Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA0562	9731	broad.mit.edu	37	1	3765275	3765275	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3765275G>T	uc001aky.2	-	3	543	c.184C>A	c.(184-186)CTT>ATT	p.L62I	KIAA0562_uc010nzm.1_RNA|KIAA0562_uc001akz.2_Missense_Mutation_p.L62I	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,	62						centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		TGGTGAGCAAGTAACTGCAGT	0.368													12	134	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7724860	7724860	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7724860C>T	uc001aoi.2	+	9	2460	c.2253C>T	c.(2251-2253)AGC>AGT	p.S751S		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	751					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCCAGCCCAGCCTCGGCAACG	0.637													5	220	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19467977	19467977	+	Silent	SNP	A	G	G	rs12068417		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19467977A>G	uc001bbi.2	-	57	8356	c.8352T>C	c.(8350-8352)AAT>AAC	p.N2784N	UBR4_uc001bbk.1_Silent_p.N466N	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2784					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGGGGTTGCCATTGTTGACAT	0.557													9	110	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45671871	45671871	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45671871C>A	uc001cnd.2	-	1	380	c.152G>T	c.(151-153)TGC>TTC	p.C51F		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	51							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					GAGGACCAGGCAGCTGCTGCC	0.716													2	1	---	---	---	---	PASS
SLC35D1	23169	broad.mit.edu	37	1	67515497	67515497	+	Silent	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67515497A>G	uc001ddk.2	-	6	885	c.501T>C	c.(499-501)TTT>TTC	p.F167F	SLC35D1_uc010oph.1_Silent_p.F88F	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic	167	Helical; (Potential).				chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	TAATCATTGCAAATACAGTCA	0.308													6	55	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70482168	70482168	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70482168C>T	uc001dep.2	+	12	1187	c.1157C>T	c.(1156-1158)TCA>TTA	p.S386L	LRRC7_uc009wbg.2_5'UTR	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	386	LRR 16.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TTACCATTCTCATTTACCAAA	0.259													11	136	---	---	---	---	PASS
ZRANB2	9406	broad.mit.edu	37	1	71534977	71534977	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71534977G>C	uc001dft.2	-	8	819	c.752C>G	c.(751-753)TCT>TGT	p.S251C	ZRANB2_uc001dfs.2_Missense_Mutation_p.S251C|uc010oqr.1_5'Flank|MIR186_hsa-mir-186|MI0000483_5'Flank	NM_203350	NP_976225	O95218	ZRAB2_HUMAN	zinc finger protein 265 isoform 1	251	Arg/Ser-rich.|Required for nuclear targeting.				mRNA processing|RNA splicing	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						CGACCCACGAGATCTCGAACG	0.433													5	79	---	---	---	---	PASS
MSH4	4438	broad.mit.edu	37	1	76280711	76280711	+	Silent	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76280711T>C	uc001dhd.1	+	5	746	c.705T>C	c.(703-705)GTT>GTC	p.V235V		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	235					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						TTCAGAATGTTAATTTCACTA	0.343								MMR					7	78	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93677773	93677773	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93677773A>T	uc001dpq.2	+	11	1972	c.1804A>T	c.(1804-1806)AGT>TGT	p.S602C	CCDC18_uc009wdl.1_Missense_Mutation_p.S163C	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	484										ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TAGCAAATTAAGTAGTTTAGA	0.318													7	315	---	---	---	---	PASS
EPS8L3	79574	broad.mit.edu	37	1	110302470	110302470	+	Intron	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110302470G>A	uc001dyr.1	-						EPS8L3_uc001dys.1_Intron|EPS8L3_uc001dyq.1_Intron|EPS8L3_uc009wfm.1_Intron|EPS8L3_uc009wfn.1_5'UTR|EPS8L3_uc009wfo.1_Intron	NM_133181	NP_573444	Q8TE67	ES8L3_HUMAN	epidermal growth factor receptor pathway							cytoplasm	protein binding			ovary(2)|skin(1)	3		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		TGCAGGGAGAGGGGGAGTCCT	0.597													5	87	---	---	---	---	PASS
BOLA1	51027	broad.mit.edu	37	1	149871795	149871795	+	Silent	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149871795G>T	uc001etf.2	+	2	304	c.183G>T	c.(181-183)CCG>CCT	p.P61P		NM_016074	NP_057158	Q9Y3E2	BOLA1_HUMAN	bolA-like 1	61						extracellular region	protein binding			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACGCGGTCCCGCCTGGCAGTG	0.677													5	65	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154544128	154544128	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154544128A>G	uc001ffg.2	+	5	1093	c.829A>G	c.(829-831)ACG>GCG	p.T277A		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	277	Helical; (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	GCTGGCGCTCACGGTCTTCCT	0.582													15	189	---	---	---	---	PASS
GPATCH4	54865	broad.mit.edu	37	1	156565284	156565284	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156565284A>T	uc001fpm.2	-	8	888	c.849T>A	c.(847-849)AAT>AAA	p.N283K	APOA1BP_uc010php.1_Intron|GPATCH4_uc001fpl.2_Missense_Mutation_p.N278K	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1	278						intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCTCTCTGCTATTCAATTCCC	0.493													148	497	---	---	---	---	PASS
CD1C	911	broad.mit.edu	37	1	158263072	158263072	+	Silent	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158263072G>T	uc001fru.2	+	5	1252	c.960G>T	c.(958-960)GTG>GTT	p.V320V	CD1C_uc001frv.2_Intron	NM_001765	NP_001756	P29017	CD1C_HUMAN	CD1C antigen precursor	320	Helical; (Potential).				antigen processing and presentation|T cell activation involved in immune response	endosome membrane|integral to plasma membrane	endogenous lipid antigen binding|exogenous lipid antigen binding|glycolipid binding|lipopeptide binding			ovary(2)|skin(1)|pancreas(1)	4	all_hematologic(112;0.0378)					TAGTCCTTGTGTTATGGTTTA	0.393													30	515	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158650398	158650398	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158650398T>G	uc001fst.1	-	5	852	c.653A>C	c.(652-654)AAC>ACC	p.N218T		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	218	Spectrin 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGCATATTGGTTCACTTCAAC	0.453													49	244	---	---	---	---	PASS
NDUFS2	4720	broad.mit.edu	37	1	161179712	161179712	+	Silent	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161179712A>T	uc001fyv.2	+	7	1141	c.693A>T	c.(691-693)GGA>GGT	p.G231G	NDUFS2_uc010pki.1_Silent_p.G133G|NDUFS2_uc001fyw.2_Silent_p.G231G|NDUFS2_uc010pkj.1_Silent_p.G180G|NDUFS2_uc001fyx.2_Silent_p.G231G	NM_004550	NP_004541	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2	231					mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity|protein binding|quinone binding			skin(1)	1	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		NADH(DB00157)	GGCCAGGAGGAGTGCACCAGG	0.547											OREG0013941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	45	---	---	---	---	PASS
DENND1B	163486	broad.mit.edu	37	1	197509126	197509126	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197509126C>T	uc010ppe.1	-	19	1761	c.1423G>A	c.(1423-1425)GGA>AGA	p.G475R	DENND1B_uc010ppf.1_RNA	NM_001142795	NP_001136267	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 1	Error:Variant_position_missing_in_Q6P3S1_after_alignment						clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						GAGTTTCCTCCCTTTTCATTG	0.338													4	115	---	---	---	---	PASS
TRAF3IP3	80342	broad.mit.edu	37	1	209933511	209933511	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209933511C>G	uc001hho.2	+	3	417	c.127C>G	c.(127-129)CGC>GGC	p.R43G	TRAF3IP3_uc001hhl.2_Missense_Mutation_p.R43G|TRAF3IP3_uc001hhm.1_Missense_Mutation_p.R43G|TRAF3IP3_uc001hhn.2_Missense_Mutation_p.R43G|TRAF3IP3_uc009xcr.2_Missense_Mutation_p.R43G	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator	43	Cytoplasmic (Potential).					integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		GACCACTTGCCGCCAGGTGGG	0.612													4	61	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215990328	215990328	+	Intron	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215990328A>T	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATTAGTTAGAAAAGACTTAC	0.383										HNSCC(13;0.011)			14	198	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216371646	216371646	+	Intron	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216371646T>A	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTTAAAACATTGATCTTTAC	0.358										HNSCC(13;0.011)			10	168	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220152836	220152836	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220152836C>A	uc001hly.1	-	27	4103	c.3833G>T	c.(3832-3834)CGA>CTA	p.R1278L		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1278	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	ACCAATAGTTCGAGTTGTCAG	0.413													13	193	---	---	---	---	PASS
MIA3	375056	broad.mit.edu	37	1	222806450	222806450	+	Silent	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222806450A>T	uc001hnl.2	+	6	3345	c.3336A>T	c.(3334-3336)CCA>CCT	p.P1112P	MIA3_uc009xea.1_Silent_p.P948P	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1112	Extracellular (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		TTCCAGGGCCAGTTACAACAG	0.353													8	602	---	---	---	---	PASS
LEFTY2	7044	broad.mit.edu	37	1	226125168	226125168	+	Silent	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226125168C>A	uc001hpt.1	-	4	1154	c.1074G>T	c.(1072-1074)GCG>GCT	p.A358A	LEFTY2_uc010pvk.1_Silent_p.A324A|LEFTY2_uc009xek.1_3'UTR	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	358					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					TTGGCACGAGCGCCCCATCCG	0.577													5	125	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	236995257	236995257	+	Intron	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236995257C>T	uc001hyi.3	+						MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	AAATGCTTCTCCTTTTAAGGT	0.408													15	54	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237870287	237870287	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237870287A>T	uc001hyl.1	+	68	9739	c.9619A>T	c.(9619-9621)AAC>TAC	p.N3207Y	RYR2_uc010pxz.1_Missense_Mutation_p.N162Y	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3207					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGTTTGTCCAAACATACCGTC	0.418													72	284	---	---	---	---	PASS
OR2B11	127623	broad.mit.edu	37	1	247614915	247614915	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614915G>T	uc010pyx.1	-	1	370	c.370C>A	c.(370-372)CTG>ATG	p.L124M		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	124	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TAGCGGTCCAGGGCCATGGCG	0.607													18	89	---	---	---	---	PASS
KCNF1	3754	broad.mit.edu	37	2	11053750	11053750	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11053750C>T	uc002rax.2	+	1	1688	c.1198C>T	c.(1198-1200)CTG>TTG	p.L400L		NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F,	400	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		CGCCATCGCCCTGCCCATCCA	0.592													3	60	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11770204	11770204	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11770204A>T	uc002rbk.1	+	26	4880	c.4580A>T	c.(4579-4581)GAG>GTG	p.E1527V	GREB1_uc002rbp.1_Missense_Mutation_p.E525V	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1527						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGCCAGCTGGAGAGCATGCGA	0.557													15	95	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27449096	27449096	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27449096T>C	uc002rji.2	+	13	2102	c.1940T>C	c.(1939-1941)CTC>CCC	p.L647P	CAD_uc010eyw.2_Intron	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	647	CPSase (Carbamoyl-phosphate synthase).|CPSase A.|ATP-grasp 1.				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GAGTATCAGCTCCTGAGGCAG	0.542													15	70	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77745843	77745843	+	Silent	SNP	G	A	A	rs34870411		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77745843G>A	uc002snr.2	-	3	1567	c.1152C>T	c.(1150-1152)ATC>ATT	p.I384I	LRRTM4_uc002snq.2_Silent_p.I384I|LRRTM4_uc002sns.2_Silent_p.I384I|LRRTM4_uc002snt.2_Silent_p.I385I	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	384	Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		TAGGTCTAGGGATAATCAGAG	0.488													6	90	---	---	---	---	PASS
CD8B	926	broad.mit.edu	37	2	87085349	87085349	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87085349C>T	uc002srz.2	-	2	284	c.234G>A	c.(232-234)GGG>GGA	p.G78G	RMND5A_uc002srs.3_Intron|CD8B_uc002srw.2_Silent_p.G78G|CD8B_uc002srx.2_Silent_p.G78G|CD8B_uc002sry.2_Silent_p.G78G|CD8B_uc010fgt.2_Silent_p.G78G|CD8B_uc002ssa.2_Silent_p.G78G|CD8B_uc010yto.1_Silent_p.G78G	NM_004931	NP_004922	P10966	CD8B_HUMAN	CD8b antigen isoform 5 precursor	78	Ig-like V-type.|Extracellular (Potential).				immune response|regulation of defense response to virus by virus|regulation of immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway|viral reproduction	early endosome|extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding			upper_aerodigestive_tract(1)|skin(1)	2						CGTGGATAGTCCCTTTTGCGG	0.552													11	114	---	---	---	---	PASS
