Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CCDC27	148870	broad.mit.edu	37	1	3680356	3680356	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3680356G>A	uc001akv.2	+	8	1489	c.1408G>A	c.(1408-1410)GAG>AAG	p.E470K		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	470										skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		GCTGCAGAAGGAGCTCCGAGA	0.567													38	74	---	---	---	---	PASS
NPHP4	261734	broad.mit.edu	37	1	5923438	5923438	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5923438C>A	uc001alq.1	-	30	4434	c.4168G>T	c.(4168-4170)GGC>TGC	p.G1390C	NPHP4_uc001alr.1_3'UTR	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	1390					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		AACTGCAAGCCGATGGTGTAG	0.542													61	140	---	---	---	---	PASS
RCC1	1104	broad.mit.edu	37	1	28857042	28857042	+	Intron	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28857042G>T	uc001bqg.1	+						SNHG3-RCC1_uc001bqa.1_Intron|SNHG3-RCC1_uc001bqb.1_Intron|SNHG3-RCC1_uc001bqc.1_Intron|RCC1_uc001bqe.1_Missense_Mutation_p.R27S|RCC1_uc001bqf.1_Missense_Mutation_p.R27S	NM_001269	NP_001260	P18754	RCC1_HUMAN	regulator of chromosome condensation 1 isoform						cell division|chromosome segregation|G1/S transition of mitotic cell cycle|mitosis|mitotic spindle organization|regulation of mitosis|regulation of S phase of mitotic cell cycle|spindle assembly|viral reproduction	condensed nuclear chromosome|cytoplasm|nuclear chromatin|nuclear membrane|nucleoplasm	histone binding|nucleosomal DNA binding|Ran guanyl-nucleotide exchange factor activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CAGACACGAGGGCCGCTGCCT	0.682													5	16	---	---	---	---	PASS
C1orf91	56063	broad.mit.edu	37	1	32682460	32682460	+	3'UTR	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32682460G>C	uc009vub.1	-	4					C1orf91_uc001buo.3_Intron|C1orf91_uc001bup.3_Intron|C1orf91_uc010oha.1_Intron|C1orf91_uc001buq.3_Silent_p.T139T			Q8WY98	TM234_HUMAN	RecName: Full=UPF0546 membrane protein C1orf91;							integral to membrane					0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCACTCAAAGGGTAGACTGTT	0.532													24	47	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34006908	34006908	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34006908G>T	uc001bxn.1	-	58	8876	c.8847C>A	c.(8845-8847)GTC>GTA	p.V2949V	CSMD2_uc001bxm.1_Silent_p.V3093V	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2949	Sushi 21.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CACAGTTTATGACTAGGATAA	0.493													29	64	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74957880	74957880	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74957880G>T	uc001dgf.1	+	23	2332	c.2281G>T	c.(2281-2283)GCA>TCA	p.A761S	TNNI3K_uc001dge.1_Missense_Mutation_p.A862S	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	761						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						GAGTCATGTGGCAGCATTAAG	0.478													59	322	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75037835	75037835	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037835C>A	uc001dgg.2	-	14	3778	c.3559G>T	c.(3559-3561)GAC>TAC	p.D1187Y		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1187	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TGCTCTGTGTCTCTGGCTTCA	0.527													114	274	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91859730	91859730	+	Silent	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91859730A>T	uc001doa.3	-	4	514	c.414T>A	c.(412-414)CCT>CCA	p.P138P	HFM1_uc010osu.1_Intron|HFM1_uc010osv.1_Intron|HFM1_uc001doc.1_Silent_p.P138P	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	138							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CACTCTTCTCAGGTGCTATCT	0.333													54	137	---	---	---	---	PASS
LPPR4	9890	broad.mit.edu	37	1	99772498	99772498	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99772498A>T	uc001dse.2	+	7	2330	c.2224A>T	c.(2224-2226)AAC>TAC	p.N742Y	LPPR4_uc010oue.1_Missense_Mutation_p.N684Y	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN	plasticity related gene 1	742							phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TGAAAGAAGCAACAGCCCCGA	0.493													19	170	---	---	---	---	PASS
VCAM1	7412	broad.mit.edu	37	1	101203708	101203708	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101203708C>G	uc001dti.2	+	9	2209	c.2089C>G	c.(2089-2091)CCT>GCT	p.P697A	VCAM1_uc001dtj.2_Missense_Mutation_p.P605A|VCAM1_uc010ouj.1_Missense_Mutation_p.P635A	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a	697	Extracellular (Potential).				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	CTATTTTTCTCCTGAGCTTCT	0.333													110	268	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103488298	103488298	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103488298G>T	uc001dul.2	-	8	1563	c.1245C>A	c.(1243-1245)AGC>AGA	p.S415R	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.S427R|COL11A1_uc001dun.2_Missense_Mutation_p.S376R|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	415	Nonhelical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATCAACTTACGCTTGTTTCTG	0.333													21	169	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111969180	111969180	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111969180C>A	uc001eba.2	-	3	195	c.139G>T	c.(139-141)GAC>TAC	p.D47Y	OVGP1_uc001eaz.2_5'UTR|OVGP1_uc010owb.1_5'UTR|OVGP1_uc010owc.1_Missense_Mutation_p.D37Y	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	47					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		AGAAAGGGGTCCAGGTCATGG	0.512													16	101	---	---	---	---	PASS
