368668delT	uc002amt.1	-						FAM96A_uc002amu.1_Intron|FAM96A_uc010uin.1_Intron	NM_032231	NP_115607	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A						chromosome segregation						0						AAGCTATCCCTCCTGGCCCTG	0.274													4	2	---	---	---	---	
CORO2B	10391	broad.mit.edu	37	15	69001019	69001020	+	Intron	INS	-	T	T	rs149417380	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69001019_69001020insT	uc002arj.3	+						CORO2B_uc010bic.2_Intron	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						GGCtttcttcctttttttttta	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69957920	69957921	+	IGR	INS	-	AG	AG	rs138669420	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69957920_69957921insAG								LOC145837 (94141 upstream) : C15orf50 (169652 downstream)																							tggctcgggacagagtttaacc	0.198													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69964813	69964814	+	IGR	INS	-	A	A	rs80162534		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69964813_69964814insA								LOC145837 (101034 upstream) : C15orf50 (162759 downstream)																							TTACAATTAAGAAAAAAAAAAT	0.307													4	2	---	---	---	---	
CELF6	60677	broad.mit.edu	37	15	72582506	72582507	+	Frame_Shift_Ins	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72582506_72582507insA	uc002auh.2	-	4	794_795	c.484_485insT	c.(484-486)GAGfs	p.E162fs	uc002aug.2_Intron|CELF6_uc002auk.3_RNA|CELF6_uc010biv.1_RNA|CELF6_uc010biw.2_Frame_Shift_Ins_p.E49fs|CELF6_uc010ukl.1_Frame_Shift_Ins_p.E47fs|CELF6_uc010ukm.1_Frame_Shift_Ins_p.E162fs|CELF6_uc002aui.2_Frame_Shift_Ins_p.E268fs|CELF6_uc002auj.2_Frame_Shift_Ins_p.E49fs	NM_052840	NP_443072	Q96J87	CELF6_HUMAN	bruno-like 6, RNA binding protein	162	RRM 2.				mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3						GACCGTGCACTCCTCGATGTGG	0.599													36	20	---	---	---	---	
HCN4	10021	broad.mit.edu	37	15	73648101	73648102	+	Intron	DEL	CA	-	-	rs60106866		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73648101_73648102delCA	uc002avp.2	-							NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic						blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		TGTACATGCGcacacacacaca	0.441													5	3	---	---	---	---	
EDC3	80153	broad.mit.edu	37	15	74931290	74931291	+	Intron	DEL	AA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74931290_74931291delAA	uc002ayn.2	-						EDC3_uc002ayo.2_Intron|EDC3_uc002aym.2_Intron	NM_001142443	NP_001135915	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1						tctaagagacaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
IREB2	3658	broad.mit.edu	37	15	78772628	78772629	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78772628_78772629insT	uc002bdr.2	+						IREB2_uc010unb.1_Intron	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2								4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TGCTTTGTCCATTTTTTTTCCT	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79028371	79028372	+	IGR	INS	-	CAAAA	CAAAA	rs144090135	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79028371_79028372insCAAAA								CHRNB4 (75497 upstream) : ADAMTS7 (23174 downstream)																							tgacactGTCTcaaaacaaaac	0.163													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79118133	79118134	+	IGR	INS	-	ACAC	ACAC	rs139035985	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79118133_79118134insACAC								ADAMTS7 (14360 upstream) : MORF4L1 (47038 downstream)																							tagcccatcAAacacacacaca	0.193													3	4	---	---	---	---	
RASGRF1	5923	broad.mit.edu	37	15	79266394	79266394	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79266394delG	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc002beo.2_Intron	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GGTGACTCATGGGGGACTGCA	0.572													4	2	---	---	---	---	
RASGRF1	5923	broad.mit.edu	37	15	79343806	79343807	+	Intron	INS	-	AC	AC	rs139582756	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79343806_79343807insAC	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						CACGCAAGCGTACACACACACA	0.480													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80292256	80292257	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80292256_80292257insA								BCL2A1 (28613 upstream) : ZFAND6 (59764 downstream)																							tgtctcaaaagaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80323351	80323355	+	IGR	DEL	TTCCA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80323351_80323355delTTCCA								BCL2A1 (59708 upstream) : ZFAND6 (28666 downstream)																							ccatccaaccttccaatcatctatc	0.005													4	2	---	---	---	---	
MESDC2	23184	broad.mit.edu	37	15	81250980	81250981	+	Intron	INS	-	T	T	rs144555365	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81250980_81250981insT	uc002bfx.2	-						MESDC2_uc010uno.1_Intron	NM_015154		Q14696	MESD_HUMAN	mesoderm development candidate 2						mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0						ggccTTAGGCATTTTTTTTTCA	0.228													4	2	---	---	---	---	
IL16	3603	broad.mit.edu	37	15	81595688	81595688	+	Intron	DEL	T	-	-	rs113855862		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81595688delT	uc002bgh.3	+						IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron|IL16_uc002bgi.1_Intron|IL16_uc002bgj.2_Intron|IL16_uc002bgk.2_Intron|IL16_uc002bgl.1_Intron|IL16_uc010unq.1_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						tttacatacattttttttttc	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82160584	82160584	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82160584delC								TMC3 (494166 upstream) : MEX3B (173544 downstream)																							TACCTATCTTCCTCCCTTTAC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82316427	82316428	+	IGR	INS	-	TTTG	TTTG	rs144333071	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82316427_82316428insTTTG								TMC3 (650009 upstream) : MEX3B (17700 downstream)																							TTTGTGTtttctttgtttgttt	0.198													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85713892	85713892	+	IGR	DEL	T	-	-	rs72261993		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85713892delT								PDE8A (31522 upstream) : AKAP13 (209979 downstream)																							attacctaccttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	88916532	88916532	+	IGR	DEL	G	-	-	rs34160917		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88916532delG								NTRK3 (116871 upstream) : MRPL46 (86176 downstream)																							ACAAGCAAGAGAAAGGAAGAG	0.398													3	3	---	---	---	---	
ACAN	176	broad.mit.edu	37	15	89375535	89375535	+	Intron	DEL	A	-	-	rs149428400		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89375535delA	uc010upo.1	+						ACAN_uc002bmx.2_Intron|ACAN_uc010upp.1_Intron|ACAN_uc002bna.2_Intron	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor						cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TAGATACCTTAAAAAAAAAAA	0.169													5	3	---	---	---	---	
HAPLN3	145864	broad.mit.edu	37	15	89435688	89435688	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89435688delA	uc002bnc.2	-						HAPLN3_uc002bne.2_Intron|HAPLN3_uc002bnd.2_Intron	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	Lung NSC(78;0.0392)|all_lung(78;0.077)					actgcatctcaaaaaaaaaag	0.174													4	3	---	---	---	---	
MESP2	145873	broad.mit.edu	37	15	90317726	90317726	+	5'Flank	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90317726delT	uc002bon.2	+						MESP2_uc010uqa.1_Intron	NM_001039958	NP_001035047	Q0VG99	MESP2_HUMAN	mesoderm posterior 2 homolog						Notch signaling pathway	nucleus	DNA binding				0	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			GACAATCTCCTTTAAACTGTA	0.284													4	2	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90558413	90558413	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90558413delG	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			atgagccactgcgcctggccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	91217658	91217659	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91217658_91217659insT								CRTC3 (29082 upstream) : BLM (42920 downstream)																							TTATGTGCTTGTTTTTTTTTTT	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93791214	93791215	+	IGR	INS	-	T	T	rs148358191	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93791214_93791215insT								RGMA (158781 upstream) : MCTP2 (983586 downstream)																							CCTCTAGTCTGTTTTtttttta	0.198													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97443158	97443159	+	IGR	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97443158_97443159delCA								SPATA8 (114314 upstream) : LOC91948 (842687 downstream)																							CACTTATGAGCACACACACACA	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97513370	97513371	+	IGR	INS	-	GTGTGTGT	GTGTGTGT	rs139041324	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97513370_97513371insGTGTGTGT								SPATA8 (184526 upstream) : LOC91948 (772475 downstream)																							catgcaggtgcgtgtgtgtgtg	0.213													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98661645	98661645	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98661645delT								ARRDC4 (144578 upstream) : FAM169B (318746 downstream)																							ctttgagcccttttttttttc	0.104													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98924361	98924362	+	IGR	DEL	TG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98924361_98924362delTG								ARRDC4 (407294 upstream) : FAM169B (56029 downstream)																							CCTCTGTAAAtgtgtgtgtgtg	0.238													4	2	---	---	---	---	
ADAMTS17	170691	broad.mit.edu	37	15	100640826	100640827	+	Intron	INS	-	T	T	rs143871884	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100640826_100640827insT	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GTGAGCTTGGGTTTTTTGTGCC	0.475													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	101088777	101088778	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101088777_101088778delAC								LASS3 (3852 upstream) : LINS1 (20658 downstream)																							CTCCACCAAGACACACACACAC	0.450													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	7610447	7610448	+	Intron	INS	-	T	T	rs72529080		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7610447_7610448insT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TGAAAGTACCCCCAGTGACTAA	0.361													4	2	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10545909	10545910	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10545909_10545910insA	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						aactccgtcccaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11142871	11142871	+	Intron	DEL	T	-	-	rs71404443		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11142871delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						gatttttttcttttttttttt	0.020													3	3	---	---	---	---	
C16orf75	116028	broad.mit.edu	37	16	11398682	11398684	+	Intron	DEL	AAT	-	-	rs151303946		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11398682_11398684delAAT	uc002daq.1	+									Q96E14	RMI2_HUMAN	Homo sapiens cDNA FLJ41770 fis, clone IMR322007225.						DNA replication	nucleus	DNA binding				0						aaataataacaataataataata	0.074			T	CIITA	PMBL|Hodgkin Lymphona|								4	2	---	---	---	---	
BFAR	51283	broad.mit.edu	37	16	14738020	14738020	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14738020delA	uc002dco.2	+						BFAR_uc002dcm.2_Intron|BFAR_uc002dcn.2_Intron|BFAR_uc002dcp.2_Intron|BFAR_uc010uzh.1_5'Flank	NM_016561	NP_057645	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator						anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2						actgtgtctcaaaaaaaaaaa	0.119													5	3	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15081770	15081771	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15081770_15081771insT	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	cgcctggccTGTTTTTTTTTTC	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	15371339	15371340	+	IGR	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15371339_15371340delTC								PDXDC1 (138144 upstream) : MPV17L (118271 downstream)																							cttctttctttctctctctctc	0.252													3	3	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18937479	18937481	+	5'UTR	DEL	AGG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18937479_18937481delAGG	uc002dfm.2	-	1						NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						gaagccgagaaggaggaggagga	0.488													6	3	---	---	---	---	