IL1RL2	8808	broad.mit.edu	37	2	102851383	102851383	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102851383G>C	uc002tbs.2	+	11	1450	c.1324G>C	c.(1324-1326)GTT>CTT	p.V442L	IL1RL2_uc002tbt.2_Missense_Mutation_p.V324L	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	442	TIR.|Cytoplasmic (Potential).				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						CGATGAAAACGTTAAGCTGTG	0.473													17	95	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109086493	109086493	+	Silent	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109086493T>C	uc002tec.2	+	6	862	c.708T>C	c.(706-708)AGT>AGC	p.S236S	GCC2_uc002ted.2_Silent_p.S135S	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	236	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						ATATTAATAGTTTGCAGGAAG	0.373													11	193	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	131976314	131976314	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131976314C>T	uc002tsn.2	+	1	391	c.339C>T	c.(337-339)GGC>GGT	p.G113G	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	113							ATP binding				0						GGGGGAGCGGCAAGAGCAAGG	0.602													9	204	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159537044	159537044	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159537044A>C	uc002tzv.2	+	22	3694	c.3434A>C	c.(3433-3435)GAT>GCT	p.D1145A	PKP4_uc002tzw.2_Missense_Mutation_p.D1102A|PKP4_uc002tzx.2_Missense_Mutation_p.D802A|PKP4_uc002uaa.2_Missense_Mutation_p.D954A|uc002uab.1_Intron|PKP4_uc002uac.2_Missense_Mutation_p.D326A|PKP4_uc002uad.2_RNA	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	1145					cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						CCTTATTTTGATGACCGAGTT	0.373										HNSCC(62;0.18)			6	323	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166909449	166909449	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166909449C>T	uc010zcz.1	-	5	625	c.607G>A	c.(607-609)GTC>ATC	p.V203I	SCN1A_uc002udo.3_Missense_Mutation_p.V72I|SCN1A_uc010fpk.2_Missense_Mutation_p.V72I	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	203	Helical; Name=S3 of repeat I; (By similarity).|I.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AACTCTGTGACGTACCTGTAA	0.438													4	68	---	---	---	---	PASS
RBM45	129831	broad.mit.edu	37	2	178988913	178988913	+	Silent	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178988913A>G	uc002ulv.2	+	8	1220	c.1128A>G	c.(1126-1128)CCA>CCG	p.P376P		NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	378					cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TTGTACTTCCATCATGCAAAA	0.358													4	225	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179485341	179485341	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179485341T>C	uc010zfg.1	-	197	38427	c.38203A>G	c.(38203-38205)AGG>GGG	p.R12735G	TTN_uc010zfh.1_Missense_Mutation_p.R6430G|TTN_uc010zfi.1_Missense_Mutation_p.R6363G|TTN_uc010zfj.1_Missense_Mutation_p.R6238G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13662							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAACAATCCTAAGGTCTTCC	0.323													9	141	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228135511	228135511	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228135511C>A	uc002vom.1	+	25	1763	c.1601C>A	c.(1600-1602)CCA>CAA	p.P534Q	COL4A3_uc002von.1_Missense_Mutation_p.P534Q|COL4A3_uc002voo.1_Missense_Mutation_p.P534Q|COL4A3_uc002vop.1_Missense_Mutation_p.P534Q|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	534	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		CAGGGTGACCCAGGACTTAAA	0.493													6	100	---	---	---	---	PASS
TM4SF20	79853	broad.mit.edu	37	2	228243969	228243969	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228243969C>T	uc002vpb.2	-	1	54	c.16G>A	c.(16-18)GGA>AGA	p.G6R		NM_024795	NP_079071	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	6	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		GATGTCCATCCTTCGCAGCAG	0.463													5	181	---	---	---	---	PASS
C2orf54	79919	broad.mit.edu	37	2	241829491	241829491	+	Silent	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241829491G>A	uc002wae.3	-	3	984	c.825C>T	c.(823-825)CTC>CTT	p.L275L	C2orf54_uc002wac.2_Silent_p.L107L|C2orf54_uc002wad.2_Silent_p.L126L	NM_001085437	NP_001078906	Q08AI8	CB054_HUMAN	hypothetical protein LOC79919 isoform 1	275											0		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		TGACCCGGTCGAGGATGGAGA	0.662													4	49	---	---	---	---	PASS
IL5RA	3568	broad.mit.edu	37	3	3139576	3139576	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3139576C>A	uc011ask.1	-	8	1331	c.687G>T	c.(685-687)CAG>CAT	p.Q229H	IL5RA_uc010hbq.2_Missense_Mutation_p.Q229H|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Missense_Mutation_p.Q229H|IL5RA_uc011asl.1_Missense_Mutation_p.Q229H|IL5RA_uc011asm.1_Missense_Mutation_p.Q229H|IL5RA_uc010hbt.2_Missense_Mutation_p.Q229H|IL5RA_uc011asn.1_Missense_Mutation_p.Q229H|IL5RA_uc010hbu.2_Missense_Mutation_p.Q229H	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1	229	Extracellular (Potential).				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		GGGCAAACAGCTGATCAAAGG	0.398													6	84	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39227577	39227577	+	Silent	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39227577G>A	uc003cjk.1	-	2	3581	c.3360C>T	c.(3358-3360)GTC>GTT	p.V1120V	XIRP1_uc003cji.2_Intron|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1120							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTTCCCTACTGACCTTTCTGG	0.602													11	191	---	---	---	---	PASS
LRRC2	79442	broad.mit.edu	37	3	46574382	46574382	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46574382T>A	uc010hji.2	-	5	872	c.508A>T	c.(508-510)AAA>TAA	p.K170*	LRRC2_uc003cpu.3_Nonsense_Mutation_p.K170*	NM_024512	NP_078788	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	170	LRR 3.									ovary(1)	1		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		TTGAGTTCTTTCAGGTTCTTC	0.358													16	233	---	---	---	---	PASS
TLR9	54106	broad.mit.edu	37	3	52257452	52257452	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52257452T>A	uc003dda.1	-	2	1514	c.880A>T	c.(880-882)AGT>TGT	p.S294C	TLR9_uc003ddb.2_Missense_Mutation_p.S391C	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor	294	LRR 9.|Extracellular (Potential).				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)	GAGAGAGAACTGTCCTTCAAC	0.562													6	64	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62423878	62423878	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62423878C>T	uc003dll.2	-	28	4038	c.3678G>A	c.(3676-3678)GGG>GGA	p.G1226G	CADPS_uc003dlj.1_Silent_p.G181G|CADPS_uc003dlk.1_Silent_p.G674G|CADPS_uc003dlm.2_Silent_p.G1187G|CADPS_uc003dln.2_Silent_p.G1147G	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1226	Mediates targeting and association with DCVs (By similarity).				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCACGTCCATCCCGGGTTTCT	0.463													11	62	---	---	---	---	PASS
ACPP	55	broad.mit.edu	37	3	132071602	132071602	+	Silent	SNP	T	C	C	rs116804987	byFrequency	TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132071602T>C	uc010htp.2	+	9	993	c.903T>C	c.(901-903)GAT>GAC	p.D301D	ACPP_uc003eon.3_Silent_p.D268D|ACPP_uc003eop.3_Silent_p.D301D	NM_001099	NP_001090	P15309	PPAP_HUMAN	acid phosphatase, prostate short isoform	301						extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity			ovary(1)	1						TGGCGCTAGATGTTTACAACG	0.423													30	200	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147113823	147113823	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147113823C>A	uc003ewd.1	-	3	777	c.504G>T	c.(502-504)CAG>CAT	p.Q168H	ZIC4_uc003ewc.1_Missense_Mutation_p.Q98H|ZIC4_uc011bno.1_Missense_Mutation_p.Q218H	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	168						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						TGTGGTTGGCCTGTTCCGGGC	0.607													30	226	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151161030	151161030	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151161030A>T	uc011bod.1	-	5	5705	c.5705T>A	c.(5704-5706)TTG>TAG	p.L1902*	IGSF10_uc011bob.1_5'Flank|IGSF10_uc011boc.1_5'Flank	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1902	Ig-like C2-type 5.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTTATATACAAAGTCCCATT	0.433													8	209	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154862192	154862192	+	Silent	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154862192T>C	uc010hvr.1	+	14	1573	c.1362T>C	c.(1360-1362)ACT>ACC	p.T454T	MME_uc003fab.1_Silent_p.T454T|MME_uc003fac.1_Silent_p.T454T|MME_uc003fad.1_Silent_p.T454T|MME_uc003fae.1_Silent_p.T454T	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	454	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	TTATTCAGACTTTAGATGACC	0.368													5	159	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167023649	167023649	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167023649C>G	uc003fep.2	-	17	1830	c.1507G>C	c.(1507-1509)GAA>CAA	p.E503Q	ZBBX_uc011bpc.1_Missense_Mutation_p.E503Q|ZBBX_uc003feq.2_Missense_Mutation_p.E474Q	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	503						intracellular	zinc ion binding			ovary(2)	2						AAATTTCTTTCAAAGGAGGTG	0.343													9	84	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180324305	180324305	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180324305A>T	uc003fkk.2	+	9	1218	c.1086A>T	c.(1084-1086)GAA>GAT	p.E362D	TTC14_uc003fkl.2_Missense_Mutation_p.E362D|TTC14_uc003fkm.2_Missense_Mutation_p.E362D	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	362	TPR 3.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AAGCAATAGAAGATTTTGAGC	0.383													17	292	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180372682	180372682	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180372682G>C	uc010hxe.2	-	7	913	c.798C>G	c.(796-798)ATC>ATG	p.I266M	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	266	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CCAAAAACTTGATCTTTTCTT	0.308													7	40	---	---	---	---	PASS
LAMP3	27074	broad.mit.edu	37	3	182841950	182841950	+	Silent	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182841950G>T	uc003flh.3	-	6	1394	c.1170C>A	c.(1168-1170)ATC>ATA	p.I390I		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	390	Helical; (Potential).				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GACCAACCACGATGGCCCCAA	0.463													32	467	---	---	---	---	PASS
HTR3C	170572	broad.mit.edu	37	3	183778105	183778105	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183778105T>A	uc003fmk.2	+	9	1343	c.1309T>A	c.(1309-1311)TCC>ACC	p.S437T		NM_130770	NP_570126	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine receptor 3 subunit C	437	Helical; Name=4; (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CATGGCCTCCTCCATCCTTAC	0.572													54	528	---	---	---	---	PASS
HTR3E	285242	broad.mit.edu	37	3	183822650	183822650	+	Silent	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183822650C>A	uc010hxq.2	+	5	931	c.465C>A	c.(463-465)CCC>CCA	p.P155P	HTR3E_uc003fml.3_Silent_p.P140P|HTR3E_uc003fmm.2_Silent_p.P170P|HTR3E_uc010hxr.2_Silent_p.P181P|HTR3E_uc003fmn.2_Silent_p.P155P	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	155	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			ATAAGAAACCCATGAAGGTGG	0.478													29	342	---	---	---	---	PASS
EIF2B5	8893	broad.mit.edu	37	3	183859720	183859720	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183859720C>T	uc003fmp.2	+	8	1528	c.1164C>T	c.(1162-1164)AAC>AAT	p.N388N	EIF2B5_uc003fmq.2_Silent_p.N109N|EIF2B5_uc003fmr.2_5'Flank	NM_003907	NP_003898	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B,	388					astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding			ovary(5)	5	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CAGGTGATAACGTGGTGCTGG	0.567													10	201	---	---	---	---	PASS
SENP5	205564	broad.mit.edu	37	3	196650360	196650360	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196650360C>T	uc003fwz.3	+	7	2209	c.1960C>T	c.(1960-1962)CTC>TTC	p.L654F	SENP5_uc011bty.1_Intron	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	654	Protease.				cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		TACTGTGACACTCTCTAATCG	0.323													56	198	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3189537	3189537	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3189537G>A	uc011bvq.1	+	40	5300	c.5155G>A	c.(5155-5157)GGG>AGG	p.G1719R		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1717					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GTTAAGAGATGGGGACAGTAC	0.378													7	216	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	54292082	54292082	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54292082A>G	uc003haa.2	+	12	1153	c.967A>G	c.(967-969)ATC>GTC	p.I323V	FIP1L1_uc003gzx.3_Missense_Mutation_p.I308V|FIP1L1_uc011bzt.1_Missense_Mutation_p.I287V|FIP1L1_uc003gzy.2_Missense_Mutation_p.I323V|FIP1L1_uc011bzu.1_Missense_Mutation_p.I308V|FIP1L1_uc003gzz.2_Missense_Mutation_p.I249V|FIP1L1_uc003hab.2_Missense_Mutation_p.I288V|FIP1L1_uc003hac.2_Missense_Mutation_p.I68V|FIP1L1_uc010ign.2_RNA|FIP1L1_uc003had.2_5'UTR|FIP1L1_uc003hae.2_5'Flank	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	Error:Variant_position_missing_in_P16234_after_alignment					cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	GACTATAACTATCAGCCGAGT	0.333			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			8	165	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55953823	55953823	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55953823C>A	uc003has.2	-	27	3915	c.3613G>T	c.(3613-3615)GAG>TAG	p.E1205*	KDR_uc003hat.1_Nonsense_Mutation_p.E1205*	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1205	Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CATACTTCCTCCTCCTCCATA	0.488			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			6	220	---	---	---	---	PASS
FAM13A	10144	broad.mit.edu	37	4	89670099	89670099	+	Intron	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89670099C>T	uc003hse.1	-						FAM13A_uc003hsa.1_Intron|FAM13A_uc003hsb.1_Intron|FAM13A_uc003hsd.1_Intron|FAM13A_uc003hsc.1_Intron|FAM13A_uc011cdq.1_Intron|FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsg.1_Intron	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						AGAATTTTACCCACCTTTAAG	0.502													31	682	---	---	---	---	PASS