OVGP1	5016	broad.mit.edu	37	1	111969196	111969196	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111969196G>C	uc001eba.2	-	3	179	c.123C>G	c.(121-123)ATC>ATG	p.I41M	OVGP1_uc001eaz.2_Translation_Start_Site|OVGP1_uc010owb.1_Translation_Start_Site|OVGP1_uc010owc.1_Missense_Mutation_p.I31M	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	41					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		CATGGGGCAAGATCGAGGCAG	0.507													16	87	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113657152	113657152	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113657152C>T	uc001edf.1	+	15	2382	c.2184C>T	c.(2182-2184)AAC>AAT	p.N728N	LRIG2_uc009wgn.1_Silent_p.N625N	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	728	Ig-like C2-type 3.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CTCGTCTCAACTGGACTAAAG	0.502													65	115	---	---	---	---	PASS
SYT6	148281	broad.mit.edu	37	1	114640424	114640424	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114640424G>T	uc001eev.2	-	6	1435	c.1185C>A	c.(1183-1185)AAC>AAA	p.N395K	SYT6_uc001eeu.2_Missense_Mutation_p.N40K	NM_205848	NP_995320	Q5T7P8	SYT6_HUMAN	synaptotagmin VI	480	Cytoplasmic (Potential).				acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAGCATCTCGTTCCAGTGGT	0.572													21	134	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	145075747	145075747	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145075747G>T	uc001emh.2	-	1	333	c.116C>A	c.(115-117)ACC>AAC	p.T39N	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Missense_Mutation_p.T39N|PDE4DIP_uc001emk.2_Missense_Mutation_p.T39N	NM_022359	NP_071754	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	713					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGACTGAGGGGTTCGCGTCGC	0.736			T	PDGFRB	MPD								9	154	---	---	---	---	PASS
HIST2H2BE	8349	broad.mit.edu	37	1	149858030	149858030	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149858030C>T	uc001etc.2	-	1	203	c.161G>A	c.(160-162)GGC>GAC	p.G54D	HIST2H2AC_uc001etd.2_5'Flank	NM_003528	NP_003519	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	54					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GGACGAGATGCCGGTGTCGGG	0.587													7	485	---	---	---	---	PASS
SEMA6C	10500	broad.mit.edu	37	1	151109545	151109545	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151109545C>A	uc001ewu.2	-	11	1062	c.762G>T	c.(760-762)CAG>CAT	p.Q254H	SEMA6C_uc001ewv.2_Missense_Mutation_p.Q254H|SEMA6C_uc001eww.2_Missense_Mutation_p.Q214H|SEMA6C_uc010pcq.1_Missense_Mutation_p.Q254H|SEMA6C_uc009wml.1_RNA	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y precursor	254	Extracellular (Potential).|Sema.					integral to membrane	receptor activity			ovary(1)|skin(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CGCGGGAGAACTGCACCTAGG	0.567													44	121	---	---	---	---	PASS
PSMD4	5710	broad.mit.edu	37	1	151227255	151227255	+	5'UTR	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151227255C>G	uc001exl.2	+	1					PSMD4_uc001exn.2_5'UTR	NM_002810	NP_002801	P55036	PSMD4_HUMAN	proteasome 26S non-ATPase subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding|zinc ion binding				0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGGAAGGTGGCAAGATGGTGT	0.632													8	10	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156642911	156642911	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156642911G>C	uc001fpq.2	-	4	1202	c.1069C>G	c.(1069-1071)CCC>GCC	p.P357A		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	357	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAGGGTGAGGGGAGGGAAGTT	0.597													35	115	---	---	---	---	PASS
FCRL4	83417	broad.mit.edu	37	1	157559034	157559034	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157559034G>A	uc001fqw.2	-	3	403	c.267C>T	c.(265-267)GGC>GGT	p.G89G	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	89	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				TTCGTGGGGAGCCCCGGGCCT	0.498													8	203	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157665949	157665949	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157665949G>T	uc001frb.2	-	7	1305	c.1013C>A	c.(1012-1014)TCC>TAC	p.S338Y	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.S338Y|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Missense_Mutation_p.S64Y|FCRL3_uc001frc.1_Missense_Mutation_p.S338Y	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	338	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					TGCCAACAGGGAACGCTGGGT	0.527													52	118	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157739847	157739847	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157739847T>C	uc001fre.2	-	4	463	c.404A>G	c.(403-405)CAG>CGG	p.Q135R	FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.Q135R|FCRL2_uc009wsp.2_Intron|FCRL2_uc010pia.1_Missense_Mutation_p.Q135R	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	135	Extracellular (Potential).|Ig-like C2-type 2.				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATCCAACCTCTGTGGAGAGAG	0.567													32	82	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158623222	158623222	+	Intron	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158623222G>T	uc001fst.1	-							NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGTCCTGAAGGGAGAGCAGAT	0.522													36	106	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160147346	160147346	+	Silent	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160147346T>C	uc001fve.3	+	18	3107	c.2628T>C	c.