GDE1	51573	broad.mit.edu	37	16	19532311	19532311	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19532311delA	uc002dgh.2	-						GDE1_uc002dgi.2_Intron|CP110_uc002dgj.2_5'Flank|CP110_uc002dgk.3_5'Flank|CP110_uc002dgl.3_5'Flank	NM_016641	NP_057725	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1						glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						GTGTCTGGGGAAAAGGTGATA	0.443													4	2	---	---	---	---	
IQCK	124152	broad.mit.edu	37	16	19776015	19776015	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19776015delT	uc002dgr.2	+						IQCK_uc002dgs.2_Intron|IQCK_uc010vat.1_Intron|IQCK_uc010bwc.2_Intron|IQCK_uc010vau.1_Intron	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K											skin(1)	1						ctttaAtttcttttttttttt	0.095													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22599703	22599703	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22599703delA								LOC653786 (11517 upstream) : HS3ST2 (226157 downstream)																							gccagaatgcaaagtctgaaa	0.000													4	2	---	---	---	---	
USP31	57478	broad.mit.edu	37	16	23125773	23125774	+	Intron	INS	-	A	A	rs12933344	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23125773_23125774insA	uc002dll.2	-							NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		Gaaaaaataggaaaaaaaaaaa	0.332													3	3	---	---	---	---	
SULT1A3	6818	broad.mit.edu	37	16	29473676	29473676	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29473676delT	uc002dsu.2	+						LOC440354_uc002dsp.3_Intron|SULT1A3_uc002dsw.2_Intron|SULT1A3_uc002dsz.2_Intron|SULT1A3_uc002dta.2_Intron|SULT1A3_uc010vdp.1_Intron|SULT1A3_uc002dtb.2_Intron|SULT1A3_uc010byw.2_Intron	NM_177552	NP_808220	P50224	ST1A3_HUMAN	sulfotransferase family, cytosolic, 1A,						3'-phosphoadenosine 5'-phosphosulfate metabolic process|catecholamine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity				0						TCATCACATCttttttttttt	0.299													5	3	---	---	---	---	
BOLA2	552900	broad.mit.edu	37	16	29777221	29777222	+	Intron	DEL	TT	-	-	rs72085054		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29777221_29777222delTT	uc010bzb.1	-						uc002dtf.2_Intron			Q9H3K6	BOLA2_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0						ttttttgttctttttttttttt	0.193													4	2	---	---	---	---	
C16orf53	79447	broad.mit.edu	37	16	29828354	29828355	+	Intron	DEL	CC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29828354_29828355delCC	uc002dug.3	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron	NM_024516	NP_078792	Q9BTK6	PA1_HUMAN	PTIP-associated 1 protein												0						TACACCTTGTCCCGGGGCTGCT	0.604											OREG0023722	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	30692517	30692519	+	IGR	DEL	AGG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30692517_30692519delAGG								FBRS (10387 upstream) : SRCAP (17943 downstream)																							aagaaggagaaggaggaggagga	0.108													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33935694	33935694	+	IGR	DEL	C	-	-	rs112373913		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33935694delC								None (None upstream) : MIR1826 (29814 downstream)																							AATCTCGGGGCCCACAGCACC	0.527													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33941390	33941391	+	IGR	INS	-	T	T	rs148453508		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33941390_33941391insT								None (None upstream) : MIR1826 (24117 downstream)																							AATTTGTGGGATTTTTAAAAGC	0.317													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33960735	33960735	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33960735delT								None (None upstream) : MIR1826 (4773 downstream)																							GCTAGCACTATTTTTTTTGGC	0.303													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33982909	33982909	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33982909delT								MIR1826 (17317 upstream) : UBE2MP1 (420893 downstream)																							gattaagcagtttggaaacag	0.000													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33998283	33998283	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33998283delA								MIR1826 (32691 upstream) : UBE2MP1 (405519 downstream)																							gcttctgtgtagtttttatgt	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34009289	34009289	+	IGR	DEL	C	-	-	rs111879019		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34009289delC								MIR1826 (43697 upstream) : UBE2MP1 (394513 downstream)																							ggtttcaaaactggtcaatca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46411627	46411627	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46411627delC								None (None upstream) : ANKRD26P1 (91622 downstream)																							ccattcgattccatttgatga	0.000													4	2	---	---	---	---	
CBLN1	869	broad.mit.edu	37	16	49312301	49312301	+	3'UTR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49312301delC	uc002efq.2	-	3						NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor						nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)				TGCAAGGAAGCCCTCGCGCCC	0.622													1	5	---	---	---	---	
MT4	84560	broad.mit.edu	37	16	56600438	56600445	+	Intron	DEL	GAAGGAAA	-	-	rs141989399		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56600438_56600445delGAAGGAAA	uc002eje.1	+							NM_032935	NP_116324	P47944	MT4_HUMAN	metallothionein 4							cytoplasm	copper ion binding|zinc ion binding			ovary(1)	1						agaaagaacggaaggaaagaaggaaaga	0.000													4	2	---	---	---	---	
NUP93	9688	broad.mit.edu	37	16	56856011	56856011	+	Intron	DEL	A	-	-	rs71381135		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56856011delA	uc002eka.2	+						NUP93_uc002ekb.2_Intron|NUP93_uc010vhi.1_Intron	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						CATAAGGGGCAAAAAAAAAAA	0.453													2	6	---	---	---	---	
SLC12A3	6559	broad.mit.edu	37	16	56925638	56925638	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56925638delA	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	gtgtctggagaaaacgggtgc	0.000													4	2	---	---	---	---	
CCDC102A	92922	broad.mit.edu	37	16	57561333	57561334	+	Intron	INS	-	G	G	rs28696702		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57561333_57561334insG	uc002elw.2	-							NM_033212	NP_149989	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A											ovary(1)	1						gctgctgctttttttttttttt	0.030													3	4	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58516610	58516613	+	Intron	DEL	TCCT	-	-	rs71155270		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58516610_58516613delTCCT	uc002enm.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc010vif.1_Intron	NM_001130487	NP_001123959	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 2						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						cctccctccctcctttccttcctc	0.049													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66206744	66206744	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66206744delG								LOC283867 (596541 upstream) : CDH5 (193781 downstream)																							ACAGAGGAGTGGGGCCAAGGA	0.547													4	2	---	---	---	---	
CCDC79	283847	broad.mit.edu	37	16	66800188	66800188	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66800188delA	uc010viv.1	-						CCDC79_uc002eqc.1_Intron	NM_001136505	NP_001129977	Q8NA31	CCD79_HUMAN	coiled-coil domain containing 79						regulation of transcription, DNA-dependent		DNA binding				0						AAATGTGGAGAAAAAAAAGAT	0.353													4	4	---	---	---	---	
ESRP2	80004	broad.mit.edu	37	16	68267100	68267101	+	Intron	DEL	AA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68267100_68267101delAA	uc010cfa.1	-						ESRP2_uc002evp.1_5'Flank|ESRP2_uc002evq.1_Intron	NM_024939	NP_079215	Q9H6T0	ESRP2_HUMAN	RNA binding motif protein 35B						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding|nucleotide binding			ovary(1)	1						agactgtctcaaaaaaaaaaaa	0.203													3	3	---	---	---	---	
VAC14	55697	broad.mit.edu	37	16	70746294	70746295	+	Intron	DEL	CG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70746294_70746295delCG	uc002ezm.2	-						VAC14_uc010cfw.2_Intron|VAC14_uc002ezn.2_Intron|VAC14_uc002ezl.2_Intron|VAC14_uc010cfx.1_Intron	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog						interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				AGCAAAGACACGAGGTAACCAC	0.614													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	71466315	71466326	+	IGR	DEL	CCACCCACCCAT	-	-	rs66485024		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71466315_71466326delCCACCCACCCAT								CALB2 (41976 upstream) : ZNF23 (15187 downstream)																							AGATTCTTAAccacccacccatccacccaccc	0.491													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75246584	75246585	+	IGR	INS	-	T	T	rs150308036		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75246584_75246585insT								CTRB2 (5512 upstream) : CTRB1 (6299 downstream)																							ttttgtgtgtgttttttttttt	0.015													3	4	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	79125184	79125184	+	Intron	DEL	T	-	-	rs75199446		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79125184delT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TTAATGCTGCTTTTTTTTTTC	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79271565	79271565	+	IGR	DEL	T	-	-	rs11330433		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79271565delT								WWOX (25002 upstream) : MAF (356181 downstream)																							TATCCTATAGTtttctcagct	0.224													2	4	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81155069	81155069	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81155069delA	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						actccatctcaaaaaaaaaaa	0.239													5	3	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81607921	81607922	+	Intron	INS	-	G	G	rs145844142	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81607921_81607922insG	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						TCAGCCCTTCTGGGGCTGCCTG	0.644													5	5	---	---	---	---	
LRRC50	123872	broad.mit.edu	37	16	84183630	84183630	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84183630delA	uc002fhl.3	+						LRRC50_uc010chi.1_Intron	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50						axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						actctgtctcaaaaaaaaaaa	0.075									Kartagener_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85346264	85346265	+	IGR	INS	-	G	G	rs145113923	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85346264_85346265insG								FAM92B (200150 upstream) : KIAA0182 (298764 downstream)																							atgggttttgaggggatgctat	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87211784	87211789	+	Intron	DEL	AGAGGC	-	-	rs76477921		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87211784_87211789delAGAGGC	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		acagagacagagaggcagaggcagaa	0.286													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88322456	88322457	+	IGR	DEL	GA	-	-	rs113923759		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88322456_88322457delGA								BANP (211533 upstream) : ZNF469 (171422 downstream)																							AGTTTCACAGGAGAGAGAGAGA	0.416													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88383493	88383494	+	IGR	INS	-	AA	AA			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88383493_88383494insAA								BANP (272570 upstream) : ZNF469 (110385 downstream)																							acaccacacacttgcacacaca	0.064													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88468490	88468493	+	IGR	DEL	GATG	-	-	rs36187526		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88468490_88468493delGATG								BANP (357567 upstream) : ZNF469 (25386 downstream)																							atagatggtagatggatgggtggg	0.000													9	6	---	---	---	---	