PDLIM5	10611	broad.mit.edu	37	4	95376450	95376450	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95376450A>G	uc003hti.2	+	2	162	c.11A>G	c.(10-12)TAC>TGC	p.Y4C	PDLIM5_uc003htf.2_Missense_Mutation_p.Y4C|PDLIM5_uc003htg.2_Missense_Mutation_p.Y4C|PDLIM5_uc011cdx.1_Missense_Mutation_p.Y4C|PDLIM5_uc003hth.2_Missense_Mutation_p.Y4C|PDLIM5_uc003htj.2_5'UTR|PDLIM5_uc003htk.2_Missense_Mutation_p.Y4C|PDLIM5_uc011cdy.1_5'UTR	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5 isoform a	4	PDZ.				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		ATGAGCAACTACAGTGTGTCA	0.423													3	53	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114277103	114277103	+	Silent	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114277103A>G	uc003ibe.3	+	38	7429	c.7329A>G	c.(7327-7329)CTA>CTG	p.L2443L	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc011cgb.1_Silent_p.L2458L	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2410					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCCCTGTGCTAGAAGATAACT	0.517													10	153	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126241388	126241388	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126241388C>T	uc003ifj.3	+	1	3822	c.3822C>T	c.(3820-3822)GAC>GAT	p.D1274D		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1274	Cadherin 12.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GCAAATTAGACTATGAAGCAA	0.353													14	187	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134071806	134071806	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134071806G>T	uc003iha.2	+	1	1337	c.511G>T	c.(511-513)GTG>TTG	p.V171L	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.V171L	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	171	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		CTCCCTGGACGTGCAGACCCA	0.632													5	127	---	---	---	---	PASS
TMEM184C	55751	broad.mit.edu	37	4	148549579	148549579	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148549579G>A	uc003ila.3	+	5	1134	c.565G>A	c.(565-567)GTT>ATT	p.V189I		NM_018241	NP_060711	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	189	Helical; (Potential).					integral to membrane					0						CACCACCATCGTTGCTTTGTA	0.338													9	212	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155219360	155219360	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155219360G>A	uc003inw.2	-	18	4741	c.4741C>T	c.(4741-4743)CCA>TCA	p.P1581S		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1581	Cadherin 13.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCCAAAACTGGATCATTGTCA	0.453													13	186	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187539060	187539060	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187539060C>A	uc003izf.2	-	10	8868	c.8680G>T	c.(8680-8682)GAA>TAA	p.E2894*		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	2894	Extracellular (Potential).|Cadherin 26.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TGGATCTTTTCACCATGATCT	0.438										HNSCC(5;0.00058)			30	120	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187554967	187554967	+	Silent	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187554967G>A	uc003izf.2	-	7	4382	c.4194C>T	c.(4192-4194)TAC>TAT	p.Y1398Y		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	1398	Extracellular (Potential).|Cadherin 12.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						AGTGACTGTCGTAGTTGCCAC	0.418										HNSCC(5;0.00058)			11	209	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13700924	13700924	+	Silent	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13700924T>C	uc003jfd.2	-	78	13590	c.13548A>G	c.(13546-13548)GAA>GAG	p.E4516E	DNAH5_uc003jfc.2_Silent_p.E684E	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4516					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ATTTGGTGACTTCATTGCAAA	0.483									Kartagener_syndrome				21	377	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31515208	31515208	+	Missense_Mutation	SNP	C	T	T	rs151137891	by1000genomes	TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31515208C>T	uc003jhg.2	-	7	1536	c.1177G>A	c.(1177-1179)GAG>AAG	p.E393K	RNASEN_uc003jhh.2_Missense_Mutation_p.E356K|RNASEN_uc003jhi.2_Missense_Mutation_p.E356K|RNASEN_uc010iui.1_Missense_Mutation_p.E316K	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	393					gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						ATGGTCTCCTCGGGCTCTTTT	0.463													24	279	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33937978	33937978	+	Missense_Mutation	SNP	C	T	T	rs143656786		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937978C>T	uc003jic.1	+	1	1490	c.1133C>T	c.(1132-1134)GCG>GTG	p.A378V		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	378	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						GTGTGCCTAGCGCACTCCAAC	0.617													11	104	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41186243	41186243	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41186243T>C	uc003jmk.2	-	6	865	c.655A>G	c.(655-657)AAA>GAA	p.K219E	C6_uc003jml.1_Missense_Mutation_p.K219E	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	219	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TTGACAGTTTTACATATTCCT	0.438													31	166	---	---	---	---	PASS
RNF180	285671	broad.mit.edu	37	5	63510147	63510147	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63510147C>A	uc003jti.2	+	4	1104	c.994C>A	c.(994-996)CTG>ATG	p.L332M	RNF180_uc003jth.3_Missense_Mutation_p.L332M|RNF180_uc010iws.2_Intron	NM_001113561	NP_001107033	Q86T96	RN180_HUMAN	ring finger protein 180 isoform 1	332	Interaction with ZIC2 (By similarity).|Cytoplasmic (Potential).					integral to membrane|nuclear envelope	zinc ion binding				0		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		TCTGACTTTCCTGATGGACCT	0.512													27	122	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82835875	82835875	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82835875C>A	uc003kii.3	+	8	7409	c.7053C>A	c.(7051-7053)TTC>TTA	p.F2351L	VCAN_uc003kij.3_Missense_Mutation_p.F1364L|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.F1015L	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	2351	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		CTCTCCCTTTCTCCACGGACA	0.458													4	130	---	---	---	---	PASS
HAPLN1	1404	broad.mit.edu	37	5	82969301	82969301	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82969301C>A	uc003kim.2	-	1	113	c.42G>T	c.(40-42)TGG>TGT	p.W14C	HAPLN1_uc003kin.2_Missense_Mutation_p.W14C	NM_001884	NP_001875	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	14					cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			large_intestine(3)|ovary(1)|skin(1)	5		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)		GATGATCAGCCCAGCAGATTG	0.398													9	195	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118502482	118502482	+	Intron	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118502482G>C	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTGAGGTAATGAGTGAAATTT	0.289													8	121	---	---	---	---	PASS
PDE6A	5145	broad.mit.edu	37	5	149240474	149240474	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149240474G>C	uc003lrg.3	-	22	2687	c.2567C>G	c.(2566-2568)TCC>TGC	p.S856C		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	856					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GATGCAGCAGGACTTGGATGT	0.562													3	55	---	---	---	---	PASS
GABRA1	2554	broad.mit.edu	37	5	161277820	161277820	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161277820A>T	uc010jiw.2	+	3	472	c.4A>T	c.(4-6)AGG>TGG	p.R2W	GABRA1_uc010jix.2_Missense_Mutation_p.R2W|GABRA1_uc010jiy.2_Missense_Mutation_p.R2W|GABRA1_uc003lyx.3_Missense_Mutation_p.R2W|GABRA1_uc010jiz.2_Missense_Mutation_p.R2W|GABRA1_uc010jja.2_Missense_Mutation_p.R2W|GABRA1_uc010jjb.2_Missense_Mutation_p.R2W	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	2					gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	GCCCGCGATGAGGAAAAGTCC	0.468													5	191	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17640218	17640218	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17640218C>A	uc003ncd.1	-	15	1998	c.1798G>T	c.(1798-1800)GCA>TCA	p.A600S	NUP153_uc011dje.1_Missense_Mutation_p.A631S|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	600					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			AGGATTTCTGCAGGTCTAAAA	0.333													18	310	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17640222	17640222	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17640222T>G	uc003ncd.1	-	15	1994	c.1794A>C	c.(1792-1794)AGA>AGC	p.R598S	NUP153_uc011dje.1_Missense_Mutation_p.R629S|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	598					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TTTCTGCAGGTCTAAAAGGAC	0.338													19	308	---	---	---	---	PASS
HIST1H1D	3007	broad.mit.edu	37	6	26234964	26234964	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26234964C>T	uc003nhd.2	-	1	253	c.198G>A	c.(196-198)GCG>GCA	p.A66A		NM_005320	NP_005311	P16402	H13_HUMAN	histone cluster 1, H1d	66	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding			skin(1)	1		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				CAGCCGCAAGCGCTTTCTTAA	0.537													12	161	---	---	---	---	PASS
HIST1H2BK	85236	broad.mit.edu	37	6	27114544	27114544	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27114544T>A	uc003nix.1	-	1	76	c.34A>T	c.(34-36)AAG>TAG	p.K12*	HIST1H2AH_uc003niz.2_5'Flank|hsa-mir-3143|MI0014167_5'Flank	NM_080593	NP_542160	O60814	H2B1K_HUMAN	histone cluster 1, H2bk	12					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						GAGCCCTTCTTGGGCGCGGGA	0.577													13	212	---	---	---	---	PASS
PHF1	5252	broad.mit.edu	37	6	33381294	33381294	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33381294A>G	uc003oeh.2	+	6	783	c.547A>G	c.(547-549)AAC>GAC	p.N183D	PHF1_uc011drh.1_RNA|PHF1_uc003oei.2_Missense_Mutation_p.N183D|PHF1_uc010jux.2_5'UTR	NM_024165	NP_077084	O43189	PHF1_HUMAN	PHD finger protein 1 isoform b	183					chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(999;0.0443)				ACATCTGAGCAACCGACAGCA	0.557													17	66	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34004261	34004261	+	Silent	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34004261G>A	uc003oir.3	-	8	1796	c.1626C>T	c.(1624-1626)TGC>TGT	p.C542C	GRM4_uc011dsn.1_Silent_p.C495C|GRM4_uc010jvh.2_Silent_p.C542C|GRM4_uc010jvi.2_Silent_p.C234C|GRM4_uc003oio.2_Silent_p.C234C|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Silent_p.C402C|GRM4_uc003oiq.2_Silent_p.C409C|GRM4_uc011dsm.1_Silent_p.C373C	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	542	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	TGCAAGGCTCGCAGTGCCAGC	0.657													33	102	---	---	---	---	PASS
PACSIN1	29993	broad.mit.edu	37	6	34499478	34499478	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34499478C>T	uc003ojo.2	+	9	1345	c.1139C>T	c.(1138-1140)CCC>CTC	p.P380L	PACSIN1_uc003ojp.2_Missense_Mutation_p.P380L	NM_020804	NP_065855	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in	380					endocytosis		protein kinase activity				0						GGCGCCAACCCCTTTGAGGAC	0.642													9	264	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39864710	39864710	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39864710G>C	uc003oow.2	+	20	2620	c.2464G>C	c.(2464-2466)GTG>CTG	p.V822L	DAAM2_uc003oox.2_Missense_Mutation_p.V822L	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	822	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CGGGTTCCGGGTGGCCAGCCT	0.597													9	59	---	---	---	---	PASS
TBCC	6903	broad.mit.edu	37	6	42713543	42713543	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42713543C>G	uc003osl.2	-	1	342	c.269G>C	c.(268-270)CGG>CCG	p.R90P		NM_003192	NP_003183	Q15814	TBCC_HUMAN	beta-tubulin cofactor C	90					'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|photoreceptor connecting cilium	chaperone binding|GTPase activity				0	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			CCCCTGGAGCCGAGAGGCCGC	0.647													5	72	---	---	---	---	PASS
MANEA	79694	broad.mit.edu	37	6	96053893	96053893	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96053893C>T	uc003poo.1	+	5	1141	c.1001C>T	c.(1000-1002)TCA>TTA	p.S334L		NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	334	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TATGGCTCATCACATCAGAAT	0.363													13	151	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152660412	152660412	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152660412T>G	uc010kiw.2	-	75	12917	c.12315A>C	c.(12313-12315)AAA>AAC	p.K4105N	SYNE1_uc003qot.3_Missense_Mutation_p.K4034N|SYNE1_uc003qou.3_Missense_Mutation_p.K4105N|SYNE1_uc010kja.1_Missense_Mutation_p.K810N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4105	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGCTGTGGTTTTCACCGAAG	0.393										HNSCC(10;0.0054)			8	161	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159618523	159618523	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159618523T>A	uc010kjv.2	+	2	370	c.170T>A	c.(169-171)GTC>GAC	p.V57D	FNDC1_uc010kjw.1_Missense_Mutation_p.V5D	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	57	Fibronectin type-III 1.					extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GGCCTGAAAGTCACGTGGGAC	0.453													5	282	---	---	---	---	PASS
C7orf50	84310	broad.mit.edu	37	7	1037447	1037447	+	Intron	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1037447G>T	uc003sju.2	-						C7orf50_uc003sjs.2_Intron|C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		GAACCTGGACGGGAAAGAGAT	0.672													5	98	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11501650	11501650	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11501650C>A	uc003ssf.3	-	10	2741	c.2489G>T	c.(2488-2490)TGC>TTC	p.C830F		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	830	TSP type-1 8.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GTAGCTTTGGCACGCTTGAGG	0.527										HNSCC(18;0.044)			8	501	---	---	---	---	PASS
INMT	11185	broad.mit.edu	37	7	30791874	30791874	+	Silent	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30791874G>A	uc003tbs.1	+	1	124	c.108G>A	c.(106-108)GAG>GAA	p.E36E	FAM188B_uc010kwe.2_5'UTR|INMT_uc010kwc.1_Intron|INMT_uc010kwd.1_Silent_p.E36E	NM_006774	NP_006765	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	36						cytoplasm	amine N-methyltransferase activity				0						CCGAGGCCGAGATGCTGAAGT	0.577													35	118	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31862822	31862822	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31862822C>A	uc003tcm.1	-	14	1916	c.1447G>T	c.(1447-1449)GTC>TTC	p.V483F	PDE1C_uc003tcn.1_Missense_Mutation_p.V483F|PDE1C_uc003tco.1_Missense_Mutation_p.V543F|PDE1C_uc003tcr.2_Missense_Mutation_p.V483F|PDE1C_uc003tcs.2_Missense_Mutation_p.V483F	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	483	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GAGGTCTTGACACCTGATCGC	0.433													26	134	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64453031	64453031	+	5'Flank	SNP	T	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64453031T>G	uc003ttr.2	-						ZNF117_uc011kdr.1_Missense_Mutation_p.Q122P	NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				ggatactatctggcaaacatc	0.000													11	62	---	---	---	---	PASS