(2626-2628)TTT>TTC	p.F876F	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Silent_p.F379F|ATP1A4_uc001fvh.2_Silent_p.F12F	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	876	Extracellular (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTACCTACTTTGTAATCCTGG	0.522													38	117	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171510562	171510562	+	Silent	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171510562G>C	uc010pmg.1	+	16	4217	c.3951G>C	c.(3949-3951)CTG>CTC	p.L1317L	BAT2L2_uc010pmh.1_Silent_p.L294L	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1317							protein C-terminus binding				0						ATAATAGACTGCTAGAAAAGC	0.433													27	57	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175049351	175049351	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175049351G>T	uc001gkl.1	+	4	950	c.837G>T	c.(835-837)CTG>CTT	p.L279L	TNN_uc010pmx.1_Silent_p.L279L	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	279	Fibronectin type-III 1.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ATTCTCTGCTGGTGAGCTGGG	0.617													34	76	---	---	---	---	PASS
RALGPS2	55103	broad.mit.edu	37	1	178885490	178885490	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178885490A>G	uc001glz.2	+	20	2086	c.1748A>G	c.(1747-1749)GAG>GGG	p.E583G	RALGPS2_uc010pnb.1_Missense_Mutation_p.E557G	NM_152663	NP_689876	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	583	Required for stimulation of nucleotide exchange by RALA (By similarity).				small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0						ATGACTTTTGAGTAGAAGCCT	0.363													14	62	---	---	---	---	PASS
XPR1	9213	broad.mit.edu	37	1	180775220	180775220	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180775220G>T	uc001goi.2	+	5	662	c.470G>T	c.(469-471)CGA>CTA	p.R157L	XPR1_uc009wxm.2_Missense_Mutation_p.R157L|XPR1_uc009wxn.2_Missense_Mutation_p.R157L	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor	157	SPX.|Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0						ACAGGGTTTCGAAAAATCCTG	0.378													34	89	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181549812	181549812	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181549812G>T	uc001gow.2	+	6	1016	c.851G>T	c.(850-852)GGC>GTC	p.G284V	CACNA1E_uc009wxr.2_Missense_Mutation_p.G191V|CACNA1E_uc009wxs.2_Missense_Mutation_p.G191V	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	284	I.|Extracellular (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GACTGGATCGGCCCCAATGAT	0.517													79	191	---	---	---	---	PASS
CACNA1S	779	broad.mit.edu	37	1	201036078	201036078	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201036078C>T	uc001gvv.2	-	20	2821	c.2594G>A	c.(2593-2595)CGC>CAC	p.R865H		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	865	III.|Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GAAGTAATTGCGGCAGAAGGA	0.602													13	48	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216073560	216073560	+	Splice_Site	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216073560C>T	uc001hku.1	-	40	7839	c.7452_splice	c.e40-1	p.E2484_splice		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGAAAATAACCTGTATGGGAA	0.348										HNSCC(13;0.011)			44	104	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216143994	216143994	+	Silent	SNP	C	T	T	rs146406377	byFrequency	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216143994C>T	uc001hku.1	-	36	7317	c.6930G>A	c.(6928-6930)ACG>ACA	p.T2310T		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2310	Fibronectin type-III 9.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AACCTTTGGCCGTGCATGCTT	0.408										HNSCC(13;0.011)			47	136	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228471378	228471378	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228471378G>C	uc009xez.1	+	33	8956	c.8912G>C	c.(8911-8913)CGG>CCG	p.R2971P	OBSCN_uc001hsn.2_Missense_Mutation_p.R2971P|OBSCN_uc001hsp.1_Missense_Mutation_p.R670P|OBSCN_uc001hsq.1_Missense_Mutation_p.R227P	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2971	Ig-like 29.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CTGACCCTGCGGCTCACCATC	0.672													25	40	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228480222	228480222	+	Splice_Site	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228480222A>T	uc009xez.1	+	40	10648	c.10604_splice	c.e40-2	p.A3535_splice	OBSCN_uc001hsn.2_Splice_Site_p.A3535_splice|OBSCN_uc001hsq.1_Splice_Site_p.A791_splice	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GGTCCTTCCCAGCTCTGCCTG	0.572													33	94	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241099992	241099992	+	Silent	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241099992A>G	uc001hyv.2	-	5	571	c.241T>C	c.(241-243)TTG>CTG	p.L81L	RGS7_uc010pyh.1_Silent_p.L55L|RGS7_uc010pyj.1_5'UTR|RGS7_uc001hyu.2_Silent_p.L81L|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Silent_p.L81L	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	81	DEP.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			AATGTTCCCAAATGGAGCGCC	0.383													30	66	---	---	---	---	PASS