SPATA22	84690	broad.mit.edu	37	17	3374813	3374814	+	Intron	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3374813_3374814delCA	uc002fvm.2	-						SPATA22_uc010vrg.1_Intron|SPATA22_uc010vrf.1_5'UTR|SPATA22_uc002fvn.2_Intron|SPATA22_uc002fvo.2_Intron|SPATA22_uc002fvp.2_Intron|SPATA22_uc010ckf.2_Intron|ASPA_uc010ckg.2_5'Flank	NM_032598	NP_115987	Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22												0						AATCTGCACGCACACACACACA	0.550													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6974488	6974489	+	IGR	INS	-	C	C	rs77893517		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6974488_6974489insC								SLC16A11 (27246 upstream) : CLEC10A (3368 downstream)																							tttttcttttttttttttttct	0.233													1	5	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7726612	7726613	+	Intron	INS	-	A	A	rs71388001		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7726612_7726613insA	uc002giu.1	+						DNAH2_uc010cnm.1_Intron	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				gactccatctcaaaaaaaaaaa	0.069													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	13690867	13690868	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13690867_13690868insA	uc002goc.1	-											Homo sapiens cDNA FLJ41269 fis, clone BRAMY2036079.																		gaatcaaagagaaaaaaaacga	0.000													4	2	---	---	---	---	
FAM106C	100129396	broad.mit.edu	37	17	16693409	16693409	+	3'UTR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16693409delT	uc002gqo.2	+	1					LOC162632_uc010cpj.1_Intron|LOC162632_uc010cpk.1_Intron|LOC162632_uc010vwq.1_Intron|LOC162632_uc002gqm.2_Intron	NR_026810				RecName: Full=Protein FAM106A;												0						ccccattctcttacattctat	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	17975965	17975965	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17975965delT								C17orf39 (4247 upstream) : DRG2 (15318 downstream)																							ttcttttttctttttttttga	0.000													4	2	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21205359	21205364	+	Intron	DEL	GGGGCT	-	-	rs74998514		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21205359_21205364delGGGGCT	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CGTCGGAGAGggggctggggctgggg	0.583													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21223391	21223391	+	IGR	DEL	C	-	-	rs67148773		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21223391delC								MAP2K3 (4842 upstream) : KCNJ12 (56308 downstream)																							GAAATTCTTTCCTTGTCTGCC	0.552													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22260320	22260321	+	IGR	INS	-	A	A	rs141529921		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22260320_22260321insA								FLJ36000 (347250 upstream) : None (None downstream)																							cgcacagaactaaacagaagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25264592	25264596	+	IGR	DEL	ATGCG	-	-	rs143566214		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25264592_25264596delATGCG								None (None upstream) : WSB1 (356510 downstream)																							atggaagggaatgcgatggagtgga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25269633	25269634	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25269633_25269634delAC								None (None upstream) : WSB1 (351472 downstream)																							gttacagaaaacacagacctgt	0.084													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25331137	25331138	+	IGR	INS	-	A	A	rs138292437	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25331137_25331138insA								None (None upstream) : WSB1 (289968 downstream)																							tttgaggaattgccacactgct	0.000													3	3	---	---	---	---	
SUZ12P	440423	broad.mit.edu	37	17	29044682	29044683	+	Intron	DEL	CC	-	-	rs151008673	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29044682_29044683delCC	uc002hfn.1	+						SUZ12P_uc002hfo.2_Intron					Homo sapiens cDNA clone IMAGE:5299523, containing frame-shift errors.												0						aatgctctttccacaggtacct	0.000													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31346858	31346859	+	Intron	DEL	GA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31346858_31346859delGA	uc002hhu.2	-						ACCN1_uc002hht.2_Intron	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GGATCTGTGTgagagagagaga	0.327													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	38777830	38777830	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38777830delG								CCR7 (56106 upstream) : SMARCE1 (6146 downstream)																							agaccagcctggccatcatgg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	40803494	40803494	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40803494delA								TUBG1 (36240 upstream) : TUBG2 (7772 downstream)																							accttgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
CNTNAP1	8506	broad.mit.edu	37	17	40834653	40834654	+	5'UTR	DEL	AG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40834653_40834654delAG	uc002iay.2	+	1					CCR10_uc002iax.3_5'Flank|CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor						axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		aCCAGGAACCagagagagagag	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42689377	42689377	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42689377delA								FZD2 (52470 upstream) : C17orf104 (44605 downstream)																							accctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
EFTUD2	9343	broad.mit.edu	37	17	42956062	42956062	+	Intron	DEL	A	-	-	rs67087012		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42956062delA	uc002ihn.2	-						EFTUD2_uc010wje.1_Intron|EFTUD2_uc010wjf.1_Intron	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain							Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				TGTGTGTCTGAACGTGTACAG	0.303													2	4	---	---	---	---	
MRPL10	124995	broad.mit.edu	37	17	45907876	45907876	+	Intron	DEL	T	-	-	rs112972415		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45907876delT	uc002ilz.2	-						MRPL10_uc010wky.1_Intron|MRPL10_uc002ily.2_Intron|LRRC46_uc002ima.2_5'Flank|LRRC46_uc002imb.2_5'Flank	NM_145255	NP_660298	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10 precursor						ribosome biogenesis|translation	mitochondrial large ribosomal subunit	structural constituent of ribosome			ovary(1)	1						ttaaactggattttttttttt	0.164													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46955838	46955838	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46955838delT								CALCOCO2 (13610 upstream) : ATP5G1 (14310 downstream)																							tcccacaGAAttttttttttc	0.025											OREG0024528	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
SPATA20	64847	broad.mit.edu	37	17	48622244	48622247	+	5'Flank	DEL	TCTT	-	-	rs72372795		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48622244_48622247delTCTT	uc002irf.2	+						SPATA20_uc002irc.2_Intron|SPATA20_uc002ire.2_5'Flank|SPATA20_uc002ird.2_5'Flank	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20						cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			cccttctgtgtctttctttctttc	0.000													4	2	---	---	---	---	
ABCC3	8714	broad.mit.edu	37	17	48737061	48737062	+	Intron	INS	-	G	G	rs144181111	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48737061_48737062insG	uc002isl.2	+						ABCC3_uc002isk.3_Intron	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3						bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	atggggacactggggccgggtg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49208028	49208029	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49208028_49208029insT								SPAG9 (9802 upstream) : NME1 (22891 downstream)																							GCTAATGTGTAttttttttttt	0.193													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49451827	49451829	+	IGR	DEL	CAG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49451827_49451829delCAG								UTP18 (76537 upstream) : CA10 (255846 downstream)																							ACAGGACTGCCAGCAGCAGCATC	0.547													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55250841	55250841	+	IGR	DEL	T	-	-	rs79079164		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55250841delT								AKAP1 (52132 upstream) : MSI2 (82371 downstream)																							TGCAAAATGCTTTTTTTTTTT	0.358													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	56046954	56046955	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56046954_56046955insA								CUEDC1 (14270 upstream) : VEZF1 (1955 downstream)																							aacaaaCAaacaacaacaacaa	0.030													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	56419372	56419375	+	Intron	DEL	AAGG	-	-	rs112446080		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56419372_56419375delAAGG	uc010dct.1	+						uc010dcu.1_Intron|uc002ivz.2_Intron|uc010dcv.1_Intron|uc002iwa.2_Intron|uc002iwb.2_Intron|uc002iwc.2_Intron					Homo sapiens cDNA FLJ20264 fis, clone COLF7912.																		aagaaagaaaaaggaaggaaggaa	0.005													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	61049362	61049362	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61049362delT								MIR633 (27689 upstream) : TANC2 (37536 downstream)																							GTATTTAAGATTCAAGGTAAT	0.234													4	2	---	---	---	---	
CYB561	1534	broad.mit.edu	37	17	61522538	61522538	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61522538delA	uc002jas.2	-						CYB561_uc010ddt.2_Intron|CYB561_uc002jat.2_Intron|CYB561_uc010wpf.1_Intron|CYB561_uc010wpg.1_Intron	NM_001017916	NP_001017916	P49447	CY561_HUMAN	cytochrome b-561						electron transport chain|transport	integral to plasma membrane	cytochrome-b5 reductase activity|ferric-chelate reductase activity|metal ion binding			ovary(1)	1				READ - Rectum adenocarcinoma(1115;0.0689)		actccatctcaaaaaaaaaag	0.184													4	2	---	---	---	---	
ACE	1636	broad.mit.edu	37	17	61593969	61593970	+	Intron	INS	-	AA	AA	rs72401453		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61593969_61593970insAA	uc002jaw.1	+							NM_152830		P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 2						arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	gacccccgtttaaaaaaaaaaa	0.035													4	3	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	63656695	63656696	+	Intron	DEL	CT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63656695_63656696delCT	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			caggttctcactctgttgccca	0.000													4	2	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64487887	64487887	+	Intron	DEL	T	-	-	rs35417149		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64487887delT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	AATGTCTTCATTAGATTATCT	0.393													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	66048845	66048846	+	IGR	INS	-	CT	CT	rs35670842		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66048845_66048846insCT								KPNA2 (5876 upstream) : LOC651250 (48850 downstream)																							cataaatcttactactgcttag	0.000													4	2	---	---	---	---	