ABCB4	5244	broad.mit.edu	37	7	87056086	87056086	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87056086C>A	uc003uiv.1	-	16	2120	c.2044G>T	c.(2044-2046)GAT>TAT	p.D682Y	ABCB4_uc003uiw.1_Missense_Mutation_p.D682Y|ABCB4_uc003uix.1_Missense_Mutation_p.D682Y	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	682	Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					GTTTCCACATCAAGGCTCTTC	0.363													17	161	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87179536	87179536	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87179536C>A	uc003uiz.1	-	13	1719	c.1301G>T	c.(1300-1302)AGC>ATC	p.S434I	ABCB1_uc011khc.1_Missense_Mutation_p.S370I	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	434	ATP 1 (By similarity).|ABC transporter 1.|Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	GACTGTTGTGCTCTTCCCACA	0.552													7	53	---	---	---	---	PASS
PRKAR2B	5577	broad.mit.edu	37	7	106791406	106791406	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106791406G>T	uc003vdx.2	+	7	956	c.781G>T	c.(781-783)GCC>TCC	p.A261S		NM_002736	NP_002727	P31323	KAP3_HUMAN	cAMP-dependent protein kinase, regulatory	261	cAMP 1.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1						GAAAAACAATGCCAAAAAGAG	0.313													5	47	---	---	---	---	PASS
LRRN3	54674	broad.mit.edu	37	7	110764114	110764114	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110764114C>G	uc003vft.3	+	4	2332	c.1286C>G	c.(1285-1287)CCT>CGT	p.P429R	IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Missense_Mutation_p.P429R|LRRN3_uc003vfs.3_Missense_Mutation_p.P429R	NM_001099660	NP_001093130	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3 precursor	429	Extracellular (Potential).|Ig-like C2-type.					integral to membrane				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GAGAGCTTTCCTTCTAATCTA	0.453													35	286	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111448922	111448922	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111448922G>A	uc003vfx.2	-	30	3390	c.3121C>T	c.(3121-3123)CGG>TGG	p.R1041W	DOCK4_uc003vfw.2_Missense_Mutation_p.R482W|DOCK4_uc003vfy.2_Missense_Mutation_p.R1077W|uc003vfz.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1041					cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				ATTGTTACCCGCATGTCACCA	0.403													3	43	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113518838	113518838	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113518838T>A	uc010ljy.1	-	4	2340	c.2309A>T	c.(2308-2310)GAA>GTA	p.E770V		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	770					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						AAACGCTGTTTCCTTTACCTC	0.403													12	259	---	---	---	---	PASS
ASZ1	136991	broad.mit.edu	37	7	117007445	117007445	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117007445C>T	uc003vjb.2	-	12	1299	c.1236G>A	c.(1234-1236)TTG>TTA	p.L412L	ASZ1_uc011kno.1_Silent_p.L403L|ASZ1_uc011knp.1_Silent_p.L204L	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper	412					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CCTTTTCACTCAAATCTTCAA	0.318													5	54	---	---	---	---	PASS
OR2F1	26211	broad.mit.edu	37	7	143657678	143657678	+	Silent	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657678T>C	uc003wds.1	+	1	659	c.615T>C	c.(613-615)GTT>GTC	p.V205V		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	205	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)					CTAGCATTGTTCTTCTGATGA	0.468													6	190	---	---	---	---	PASS
KCNH2	3757	broad.mit.edu	37	7	150648568	150648568	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150648568T>C	uc003wic.2	-	7	1926	c.1913A>G	c.(1912-1914)AAG>AGG	p.K638R	KCNH2_uc003wib.2_Missense_Mutation_p.K298R|KCNH2_uc011kux.1_Missense_Mutation_p.K542R|KCNH2_uc003wid.2_Missense_Mutation_p.K298R|KCNH2_uc003wie.2_Missense_Mutation_p.K638R	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	638	Extracellular (Potential).		K -> E (in LQT2).|Missing (in LQT2).		blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)	GGAGAAGATCTTCTCTGAGTT	0.587													11	215	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25897562	25897562	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25897562G>A	uc003xes.1	-	5	481	c.464C>T	c.(463-465)ACG>ATG	p.T155M	PPP2R2A_uc003xek.2_Intron|EBF2_uc003xet.1_Missense_Mutation_p.T155M	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	155	C5-type (Potential).				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		CACTTCGTGCGTCAGGAGAAC	0.602													30	269	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55537790	55537790	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55537790C>G	uc003xsd.1	+	4	1496	c.1348C>G	c.(1348-1350)CCT>GCT	p.P450A	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	450					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TTATAGGCCCCCTACACCTGG	0.438													18	154	---	---	---	---	PASS
SLCO5A1	81796	broad.mit.edu	37	8	70617409	70617409	+	Silent	SNP	T	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70617409T>G	uc003xyl.2	-	6	2186	c.1479A>C	c.(1477-1479)ATA>ATC	p.I493I	SLCO5A1_uc010lzb.2_Silent_p.I438I|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Silent_p.I493I|SLCO5A1_uc010lzc.2_Silent_p.I438I	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	493	Helical; Name=8; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TCAATTTTTTTATAATGTAGC	0.408													15	196	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100514011	100514011	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100514011A>T	uc003yiv.2	+	26	4078	c.3967A>T	c.(3967-3969)AGT>TGT	p.S1323C	VPS13B_uc003yiw.2_Missense_Mutation_p.S1323C|VPS13B_uc003yiu.1_Missense_Mutation_p.S1323C|VPS13B_uc003yix.1_Missense_Mutation_p.S793C	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1323					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGGACGTGTTAGTTTATGGAT	0.413													20	281	---	---	---	---	PASS
SYBU	55638	broad.mit.edu	37	8	110598380	110598380	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110598380C>A	uc003ynj.3	-	4	602	c.439G>T	c.(439-441)GAT>TAT	p.D147Y	SYBU_uc003yni.3_Missense_Mutation_p.D144Y|SYBU_uc003ynk.3_Missense_Mutation_p.D28Y|SYBU_uc010mco.2_Missense_Mutation_p.D146Y|SYBU_uc003ynl.3_Missense_Mutation_p.D146Y|SYBU_uc010mcp.2_Missense_Mutation_p.D147Y|SYBU_uc010mcq.2_Missense_Mutation_p.D147Y|SYBU_uc003yno.3_Missense_Mutation_p.D28Y|SYBU_uc010mcr.2_Missense_Mutation_p.D147Y|SYBU_uc003ynm.3_Missense_Mutation_p.D146Y|SYBU_uc003ynn.3_Missense_Mutation_p.D146Y|SYBU_uc010mcs.2_Missense_Mutation_p.D28Y|SYBU_uc010mct.2_Missense_Mutation_p.D147Y|SYBU_uc010mcu.2_Missense_Mutation_p.D146Y|SYBU_uc003ynp.3_Missense_Mutation_p.D79Y|SYBU_uc010mcv.2_Missense_Mutation_p.D147Y|SYBU_uc011lhw.1_Missense_Mutation_p.D17Y	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	147	Sufficient for interaction with KIF5B.|Ser-rich.					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						GAGCTAAAATCAGCTTCACTA	0.542													3	23	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	114326869	114326869	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114326869G>T	uc003ynu.2	-	2	491	c.332C>A	c.(331-333)GCT>GAT	p.A111D	CSMD3_uc003ynt.2_Missense_Mutation_p.A71D|CSMD3_uc011lhx.1_Missense_Mutation_p.A111D|CSMD3_uc010mcx.1_Missense_Mutation_p.A111D|CSMD3_uc003ynx.3_Missense_Mutation_p.A111D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	111	Extracellular (Potential).|CUB 1.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTCTTCTAGAGCAAATGACTG	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			5	186	---	---	---	---	PASS
KCNV2	169522	broad.mit.edu	37	9	2717996	2717996	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2717996C>A	uc003zho.1	+	1	471	c.257C>A	c.(256-258)CCC>CAC	p.P86H		NM_133497	NP_598004	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	86	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(50;0.0257)		ACCGCCAAGCCCGAGGGCCCC	0.657													14	28	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8633316	8633316	+	Splice_Site	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8633316C>T	uc003zkk.2	-	13	1063	c.352_splice	c.e13+1	p.E118_splice	PTPRD_uc003zkp.2_Splice_Site_p.E118_splice|PTPRD_uc003zkq.2_Splice_Site_p.E118_splice|PTPRD_uc003zkr.2_Splice_Site_p.E118_splice|PTPRD_uc003zks.2_Splice_Site_p.E118_splice|PTPRD_uc003zkl.2_Splice_Site_p.E118_splice|PTPRD_uc003zkm.2_Splice_Site_p.E118_splice|PTPRD_uc003zkn.2_Splice_Site_p.E118_splice|PTPRD_uc003zko.2_Splice_Site_p.E118_splice|PTPRD_uc003zkt.1_Splice_Site_p.E118_splice	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TGAGCACTTACCCCGCAAAAC	0.423										TSP Lung(15;0.13)			28	219	---	---	---	---	PASS
ALG2	85365	broad.mit.edu	37	9	101981079	101981079	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101981079G>A	uc004azf.2	-	2	458	c.388C>T	c.(388-390)CGG>TGG	p.R130W	ALG2_uc004azg.2_Missense_Mutation_p.R37W	NM_033087	NP_149078	Q9H553	ALG2_HUMAN	alpha-1,3-mannosyltransferase ALG2	130					dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in endoplasmic reticulum|protein N-linked glycosylation via asparagine|response to calcium ion	endoplasmic reticulum membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	alpha-1,3-mannosyltransferase activity|calcium-dependent protein binding|glycolipid 3-alpha-mannosyltransferase activity|protein anchor|protein heterodimerization activity|protein N-terminus binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.0559)				ATCTTCTTCCGCCGTCTAGCC	0.448													10	95	---	---	---	---	PASS
TAL2	6887	broad.mit.edu	37	9	108425025	108425025	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108425025A>C	uc004bct.2	+	1	288	c.248A>C	c.(247-249)CAC>CCC	p.H83P		NM_005421	NP_005412	Q16559	TAL2_HUMAN	T-cell acute lymphocytic leukemia 2	83					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						CAAGGACCCCACCTGCCAGGC	0.552			T	TRB@	T-ALL								9	78	---	---	---	---	PASS
GTPBP4	23560	broad.mit.edu	37	10	1043190	1043190	+	Missense_Mutation	SNP	C	T	T	rs149028639		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1043190C>T	uc001ift.2	+	5	574	c.503C>T	c.(502-504)ACC>ATC	p.T168I	GTPBP4_uc010qac.1_5'UTR|GTPBP4_uc001ifu.2_RNA|GTPBP4_uc010qad.1_Missense_Mutation_p.T52I|GTPBP4_uc010qae.1_Missense_Mutation_p.T121I	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG	168					negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		GATCCGAATACCAGGACCCTG	0.373													21	448	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	21845583	21845583	+	Intron	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21845583T>C	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001iqr.1_Missense_Mutation_p.F120L|MLLT10_uc001iqq.1_Silent_p.N84N|MLLT10_uc001iqu.1_Silent_p.N84N|MLLT10_uc009xke.1_Intron|MLLT10_uc001iqw.1_Intron|MLLT10_uc001iqx.1_Intron|MLLT10_uc009xkf.1_Intron	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						tggtatgcaattcctgttggt	0.000			T	MLL|PICALM|CDK6	AL								3	40	---	---	---	---	PASS
KIF5B	3799	broad.mit.edu	37	10	32322782	32322782	+	Silent	SNP	A	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32322782A>C	uc001iwe.3	-	12	1766	c.1296T>G	c.(1294-1296)CTT>CTG	p.L432L		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	432					stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				CCTTGTCATCAAGCTGTTTGT	0.338													9	107	---	---	---	---	PASS
PGBD3	267004	broad.mit.edu	37	10	50723759	50723759	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50723759C>T	uc001jht.2	-	2	1657	c.1402G>A	c.(1402-1404)GAA>AAA	p.E468K	ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Missense_Mutation_p.E936K|PGBD3_uc001jhu.2_Missense_Mutation_p.E936K	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN	hypothetical protein LOC267004	468										pancreas(1)|breast(1)|skin(1)	3						TCAATGTTTTCATCAGCTCTG	0.408													33	429	---	---	---	---	PASS
EXOC6	54536	broad.mit.edu	37	10	94659401	94659401	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94659401G>A	uc001kig.2	+	5	524	c.458G>A	c.(457-459)AGG>AAG	p.R153K	EXOC6_uc010qnr.1_Missense_Mutation_p.R169K|EXOC6_uc001kie.2_Missense_Mutation_p.R148K|EXOC6_uc001kif.3_Missense_Mutation_p.R153K|EXOC6_uc009xub.2_Missense_Mutation_p.R153K|EXOC6_uc009xuc.2_Missense_Mutation_p.R153K	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a	153					protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				AGTGCCAAAAGGTGAGTTGGT	0.269													3	118	---	---	---	---	PASS
AS3MT	57412	broad.mit.edu	37	10	104632929	104632929	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104632929C>A	uc001kwk.2	+	5	537	c.397C>A	c.(397-399)CAT>AAT	p.H133N	AS3MT_uc001kwj.2_Missense_Mutation_p.H135N|AS3MT_uc009xxh.2_Missense_Mutation_p.H133N	NM_020682	NP_065733	Q9HBK9	AS3MT_HUMAN	arsenic (+3 oxidation state) methyltransferase	133					arsonoacetate metabolic process|toxin metabolic process	cytosol	arsenite methyltransferase activity|methylarsonite methyltransferase activity				0		Colorectal(252;0.122)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;5.87e-09)|all cancers(201;1.58e-07)|BRCA - Breast invasive adenocarcinoma(275;0.223)		GACTTTTATTCATGGCTACAT	0.363													4	112	---	---	---	---	PASS
HSPA12A	259217	broad.mit.edu	37	10	118434726	118434726	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118434726G>A	uc001lct.2	-	12	1699	c.1594C>T	c.(1594-1596)CGG>TGG	p.R532W	HSPA12A_uc001lcu.2_Missense_Mutation_p.R449W	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	532							ATP binding			ovary(1)	1				all cancers(201;0.0158)		AGCGGCGACCGGCGCACCTTG	0.662													3	50	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129901609	129901609	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129901609T>G	uc001lke.2	-	13	8690	c.8495A>C	c.(8494-8496)GAA>GCA	p.E2832A	MKI67_uc001lkf.2_Missense_Mutation_p.E2472A|MKI67_uc009yav.1_Missense_Mutation_p.E2407A|MKI67_uc009yaw.1_Missense_Mutation_p.E1982A	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	2832	16 X 122 AA approximate repeats.|16.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGCGGTGTCTTCTAGTTCTGG	0.488													31	265	---	---	---	---	PASS