OR2L8	391190	broad.mit.edu	37	1	248112521	248112521	+	Missense_Mutation	SNP	G	T	T	rs148005952	byFrequency	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248112521G>T	uc001idt.1	+	1	362	c.362G>T	c.(361-363)CGT>CTT	p.R121L	OR2L13_uc001ids.2_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GCCTATGATCGTTACATTGCT	0.443													122	334	---	---	---	---	PASS
OR2AK2	391191	broad.mit.edu	37	1	248129478	248129478	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248129478C>G	uc010pzd.1	+	1	845	c.845C>G	c.(844-846)TCC>TGC	p.S282C	OR2L13_uc001ids.2_Intron	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK,	282	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCCTTGCGTTCCCCTTCACGG	0.498													46	108	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343459	248343459	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343459C>A	uc010pzf.1	+	1	172	c.172C>A	c.(172-174)CCC>ACC	p.P58T		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCTCCACACCCCCATGTACTT	0.537													203	478	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1161234	1161234	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1161234G>T	uc002qwq.2	+	7	540	c.412G>T	c.(412-414)GTG>TTG	p.V138L	SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	138	PDZ.				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		ATATTGACAGGTGCATCTGCT	0.428													22	61	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20494185	20494185	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20494185G>T	uc002rds.1	-	8	1127	c.1104C>A	c.(1102-1104)AAC>AAA	p.N368K	PUM2_uc002rdt.1_Missense_Mutation_p.N368K|PUM2_uc002rdr.2_Missense_Mutation_p.N307K|PUM2_uc010yjy.1_Missense_Mutation_p.N368K|PUM2_uc002rdu.1_Missense_Mutation_p.N368K|PUM2_uc010yjz.1_Missense_Mutation_p.N307K	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	368	Ala-rich.|Gln-rich.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACTGGCTGTGTTATTTGCCG	0.483													23	122	---	---	---	---	PASS
CCDC121	79635	broad.mit.edu	37	2	27849963	27849963	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27849963C>A	uc002rle.2	-	2	885	c.704G>T	c.(703-705)TGG>TTG	p.W235L	ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_Missense_Mutation_p.W399L|CCDC121_uc002rld.2_Missense_Mutation_p.W397L|GPN1_uc010ezf.2_5'Flank|GPN1_uc010yma.1_5'Flank|GPN1_uc010ymb.1_5'Flank|GPN1_uc010ymc.1_5'Flank|GPN1_uc010ymd.1_5'Flank|GPN1_uc010yme.1_5'Flank|GPN1_uc010ezg.1_5'Flank	NM_024584	NP_078860	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121 isoform 3	235	Potential.										0	Acute lymphoblastic leukemia(172;0.155)					CTCCAGATACCACTGTTCCTG	0.478													4	167	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32667235	32667235	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32667235G>C	uc010ezu.2	+	18	4181	c.4047G>C	c.(4045-4047)CAG>CAC	p.Q1349H		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	1349					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					AACATGCCCAGAGCCTTGTGT	0.398													82	82	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40401987	40401987	+	Intron	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40401987A>T	uc002rrx.2	-						uc002rrw.2_Intron|SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AGCCACCTAAAAAAGAAAAAA	0.323													33	150	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77746750	77746750	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746750G>A	uc002snr.2	-	3	660	c.245C>T	c.(244-246)GCC>GTC	p.A82V	LRRTM4_uc002snq.2_Missense_Mutation_p.A82V|LRRTM4_uc002sns.2_Missense_Mutation_p.A82V|LRRTM4_uc002snt.2_Missense_Mutation_p.A83V	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	82	LRR 1.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		GTTAAGGCCGGCAAACTGATT	0.403													4	167	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89292050	89292050	+	RNA	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89292050G>C	uc010ytr.1	-	82		c.7156C>G			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		ACCCCACTTTGCAAAGTGGAT	0.493													108	190	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99185132	99185132	+	Splice_Site	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99185132G>T	uc002syy.2	+	23	2926	c.2533_splice	c.e23+1	p.C845_splice	INPP4A_uc010yvj.1_Splice_Site_p.C806_splice|INPP4A_uc010yvk.1_Splice_Site_p.C806_splice|INPP4A_uc002syx.2_Splice_Site_p.C840_splice|INPP4A_uc010fik.2_Splice_Site_p.C174_splice	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						CCTGAGGATTGTAAGTATTTC	0.433													3	18	---	---	---	---	PASS
IL18RAP	8807	broad.mit.edu	37	2	103068286	103068286	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103068286G>A	uc002tbx.2	+	12	1929	c.1445G>A	c.(1444-1446)AGC>AAC	p.S482N	IL18RAP_uc010fiz.2_Missense_Mutation_p.S340N	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	482	TIR.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						TTTATCTTGAGCCCCAACTAT	0.348													62	207	---	---	---	---	PASS
SULT1C2	6819	broad.mit.edu	37	2	108921151	108921151	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108921151G>A	uc002tdy.2	+	5	950	c.497G>A	c.(496-498)GGA>GAA	p.G166E	SULT1C2_uc010ywp.1_Missense_Mutation_p.G81E|SULT1C2_uc002tdx.2_Missense_Mutation_p.G177E|SULT1C2_uc010ywq.1_Missense_Mutation_p.G180E	NM_001056	NP_001047	O00338	ST1C2_HUMAN	sulfotransferase family, cytosolic, 1C, member 1	166					3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine metabolic process|sulfation|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	sulfotransferase activity			ovary(1)	1						TTCATCAATGGAAAAGGTACG	0.478													61	154	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112550114	112550114	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112550114C>A	uc002thi.2	-	38	4784	c.4537G>T	c.(4537-4539)GAA>TAA	p.E1513*		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1513					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						AGACAAGTTTCTAGGTTATGA	0.438													42	97	---	---	---	---	PASS