ARSG	22901	broad.mit.edu	37	17	66269351	66269352	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66269351_66269352insT	uc002jhc.2	+						SLC16A6_uc002jgz.1_Intron|SLC16A6_uc002jha.1_Intron	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TGTTCATTTCAttttttttttt	0.158													4	2	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	70936416	70936417	+	Intron	INS	-	T	T	rs5821935		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70936416_70936417insT	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						AGCCATCTGACttttttttttt	0.228													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72182801	72182810	+	IGR	DEL	TGTGCATGCA	-	-	rs72209828		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72182801_72182810delTGTGCATGCA								C17orf54 (358125 upstream) : RPL38 (16985 downstream)																							cacgcacgtgtgtgcatgcatgtgtgtgca	0.071													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72516627	72516628	+	IGR	INS	-	T	T	rs36055877		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72516627_72516628insT								CD300A (35696 upstream) : CD300LB (685 downstream)																							TGCCCACTAACttttttttttt	0.238													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72595932	72595933	+	IGR	INS	-	A	A	rs148589759	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72595932_72595933insA								C17orf77 (5584 upstream) : CD300E (12779 downstream)																							AGAAAACAAACAAAAAAAATGA	0.401													4	2	---	---	---	---	
CDR2L	30850	broad.mit.edu	37	17	72995383	72995384	+	Intron	INS	-	CACA	CACA	rs67981463		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72995383_72995384insCACA	uc002jml.3	+							NM_014603	NP_055418	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like												0	all_lung(278;0.226)					ATTACATCTTGcacacacacac	0.332													3	5	---	---	---	---	
QRICH2	84074	broad.mit.edu	37	17	74306553	74306553	+	5'Flank	DEL	T	-	-	rs35037723		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74306553delT	uc002jrd.1	-						QRICH2_uc010dgw.1_5'Flank	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						ccctggccTGttttttttttt	0.005													4	3	---	---	---	---	
PRPSAP1	5635	broad.mit.edu	37	17	74329931	74329932	+	Intron	INS	-	CATT	CATT	rs141801364	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74329931_74329932insCATT	uc010wta.1	-						PRPSAP1_uc010wtb.1_Intron	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						TGTAGACTCTGcattcattcat	0.168													4	3	---	---	---	---	
C17orf95	124512	broad.mit.edu	37	17	74724322	74724323	+	Intron	DEL	AA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74724322_74724323delAA	uc002jsr.2	+						JMJD6_uc002jsn.1_5'Flank|JMJD6_uc002jso.2_5'Flank|JMJD6_uc010dgz.2_5'Flank|C17orf95_uc002jsp.2_Intron|C17orf95_uc002jsq.2_Intron|C17orf95_uc002jss.2_Intron|C17orf95_uc002jst.2_Intron|C17orf95_uc002jsu.2_Intron	NM_001080510	NP_001073979	Q86XA0	MET23_HUMAN	hypothetical protein LOC124512							integral to membrane	methyltransferase activity				0						tgtcaagaagaaaaaaaaaaaa	0.099													4	2	---	---	---	---	
MGAT5B	146664	broad.mit.edu	37	17	74928205	74928206	+	Intron	INS	-	TCTTCTCCT	TCTTCTCCT	rs144269530	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74928205_74928206insTCTTCTCCT	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						CGTCttctttgtcttctccttc	0.035													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75677635	75677636	+	IGR	DEL	TT	-	-	rs112881520		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75677635_75677636delTT								SEPT9 (180959 upstream) : FLJ45079 (197473 downstream)																							ttttcttctctttttttttttt	0.025													6	3	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77116252	77116252	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77116252delA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			ctggttccccaggggactgta	0.209													4	2	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77318341	77318342	+	Intron	INS	-	GA	GA	rs146622615	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77318341_77318342insGA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			AGGAAAGAAGGGAGAGAGAGAG	0.564													3	4	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77336805	77336805	+	Intron	DEL	A	-	-	rs112341531		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77336805delA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			CCGATGAATGAAAAAAAAAAG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78950793	78950794	+	IGR	DEL	AA	-	-	rs112496455		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78950793_78950794delAA								RPTOR (10620 upstream) : CHMP6 (14847 downstream)																							tttgacaattaaaaaaaaaaaa	0.129													3	3	---	---	---	---	
LOC388428	388428	broad.mit.edu	37	17	79148430	79148430	+	Intron	DEL	A	-	-	rs77746288		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79148430delA	uc010wuk.1	+						LOC388428_uc010wul.1_Intron					SubName: Full=cDNA FLJ44861 fis, clone BRALZ2008930;												0						actccacctcaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79837881	79837881	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79837881delA								ARHGDIA (8643 upstream) : THOC4 (7830 downstream)																							accctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	558051	558051	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:558051delG								COLEC12 (57322 upstream) : CETN1 (22318 downstream)																							CCTACACTGTGGTCACAATAA	0.299													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	2110653	2110654	+	IGR	DEL	TA	-	-	rs78463748		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2110653_2110654delTA								C18orf2 (703472 upstream) : METTL4 (426871 downstream)																							AAAGAAACGTTAAAAAAAAAAA	0.252													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	4510880	4510881	+	IGR	INS	-	GT	GT	rs112575545		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4510880_4510881insGT								DLGAP1 (55614 upstream) : LOC642597 (632791 downstream)																							gtgtggtggtggtgtggtggtg	0.000													13	7	---	---	---	---	
L3MBTL4	91133	broad.mit.edu	37	18	6251049	6251050	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6251049_6251050insA	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				tcactcaatggaaaaaaaaatc	0.000													4	2	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8387733	8387734	+	Intron	INS	-	GAGT	GAGT	rs149661221	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8387733_8387734insGAGT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				AAGGACCTGGAgtgtgtgtgtg	0.218													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10566988	10566988	+	IGR	DEL	T	-	-	rs66584824		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10566988delT								NAPG (14226 upstream) : FAM38B (103872 downstream)																							cttttctttcttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10623866	10623866	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10623866delT								NAPG (71104 upstream) : FAM38B (46994 downstream)																							aaaaCAAAACTTTTTATTCAT	0.368													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10729003	10729004	+	IGR	INS	-	AT	AT	rs139802659	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10729003_10729004insAT								FAM38B (27024 upstream) : GNAL (960132 downstream)																							cacctgcatacgtgtgtgcaca	0.045													3	10	---	---	---	---	
FAM38B	63895	broad.mit.edu	37	18	10736293	10736294	+	Intron	INS	-	CC	CC	rs142837279	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10736293_10736294insCC	uc002kos.1	-									Q9H5I5	PIEZ2_HUMAN	SubName: Full=cDNA FLJ45725 fis, clone HCHON2009766; Flags: Fragment;							integral to membrane	ion channel activity			ovary(1)	1						CTTTTTCACTTTGCTTGCAAGA	0.381													4	3	---	---	---	---	
GNAL	2774	broad.mit.edu	37	18	11871253	11871253	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11871253delT	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron|GNAL_uc010wzt.1_Intron	NM_001142339	NP_001135811	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						tttttctttcttttttttttt	0.154													4	3	---	---	---	---	
SPIRE1	56907	broad.mit.edu	37	18	12461481	12461482	+	Intron	DEL	AT	-	-	rs5823219		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12461481_12461482delAT	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0						acgtacatacatatgtgtgtat	0.059													5	3	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13438078	13438078	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13438078delC	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		AAGGTCCTTACCCAGATGGCC	0.562													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	19805803	19805804	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19805803_19805804insT								GATA6 (23576 upstream) : CTAGE1 (187760 downstream)																							TCTTGATTTAAttttttttttt	0.158													4	3	---	---	---	---	
OSBPL1A	114876	broad.mit.edu	37	18	21940613	21940613	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21940613delA	uc002kve.2	-							NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					tgttcacaagaaaaaaaaatc	0.050													4	2	---	---	---	---	
PSMA8	143471	broad.mit.edu	37	18	23768304	23768305	+	Intron	INS	-	A	A	rs35512719		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23768304_23768305insA	uc002kvq.2	+						PSMA8_uc002kvo.2_Intron|PSMA8_uc002kvp.2_Intron|PSMA8_uc002kvr.2_Intron	NM_144662	NP_653263	Q8TAA3	PSA7L_HUMAN	proteasome alpha 8 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			aaaaggacaccaaaaaaaaaaa	0.000													3	4	---	---	---	---	
CHST9	83539	broad.mit.edu	37	18	24723040	24723040	+	5'Flank	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24723040delT	uc002kwd.2	-						C18orf16_uc010xbm.1_Intron|CHST9_uc002kwe.2_Intron	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2						carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)					TTCTATTGCATACTTTTATCT	0.358													4	2	---	---	---	---	
FAM59A	64762	broad.mit.edu	37	18	29848872	29848873	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29848872_29848873insT	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A											ovary(1)|skin(1)	2						ACTTCACTGGGTTTTTTTTTTA	0.282													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	44944005	44944005	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44944005delT	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																		GTGGCGTTACTTACAGGAGGC	0.299													4	2	---	---	---	---	
CDH19	28513	broad.mit.edu	37	18	64221842	64221842	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64221842delC	uc002lkc.1	-						CDH19_uc010dql.1_Intron|CDH19_uc010xey.1_Intron|CDH19_uc002lkd.2_Intron	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				TCTTTCTTTACCAAGCAAGAT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68446418	68446418	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68446418delT								SOCS6 (448984 upstream) : None (None downstream)																							tatttctttcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75822636	75822636	+	IGR	DEL	C	-	-	rs34774386		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75822636delC								GALR1 (840542 upstream) : SALL3 (917639 downstream)																							GTCCCCGGAACCTCAATGATT	0.498													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77344953	77344955	+	IGR	DEL	CTT	-	-	rs72183142		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77344953_77344955delCTT								NFATC1 (55631 upstream) : CTDP1 (94846 downstream)																							CTTGTTCCTCCTTTCCACTAAAG	0.626													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77523085	77523086	+	IGR	INS	-	T	T	rs33961705		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77523085_77523086insT								CTDP1 (8578 upstream) : KCNG2 (100582 downstream)																							atggtaagtAGGGAGGGAACCT	0.282													4	2	---	---	---	---	
MKNK2	2872	broad.mit.edu	37	19	2049908	2049909	+	Intron	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2049908_2049909delAC	uc002lus.2	-						MKNK2_uc010xgv.1_Intron|MKNK2_uc002lur.2_Intron	NM_199054	NP_951009	Q9HBH9	MKNK2_HUMAN	MAP kinase-interacting serine/threonine kinase 2						cell surface receptor linked signaling pathway|intracellular protein kinase cascade|regulation of translation		ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(1)|breast(1)	2		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGACAGAGacacacacacac	0.490													6	3	---	---	---	---	
SPPL2B	56928	broad.mit.edu	37	19	2319727	2319727	+	Intron	DEL	C	-	-	rs141735242	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2319727delC	uc010dsw.1	+									Q8TCT7	PSL1_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000371624;							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCAGCAAACCCCCGCCATC	0.677													4	2	---	---	---	---	