CDHR5	53841	broad.mit.edu	37	11	618689	618689	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:618689G>A	uc001lqj.2	-	13	1975	c.1870C>T	c.(1870-1872)CAA>TAA	p.Q624*	IRF7_uc001lqg.2_5'Flank|IRF7_uc001lqh.2_5'Flank|IRF7_uc001lqi.2_5'Flank|IRF7_uc010qwh.1_5'Flank|CDHR5_uc001lqk.2_Intron|CDHR5_uc009ycc.2_Nonsense_Mutation_p.Q458*|CDHR5_uc009ycd.2_Nonsense_Mutation_p.Q618*|CDHR5_uc001lql.2_Nonsense_Mutation_p.Q624*	NM_021924	NP_068743	Q9HBB8	CDHR5_HUMAN	mucin and cadherin-like isoform 1	624	4 X 31 AA approximate tandem repeats.|3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						GTGGTTGGTTGGTGGGAGGTG	0.657													9	128	---	---	---	---	PASS
KRTAP5-6	440023	broad.mit.edu	37	11	1718724	1718724	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1718724T>A	uc001lua.2	+	1	300	c.249T>A	c.(247-249)TGT>TGA	p.C83*		NM_001012416	NP_001012416	Q6L8G9	KRA56_HUMAN	keratin associated protein 5-6	83	6 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GTGGCTCTTGTGGCTGCTCCC	0.642													13	89	---	---	---	---	PASS
UBQLNL	143630	broad.mit.edu	37	11	5537287	5537287	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5537287T>C	uc001maz.3	-	1	670	c.385A>G	c.(385-387)AAA>GAA	p.K129E	HBG2_uc001mak.1_Intron	NM_145053	NP_659490	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	129										large_intestine(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		CTGTTTCCTTTGGTGTTTCTG	0.537													21	148	---	---	---	---	PASS
OR52N1	79473	broad.mit.edu	37	11	5809595	5809595	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5809595A>C	uc010qzo.1	-	1	452	c.452T>G	c.(451-453)TTT>TGT	p.F151C	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		ACCCCTAAGAAAAGTGAGGAA	0.517													24	103	---	---	---	---	PASS
TIMM10	26519	broad.mit.edu	37	11	57297665	57297665	+	5'UTR	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57297665C>T	uc001nkm.1	-	2						NM_012456	NP_036588	P62072	TIM10_HUMAN	translocase of inner mitochondrial membrane 10						protein import into mitochondrial inner membrane|sensory perception of sound|transmembrane transport	mitochondrial inner membrane presequence translocase complex|mitochondrial intermembrane space protein transporter complex	zinc ion binding				0						GGATCCATCTCAGCCTAGCAC	0.582													23	119	---	---	---	---	PASS
SYT7	9066	broad.mit.edu	37	11	61295405	61295405	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61295405C>T	uc001nrv.2	-	5	610	c.604G>A	c.(604-606)GAG>AAG	p.E202K	SYT7_uc009ynr.2_Missense_Mutation_p.E277K	NM_004200	NP_004191	O43581	SYT7_HUMAN	synaptotagmin VII	202	C2 1.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4						AGGAAGGTCTCGTTCCAGTGG	0.567													16	161	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64525759	64525759	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64525759C>A	uc001oax.3	-	4	1304	c.487G>T	c.(487-489)GAG>TAG	p.E163*	PYGM_uc001oay.3_Intron	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	163					glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	ATCCCAAACTCATAGCGAATC	0.592													8	172	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	70007820	70007820	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70007820G>A	uc001opj.2	+	18	2178	c.1873G>A	c.(1873-1875)GTG>ATG	p.V625M	ANO1_uc001opk.1_Missense_Mutation_p.V567M|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.V334M	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	625	Helical; (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						CATCTTTTACGTGGCGTTCTT	0.552													8	408	---	---	---	---	PASS
ATG16L2	89849	broad.mit.edu	37	11	72528819	72528819	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72528819C>A	uc001otd.2	+	3	277	c.237C>A	c.(235-237)GAC>GAA	p.D79E	ATG16L2_uc001otc.1_Missense_Mutation_p.D79E|ATG16L2_uc010rrf.1_Missense_Mutation_p.D79E|ATG16L2_uc001ote.2_5'UTR|ATG16L2_uc009ytj.1_Missense_Mutation_p.D79E	NM_033388	NP_203746	Q8NAA4	A16L2_HUMAN	ATG16 autophagy related 16-like 2	79					autophagy|protein transport	cytoplasm	protein binding				0			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			CAGAGCTTGACTCAGACCAAG	0.577													3	50	---	---	---	---	PASS
PICALM	8301	broad.mit.edu	37	11	85692224	85692224	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85692224G>T	uc001pbm.2	-	17	2013	c.1727C>A	c.(1726-1728)TCT>TAT	p.S576Y	PICALM_uc001pbl.2_Missense_Mutation_p.S526Y|PICALM_uc001pbn.2_Missense_Mutation_p.S569Y|PICALM_uc010rtl.1_Missense_Mutation_p.S475Y|PICALM_uc001pbk.2_RNA|PICALM_uc010rtk.1_Missense_Mutation_p.S153Y|PICALM_uc001pbo.1_Missense_Mutation_p.S208Y	NM_007166	NP_009097	Q13492	PICAL_HUMAN	phosphatidylinositol-binding clathrin assembly	576					clathrin coat assembly|endosome transport|negative regulation of receptor-mediated endocytosis|positive regulation of transcription, DNA-dependent|receptor internalization|regulation of protein localization	clathrin coat|clathrin-coated vesicle|coated pit|Golgi apparatus|nucleus|postsynaptic membrane|presynaptic membrane	1-phosphatidylinositol binding|clathrin heavy chain binding			urinary_tract(1)|ovary(1)	2		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				TTGCCAGTTAGATCCCCCAGT	0.353			T	MLLT10|MLL	TALL|AML|								7	203	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92714914	92714914	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92714914C>A	uc001pdk.1	+	2	628	c.525C>A	c.(523-525)AAC>AAA	p.N175K		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	175	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	TGCTGCCCAACTTCTTTGTGG	0.612													4	89	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2778165	2778165	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2778165G>T	uc009zdu.1	+	40	5147	c.4834G>T	c.(4834-4836)GCC>TCC	p.A1612S	CACNA1C_uc009zdv.1_Missense_Mutation_p.A1561S|CACNA1C_uc001qkb.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qkc.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qke.2_Missense_Mutation_p.A1553S|CACNA1C_uc001qkf.2_Missense_Mutation_p.A1553S|CACNA1C_uc001qjz.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qkd.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qkg.2_Missense_Mutation_p.A1551S|CACNA1C_uc009zdw.1_Missense_Mutation_p.A1586S|CACNA1C_uc001qkh.2_Missense_Mutation_p.A1553S|CACNA1C_uc001qkl.2_Missense_Mutation_p.A1612S|CACNA1C_uc001qkn.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qko.2_Missense_Mutation_p.A1584S|CACNA1C_uc001qkp.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qkr.2_Missense_Mutation_p.A1581S|CACNA1C_uc001qku.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qkq.2_Missense_Mutation_p.A1592S|CACNA1C_uc001qks.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qkt.2_Missense_Mutation_p.A1564S|CACNA1C_uc001qki.1_Missense_Mutation_p.A1300S|CACNA1C_uc001qkj.1_Missense_Mutation_p.A1300S|CACNA1C_uc001qkk.1_Missense_Mutation_p.A1300S|CACNA1C_uc001qkm.1_Missense_Mutation_p.A1289S|CACNA1C_uc010sea.1_Missense_Mutation_p.A255S	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1612	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CACCCTGTTTGCCCTGGTCAG	0.562													9	113	---	---	---	---	PASS
KRT5	3852	broad.mit.edu	37	12	52913973	52913973	+	Silent	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52913973G>C	uc001san.2	-	1	271	c.108C>G	c.(106-108)TCC>TCG	p.S36S	KRT5_uc009zmh.2_Silent_p.S36S	NM_000424	NP_000415	P13647	K2C5_HUMAN	keratin 5	36	Head.				epidermis development|hemidesmosome assembly	cytosol|keratin filament	protein binding|structural constituent of cytoskeleton				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCCCGGACCGGGACACGGAGG	0.677													4	48	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95645743	95645743	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95645743G>T	uc001tdz.2	+	2	169	c.64G>T	c.(64-66)GAT>TAT	p.D22Y	VEZT_uc009zsy.1_5'UTR|VEZT_uc001tdr.2_5'UTR|VEZT_uc001tds.2_5'UTR|VEZT_uc001tdt.2_5'UTR|VEZT_uc009zsz.1_Missense_Mutation_p.D22Y|VEZT_uc001tdv.2_5'UTR|VEZT_uc001tdw.1_5'UTR|VEZT_uc009zta.1_5'UTR	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	22						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						ATACTTACAGGATCTGGGACA	0.368													5	164	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100452092	100452092	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100452092C>G	uc001tgq.2	-	14	3192	c.2963G>C	c.(2962-2964)GGC>GCC	p.G988A	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.G638A	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	988										ovary(2)	2						TTCTCCTGAGCCACTTTTGTA	0.308													22	186	---	---	---	---	PASS
ATP6V0A2	23545	broad.mit.edu	37	12	124209287	124209287	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124209287G>T	uc001ufr.2	+	4	629	c.381G>T	c.(379-381)GAG>GAT	p.E127D	ATP6V0A2_uc001ufq.1_Missense_Mutation_p.E127D	NM_012463	NP_036595	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	127	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		AACTGATAGAGTACACTCACA	0.408													47	268	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129360565	129360565	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129360565G>T	uc010tbh.1	+	2	151	c.142G>T	c.(142-144)GCC>TCC	p.A48S	GLT1D1_uc001uhx.1_Missense_Mutation_p.A59S|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	59					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		CTGCGAGGCTGCCCTGGCTCT	0.473													70	312	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35864575	35864575	+	Silent	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35864575G>T	uc001uvb.2	+	35	6032	c.5826G>T	c.(5824-5826)CTG>CTT	p.L1942L	NBEA_uc010abi.2_Silent_p.L598L	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1942						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTGTTATGCTGCTTTGTTCTC	0.323													41	291	---	---	---	---	PASS
ZC3H13	23091	broad.mit.edu	37	13	46559779	46559779	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46559779C>T	uc010tfw.1	-	9	1379	c.1373G>A	c.(1372-1374)CGG>CAG	p.R458Q	ZC3H13_uc001vas.1_Missense_Mutation_p.R458Q|ZC3H13_uc001vat.1_Missense_Mutation_p.R458Q	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	458	Arg/Ser-rich.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		GGCATCTCTCCGATCCCGACC	0.483													29	377	---	---	---	---	PASS
KPNA3	3839	broad.mit.edu	37	13	50306891	50306891	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50306891T>C	uc001vdj.2	-	4	641	c.226A>G	c.(226-228)ATA>GTA	p.I76V		NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3	76	ARM 1; truncated.				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		ACCTGCAATATAGCTTCTAGG	0.244													10	80	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58208468	58208468	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208468G>T	uc001vhq.1	+	1	2680	c.1788G>T	c.(1786-1788)CAG>CAT	p.Q596H	PCDH17_uc010aec.1_Missense_Mutation_p.Q596H	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	596	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CGGAGCTGCAGGTGCCGCGCA	0.647													15	48	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70514196	70514196	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70514196C>A	uc001vip.2	-	4	1784	c.990G>T	c.(988-990)ATG>ATT	p.M330I	KLHL1_uc010thm.1_Missense_Mutation_p.M269I	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	330					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GGGCCACCTTCATTAACTCAA	0.413													6	92	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77760189	77760189	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77760189C>G	uc001vkf.2	-	32	4238	c.4147G>C	c.(4147-4149)GAG>CAG	p.E1383Q	MYCBP2_uc010aev.2_Missense_Mutation_p.E787Q	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1383					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AACAATGACTCAAAACATTCC	0.363													8	93	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110864803	110864803	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110864803C>T	uc001vqw.3	-	6	470	c.348G>A	c.(346-348)CCG>CCA	p.P116P	COL4A1_uc010agl.2_Silent_p.P116P	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	116					angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GGGGGCCTGGCGGGCCGTCTT	0.453													42	361	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111138086	111138086	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111138086G>A	uc001vqx.2	+	34	3399	c.3110G>A	c.(3109-3111)GGA>GAA	p.G1037E		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	1037	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGAGTCAAGGGAGACATCGGA	0.627													10	130	---	---	---	---	PASS
SSTR1	6751	broad.mit.edu	37	14	38679090	38679090	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38679090G>A	uc001wul.1	+	3	1113	c.496G>A	c.(496-498)GCC>ACC	p.A166T	SSTR1_uc010amu.1_Intron	NM_001049	NP_001040	P30872	SSR1_HUMAN	somatostatin receptor 1	166	Cytoplasmic (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity			central_nervous_system(3)|ovary(1)|lung(1)	5	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)	CATCAAGGCGGCCCGCTACCG	0.637													14	73	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64593522	64593522	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64593522C>A	uc001xgm.2	+	73	14144	c.13914C>A	c.(13912-13914)TAC>TAA	p.Y4638*	SYNE2_uc001xgl.2_Nonsense_Mutation_p.Y4638*|SYNE2_uc010apy.2_Nonsense_Mutation_p.Y1023*|SYNE2_uc010apz.1_Nonsense_Mutation_p.Y530*	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4638	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACCGCAGTTACCAGGTATGAT	0.458													6	97	---	---	---	---	PASS