MARCO	8685	broad.mit.edu	37	2	119727695	119727695	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119727695A>C	uc002tln.1	+	3	337	c.205A>C	c.(205-207)AAT>CAT	p.N69H	MARCO_uc010yyf.1_5'UTR	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	69	Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						CCCAGTTCTGAATCTGCAGGC	0.552													31	82	---	---	---	---	PASS
ERCC3	2071	broad.mit.edu	37	2	128030447	128030447	+	Silent	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128030447T>A	uc002toh.1	-	11	1916	c.1821A>T	c.(1819-1821)ATA>ATT	p.I607I	ERCC3_uc002toe.1_Silent_p.I362I|ERCC3_uc002tof.1_Silent_p.I543I|ERCC3_uc002tog.1_Silent_p.I543I	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent	607	Helicase C-terminal.				cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(2)|lung(2)|breast(2)|kidney(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		AAACCTTGGATATGAAGATGG	0.488			Mis|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				19	105	---	---	---	---	PASS
ARHGEF4	50649	broad.mit.edu	37	2	131796570	131796570	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131796570G>T	uc002tsa.1	+	6	1232	c.712G>T	c.(712-714)GAT>TAT	p.D238Y	ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Missense_Mutation_p.D238Y|ARHGEF4_uc010fmx.1_Missense_Mutation_p.D238Y|ARHGEF4_uc002tsc.1_5'Flank	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform	238	SH3.				apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CCGGGTCGCCGATGGCGAGGG	0.592													14	39	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135744462	135744462	+	Silent	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135744462A>T	uc002tue.1	-	7	2011	c.1980T>A	c.(1978-1980)CCT>CCA	p.P660P	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Silent_p.P547P|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Silent_p.P388P|YSK4_uc002tui.3_Silent_p.P677P	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	660							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		CATAGATTCCAGGTCCATTAG	0.408													100	286	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141598639	141598639	+	Silent	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141598639T>C	uc002tvj.1	-	30	5934	c.4962A>G	c.(4960-4962)CTA>CTG	p.L1654L		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1654	Extracellular (Potential).|LDL-receptor class B 14.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATCCACTGCTAGCCCTCTGA	0.363										TSP Lung(27;0.18)			31	155	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158114977	158114977	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158114977A>T	uc002tzg.2	+	1	638	c.383A>T	c.(382-384)CAT>CTT	p.H128L	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	128	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						CCGTTGTGGCATCCTGCACAT	0.557													18	114	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166246194	166246194	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166246194C>G	uc002udc.2	+	27	6168	c.5878C>G	c.(5878-5880)CCA>GCA	p.P1960A	SCN2A_uc002udd.2_Missense_Mutation_p.P1960A|SCN2A_uc002ude.2_Missense_Mutation_p.P1960A	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1960					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	GAATTCAACTCCAGAGAAAAC	0.368													32	89	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166848433	166848433	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166848433G>T	uc010zcz.1	-	26	5337	c.5319C>A	c.(5317-5319)GTC>GTA	p.V1773V		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1784	IV.|Helical; Name=S6 of repeat IV; (By similarity).					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TCTCCAGGATGACCGCGATGT	0.448													82	181	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168101741	168101741	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168101741A>T	uc002udx.2	+	8	3857	c.3839A>T	c.(3838-3840)GAG>GTG	p.E1280V	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E1105V|XIRP2_uc010fpq.2_Missense_Mutation_p.E1058V|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1105	Xin 21.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TTTATTTTTGAGACTTTTTCT	0.353													24	153	---	---	---	---	PASS
DLX2	1746	broad.mit.edu	37	2	172967060	172967060	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172967060G>T	uc002uhn.2	-	1	419	c.207C>A	c.(205-207)AAC>AAA	p.N69K	DLX2_uc010zdx.1_Missense_Mutation_p.N69K	NM_004405	NP_004396	Q07687	DLX2_HUMAN	distal-less homeobox 2	69						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.216)			ggTGCTGCTGGTTGGTGTAGT	0.443													2	2	---	---	---	---	PASS
HOXD9	3235	broad.mit.edu	37	2	176987592	176987592	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176987592G>C	uc010zex.1	+	1	180	c.96G>C	c.(94-96)GAG>GAC	p.E32D		NM_014213	NP_055028	P28356	HXD9_HUMAN	homeobox D9	32						nucleus	sequence-specific DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		AGGGCGACGAGGTGTTCGCGG	0.682													4	21	---	---	---	---	PASS