EMR1	2015	broad.mit.edu	37	19	6897083	6897084	+	Intron	DEL	TT	-	-	rs72175542		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6897083_6897084delTT	uc002mfw.2	+						EMR1_uc010dvc.2_Intron|EMR1_uc010dvb.2_Intron|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Intron	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					ttgttTTAACTTTTTTTTTTTT	0.139													4	2	---	---	---	---	
LRRC8E	80131	broad.mit.edu	37	19	7959400	7959400	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7959400delC	uc002mir.2	+							NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane				lung(1)|pancreas(1)	2						gcatgagccaccgcgcccagc	0.234													4	2	---	---	---	---	
KANK3	256949	broad.mit.edu	37	19	8391685	8391685	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8391685delA	uc010dwa.2	-							NM_198471	NP_940873	Q6NY19	KANK3_HUMAN	ankyrin repeat domain 47												0						catctctcagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
RAB3D	9545	broad.mit.edu	37	19	11447651	11447651	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11447651delA	uc002mqy.2	-							NM_004283	NP_004274	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family						exocytosis|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(2)	2						gtctcgagagaaaaaaaaaaa	0.000													6	3	---	---	---	---	
DNASE2	1777	broad.mit.edu	37	19	12993144	12993145	+	5'Flank	INS	-	T	T	rs140128484	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12993144_12993145insT	uc002mvn.1	-						DNASE2_uc010xmr.1_5'Flank	NM_001375	NP_001366	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal precursor						apoptosis	lysosome	deoxyribonuclease II activity|DNA binding|protein binding				0						aatttttgtagttttttttttg	0.000								Direct_reversal_of_damage					5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13901786	13901786	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13901786delA								C19orf53 (12202 upstream) : ZSWIM4 (4488 downstream)																							actccgtctcaaaaaaaaaaa	0.000													2	5	---	---	---	---	
TPM4	7171	broad.mit.edu	37	19	16203342	16203343	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16203342_16203343insT	uc002ndj.2	+						TPM4_uc002ndi.2_Intron|TPM4_uc002ndk.1_Intron	NM_003290	NP_003281	P67936	TPM4_HUMAN	tropomyosin 4 isoform 2						cellular component movement|muscle filament sliding|response to oxidative stress	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding|calcium ion binding|structural constituent of muscle		TPM4/ALK(12)	soft_tissue(10)|haematopoietic_and_lymphoid_tissue(2)|breast(1)	13						ACTCTGCCTACttttttttttt	0.248			T	ALK	ALCL								3	3	---	---	---	---	
ELL	8178	broad.mit.edu	37	19	18554204	18554205	+	3'UTR	INS	-	AC	AC	rs146329090	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18554204_18554205insAC	uc002njh.2	-	12					ELL_uc010ebq.2_3'UTR|ELL_uc002njg.2_3'UTR	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		TAGAAAAATAGACATCTGTATT	0.574			T	MLL	AL								3	3	---	---	---	---	
ELL	8178	broad.mit.edu	37	19	18581532	18581532	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18581532delG	uc002njh.2	-						ELL_uc010ebq.2_Intron|ELL_uc002njg.2_Intron	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		gaccctcgatggtctgggtgg	0.000			T	MLL	AL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23007518	23007519	+	IGR	DEL	AT	-	-	rs145908174		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23007518_23007519delAT								ZNF99 (54734 upstream) : ZNF91 (513900 downstream)																							acccacacacatgtttttagcc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23277325	23277325	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23277325delC								ZNF99 (324541 upstream) : ZNF91 (244094 downstream)																							actcttgtcacccaggctggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31055324	31055325	+	IGR	DEL	GA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31055324_31055325delGA								ZNF536 (6359 upstream) : DKFZp566F0947 (585458 downstream)																							GGGTAAAGAGGAGAGAGAGAGA	0.490													6	3	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33116342	33116342	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33116342delT	uc002ntn.1	-							NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					AAACAttctcttttttttttt	0.129													5	3	---	---	---	---	
SLC7A9	11136	broad.mit.edu	37	19	33360743	33360744	+	5'Flank	INS	-	TT	TT	rs11441727		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33360743_33360744insTT	uc002ntv.3	-						SLC7A9_uc002ntt.3_5'Flank|SLC7A9_uc002ntu.3_5'Flank|SLC7A9_uc002ntw.3_5'Flank	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	TATTAAACACCTTTTTTTTTTT	0.421													4	3	---	---	---	---	
GPI	2821	broad.mit.edu	37	19	34885625	34885626	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34885625_34885626insT	uc002nvg.1	+						GPI_uc002nvf.2_Intron|GPI_uc010xrv.1_Intron|GPI_uc010xrw.1_Intron|GPI_uc010edl.1_Intron|GPI_uc002nvi.1_Intron	NM_000175	NP_000166	P06744	G6PI_HUMAN	glucose phosphate isomerase						angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)					CCTGTCCCTGCttttttttttt	0.292													3	3	---	---	---	---	
DPF1	8193	broad.mit.edu	37	19	38712179	38712180	+	Intron	INS	-	A	A	rs74628406		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38712179_38712180insA	uc002ohl.2	-						DPF1_uc002ohm.2_Intron|DPF1_uc002ohn.2_Intron|DPF1_uc010xtu.1_Intron|DPF1_uc010xtv.1_Intron|DPF1_uc010xtw.1_Intron	NM_004647	NP_004638	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1 isoform						induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding				0	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			gactccatctcaaaaaaaaaaa	0.223													1	6	---	---	---	---	
CAPN12	147968	broad.mit.edu	37	19	39227605	39227612	+	Intron	DEL	CTCCTCCC	-	-	rs62120077		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39227605_39227612delCTCCTCCC	uc002ojd.1	-						CAPN12_uc010egd.1_5'Flank|CAPN12_uc002ojc.1_5'Flank	NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			tgctcctccactcctcccctcctccccg	0.096													4	2	---	---	---	---	
PAK4	10298	broad.mit.edu	37	19	39669600	39669601	+	3'UTR	INS	-	TG	TG	rs140812419	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39669600_39669601insTG	uc002okj.1	+	11					PAK4_uc002okl.1_3'UTR|PAK4_uc002okn.1_3'UTR|PAK4_uc002okm.1_3'UTR|PAK4_uc002oko.1_3'UTR|PAK4_uc002okp.1_3'UTR	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			gtgagtgtgcatgtgtgtgtgt	0.505													4	4	---	---	---	---	
LTBP4	8425	broad.mit.edu	37	19	41130969	41130970	+	Intron	INS	-	CT	CT	rs55652103	byFrequency	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41130969_41130970insCT	uc002ooh.1	+						LTBP4_uc002oog.1_Intron|LTBP4_uc002ooi.1_Intron|LTBP4_uc002ooj.1_Intron|LTBP4_uc002ook.1_Intron|LTBP4_uc002ool.1_Intron|LTBP4_uc010xvp.1_Intron	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding						growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCTCTTGAACACTCTACTTGTC	0.208													4	2	---	---	---	---	
EGLN2	112398	broad.mit.edu	37	19	41287544	41287545	+	Intron	DEL	GA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41287544_41287545delGA	uc010ehd.2	+						MIA_uc010xvt.1_Intron|RAB4B_uc002opc.1_Intron|RAB4B_uc002opd.1_Intron|RAB4B_uc002ope.1_Intron|RAB4B_uc002opf.1_Intron	NM_080732	NP_542770	Q96KS0	EGLN2_HUMAN	EGL nine (C.elegans) homolog 2						cell redox homeostasis|estrogen receptor signaling pathway|positive regulation of protein catabolic process|regulation of cell growth|response to hypoxia	cytoplasm|nucleus	ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|oxygen sensor activity			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	CGTGTTGTGGGAGAGAGAGAGA	0.292													4	3	---	---	---	---	
PSG1	5669	broad.mit.edu	37	19	43255620	43255621	+	Intron	DEL	AG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43255620_43255621delAG	uc002oug.1	-						PSG3_uc002ouf.2_Intron			P11464	PSG1_HUMAN	SubName: Full=cDNA FLJ90654 fis, clone PLACE1004520, highly similar to Human pregnancy-specific beta-glycoprotein d mRNA;						female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				cagctgaggcagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	44919973	44919974	+	IGR	INS	-	AC	AC	rs140270816	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44919973_44919974insAC								ZFP112 (14196 upstream) : ZNF229 (10452 downstream)																							accacacacaaacacacacaca	0.327													4	3	---	---	---	---	
DKFZp434J0226	93429	broad.mit.edu	37	19	46716265	46716265	+	RNA	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46716265delC	uc010xxw.1	+	4		c.516delC				NR_027003				Homo sapiens mRNA; cDNA DKFZp434J0226 (from clone DKFZp434J0226).												0						CCATGAGCTGCAGGTGAGTGA	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47891038	47891040	+	IGR	DEL	GTT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47891038_47891040delGTT								DHX34 (5077 upstream) : MEIS3 (15342 downstream)																							cggagcagaagttgttgttgttg	0.015													4	3	---	---	---	---	
SLC8A2	6543	broad.mit.edu	37	19	47950110	47950111	+	Intron	INS	-	T	T	rs141720064	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47950110_47950111insT	uc002pgx.2	-						SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Intron	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CCGTGTGTGTCTATGTGTGTGT	0.292													3	3	---	---	---	---	
SULT2A1	6822	broad.mit.edu	37	19	48376018	48376019	+	Intron	INS	-	T	T	rs11352410		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48376018_48376019insT	uc002phr.2	-							NM_003167	NP_003158	Q06520	ST2A1_HUMAN	bile-salt sulfotransferase 2A1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|bile acid catabolic process|cellular lipid metabolic process|digestion|sulfation|xenobiotic metabolic process	cytosol	bile-salt sulfotransferase activity			ovary(1)|pancreas(1)	2		all_cancers(25;3.02e-09)|all_lung(116;6.48e-07)|all_epithelial(76;7.35e-07)|Lung NSC(112;1.56e-06)|all_neural(266;0.0146)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000254)|all cancers(93;0.000545)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.0552)		CAGCAtttatcttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	48691650	48691651	+	Intron	DEL	TG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48691650_48691651delTG	uc002pic.3	+											RecName: Full=Uncharacterized protein C19orf68;																		tggctaattttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	50648852	50648853	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50648852_50648853insT								SNAR-D (5275 upstream) : C19orf41 (6952 downstream)																							TGCATGAGGTGttttttttttt	0.257													5	3	---	---	---	---	
MYBPC2	4606	broad.mit.edu	37	19	50952671	50952671	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50952671delG	uc002psf.2	+							NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		acactcacgtggcagaggcag	0.000													4	2	---	---	---	---	
KLK2	3817	broad.mit.edu	37	19	51382118	51382118	+	3'UTR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51382118delG	uc002ptv.2	+	5					KLK2_uc002ptu.2_3'UTR|KLK2_uc002ptt.2_RNA|KLK2_uc010ycl.1_3'UTR|KLK2_uc010ycm.1_3'UTR|KLK2_uc010eoh.2_3'UTR	NM_005551	NP_005542	P20151	KLK2_HUMAN	kallikrein 2, prostatic isoform 1						proteolysis		serine-type endopeptidase activity			ovary(1)|skin(1)	2		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		acaaagacgtgggtgaccatg	0.134			T	ETV4	prostate								4	2	---	---	---	---	
ZNF611	81856	broad.mit.edu	37	19	53223315	53223316	+	Intron	INS	-	AT	AT	rs137928863	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53223315_53223316insAT	uc002pzz.2	-						ZNF611_uc010eqc.2_Intron|ZNF611_uc010ydo.1_Intron|ZNF611_uc010ydr.1_Intron|ZNF611_uc010ydp.1_Intron|ZNF611_uc010ydq.1_Intron|ZNF611_uc002qaa.3_Intron	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		tgacacagcacgtttcagagag	0.000													5	3	---	---	---	---	