ATP6V1D	51382	broad.mit.edu	37	14	67805337	67805337	+	3'UTR	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67805337A>T	uc001xjf.2	-	9					ATP6V1D_uc001xje.2_RNA	NM_015994	NP_057078	Q9Y5K8	VATD_HUMAN	H(+)-transporting two-sector ATPase						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)|lung(1)	2				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		AACAGGAAAGATTATTCAAAT	0.418													16	315	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71555129	71555129	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71555129C>T	uc001xmo.2	+	29	5866	c.5420C>T	c.(5419-5421)GCA>GTA	p.A1807V	PCNX_uc010are.1_Missense_Mutation_p.A1696V|PCNX_uc010arf.1_Missense_Mutation_p.A595V	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1807						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TTGGGGACTGCATCCCATCAT	0.423													4	106	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	81380730	81380730	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81380730T>A	uc001xux.2	-	3	341	c.170A>T	c.(169-171)CAA>CTA	p.Q57L	C14orf145_uc001xuz.2_Missense_Mutation_p.Q57L|C14orf145_uc001xva.1_Missense_Mutation_p.Q57L|C14orf145_uc010ata.1_Missense_Mutation_p.Q57L	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	57						centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		CTGGTCCACTTGTCGCAGGTT	0.393													17	173	---	---	---	---	PASS
TECPR2	9895	broad.mit.edu	37	14	102916045	102916045	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102916045C>T	uc001ylw.1	+	14	3303	c.3155C>T	c.(3154-3156)ACA>ATA	p.T1052I	TECPR2_uc010awl.2_Missense_Mutation_p.T1052I|TECPR2_uc010txx.1_Missense_Mutation_p.T215I	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1052							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						TCGGTGGCCACAGCAGCCCAA	0.547													10	153	---	---	---	---	PASS
TECPR2	9895	broad.mit.edu	37	14	102916046	102916046	+	Silent	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102916046A>T	uc001ylw.1	+	14	3304	c.3156A>T	c.(3154-3156)ACA>ACT	p.T1052T	TECPR2_uc010awl.2_Silent_p.T1052T|TECPR2_uc010txx.1_Silent_p.T215T	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1052							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						CGGTGGCCACAGCAGCCCAAG	0.547													10	148	---	---	---	---	PASS
BAG5	9529	broad.mit.edu	37	14	104026793	104026793	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104026793C>A	uc001yni.1	-	2	943	c.709G>T	c.(709-711)GAA>TAA	p.E237*	KLC1_uc010tyd.1_5'Flank|BAG5_uc001ynh.1_Nonsense_Mutation_p.E278*|BAG5_uc001ynj.1_Nonsense_Mutation_p.E237*|C14orf153_uc001ynl.3_5'Flank|C14orf153_uc010tyc.1_5'Flank	NM_004873	NP_004864	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5 isoform b	237	BAG 3.				apoptosis|negative regulation of protein refolding|negative regulation of ubiquitin-protein ligase activity|neuron death|protein folding|regulation of inclusion body assembly	inclusion body|perinuclear region of cytoplasm	chaperone binding|ubiquitin protein ligase binding			ovary(2)	2		Melanoma(154;0.155)	Epithelial(46;0.144)			TTTCTGATTTCTGTCCGGCCG	0.458													13	196	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105415980	105415980	+	Silent	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105415980T>C	uc010axc.1	-	7	5928	c.5808A>G	c.(5806-5808)AAA>AAG	p.K1936K	AHNAK2_uc001ypx.2_Silent_p.K1836K	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1936						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTTGGGGCCTTTCAGGTCCA	0.607													18	373	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25953150	25953150	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25953150G>A	uc010ayu.2	-	12	2654	c.2548C>T	c.(2548-2550)CGC>TGC	p.R850C		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	850	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTCTCCAGGCGAATGGCAGAC	0.542													16	56	---	---	---	---	PASS
GABRA5	2558	broad.mit.edu	37	15	27126086	27126086	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27126086C>G	uc001zbd.1	+	5	519	c.180C>G	c.(178-180)TAC>TAG	p.Y60*	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	60	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGGATGGCTACGACAACAGAC	0.502													3	90	---	---	---	---	PASS
ZNF263	10127	broad.mit.edu	37	16	3340467	3340467	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3340467C>T	uc002cuq.2	+	6	2293	c.1961C>T	c.(1960-1962)ACG>ATG	p.T654M	ZNF263_uc010uww.1_Missense_Mutation_p.T302M|ZNF263_uc002cur.2_Missense_Mutation_p.T302M	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	654					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						AGAACGCATACGGGAGAGAGA	0.488													33	224	---	---	---	---	PASS
ARHGAP17	55114	broad.mit.edu	37	16	24971010	24971010	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24971010C>T	uc002dnb.2	-	9	799	c.706G>A	c.(706-708)GAA>AAA	p.E236K	ARHGAP17_uc002dna.2_5'Flank|ARHGAP17_uc002dnc.2_Missense_Mutation_p.E236K|ARHGAP17_uc010vcf.1_Missense_Mutation_p.E57K|ARHGAP17_uc002dnf.2_Missense_Mutation_p.E144K|ARHGAP17_uc002dng.1_Intron	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1	236	BAR.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		GCTCGCATTTCGGGGAGGGTC	0.483													7	127	---	---	---	---	PASS
IL4R	3566	broad.mit.edu	37	16	27374493	27374493	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27374493C>A	uc002don.2	+	11	2062	c.1820C>A	c.(1819-1821)TCA>TAA	p.S607*	IL4R_uc002dop.3_Nonsense_Mutation_p.S592*|IL4R_uc010bxy.2_Nonsense_Mutation_p.S607*|IL4R_uc002doo.2_Nonsense_Mutation_p.S447*	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	607	Required for IL4-induced gene expression.|Cytoplasmic (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						AAGGCCTTCTCAAGCCTGCTT	0.597													4	101	---	---	---	---	PASS
ATXN2L	11273	broad.mit.edu	37	16	28841947	28841947	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28841947A>G	uc002drc.2	+	9	1214	c.1046A>G	c.(1045-1047)TAT>TGT	p.Y349C	uc010vct.1_Intron|ATXN2L_uc010byl.1_Missense_Mutation_p.Y349C|ATXN2L_uc002drb.2_Missense_Mutation_p.Y349C|ATXN2L_uc002dqy.2_Missense_Mutation_p.Y349C|ATXN2L_uc002dra.2_Missense_Mutation_p.Y349C|ATXN2L_uc002dqz.2_Missense_Mutation_p.Y349C|ATXN2L_uc010vdb.1_Missense_Mutation_p.Y349C|ATXN2L_uc002dre.2_Missense_Mutation_p.Y349C|ATXN2L_uc002drf.2_5'UTR	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	349						membrane				upper_aerodigestive_tract(1)|ovary(1)	2						GAGGGGAAGTATATCCCTCTG	0.552													10	62	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30749733	30749733	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30749733C>T	uc002dze.1	+	34	8757	c.8372C>T	c.(8371-8373)CCG>CTG	p.P2791L	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.P2586L	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2791	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CCGGGAAGCCCGTCTGTCCGC	0.662													7	123	---	---	---	---	PASS
VPS4A	27183	broad.mit.edu	37	16	69350244	69350244	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69350244C>T	uc002eww.2	+	3	378	c.250C>T	c.(250-252)CCA>TCA	p.P84S		NM_013245	NP_037377	Q9UN37	VPS4A_HUMAN	vacuolar protein sorting factor 4A	84	Interaction with CHMP1B.				cell cycle|cellular membrane organization|cytokinesis|endosome transport|protein transport	cytosol|late endosome membrane|midbody|perinuclear region of cytoplasm	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein domain specific binding				0		Ovarian(137;0.101)				CGGCAAGAAGCCAGTCAAAGA	0.572													4	128	---	---	---	---	PASS
NFAT5	10725	broad.mit.edu	37	16	69727791	69727791	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69727791C>T	uc002exm.1	+	12	5217	c.4009C>T	c.(4009-4011)CAG>TAG	p.Q1337*	NFAT5_uc002exi.2_Nonsense_Mutation_p.Q1261*|NFAT5_uc002exj.1_Nonsense_Mutation_p.Q1261*|NFAT5_uc002exk.1_Nonsense_Mutation_p.Q1261*|NFAT5_uc002exl.1_Nonsense_Mutation_p.Q1355*|NFAT5_uc002exn.1_Nonsense_Mutation_p.Q1354*|NFAT5_uc002exo.1_RNA	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c	1337					excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						TTCCTCACTTCAGAACCCAGG	0.473													15	185	---	---	---	---	PASS
GALNS	2588	broad.mit.edu	37	16	88898492	88898492	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88898492A>T	uc002fly.3	-	9	1005	c.916T>A	c.(916-918)TTT>ATT	p.F306I	GALNS_uc010cid.2_Missense_Mutation_p.F312I|GALNS_uc002flz.3_5'UTR	NM_000512	NP_000503	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfate sulfatase	306						lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)	CCACACAGAAAGGGGCCGTTG	0.657													5	31	---	---	---	---	PASS
CAMTA2	23125	broad.mit.edu	37	17	4876459	4876459	+	Intron	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4876459G>A	uc002gah.1	-						CAMTA2_uc010cku.1_Intron|CAMTA2_uc002gag.1_Intron|CAMTA2_uc002gai.1_Intron|CAMTA2_uc010ckv.1_Intron	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2						cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						TCAGGAATCCGTCATCCTCAC	0.567													5	118	---	---	---	---	PASS
SENP3	26168	broad.mit.edu	37	17	7468014	7468014	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7468014C>A	uc002ghm.2	+	3	1061	c.788C>A	c.(787-789)CCC>CAC	p.P263H	EIF4A1_uc002gho.1_5'Flank|SENP3_uc002ghn.1_Missense_Mutation_p.P98H	NM_015670	NP_056485	Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific protease 3	263					proteolysis	MLL1 complex|nucleolus	cysteine-type peptidase activity			ovary(1)|central_nervous_system(1)	2		Prostate(122;0.157)				AGCTTGGCACCCCCTGATGCC	0.577													4	93	---	---	---	---	PASS
TOP3A	7156	broad.mit.edu	37	17	18188474	18188474	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18188474G>A	uc002gsx.1	-	15	2088	c.1859C>T	c.(1858-1860)GCG>GTG	p.A620V	TOP3A_uc010cpz.1_Missense_Mutation_p.A72V|TOP3A_uc010vxr.1_Missense_Mutation_p.A150V|TOP3A_uc002gsw.1_Missense_Mutation_p.A72V|TOP3A_uc010vxs.1_Missense_Mutation_p.A518V	NM_004618	NP_004609	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	620					DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3						TTTAGCCACCGCTTCAATGAA	0.279													49	319	---	---	---	---	PASS
SRCIN1	80725	broad.mit.edu	37	17	36705423	36705423	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36705423G>A	uc002hqd.2	-	16	3211	c.2986C>T	c.(2986-2988)CGC>TGC	p.R996C	SRCIN1_uc002hqf.1_Missense_Mutation_p.R868C|SRCIN1_uc002hqe.2_Missense_Mutation_p.R850C	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	868	Pro-rich.				exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						TTCTCTGTGCGGTATCGGGGC	0.642													8	34	---	---	---	---	PASS
IKZF3	22806	broad.mit.edu	37	17	37949057	37949057	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37949057T>C	uc002hsu.2	-	4	355	c.293A>G	c.(292-294)AAC>AGC	p.N98S	IKZF3_uc002htd.2_Missense_Mutation_p.N64S|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Missense_Mutation_p.N64S|IKZF3_uc010cwe.2_Missense_Mutation_p.N98S|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Missense_Mutation_p.N98S|IKZF3_uc002hsx.2_Missense_Mutation_p.N98S|IKZF3_uc002hsy.2_Missense_Mutation_p.N98S|IKZF3_uc002hsz.2_Missense_Mutation_p.N98S|IKZF3_uc002hta.2_Missense_Mutation_p.N98S|IKZF3_uc002htb.2_RNA|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_5'UTR	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1	98					B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CAACTTAATGTTTTCATATTC	0.393													13	220	---	---	---	---	PASS
KRTAP9-8	83901	broad.mit.edu	37	17	39394356	39394356	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39394356G>A	uc002hwh.3	+	1	87	c.53G>A	c.(52-54)TGC>TAC	p.C18Y	KRTAP9-9_uc010wfq.1_Intron	NM_031963	NP_114169	Q9BYQ0	KRA98_HUMAN	keratin associated protein 9.8	18	15 X 5 AA repeats of C-C-[RQVSGE]- [SPSNQ]-[TASPI].					keratin filament				ovary(1)	1		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			AGGACCACCTGCTGGAAGCCC	0.617													7	113	---	---	---	---	PASS
EME1	146956	broad.mit.edu	37	17	48453533	48453533	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48453533G>T	uc002iqs.1	+	3	955	c.882G>T	c.(880-882)AGG>AGT	p.R294S	MRPL27_uc002iqq.2_5'Flank|MRPL27_uc002iqr.2_5'Flank|EME1_uc010dbp.1_Missense_Mutation_p.R294S	NM_152463	NP_689676	Q96AY2	EME1_HUMAN	essential meiotic endonuclease 1 homolog 1	294					DNA recombination|DNA repair	nucleolus	DNA binding|endonuclease activity|metal ion binding|protein binding				0	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			TCACTTGGAGGAGAAGGGCTG	0.522								Direct_reversal_of_damage|Homologous_recombination					10	137	---	---	---	---	PASS
TOM1L1	10040	broad.mit.edu	37	17	52978259	52978259	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52978259C>G	uc002iud.2	+	1	208	c.33C>G	c.(31-33)TAC>TAG	p.Y11*	TOM1L1_uc002iub.2_5'UTR|TOM1L1_uc002iuc.2_Nonsense_Mutation_p.Y11*|TOM1L1_uc010dca.1_Nonsense_Mutation_p.Y11*|TOM1L1_uc010wnb.1_Nonsense_Mutation_p.Y11*|TOM1L1_uc010wnc.1_5'UTR|TOM1L1_uc010dbz.2_5'UTR|TOM1L1_uc010wnd.1_5'UTR	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1	11					intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						GGGATCCCTACGCGACCTCCG	0.672													7	128	---	---	---	---	PASS
TEX2	55852	broad.mit.edu	37	17	62291306	62291306	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62291306G>A	uc002jec.2	-	2	445	c.272C>T	c.(271-273)TCG>TTG	p.S91L	TEX2_uc002jed.2_Missense_Mutation_p.S91L|TEX2_uc002jee.2_Missense_Mutation_p.S91L	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	91					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CAGGACAGGCGAGGCAGCAGG	0.592													26	275	---	---	---	---	PASS
SLC16A6	9120	broad.mit.edu	37	17	66267716	66267716	+	Silent	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66267716G>T	uc002jgz.1	-	5	773	c.585C>A	c.(583-585)ATC>ATA	p.I195I	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Silent_p.I195I	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	195	Helical; (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	GTGCTCCGAAGATGACAATGT	0.478													41	137	---	---	---	---	PASS
SAP30BP	29115	broad.mit.edu	37	17	73698642	73698642	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73698642G>A	uc002jpe.2	+	6	533	c.479G>A	c.(478-480)CGG>CAG	p.R160Q	SAP30BP_uc002jpc.1_RNA|SAP30BP_uc010wsf.1_RNA|SAP30BP_uc010wsg.1_RNA|SAP30BP_uc002jpf.2_Missense_Mutation_p.R144Q	NM_013260	NP_037392	Q9UHR5	S30BP_HUMAN	transcriptional regulator protein	160					apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			AAAGAATTTCGGAACCCTAGG	0.433													10	99	---	---	---	---	PASS