FRZB	2487	broad.mit.edu	37	2	183723523	183723523	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183723523C>A	uc002upa.1	-	2	735	c.517G>T	c.(517-519)GCA>TCA	p.A173S		NM_001463	NP_001454	Q92765	SFRP3_HUMAN	frizzled-related protein precursor	173					brain development|cochlea morphogenesis|gonad development|mammary gland involution|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of hepatocyte differentiation|positive regulation of apoptosis|positive regulation of fat cell differentiation|skeletal system development|vasculature development|Wnt receptor signaling pathway	cytoplasm|extracellular space|membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			CCACTGCTTGCCCCTCTACAG	0.348													49	133	---	---	---	---	PASS
CCDC150	284992	broad.mit.edu	37	2	197583269	197583269	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197583269A>T	uc002utp.1	+	18	2044	c.1909A>T	c.(1909-1911)ACA>TCA	p.T637S	CCDC150_uc010zgs.1_Missense_Mutation_p.T284S|CCDC150_uc010zgt.1_Missense_Mutation_p.T54S|CCDC150_uc002utq.1_5'Flank|CCDC150_uc002utr.1_5'Flank	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	637	Potential.										0						GCTGTCCCGAACAGTGAAGTG	0.403													14	43	---	---	---	---	PASS
CDK15	65061	broad.mit.edu	37	2	202712138	202712138	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202712138G>T	uc002uyt.2	+	9	935	c.886G>T	c.(886-888)GGT>TGT	p.G296C	CDK15_uc010ftm.2_Missense_Mutation_p.G161C|CDK15_uc002uys.2_Missense_Mutation_p.G245C|CDK15_uc010ftn.1_Missense_Mutation_p.G245C|CDK15_uc010fto.1_Missense_Mutation_p.G275C	NM_139158	NP_631897	Q96Q40	CDK15_HUMAN	PFTAIRE protein kinase 2	296	Protein kinase.						ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)	AATGTTCCAGGGTCAACCTTT	0.378													13	134	---	---	---	---	PASS
WDR12	55759	broad.mit.edu	37	2	203762032	203762032	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203762032C>A	uc002uzl.2	-	5	1195	c.445G>T	c.(445-447)GTG>TTG	p.V149L	WDR12_uc010ftt.2_Missense_Mutation_p.V149L	NM_018256	NP_060726	Q9GZL7	WDR12_HUMAN	WD repeat domain 12 protein	149	WD 2.|Sufficient for nucleolar localization.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						CCTTTTTTCACCCAGGCCACA	0.438													40	115	---	---	---	---	PASS
NRP2	8828	broad.mit.edu	37	2	206617572	206617572	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206617572G>T	uc002vaw.2	+	12	2708	c.1917G>T	c.(1915-1917)CAG>CAT	p.Q639H	NRP2_uc002vau.2_Missense_Mutation_p.Q639H|NRP2_uc002vav.2_Missense_Mutation_p.Q639H|NRP2_uc002vax.2_Missense_Mutation_p.Q639H|NRP2_uc002vay.2_Missense_Mutation_p.Q639H	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor	639	Extracellular (Potential).				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						AAGATTTGCAGCTCCCTTCGG	0.488													23	62	---	---	---	---	PASS
BARD1	580	broad.mit.edu	37	2	215610441	215610441	+	Intron	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215610441C>A	uc002veu.2	-						BARD1_uc010zjm.1_Intron	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1						cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATTCAAAATCCTCACCTGTAC	0.358									Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				63	193	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220355278	220355278	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220355278G>C	uc010fwg.2	+	37	9069	c.9069G>C	c.(9067-9069)ATG>ATC	p.M3023I		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	3023	Protein kinase 2.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGCGGATCATGTCCCTGCACG	0.632													13	64	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225672459	225672459	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225672459C>G	uc010fwz.1	-	33	3867	c.3628G>C	c.(3628-3630)GGC>CGC	p.G1210R	DOCK10_uc002vob.2_Missense_Mutation_p.G1204R|DOCK10_uc002voa.2_5'Flank|DOCK10_uc002voc.2_Missense_Mutation_p.G73R	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1210							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AGGAGCATGCCGTACAGGGGC	0.403													3	14	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228128559	228128559	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228128559A>T	uc002vom.1	+	21	1376	c.1214A>T	c.(1213-1215)GAA>GTA	p.E405V	COL4A3_uc002von.1_Missense_Mutation_p.E405V|COL4A3_uc002voo.1_Missense_Mutation_p.E405V|COL4A3_uc002vop.1_Missense_Mutation_p.E405V|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	405	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AGTAAAGGGGAACGAGGCCGC	0.552													5	83	---	---	---	---	PASS
FGD5	152273	broad.mit.edu	37	3	14862052	14862052	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14862052T>G	uc003bzc.2	+	1	1584	c.1474T>G	c.(1474-1476)TAT>GAT	p.Y492D	FGD5_uc011avk.1_Missense_Mutation_p.Y492D	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	492					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						GGTGGCCGGCTATGTCCCAGA	0.617													28	36	---	---	---	---	PASS
METTL6	131965	broad.mit.edu	37	3	15457358	15457358	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15457358A>G	uc003bzs.1	-	4	710	c.452T>C	c.(451-453)GTG>GCG	p.V151A	METTL6_uc011avp.1_Missense_Mutation_p.V106A|METTL6_uc003bzt.1_Missense_Mutation_p.V151A|METTL6_uc010hen.1_5'Flank	NM_152396	NP_689609	Q8TCB7	METL6_HUMAN	methyltransferase like 6	151							methyltransferase activity				0						AACAACATCCACAGACTCTGG	0.408													55	93	---	---	---	---	PASS