ZNF160	90338	broad.mit.edu	37	19	53571486	53571486	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53571486delC	uc010eqk.2	-	7	2717	c.2301delG	c.(2299-2301)GGGfs	p.G767fs	ZNF160_uc002qaq.3_Frame_Shift_Del_p.G767fs|ZNF160_uc002qar.3_Frame_Shift_Del_p.G767fs	NM_001102603	NP_001096073	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	767	C2H2-type 19.				hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(134;0.02)		TAAAGGCTTTCCCACACTCTG	0.433													45	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54594053	54594053	+	IGR	DEL	A	-	-	rs34980687		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54594053delA								TARM1 (9419 upstream) : OSCAR (3882 downstream)																							tccaactcggaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54949743	54949743	+	IGR	DEL	A	-	-	rs11296289		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54949743delA								TTYH1 (1691 upstream) : LENG8 (10322 downstream)																							ccatcccttgaaaaaaaaaaa	0.015													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55960506	55960509	+	IGR	DEL	CACG	-	-	rs113388310		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55960506_55960509delCACG								SHISA7 (6276 upstream) : ISOC2 (3839 downstream)																							acacacaccacacgcacacacacc	0.260													4	2	---	---	---	---	
ISOC2	79763	broad.mit.edu	37	19	55969198	55969199	+	Intron	INS	-	A	A	rs143317573		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55969198_55969199insA	uc002qlb.2	-						ISOC2_uc002qla.2_Intron|ISOC2_uc002qlc.2_Intron	NM_001136201	NP_001129673	Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2 isoform 1						protein destabilization	mitochondrion|nucleus	catalytic activity|protein binding			ovary(1)	1	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		aactccatctcaaaaaaaaaaa	0.000													5	4	---	---	---	---	
EPN1	29924	broad.mit.edu	37	19	56197176	56197176	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56197176delT	uc002qlw.2	+						EPN1_uc002qlv.2_Intron|EPN1_uc010etd.2_Intron|EPN1_uc002qlx.2_Intron	NM_001130072	NP_001123544	Q9Y6I3	EPN1_HUMAN	epsin 1 isoform b						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|cytoplasm|nucleus|plasma membrane	lipid binding				0		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		ACTTGGGCCCTTTTTTTCCCT	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57205352	57205355	+	IGR	DEL	TGTG	-	-	rs148185442		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57205352_57205355delTGTG								ZNF835 (21106 upstream) : ZIM2 (80568 downstream)																							ACTAtgtgtatgtgtgtgtgtgtg	0.299													5	3	---	---	---	---	
ZNF135	7694	broad.mit.edu	37	19	58569421	58569421	+	5'Flank	DEL	T	-	-	rs5828741		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58569421delT	uc010yhq.1	+						ZNF135_uc002qre.2_5'Flank|ZNF135_uc002qrd.1_5'Flank|ZNF135_uc002qrf.2_5'Flank|ZNF135_uc002qrg.2_5'Flank|ZNF135_uc010yhr.1_5'Flank	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CGGTTGGGGGTGGGGGTGGGG	0.438													4	7	---	---	---	---	
ZNF544	27300	broad.mit.edu	37	19	58741024	58741025	+	Intron	DEL	TG	-	-	rs34298440		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58741024_58741025delTG	uc010euo.2	+						ZNF544_uc010eun.1_Intron|ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Intron|ZNF544_uc010yhy.1_Intron|ZNF544_uc002qrt.3_Intron|ZNF544_uc002qru.3_Intron|ZNF544_uc002qrv.2_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		CAGGGGTAACTGGGGTGTTGGG	0.495													3	5	---	---	---	---	
TGM3	7053	broad.mit.edu	37	20	2294297	2294298	+	Intron	INS	-	CT	CT	rs150469143	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2294297_2294298insCT	uc002wfx.3	+							NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor						cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	aatcacacacactctctctctc	0.218													4	3	---	---	---	---	
MCM8	84515	broad.mit.edu	37	20	5955905	5955906	+	Intron	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5955905_5955906insA	uc002wmi.2	+						MCM8_uc002wmj.2_Intron|MCM8_uc002wmk.2_Intron|MCM8_uc002wml.2_Intron|MCM8_uc010gbp.2_Intron|MCM8_uc002wmm.2_Intron	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8						cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1						accctgtctttaaaaaaaaaaa	0.139													6	3	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8861976	8861977	+	Intron	DEL	GT	-	-	rs35661660		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8861976_8861977delGT	uc002wnb.2	+						PLCB1_uc002wna.2_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						CAAAAGACCCgtgtgtgtgtgt	0.183													4	3	---	---	---	---	
C20orf103	24141	broad.mit.edu	37	20	9498085	9498086	+	Intron	INS	-	T	T	rs143159970	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9498085_9498086insT	uc002wni.1	+						C20orf103_uc010zrc.1_Intron	NM_012261	NP_036393	Q9UJQ1	CT103_HUMAN	chromosome 20 open reading frame 103 precursor							integral to membrane				upper_aerodigestive_tract(1)|lung(1)|breast(1)	3			COAD - Colon adenocarcinoma(9;0.194)			ATTATTAGGGAttttttttttc	0.208													3	3	---	---	---	---	
THBD	7056	broad.mit.edu	37	20	23028359	23028359	+	3'UTR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23028359delG	uc002wss.2	-	1					THBD_uc002wst.1_RNA	NM_000361	NP_000352	P07204	TRBM_HUMAN	thrombomodulin precursor						blood coagulation|leukocyte migration|negative regulation of fibrinolysis|negative regulation of platelet activation	cell surface|integral to plasma membrane	calcium ion binding|protein binding|transmembrane receptor activity				0	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)	TAGCAAAGCTGGGGGTGAGGA	0.627													4	2	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25531812	25531813	+	Intron	DEL	AT	-	-	rs142473591		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25531812_25531813delAT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						aatacagcacatgttttctggg	0.000													3	3	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25755082	25755084	+	Intron	DEL	GCC	-	-	rs112942207		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25755082_25755084delGCC	uc010zth.1	-						FAM182B_uc002wvd.1_Intron|FAM182B_uc002wve.2_RNA|FAM182B_uc010zti.1_Intron	NR_027061				Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						CAAGGACCTTGCCGCCGCGGCCC	0.675													4	2	---	---	---	---	
BCL2L1	598	broad.mit.edu	37	20	30303075	30303075	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30303075delA	uc002wwl.2	-						BCL2L1_uc002wwk.2_Intron|BCL2L1_uc002wwm.2_Intron|BCL2L1_uc002wwn.2_Intron	NM_138578	NP_612815	Q07817	B2CL1_HUMAN	BCL2-like 1 isoform 1						induction of apoptosis by intracellular signals|negative regulation of establishment of protein localization in plasma membrane|negative regulation of survival gene product expression|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|release of cytochrome c from mitochondria|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nuclear membrane	BH3 domain binding|identical protein binding			lung(1)|central_nervous_system(1)	2	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			actctgtctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
MYLK2	85366	broad.mit.edu	37	20	30415685	30415686	+	Intron	INS	-	T	T	rs72076097		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30415685_30415686insT	uc002wwq.2	+						MYLK2_uc002wws.2_Intron	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase						cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGCAGATCTGCttttttttttt	0.158													3	3	---	---	---	---	
TM9SF4	9777	broad.mit.edu	37	20	30724536	30724536	+	Intron	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30724536delC	uc002wxj.2	+						TM9SF4_uc010ztr.1_Intron|TM9SF4_uc010zts.1_Intron|TM9SF4_uc002wxk.2_Intron	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4							integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTCCATTTGACAGAATTTCAG	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31939063	31939066	+	IGR	DEL	TTTT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31939063_31939066delTTTT								C20orf114 (41379 upstream) : CDK5RAP1 (7581 downstream)																							agctaacttcttttttttttttta	0.000													4	2	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32364199	32364199	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32364199delT	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						gcacctggccttttttttttt	0.000													4	2	---	---	---	---	
CHMP4B	128866	broad.mit.edu	37	20	32399279	32399279	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32399279delC	uc002xaa.2	+	1	161	c.5delC	c.(4-6)TCGfs	p.S2fs		NM_176812	NP_789782	Q9H444	CHM4B_HUMAN	chromatin modifying protein 4B	2					cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			ovary(1)|central_nervous_system(1)	2						GCAACCATGTCGGTGTTCGGG	0.403													4	2	---	---	---	---	
SAMHD1	25939	broad.mit.edu	37	20	35574816	35574816	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35574816delA	uc002xgh.1	-							NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1						defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				actctgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
TGM2	7052	broad.mit.edu	37	20	36781936	36781936	+	Intron	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36781936delA	uc002xhr.2	-						TGM2_uc010zvx.1_Intron|TGM2_uc010zvy.1_Intron|TGM2_uc002xhs.1_Intron|TGM2_uc002xht.2_Intron|TGM2_uc002xhu.3_Intron	NM_004613	NP_004604	P21980	TGM2_HUMAN	transglutaminase 2 isoform a						apoptotic cell clearance|peptide cross-linking|positive regulation of cell adhesion		acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(1)|lung(1)|ovary(1)	3		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	caaaaaaaagaaaaaaaaaaa	0.000													4	3	---	---	---	---	
KIAA1755	85449	broad.mit.edu	37	20	36880889	36880889	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36880889delG	uc002xhy.1	-						KIAA1755_uc002xhz.1_Intron	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449											ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)				ggctgatcttgcccaagaccg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37411868	37411869	+	IGR	INS	-	AC	AC	rs11473802		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37411868_37411869insAC								ACTR5 (10779 upstream) : PPP1R16B (22479 downstream)																							tttatggagggagagagagtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39071507	39071508	+	IGR	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39071507_39071508delTC								None (None upstream) : MAFB (243011 downstream)																							CACACACATTTCTCtgtgtgtg	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39402407	39402409	+	IGR	DEL	CAG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39402407_39402409delCAG								MAFB (84531 upstream) : TOP1 (255053 downstream)																							CTACTGCTAACAGCAGCAGCAGC	0.562													4	2	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41508374	41508375	+	Intron	DEL	TG	-	-	rs11468460		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41508374_41508375delTG	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TTGGGTGAAAtgtgtgtgtgtg	0.317													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42057839	42057839	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42057839delT								PTPRT (239282 upstream) : SFRS6 (28665 downstream)																							ttttttttaattttttttttt	0.229													4	2	---	---	---	---	
MYBL2	4605	broad.mit.edu	37	20	42325373	42325374	+	Intron	INS	-	T	T	rs139433233	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42325373_42325374insT	uc002xlb.1	+						MYBL2_uc010zwj.1_Intron|MYBL2_uc002xla.1_Intron	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			tgtgtggttgatttttttgttt	0.000													7	6	---	---	---	---	