DUS1L	64118	broad.mit.edu	37	17	80019200	80019200	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80019200C>T	uc002kdq.2	-	7	1146	c.727G>A	c.(727-729)GAG>AAG	p.E243K	DUS1L_uc002kdp.2_Missense_Mutation_p.E112K|DUS1L_uc002kdr.2_Missense_Mutation_p.E243K|DUS1L_uc002kds.2_RNA|DUS1L_uc002kdt.2_RNA|DUS1L_uc010wvi.1_Missense_Mutation_p.E226K	NM_022156	NP_071439	Q6P1R4	DUS1L_HUMAN	PP3111 protein	243					tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity			skin(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			CTCCGGCCCTCGAACAGGGCG	0.677													5	50	---	---	---	---	PASS
RBBP8	5932	broad.mit.edu	37	18	20573509	20573509	+	Silent	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20573509A>G	uc002ktw.2	+	11	2050	c.1719A>G	c.(1717-1719)CCA>CCG	p.P573P	RBBP8_uc002kty.2_Silent_p.P573P|RBBP8_uc002ktz.2_Silent_p.P573P|RBBP8_uc002kua.2_Silent_p.P573P|RBBP8_uc010xap.1_5'Flank|RBBP8_uc002ktx.1_Silent_p.P573P	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a	573					cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			ACAATAAACCATCATTACAAA	0.413								Direct_reversal_of_damage|Homologous_recombination					23	182	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19329873	19329873	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19329873C>T	uc002nlz.2	+	3	322	c.223C>T	c.(223-225)CGG>TGG	p.R75W		NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	75	Ig-like V-type.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			AGATGCCCCTCGGATAAAGTG	0.657													6	64	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19339016	19339016	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19339016G>T	uc002nlz.2	+	8	2686	c.2587G>T	c.(2587-2589)GTG>TTG	p.V863L	NCAN_uc010ecc.1_Missense_Mutation_p.V427L	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	863					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			GAGCCCTCAGGTGGCCCTGGA	0.587													12	180	---	---	---	---	PASS
RHPN2	85415	broad.mit.edu	37	19	33512468	33512468	+	Intron	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33512468G>C	uc002nuf.2	-						RHPN2_uc010xro.1_Intron|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					CCATGGCTTTGAGATTTACCT	0.353													20	80	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36335017	36335017	+	Silent	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36335017G>A	uc002oby.2	-	16	2200	c.2200C>T	c.(2200-2202)CTG>TTG	p.L734L		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	734	Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCACGTCCAGCCGCAGCCGC	0.652													10	38	---	---	---	---	PASS
IRF3	3661	broad.mit.edu	37	19	50165456	50165456	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50165456G>C	uc010end.1	-	6	1113	c.731C>G	c.(730-732)ACA>AGA	p.T244R	IRF3_uc002pos.1_5'Flank|IRF3_uc002pot.1_Intron|IRF3_uc002pox.1_Missense_Mutation_p.T244R|IRF3_uc002poy.1_Missense_Mutation_p.T244R|IRF3_uc002pou.2_Missense_Mutation_p.T244R|IRF3_uc002pov.2_Missense_Mutation_p.T98R|IRF3_uc002pow.2_Missense_Mutation_p.T244R|IRF3_uc002poz.1_Missense_Mutation_p.T244R|BCL2L12_uc002ppa.2_5'Flank|BCL2L12_uc002ppb.2_5'Flank	NM_001571	NP_001562	Q14653	IRF3_HUMAN	interferon regulatory factor 3	244	Involved in HERC5 binding.				interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|endosome membrane|nucleoplasm|plasma membrane	DNA binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		GTCTGGCAGTGTGACTGGCCA	0.672													6	73	---	---	---	---	PASS
PRPF31	26121	broad.mit.edu	37	19	54627995	54627995	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54627995G>A	uc002qdh.2	+	8	1211	c.815G>A	c.(814-816)GGC>GAC	p.G272D	PRPF31_uc010yek.1_Missense_Mutation_p.G272D	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog	272	Nop.				assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCCCACACCGGCTACATCTAC	0.662													3	46	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56481994	56481994	+	Silent	SNP	A	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56481994A>C	uc002qmh.2	+	6	2537	c.2466A>C	c.(2464-2466)ATA>ATC	p.I822I	NLRP8_uc010etg.2_Silent_p.I822I	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	822	LRR 2.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AGACTCTCATACTAAGAAAAA	0.488													30	301	---	---	---	---	PASS
SNPH	9751	broad.mit.edu	37	20	1285887	1285887	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1285887G>C	uc002wes.2	+	6	910	c.674G>C	c.(673-675)GGT>GCT	p.G225A	SNPH_uc002wet.2_Missense_Mutation_p.G269A	NM_014723	NP_055538	O15079	SNPH_HUMAN	syntaphilin	225					synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2						GCTGTCTGTGGTGACCGCCAG	0.677													4	40	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3209565	3209565	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3209565G>A	uc002wig.2	-	16	2207	c.2159C>T	c.(2158-2160)GCC>GTC	p.A720V	SLC4A11_uc010zqe.1_Missense_Mutation_p.A747V|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.A704V	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	720	Helical; (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						GGGGTAGGCGGCATGGATCCA	0.617													4	76	---	---	---	---	PASS
C20orf72	92667	broad.mit.edu	37	20	17956459	17956459	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17956459A>C	uc002wqh.2	+	3	726	c.644A>C	c.(643-645)GAT>GCT	p.D215A	C20orf72_uc010gco.2_Intron|C20orf72_uc010gcp.2_RNA	NM_052865	NP_443097	Q9BQP7	CT072_HUMAN	hypothetical protein LOC92667	215											0						ATTCTGAAAGATGTCAGTGGA	0.418													4	162	---	---	---	---	PASS
CST4	1472	broad.mit.edu	37	20	23666549	23666549	+	Silent	SNP	G	C	C			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23666549G>C	uc002wto.1	-	3	464	c.408C>G	c.(406-408)TCC>TCG	p.S136S		NM_001899	NP_001890	P01036	CYTS_HUMAN	cystatin S precursor	136						extracellular region	cysteine-type endopeptidase inhibitor activity			breast(1)	1	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					CTTGACACCTGGAATTCACCA	0.577													4	93	---	---	---	---	PASS
ZNF337	26152	broad.mit.edu	37	20	25656918	25656918	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25656918C>G	uc002wva.2	-	4	1528	c.1006G>C	c.(1006-1008)GTT>CTT	p.V336L	uc002wuz.2_RNA|ZNF337_uc010ztg.1_Missense_Mutation_p.V304L|ZNF337_uc002wvb.2_Missense_Mutation_p.V336L|ZNF337_uc002wvc.2_Missense_Mutation_p.V336L	NM_015655	NP_056470	Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	336	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTGTGCACAACGAAGTATGAC	0.483													5	174	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345834	33345834	+	Silent	SNP	T	A	A	rs957277		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345834T>A	uc002xav.2	-	8	3288	c.717A>T	c.(715-717)CCA>CCT	p.P239P	NCOA6_uc002xaw.2_Silent_p.P239P|NCOA6_uc010gew.1_Silent_p.P196P	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	239	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						TTGGGTGATGTGGGGGAGCTA	0.363													7	96	---	---	---	---	PASS
GGT7	2686	broad.mit.edu	37	20	33450711	33450711	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33450711C>A	uc002xay.2	-	3	506	c.463G>T	c.(463-465)GAG>TAG	p.E155*	GGT7_uc002xaz.1_Nonsense_Mutation_p.E172*|GGT7_uc002xba.1_Nonsense_Mutation_p.E155*	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	155	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1						CTGAGCACCTCGATGCCCAGT	0.617													9	48	---	---	---	---	PASS
VSTM2L	128434	broad.mit.edu	37	20	36560111	36560111	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36560111G>A	uc002xhk.3	+	2	450	c.196G>A	c.(196-198)GGC>AGC	p.G66S		NM_080607	NP_542174	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like	66	Ig-like.									ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				CTCCTTCCGCGGCAGCGGCTC	0.622													30	178	---	---	---	---	PASS
CBLN4	140689	broad.mit.edu	37	20	54573676	54573676	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54573676T>A	uc002xxa.2	-	3	1328	c.543A>T	c.(541-543)AAA>AAT	p.K181N		NM_080617	NP_542184	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	181	C1q.					cell junction|extracellular region|synapse				ovary(3)|pancreas(1)	4			Colorectal(105;0.202)			CCAAATTACCTTTCTCCAGTT	0.468													7	165	---	---	---	---	PASS
C20orf108	116151	broad.mit.edu	37	20	54941160	54941160	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54941160C>T	uc002xxc.2	+	3	475	c.396C>T	c.(394-396)CTC>CTT	p.L132L		NM_080821	NP_543011	Q96KR6	CT108_HUMAN	hypothetical protein LOC116151	132	DUF1279.					integral to membrane					0			Colorectal(105;0.202)			TGCTGAAACTCGGATTTAAAG	0.453													8	115	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17443716	17443716	+	Silent	SNP	C	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17443716C>T	uc002zlw.2	-	10	1740	c.1632G>A	c.(1630-1632)GTG>GTA	p.V544V		NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	544										large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TCTCCAGATCCACCTGGACAT	0.607													7	95	---	---	---	---	PASS
CRYBB1	1414	broad.mit.edu	37	22	26997948	26997948	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26997948G>T	uc003acy.1	-	5	540	c.470C>A	c.(469-471)GCC>GAC	p.A157D		NM_001887	NP_001878	P53674	CRBB1_HUMAN	crystallin, beta B1	157	Beta/gamma crystallin 'Greek key' 3.				visual perception		structural constituent of eye lens			ovary(1)	1						CTTGAAGTTGGCCCCTTCAAA	0.557													21	111	---	---	---	---	PASS
CARD10	29775	broad.mit.edu	37	22	37888691	37888691	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37888691G>T	uc003asx.1	-	17	2598	c.2595C>A	c.(2593-2595)GAC>GAA	p.D865E	CARD10_uc003ast.1_RNA|CARD10_uc003asu.1_5'Flank|CARD10_uc003asv.1_5'UTR|CARD10_uc011ank.1_Missense_Mutation_p.D183E|CARD10_uc003asw.1_Missense_Mutation_p.D579E|CARD10_uc003asy.1_Missense_Mutation_p.D865E	NM_014550	NP_055365	Q9BWT7	CAR10_HUMAN	caspase recruitment domain protein 10	865					activation of NF-kappaB-inducing kinase activity|protein complex assembly|regulation of apoptosis	CBM complex	receptor signaling complex scaffold activity			upper_aerodigestive_tract(1)|lung(1)|breast(1)|ovary(1)|prostate(1)|kidney(1)	6	Melanoma(58;0.0574)					AGCTGGGCAGGTCTAGCAGGT	0.687													4	32	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38122102	38122102	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38122102A>G	uc003atr.2	+	7	3810	c.3539A>G	c.(3538-3540)CAG>CGG	p.Q1180R	TRIOBP_uc003atu.2_Missense_Mutation_p.Q1008R|TRIOBP_uc003atq.1_Missense_Mutation_p.Q1180R|TRIOBP_uc003ats.1_Missense_Mutation_p.Q1008R	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	1180					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CCACCACGCCAGGCTCCTGAG	0.622													15	141	---	---	---	---	PASS
GTPBP1	9567	broad.mit.edu	37	22	39122020	39122020	+	Silent	SNP	G	T	T	rs146011021		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39122020G>T	uc003awg.2	+	7	1237	c.1083G>T	c.(1081-1083)CCG>CCT	p.P361P		NM_004286	NP_004277	O00178	GTPB1_HUMAN	GTP binding protein 1	361					immune response|positive regulation of mRNA catabolic process|signal transduction	cytoplasmic exosome (RNase complex)|cytosol	GTP binding|GTPase activity			ovary(1)	1	Melanoma(58;0.04)					GGATGTGCCCGATATTCCAGA	0.572													27	250	---	---	---	---	PASS
PNPLA5	150379	broad.mit.edu	37	22	44285398	44285398	+	Silent	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44285398C>A	uc003beg.2	-	4	610	c.513G>T	c.(511-513)CTG>CTT	p.L171L	PNPLA5_uc011aqc.1_Intron|PNPLA5_uc003beh.2_Intron	NM_138814	NP_620169	Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	171	Patatin.				lipid catabolic process		hydrolase activity				0		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				AGTTGTTGCTCAGAGCCCCAT	0.637													14	221	---	---	---	---	PASS
CRLF2	64109	broad.mit.edu	37	X	1331536	1331536	+	5'Flank	SNP	C	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1331536C>G	uc004cpm.1	-									Q9HC73	CRLF2_HUMAN	Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				ATGCCTGAAACAGGAGTGGAG	0.507			Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								3	37	---	---	---	---	PASS
GSPT2	23708	broad.mit.edu	37	X	51487663	51487663	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51487663C>A	uc004dpl.2	+	1	1167	c.941C>A	c.(940-942)GCC>GAC	p.A314D		NM_018094	NP_060564	Q8IYD1	ERF3B_HUMAN	peptide chain release factor 3	314					cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1	Ovarian(276;0.236)					GTCATCTCTGCCAGGAAAGGA	0.428													30	151	---	---	---	---	PASS
SPANXC	64663	broad.mit.edu	37	X	140336531	140336531	+	Missense_Mutation	SNP	C	A	A	rs145019855	byFrequency	TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140336531C>A	uc004fbk.2	-	1	116	c.60G>T	c.(58-60)GAG>GAT	p.E20D	SPANXC_uc004fbl.2_Intron	NM_022661	NP_073152	Q9NY87	SPNXC_HUMAN	sperm protein associated with the nucleus, X	20						cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)					TCTCATTCACCTCGTTGGATT	0.294													19	139	---	---	---	---	PASS
GABRA3	2556	broad.mit.edu	37	X	151336820	151336820	+	Silent	SNP	G	A	A			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151336820G>A	uc010ntk.1	-	10	1599	c.1359C>T	c.(1357-1359)AGC>AGT	p.S453S		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	453	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGTCAACCTTGCTGACACTGT	0.512													24	132	---	---	---	---	PASS
FAM54B	56181	broad.mit.edu	37	1	26149357	26149358	+	Intron	DEL	CT	-	-	rs150838925		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26149357_26149358delCT	uc001bkq.3	+						FAM54B_uc001bkr.3_Intron|FAM54B_uc010oet.1_Intron|FAM54B_uc009vrz.2_Intron|LOC646471_uc010oeu.1_RNA|FAM54B_uc001bks.3_Intron|FAM54B_uc001bkt.3_Intron|FAM54B_uc001bku.3_5'UTR|FAM54B_uc001bkv.3_5'Flank	NM_001099625	NP_001093095	Q9H019	FA54B_HUMAN	hypothetical protein LOC56181 isoform a											pancreas(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.96e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.00095)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0649)		GGACTTAGAGCTAAGTGTTGGG	0.351													7	4	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62492159	62492160	+	Intron	DEL	TC	-	-	rs55936746		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62492159_62492160delTC	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						tgtgtgtgtgtctgtgtgtgtg	0.282													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199878832	199878832	+	IGR	DEL	A	-	-	rs34433898		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199878832delA								None (None upstream) : NR5A2 (117938 downstream)																							GCTTGTTTTTAAAAAAAAAAA	0.318													5	3	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233135199	233135199	+	Intron	DEL	T	-	-	rs137857886		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233135199delT	uc001hvl.2	-						PCNXL2_uc001hvk.1_Intron|PCNXL2_uc001hvm.1_Intron	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				tttctttttcttttttttttt	0.219													4	2	---	---	---	---	