TOP2B	7155	broad.mit.edu	37	3	25668689	25668689	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25668689C>A	uc011awn.1	-	16	2048	c.2005G>T	c.(2005-2007)GCC>TCC	p.A669S	TOP2B_uc003cdj.2_Missense_Mutation_p.A664S	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	669					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						AAGGTAATGGCAGCATCATCT	0.398													4	170	---	---	---	---	PASS
ZNF619	285267	broad.mit.edu	37	3	40529231	40529231	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40529231C>T	uc011azb.1	+	6	1628	c.1350C>T	c.(1348-1350)AGC>AGT	p.S450S	ZNF619_uc010hhz.2_Silent_p.S401S|ZNF619_uc003ckj.2_Silent_p.S394S|ZNF619_uc011azc.1_Silent_p.S410S|ZNF619_uc011azd.1_Silent_p.S366S|ZNF619_uc011aza.1_Silent_p.S352S	NM_001145082	NP_001138554	E9PCD9	E9PCD9_HUMAN	zinc finger protein 619 isoform 1	450					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		AAACTTTCAGCTGTAGCTCCC	0.473													35	82	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47125224	47125224	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47125224A>G	uc003cqs.2	-	12	6099	c.6046T>C	c.(6046-6048)TGG>CGG	p.W2016R	SETD2_uc003cqv.2_Missense_Mutation_p.W2083R|SETD2_uc003cqt.1_RNA	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2016					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGGTCTTTCCAACTGTCCAGG	0.388			N|F|S|Mis		clear cell renal carcinoma								105	170	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49940543	49940543	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49940543T>G	uc003cxy.3	-	1	764	c.500A>C	c.(499-501)CAC>CCC	p.H167P	MST1R_uc011bdd.1_Missense_Mutation_p.H167P|MST1R_uc011bde.1_Missense_Mutation_p.H167P|MST1R_uc011bdf.1_Missense_Mutation_p.H167P|MST1R_uc011bdg.1_Missense_Mutation_p.H167P	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	167	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CCGGTTATGGTGGGCTGAGAA	0.632													29	28	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100364866	100364866	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100364866G>A	uc003duc.2	+	9	1292	c.1024G>A	c.(1024-1026)GAT>AAT	p.D342N	GPR128_uc011bhc.1_Missense_Mutation_p.D43N	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	342	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						AGCTAAATCGGATTTTAGTCA	0.333													50	189	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108403065	108403065	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108403065G>T	uc003dxd.2	+	27	3308	c.2886G>T	c.(2884-2886)ATG>ATT	p.M962I	DZIP3_uc003dxf.1_Missense_Mutation_p.M962I|DZIP3_uc011bhm.1_Missense_Mutation_p.M413I	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	962					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TATTTTAGATGCAGCAGTTCT	0.378													239	356	---	---	---	---	PASS
CD96	10225	broad.mit.edu	37	3	111297997	111297997	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111297997T>C	uc003dxw.2	+	5	885	c.715T>C	c.(715-717)TTC>CTC	p.F239L	CD96_uc003dxv.2_Missense_Mutation_p.F223L|CD96_uc003dxx.2_Missense_Mutation_p.F223L|CD96_uc010hpy.1_Missense_Mutation_p.F223L	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	239	Extracellular (Potential).				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						AGTCCAAATCTTCGATGATGG	0.443									Opitz_Trigonocephaly_syndrome				68	271	---	---	---	---	PASS
TMPRSS7	344805	broad.mit.edu	37	3	111795864	111795864	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111795864G>T	uc010hqb.2	+	14	1889	c.1719G>T	c.(1717-1719)CAG>CAT	p.Q573H	TMPRSS7_uc011bhr.1_Missense_Mutation_p.Q428H	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	699	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						CTTTGCTACAGCTCAGTATTG	0.478													117	381	---	---	---	---	PASS
ZNF80	7634	broad.mit.edu	37	3	113955205	113955205	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113955205G>A	uc010hqo.2	-	1	1221	c.717C>T	c.(715-717)CAC>CAT	p.H239H	ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80	239	C2H2-type 7.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TCTCTCCAGTGTGACTCCTTG	0.458													149	168	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124692706	124692706	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124692706C>A	uc003ehs.3	-	16	3933	c.3865G>T	c.(3865-3867)GAT>TAT	p.D1289Y	HEG1_uc003ehr.3_Missense_Mutation_p.D143Y|HEG1_uc011bke.1_Missense_Mutation_p.D1389Y	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	1289	Cytoplasmic (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						ATTTGGAAATCTCCACTTTTG	0.373													29	104	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126732960	126732960	+	Splice_Site	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126732960G>T	uc003ejg.2	+	10	2345	c.2341_splice	c.e10+1	p.A781_splice		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1						axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		AACATCCAGGGTGAGTGGGCG	0.652													19	186	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132166270	132166270	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132166270A>G	uc003eor.2	+	4	315	c.250A>G	c.(250-252)AAA>GAA	p.K84E	DNAJC13_uc010htq.1_Missense_Mutation_p.K84E	NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	84							heat shock protein binding			ovary(1)|breast(1)	2						AGAAACTTTAAAATTTTCTAC	0.353													50	133	---	---	---	---	PASS