WISP2	8839	broad.mit.edu	37	20	43343737	43343738	+	5'UTR	INS	-	CA	CA	rs144166282	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43343737_43343738insCA	uc002xmn.2	+	1					uc002xml.1_Intron|uc002xmm.1_Intron|WISP2_uc002xmo.1_5'Flank|WISP2_uc002xmp.2_5'Flank|WISP2_uc002xmq.2_5'Flank	NM_003881	NP_003872	O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2						cell adhesion|cell-cell signaling|signal transduction	extracellular region|soluble fraction	insulin-like growth factor binding			skin(1)	1		Myeloproliferative disorder(115;0.0122)				acacacacgcgcacacacacac	0.470													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46425091	46425091	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46425091delG								SULF2 (9731 upstream) : LOC284749 (563563 downstream)																							tgttgttgttgtttttttttt	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47523252	47523252	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47523252delA								PREX1 (78832 upstream) : ARFGEF2 (15023 downstream)																							aaccttggacaagaaacctca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51041980	51041981	+	IGR	INS	-	C	C	rs146372523	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51041980_51041981insC								ZFP64 (233456 upstream) : TSHZ2 (546896 downstream)																							CGAGGACGCCTCCTGCAGGTTT	0.500													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54921374	54921374	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54921374delC								MC3R (96503 upstream) : C20orf108 (12609 downstream)																							gccatgccatccccattcttg	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55665795	55665795	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55665795delC								TFAP2C (451459 upstream) : BMP7 (78014 downstream)																							CAGCTCCAGACCCACACACCT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56296818	56296821	+	IGR	DEL	TTCT	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56296818_56296821delTTCT								PMEPA1 (10277 upstream) : C20orf85 (429162 downstream)																							cgattctgacttctttgacggtag	0.147													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56367054	56367055	+	IGR	INS	-	AT	AT	rs147026839	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56367054_56367055insAT								PMEPA1 (80513 upstream) : C20orf85 (358928 downstream)																							cacacacacacacGTGCATGAG	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57220209	57220209	+	IGR	DEL	A	-	-	rs141982759		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57220209delA								APCDD1L (130260 upstream) : STX16 (6100 downstream)																							accctggctcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
EDN3	1908	broad.mit.edu	37	20	57896663	57896664	+	Intron	INS	-	G	G	rs148681039	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57896663_57896664insG	uc002yap.2	+						EDN3_uc002yao.1_Intron|EDN3_uc002yaq.2_Intron|EDN3_uc002yar.2_Intron|EDN3_uc002yas.2_Intron	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					GCTTATTGGGAGGGGGGGGAAC	0.381													4	3	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59950889	59950891	+	Intron	DEL	TGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59950889_59950891delTGA	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ttggtggtggtgatggtgtggtt	0.010													4	3	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60362155	60362166	+	Intron	DEL	CATCCATCCATC	-	-	rs113099172		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60362155_60362166delCATCCATCCATC	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			atccatccatcatccatccatccatccatcca	0.245													5	3	---	---	---	---	
RTEL1	51750	broad.mit.edu	37	20	62319207	62319208	+	Intron	INS	-	GGG	GGG	rs143664886	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62319207_62319208insGGG	uc002yfu.1	+						RTEL1_uc011abc.1_Intron|RTEL1_uc002yft.1_Intron|RTEL1_uc011abd.1_Intron|RTEL1_uc011abe.1_Intron|RTEL1_uc002yfw.2_Intron|RTEL1_uc002yfx.1_5'Flank	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CCCCATGAGCCGGGTGCTGGGG	0.668													4	2	---	---	---	---	
ZGPAT	84619	broad.mit.edu	37	20	62363697	62363699	+	Intron	DEL	GGT	-	-	rs71959904		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62363697_62363699delGGT	uc002ygk.2	+						ZGPAT_uc002ygi.2_Intron|ZGPAT_uc002ygj.2_Intron|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Intron|ZGPAT_uc002ygm.2_Intron|ZGPAT_uc002ygn.3_Intron	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain						negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					gtgtgggtgaggtgtgtgtgtgc	0.039													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10545904	10545904	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10545904delG	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		TATATAACAAGAAATAAAATA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10731178	10731179	+	IGR	DEL	AA	-	-	rs146936303		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10731178_10731179delAA								None (None upstream) : TPTE (175564 downstream)																							cagattctacaaaaaaagagag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11125601	11125602	+	IGR	INS	-	A	A	rs79312979		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11125601_11125602insA								BAGE (26664 upstream) : None (None downstream)																							actccatctccaaaaaaaaaac	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11139900	11139901	+	IGR	INS	-	T	T	rs113435986		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11139900_11139901insT								BAGE (40963 upstream) : None (None downstream)																							ctgtgtcGCCCttttttttcct	0.020													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11155113	11155113	+	IGR	DEL	A	-	-	rs149249762		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11155113delA								BAGE (56176 upstream) : None (None downstream)																							TGTAGATCTGAAAAAAAATGA	0.264													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14363881	14363882	+	IGR	DEL	AG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14363881_14363882delAG								None (None upstream) : C21orf99 (46605 downstream)																							ttctacaaaaagagagtttcaa	0.000													3	3	---	---	---	---	
ITSN1	6453	broad.mit.edu	37	21	35061898	35061898	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35061898delT	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_Intron|ITSN1_uc002ysz.2_Intron|ITSN1_uc010gmg.2_Intron|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Intron|ITSN1_uc010gmi.2_Intron|ITSN1_uc010gmj.2_Intron|ITSN1_uc002ysy.2_Intron|ITSN1_uc002ysx.2_Intron|ITSN1_uc002ytb.1_Intron	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						ggaggattgcttgcactcagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	35331965	35331966	+	Intron	INS	-	AC	AC	rs147418963	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35331965_35331966insAC	uc002ytn.2	+											Homo sapiens cDNA, FLJ18587.																		acagtcactatacacacacaca	0.000													4	2	---	---	---	---	
KCNJ6	3763	broad.mit.edu	37	21	39125056	39125056	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39125056delG	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)	CTGCAACCCTGAGGAGCCTCA	0.532													4	2	---	---	---	---	
KRTAP10-3	386682	broad.mit.edu	37	21	45978509	45978509	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45978509delG	uc002zfj.1	-	1	135	c.90delC	c.(88-90)CCCfs	p.P30fs	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	30	1.|18 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						TGGCGCAGCAGGGGGGCTCAC	0.697													16	9	---	---	---	---	
C21orf29	54084	broad.mit.edu	37	21	46121932	46121932	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46121932delG	uc002zfe.1	-						C21orf29_uc010gpv.1_Intron	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor						cell adhesion	extracellular region	structural molecule activity				0						gCCaagttcagagccctgaga	0.055													4	2	---	---	---	---	
C21orf57	54059	broad.mit.edu	37	21	47709850	47709851	+	Intron	DEL	TG	-	-	rs113422051		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47709850_47709851delTG	uc002ziv.2	+						C21orf57_uc002zit.1_Intron|C21orf57_uc002ziu.1_Intron|C21orf57_uc002ziw.2_Intron|C21orf57_uc002zix.2_Intron|C21orf57_uc010gqh.2_Intron|C21orf57_uc002ziy.2_Intron	NM_058181	NP_478061	P58557	YBEY_HUMAN	hypothetical protein LOC54059 isoform 1								metal ion binding|metalloendopeptidase activity				0	Breast(49;0.112)			Colorectal(79;0.236)		gttgcagttttGTGtgtgtgta	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17238598	17238599	+	IGR	INS	-	A	A	rs142952466	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17238598_17238599insA								psiTPTE22 (59077 upstream) : XKR3 (25714 downstream)																							aataaatgaataaaaaaaaata	0.000													4	3	---	---	---	---	
IL17RA	23765	broad.mit.edu	37	22	17567263	17567263	+	Intron	DEL	A	-	-	rs35941988		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17567263delA	uc002zly.2	+						IL17RA_uc010gqt.2_Intron	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor						fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TATGTCGCAGAAAAAAAAAAA	0.413													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17832254	17832256	+	IGR	DEL	TTC	-	-	rs112319651		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17832254_17832256delTTC								CECR1 (129516 upstream) : CECR2 (8583 downstream)																							ctttctttctttctttttttttt	0.143													4	3	---	---	---	---	
SEPT5	5413	broad.mit.edu	37	22	19699181	19699182	+	5'Flank	INS	-	T	T	rs35682118		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19699181_19699182insT	uc002zpv.1	+							NM_002688	NP_002679	Q99719	SEPT5_HUMAN	septin 5						cell cycle|cytokinesis|regulation of exocytosis|synaptic vesicle targeting	plasma membrane|septin complex|synaptic vesicle	GTP binding|GTPase activity|protein binding|structural molecule activity			lung(1)	1	Colorectal(54;0.0993)					accacagccagttttttttttt	0.000													4	3	---	---	---	---	
TBX1	6899	broad.mit.edu	37	22	19758152	19758153	+	Intron	DEL	TC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19758152_19758153delTC	uc002zqb.2	+						TBX1_uc002zqc.2_Intron	NM_080646	NP_542377	O43435	TBX1_HUMAN	T-box 1 isoform A						embryonic viscerocranium morphogenesis|heart development|parathyroid gland development|pharyngeal system development|regulation of transcription from RNA polymerase II promoter|soft palate development|thymus development	nucleus	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)	2	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				CTGGTGGGCTTCAGGCCCCACC	0.639													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20143168	20143169	+	IGR	INS	-	A	A			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20143168_20143169insA								ZDHHC8 (7639 upstream) : LOC150197 (50686 downstream)																							TGGGCTGGGAGGACAAAGAGGA	0.678													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	22226712	22226715	+	IGR	DEL	TGTT	-	-	rs71735050		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22226712_22226715delTGTT								MAPK1 (4742 upstream) : PPM1F (47078 downstream)																							gtgctgagactgtttgaatcttgg	0.044													4	3	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22978157	22978158	+	Intron	INS	-	A	A	rs66812776		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22978157_22978158insA	uc011aim.1	+						POM121L1P_uc011ait.1_Intron|uc002zwm.2_5'Flank					Parts of antibodies, mostly variable regions.												0						cccatctccagaaaaaatagaa	0.000													3	3	---	---	---	---	
MMP11	4320	broad.mit.edu	37	22	24118420	24118421	+	Intron	INS	-	G	G	rs138024450	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24118420_24118421insG	uc002zxx.2	+						MMP11_uc002zxy.2_Intron	NM_005940	NP_005931	P24347	MMP11_HUMAN	matrix metalloproteinase 11 preproprotein						collagen catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|large_intestine(1)	3		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)				CCATGGGCATAGCAGGGCTGGC	0.624													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27531753	27531754	+	IGR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27531753_27531754delAC								MIAT (416804 upstream) : MN1 (612512 downstream)																							GTCCCCTGTGACACACACACAC	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	28201741	28201742	+	IGR	DEL	CA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28201741_28201742delCA								MN1 (4255 upstream) : PITPNB (45916 downstream)																							GCTATGTCAGCACACACACACA	0.361													4	2	---	---	---	---	