UBR3	130507	broad.mit.edu	37	2	170815202	170815203	+	Intron	DEL	TT	-	-	rs78926703		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170815202_170815203delTT	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						tattatagacttttattatatt	0.089													3	5	---	---	---	---	
SFMBT1	51460	broad.mit.edu	37	3	52947312	52947312	+	Intron	DEL	A	-	-	rs5848965		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52947312delA	uc003dgf.2	-						SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Intron|SFMBT1_uc003dgh.2_Intron	NM_001005159	NP_001005159	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		TGTTTACGTGAATGTTTCCTA	0.393													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168269865	168269865	+	IGR	DEL	A	-	-	rs139746804		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168269865delA								MIR551B (128 upstream) : C3orf50 (257719 downstream)																							CAATGGGATTAAAAAAAAAAA	0.279													5	4	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68531131	68531132	+	Intron	INS	-	T	T	rs72340884		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68531131_68531132insT	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						CCAGCATAGTGtttttttttgt	0.243													12	6	---	---	---	---	
CENPE	1062	broad.mit.edu	37	4	104064763	104064763	+	Intron	DEL	C	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104064763delC	uc003hxb.1	-						CENPE_uc003hxc.1_Intron	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E						blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ggacacttcacccttcaaatc	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190548468	190548469	+	IGR	INS	-	GTGTGTGT	GTGTGTGT	rs148736094		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190548468_190548469insGTGTGTGT								None (None upstream) : FRG1 (313505 downstream)																							CCAGTCAACTGgtgtgtgtgtg	0.342													4	2	---	---	---	---	
FBXL7	23194	broad.mit.edu	37	5	15615946	15615946	+	Intron	DEL	A	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15615946delA	uc003jfn.1	+							NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						TGCATAAGGCAAAAAAAAACT	0.353													3	3	---	---	---	---	
MYOT	9499	broad.mit.edu	37	5	137211346	137211346	+	Intron	DEL	A	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137211346delA	uc011cye.1	+						MYOT_uc003lbv.2_Intron|MYOT_uc011cyg.1_Intron|MYOT_uc011cyh.1_Intron	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b						muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			tgccaaaaggaaaaaaaaaag	0.129													4	2	---	---	---	---	
GNPDA1	10007	broad.mit.edu	37	5	141386036	141386037	+	Intron	INS	-	T	T			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141386036_141386037insT	uc003lmf.3	-						GNPDA1_uc003lmg.3_Intron|GNPDA1_uc010jgh.2_Intron|GNPDA1_uc003lmh.3_Intron	NM_005471	NP_005462	P46926	GNPI1_HUMAN	glucosamine-6-phosphate deaminase 1						generation of precursor metabolites and energy|glucosamine catabolic process|N-acetylglucosamine metabolic process|single fertilization	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity				0		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCTGACCCCTAGCCACTCGG	0.604													4	3	---	---	---	---	
EXOC2	55770	broad.mit.edu	37	6	499430	499431	+	Intron	INS	-	AC	AC	rs4061197		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:499430_499431insAC	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CTCACAGTTAAacacacacaca	0.272													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	1478542	1478547	+	IGR	DEL	GTGGTG	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1478542_1478547delGTGGTG								FOXF2 (82711 upstream) : FOXC1 (132134 downstream)																							gtattgtgatgtggtggtggtggtgg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	75560075	75560075	+	IGR	DEL	T	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75560075delT								None (None upstream) : COL12A1 (233968 downstream)																							TACGTGTTGCTTTTTTTTTTT	0.373													4	3	---	---	---	---	
ANLN	54443	broad.mit.edu	37	7	36466798	36466799	+	Intron	INS	-	T	T	rs34986676		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36466798_36466799insT	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						GTACCTAAATGTTTTTTTTTTT	0.317													4	2	---	---	---	---	
NSUN5P1	155400	broad.mit.edu	37	7	75045497	75045497	+	Intron	DEL	G	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75045497delG	uc003udh.1	+						NSUN5P1_uc003ude.1_Intron|NSUN5P1_uc003udf.1_Intron|NSUN5P1_uc003udg.1_Intron	NM_145645	NP_663620			NOL1/NOP2/Sun domain family, member 5B												0						GGGTCGTGGAGGGGGGGGATG	0.657													9	4	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133859563	133859563	+	Intron	DEL	T	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133859563delT	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						AAAGTGACAATTTTTTTTTTA	0.343													4	2	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40389934	40389935	+	Intron	DEL	AA	-	-	rs35797324		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40389934_40389935delAA	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CTGTATATATAAAATATCTCCA	0.302													3	3	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	105261141	105261144	+	Intron	DEL	TTCC	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105261141_105261144delTTCC	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ctctctctctttccctctctctct	0.103										HNSCC(12;0.0054)			11	7	---	---	---	---	
MAFA	389692	broad.mit.edu	37	8	144511954	144511956	+	In_Frame_Del	DEL	TGG	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144511954_144511956delTGG	uc003yyc.1	-	1	621_623	c.621_623delCCA	c.(619-624)CACCAT>CAT	p.207_208HH>H		NM_201589	NP_963883	Q8NHW3	MAFA_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	207_208	His-rich.				insulin secretion|nitric oxide mediated signal transduction|response to glucose stimulus	nucleus	protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			CGCGCCGCCAtggtggtggtggt	0.581										HNSCC(29;0.082)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70117457	70117458	+	IGR	INS	-	G	G			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70117457_70117458insG								LOC100133920 (452508 upstream) : FOXD4L5 (58251 downstream)																							aagaaagaaaaaGAGAGAGAGA	0.074													4	2	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	92007622	92007625	+	Intron	DEL	TTCT	-	-	rs67832119		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92007622_92007625delTTCT	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						TGTCTTCTAGTTCTTTCTTTTTCG	0.265													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102150551	102150551	+	IGR	DEL	T	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102150551delT								SEC61B (157651 upstream) : NR4A3 (433586 downstream)																							ccttccttcctttcctttcct	0.050													4	3	---	---	---	---	
AIF1L	83543	broad.mit.edu	37	9	133987249	133987254	+	Intron	DEL	CTGCGG	-	-	rs145131993		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133987249_133987254delCTGCGG	uc004cab.1	+						AIF1L_uc004cad.1_Intron|AIF1L_uc004cae.1_Intron|AIF1L_uc004cac.1_Intron|AIF1L_uc011mce.1_Intron	NM_031426	NP_113614	Q9BQI0	AIF1L_HUMAN	ionized calcium binding adapter molecule 2							actin cytoskeleton|cytoplasm|focal adhesion|ruffle membrane	actin filament binding|calcium ion binding				0						CTCCCTGCCCCTGCGGGCCCCGTCAC	0.704													5	4	---	---	---	---	
PAAF1	80227	broad.mit.edu	37	11	73611047	73611047	+	Intron	DEL	T	-	-	rs34058264		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73611047delT	uc001ouk.1	+						PAAF1_uc001oul.1_Intron|PAAF1_uc009ytx.1_Intron|PAAF1_uc001oum.1_Intron	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1						interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)|skin(1)	2	Breast(11;7.42e-05)					CATGGAATTCTTTTTTTTTTT	0.378													3	3	---	---	---	---	
DDX12	440081	broad.mit.edu	37	12	9585728	9585728	+	Intron	DEL	C	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9585728delC	uc010sgs.1	-						DDX12_uc009zgq.1_Intron	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CGTGGACCTGCCCCCGCCACC	0.567													6	3	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111951477	111951477	+	Intron	DEL	A	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111951477delA	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsm.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						TTAAAAATAGAAAAAAAAAAA	0.199													4	2	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96579725	96579725	+	Intron	DEL	T	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96579725delT	uc001vmt.2	-							NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						Attttctttcttttttttttt	0.259													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22646862	22646862	+	IGR	DEL	C	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22646862delC								MIR1268 (133582 upstream) : GOLGA8DP (55423 downstream)																							CCCAAGTGAGCAggctggggc	0.463													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29294232	29294233	+	Intron	INS	-	CTTCCTTT	CTTCCTTT	rs28856588	by1000genomes	TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29294232_29294233insCTTCCTTT	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		ttccttccttcctttctttctt	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81759318	81759319	+	IGR	INS	-	CTTTCTTCCTTC	CTTTCTTCCTTC	rs13330700	by1000genomes	TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81759318_81759319insCTTTCTTCCTTC								CMIP (13953 upstream) : PLCG2 (53611 downstream)																							tttctttctttcttccttcctt	0.005													6	5	---	---	---	---	
NECAB2	54550	broad.mit.edu	37	16	84035269	84035288	+	Intron	DEL	CCTGGGCACCCCCTCACCTT	-	-	rs3215187		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84035269_84035288delCCTGGGCACCCCCTCACCTT	uc002fhd.2	+						NECAB2_uc002fhe.2_Intron	NM_019065	NP_061938	Q7Z6G3	NECA2_HUMAN	neuronal calcium-binding protein 2						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity|protein binding			ovary(2)	2						AGTCAGCCTCCCTGGGCACCCCCTCACCTTCCCACAAAGG	0.582													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20806093	20806093	+	RNA	DEL	G	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20806093delG	uc002gyg.1	+	4		c.1277delG			uc002gyh.1_RNA					Homo sapiens cDNA FLJ32911 fis, clone TESTI2006210.																		CGACTCCCAAGGAACCACTAA	0.448													4	2	---	---	---	---	
RHBDF2	79651	broad.mit.edu	37	17	74476090	74476099	+	Intron	DEL	TGTGTGTGTG	-	-	rs67036316		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74476090_74476099delTGTGTGTGTG	uc002jrq.1	-						RHBDF2_uc002jrp.1_Intron|RHBDF2_uc002jrr.1_Intron|RHBDF2_uc010wtf.1_Intron|RHBDF2_uc002jrs.1_Intron	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1						negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						atatatataatgtgtgtgtgtgtgtgtgtg	0.167													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	29339530	29339530	+	IGR	DEL	A	-	-	rs145174847		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29339530delA								B4GALT6 (74844 upstream) : MCART2 (129 downstream)																							aaaacaaaacaaaaaaaaaCC	0.308													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393630	77393638	+	IGR	DEL	CAGTGGTGA	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393630_77393638delCAGTGGTGA								NFATC1 (104308 upstream) : CTDP1 (46163 downstream)																							gtggtgatggcagtggtgatggtggttgt	0.000													4	2	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4207083	4207084	+	Intron	DEL	TT	-	-	rs67275884		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4207083_4207084delTT	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		taatgtttgctttttttttttt	0.000													4	2	---	---	---	---	
ADAMTS10	81794	broad.mit.edu	37	19	8657127	8657128	+	Intron	DEL	AG	-	-	rs35800262		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8657127_8657128delAG	uc002mkj.1	-						ADAMTS10_uc002mki.1_5'Flank|ADAMTS10_uc002mkk.1_Intron	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						ACATGCGAACAGAGTCAGGTTA	0.619													3	4	---	---	---	---	
FARSA	2193	broad.mit.edu	37	19	13036039	13036039	+	Intron	DEL	T	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13036039delT	uc002mvs.2	-						FARSA_uc002mvt.2_Intron|FARSA_uc010xmv.1_Intron|FARSA_uc010dyy.1_Intron	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit						phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	TTCCCACCCCttttttttttt	0.299													5	3	---	---	---	---	
VSTM2L	128434	broad.mit.edu	37	20	36572311	36572311	+	Intron	DEL	C	-	-	rs33961791		TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36572311delC	uc002xhk.3	+							NM_080607	NP_542174	Q96N03	VTM2L_HUMAN	V-set and transmembrane domain containing 2 like											ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				GATCTTGGGACCCCCCCCCCC	0.418													6	3	---	---	---	---	
EFCAB6	64800	broad.mit.edu	37	22	44127853	44127853	+	Intron	DEL	T	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44127853delT	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzk.1_5'Flank|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				TACTGTCAGATTTTTTTTTTA	0.373													4	2	---	---	---	---	
GK	2710	broad.mit.edu	37	X	30725446	30725446	+	Intron	DEL	A	-	-			TCGA-60-2715-01A-01D-1522-08	TCGA-60-2715-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30725446delA	uc004dch.3	+						GK_uc010ngj.2_Intron|GK_uc004dci.3_Intron|GK_uc011mjz.1_Intron|GK_uc011mka.1_Intron|GK_uc010ngk.2_Intron	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a						glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						actccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