EWSR1	2130	broad.mit.edu	37	22	29676663	29676664	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29676663_29676664insT	uc003aet.2	+						EWSR1_uc003aes.3_Intron|EWSR1_uc003aev.2_Intron|EWSR1_uc003aew.2_Intron|EWSR1_uc003aex.2_Intron|EWSR1_uc003aey.2_Intron	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254						GGTTTGGTTGGttttttttttt	0.208			T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29888148	29888149	+	IGR	INS	-	A	A	rs35198111		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29888148_29888149insA								NEFH (873 upstream) : THOC5 (16008 downstream)																							gactgcgtctcaaaaaaaaaaa	0.020													3	3	---	---	---	---	
PISD	23761	broad.mit.edu	37	22	32020641	32020642	+	Intron	DEL	AC	-	-	rs68001293	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32020641_32020642delAC	uc003alm.3	-						PISD_uc003alk.2_Intron|PISD_uc003all.2_Intron|PISD_uc011alr.1_Intron|PISD_uc003aln.3_Intron	NM_014338	NP_055153	Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						phospholipid biosynthetic process	mitochondrion	phosphatidylserine decarboxylase activity			central_nervous_system(2)|ovary(1)	3					Phosphatidylserine(DB00144)	Gcacagacagacacacacacac	0.347													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35991557	35991558	+	IGR	DEL	TT	-	-	rs35164647		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35991557_35991558delTT								RASD2 (41514 upstream) : MB (11254 downstream)																							atacagactctttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36449632	36449633	+	IGR	DEL	CC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36449632_36449633delCC								RBM9 (25047 upstream) : APOL3 (86739 downstream)																							cttctcccttcccatcccttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36951822	36951822	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36951822delC								EIF3D (26545 upstream) : CACNG2 (8282 downstream)																							GAACCCCAGTCCACCACATTC	0.458													4	2	---	---	---	---	
CSF2RB	1439	broad.mit.edu	37	22	37334735	37334736	+	3'UTR	DEL	AC	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37334735_37334736delAC	uc003aqa.3	+	14					CSF2RB_uc003aqc.3_3'UTR	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta						respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	GCTcacacagacacacacacac	0.386													4	2	---	---	---	---	
TMPRSS6	164656	broad.mit.edu	37	22	37474893	37474914	+	Intron	DEL	GGAGAAGAAGGAGAAGAGGAAG	-	-	rs72057036	by1000genomes	TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37474893_37474914delGGAGAAGAAGGAGAAGAGGAAG	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						aggaagagaaggagaagaaggagaagaggaagggagaagaag	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	37839279	37839279	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37839279delC								ELFN2 (15774 upstream) : MFNG (25824 downstream)																							aggaagggcaccgctatgtgg	0.000													4	3	---	---	---	---	
KCNJ4	3761	broad.mit.edu	37	22	38834709	38834712	+	Intron	DEL	AAAG	-	-	rs143387264		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38834709_38834712delAAAG	uc003avs.1	-						KCNJ4_uc003avt.1_Intron	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4						synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)					aaaaagaaaaaaagaaagaaagaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	41758675	41758675	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41758675delG								ZC3H7B (2525 upstream) : TEF (4717 downstream)																							cagggatacaggattacttaa	0.119													4	2	---	---	---	---	
POLR3H	171568	broad.mit.edu	37	22	41941273	41941275	+	5'Flank	DEL	AGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41941273_41941275delAGA	uc003baf.2	-						POLR3H_uc003bae.2_5'Flank|POLR3H_uc003bag.2_5'Flank|POLR3H_uc003bai.2_5'Flank|POLR3H_uc003baj.1_5'Flank	NM_138338	NP_612211	Q9Y535	RPC8_HUMAN	polymerase (RNA) III (DNA directed) polypeptide						innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity			skin(1)	1						aagaagaaggagaagaagaagaa	0.000													10	5	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43614037	43614039	+	Intron	DEL	CCT	-	-	rs79792173		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43614037_43614039delCCT	uc003bdt.1	-							NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				actccttgtccctcctcagactg	0.256													4	3	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43732964	43732965	+	Intron	DEL	TG	-	-	rs34868094		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43732964_43732965delTG	uc003bdt.1	-						SCUBE1_uc003bdu.1_Intron	NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				tgtgtatgtctgtgtgtgtgtg	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48537000	48537000	+	IGR	DEL	A	-	-	rs36014329		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48537000delA								TBC1D22A (967278 upstream) : FAM19A5 (348288 downstream)																							CCAGACAGGCAAAAAAATATC	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48608971	48608971	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48608971delC								None (None upstream) : FAM19A5 (276317 downstream)																							catccatccacccccatccat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49313385	49313385	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49313385delA								FAM19A5 (165643 upstream) : C22orf34 (494791 downstream)																							ATGAGATGTGAAAAAAAAAAA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49518599	49518599	+	IGR	DEL	A	-	-	rs5845870		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49518599delA								FAM19A5 (370857 upstream) : C22orf34 (289577 downstream)																							AGTACTTGTTATTTTTTTCTT	0.308													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49729979	49729979	+	IGR	DEL	T	-	-	rs66932187		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49729979delT								FAM19A5 (582237 upstream) : C22orf34 (78197 downstream)																							GGTTGCATCCttttttttttt	0.303													4	2	---	---	---	---	
MOV10L1	54456	broad.mit.edu	37	22	50569007	50569007	+	Intron	DEL	G	-	-	rs35981976		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50569007delG	uc003bjj.2	+						MOV10L1_uc003bjk.3_Intron|MOV10L1_uc011arp.1_Intron|MOV10L1_uc011arq.1_Intron|MOV10L1_uc010hao.1_Intron	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1						germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		AGGACCAGGAGGGGGGTACTT	0.512													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	715800	715800	+	IGR	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:715800delT								SHOX (95655 upstream) : CRLF2 (599087 downstream)																							AGATGGATTATTTTTTGTTTG	0.294													4	2	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1592419	1592422	+	Intron	DEL	TGGA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1592419_1592422delTGGA	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				catggatgggtggatggatgggtg	0.000			T	CRLF2	B-ALL|Downs associated ALL								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1942273	1942273	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1942273delA								ASMT (180300 upstream) : DHRSX (195284 downstream)																							CCAAGCAAATAACAGACAGGG	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2449557	2449557	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2449557delA								DHRSX (30542 upstream) : CD99 (159671 downstream)																							actccgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2516016	2516017	+	IGR	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2516016_2516017insT								DHRSX (97001 upstream) : CD99 (93211 downstream)																							AACGTGCTTCATTTTTTTTTTT	0.317													4	2	---	---	---	---	
ATP6AP2	10159	broad.mit.edu	37	X	40457910	40457911	+	Intron	INS	-	T	T			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40457910_40457911insT	uc004det.2	+						ATP6AP2_uc010nhc.2_Intron|ATP6AP2_uc011mkl.1_Intron|ATP6AP2_uc011mkm.1_Intron|ATP6AP2_uc011mkn.1_Intron|ATP6AP2_uc004deu.1_Intron	NM_005765	NP_005756	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory						angiotensin maturation|positive regulation of transforming growth factor-beta1 production|regulation of MAPKKK cascade	external side of plasma membrane|integral to membrane	protein binding|receptor activity				0						AAAGAATGCTCTTTTTTTTTGG	0.342													11	11	---	---	---	---	
WNK3	65267	broad.mit.edu	37	X	54236503	54236504	+	Intron	DEL	AA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54236503_54236504delAA	uc004dtd.1	-						WNK3_uc004dtc.1_Intron	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2						intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						ATGCTGTGCTAAGGCCAACAAA	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61754767	61754767	+	IGR	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61754767delG								None (None upstream) : SPIN4 (812341 downstream)																							tcaactcacagagttgaacat	0.000													4	4	---	---	---	---	
IRAK1	3654	broad.mit.edu	37	X	153278143	153278143	+	Intron	DEL	G	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153278143delG	uc004fjs.1	-						IRAK1_uc004fjr.1_Intron|IRAK1_uc004fjt.1_Intron|IRAK1_uc010nur.2_Intron	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1						activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGTGGAGATGGCACTCCCTT	0.617													6	20	---	---	---	---	
PCDH11Y	83259	broad.mit.edu	37	Y	5442528	5442528	+	Intron	DEL	T	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:5442528delT	uc004fqo.2	+							NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						AAGTACAGAGTTAAAAAAAaa	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10008561	10008571	+	IGR	DEL	TCCTCCTTTCA	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10008561_10008571delTCCTCCTTTCA								TTTY22 (357707 upstream) : None (None downstream)																							ccttccaaggtcctcctttcatccgtccttt	0.057													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10024055	10024056	+	IGR	DEL	TG	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10024055_10024056delTG								TTTY22 (373201 upstream) : None (None downstream)																							tcgctgtctctgtctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10030646	10030646	+	IGR	DEL	A	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10030646delA								TTTY22 (379792 upstream) : None (None downstream)																							cttgatggggatggcaAaggg	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13270122	13270122	+	IGR	DEL	T	-	-	rs75692746		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13270122delT								None (None upstream) : None (None downstream)																							atttcttttctttttcttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13354869	13354870	+	IGR	INS	-	T	T	rs111255052		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13354869_13354870insT								None (None upstream) : None (None downstream)																							aaaaaaaaaaaaaacaaacaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28807115	28807115	+	IGR	DEL	C	-	-			TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28807115delC								None (None upstream) : None (None downstream)																							tcgaatcgaacggaaAATTAT	0.015													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59019360	59019361	+	IGR	DEL	AT	-	-	rs138718736		TCGA-37-3789-01A-01D-0983-08	TCGA-37-3789-10A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59019360_59019361delAT								None (None upstream) : None (None downstream)																							aaaaaataaaataaaaacaaaG	0.114													2	6	---	---	---	---	