TMEM108	66000	broad.mit.edu	37	3	133098802	133098802	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133098802A>G	uc003eph.2	+	4	521	c.247A>G	c.(247-249)ACA>GCA	p.T83A	TMEM108_uc003epi.2_Missense_Mutation_p.T83A|TMEM108_uc003epj.1_Missense_Mutation_p.T83A|TMEM108_uc003epk.2_Intron|TMEM108_uc003epm.2_Missense_Mutation_p.T34A	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	83	Pro-rich.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)	4						TCCCATGGCAACACCGACACC	0.617													39	227	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739325	138739325	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739325A>G	uc003esy.1	-	1	444	c.179T>C	c.(178-180)ATA>ACA	p.I60T		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	60										breast(1)	1						CAGGACCACTATGGAGGTGAG	0.726													6	33	---	---	---	---	PASS
BCHE	590	broad.mit.edu	37	3	165547603	165547603	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165547603C>A	uc003fem.3	-	2	1379	c.1219G>T	c.(1219-1221)GAT>TAT	p.D407Y	BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	407					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	GGTCTCTGATCATCTACCCAG	0.398													53	154	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	183014824	183014824	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183014824C>T	uc003fli.1	-	12	1527	c.1437G>A	c.(1435-1437)CCG>CCA	p.P479P	MCF2L2_uc003flj.1_Silent_p.P479P|MCF2L2_uc011bqr.1_Intron|uc003fln.1_RNA|uc003flo.2_5'Flank	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	479					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGCTGAGCAACGGGTACTCCT	0.507													39	148	---	---	---	---	PASS
TNK2	10188	broad.mit.edu	37	3	195595138	195595138	+	Silent	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195595138C>A	uc003fvu.1	-	12	2529	c.1986G>T	c.(1984-1986)GGG>GGT	p.G662G	TNK2_uc003fvq.1_Silent_p.G69G|TNK2_uc003fvr.1_Silent_p.G187G|TNK2_uc003fvs.1_Silent_p.G694G|TNK2_uc003fvt.1_Silent_p.G740G|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_3'UTR	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1	662	Pro-rich.			Missing (in Ref. 4; AAH08884).	positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CCTGGCTGGGCCCGGCAGGGA	0.701													8	55	---	---	---	---	PASS
RGS12	6002	broad.mit.edu	37	4	3427268	3427268	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3427268G>A	uc003ggw.2	+	14	4216	c.3312G>A	c.(3310-3312)AAG>AAA	p.K1104K	RGS12_uc003ggv.2_Silent_p.K1104K|RGS12_uc003ggy.1_Silent_p.K502K|RGS12_uc003ggz.2_Silent_p.K456K|RGS12_uc010icu.1_Silent_p.K303K|RGS12_uc011bvs.1_Silent_p.K446K|RGS12_uc003gha.2_Silent_p.K446K|RGS12_uc010icv.2_Silent_p.K303K|RGS12_uc003ghb.2_Silent_p.K303K	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	1104	RBD 2.					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGGAGGAGAAGGATCCTTCCA	0.622													85	132	---	---	---	---	PASS
TBC1D14	57533	broad.mit.edu	37	4	6969094	6969094	+	Silent	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6969094A>G	uc011bwg.1	+	3	865	c.786A>G	c.(784-786)TTA>TTG	p.L262L	TBC1D14_uc003gjs.3_Silent_p.L262L	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a	262						intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						GATGGAAGTTATTTGGGAAAG	0.413													42	87	---	---	---	---	PASS
CC2D2A	57545	broad.mit.edu	37	4	15529081	15529081	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15529081C>T	uc010idv.2	+	13	1406	c.1161C>T	c.(1159-1161)TAC>TAT	p.Y387Y	CC2D2A_uc003gnx.2_Silent_p.Y338Y|CC2D2A_uc003gnv.2_Silent_p.Y387Y	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	387					cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						CTGTAAAATACGTTCACAGTA	0.413													9	19	---	---	---	---	PASS
PROM1	8842	broad.mit.edu	37	4	15987391	15987391	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15987391C>G	uc003goo.2	-	21	2484	c.2272G>C	c.(2272-2274)GAG>CAG	p.E758Q	PROM1_uc003gor.2_Missense_Mutation_p.E758Q|PROM1_uc003gos.2_Missense_Mutation_p.E749Q|PROM1_uc003got.2_Missense_Mutation_p.E758Q|PROM1_uc003gou.2_Missense_Mutation_p.E749Q|PROM1_uc003gop.2_Missense_Mutation_p.E749Q|PROM1_uc003goq.3_Missense_Mutation_p.E749Q	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1	758	Extracellular (Potential).				camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						ACAGAGAACTCGATCCACTGC	0.318													4	20	---	---	---	---	PASS
SPATA18	132671	broad.mit.edu	37	4	52928470	52928470	+	Silent	SNP	C	A	A	rs143076152		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52928470C>A	uc003gzl.2	+	4	672	c.394C>A	c.(394-396)CGG>AGG	p.R132R	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Silent_p.R132R|SPATA18_uc003gzk.1_Silent_p.R132R	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	132	Potential.				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			GAACTCAACCCGGAGTCAATG	0.358													4	162	---	---	---	---	PASS
UGT2B10	7365	broad.mit.edu	37	4	69683839	69683839	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69683839C>A	uc003hee.2	+	2	836	c.811C>A	c.(811-813)CCA>ACA	p.P271T	UGT2B10_uc011cam.1_Missense_Mutation_p.P187T	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	271					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						TCCATTCTTACCAAATGTTGA	0.393													114	209	---	---	---	---	PASS
AFF1	4299	broad.mit.edu	37	4	87968580	87968580	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87968580C>T	uc003hqj.3	+	3	1279	c.872C>T	c.(871-873)ACG>ATG	p.T291M	AFF1_uc011ccx.1_Missense_Mutation_p.T232M|AFF1_uc003hqh.1_Missense_Mutation_p.T298M|AFF1_uc011ccy.1_Missense_Mutation_p.T298M|AFF1_uc011ccz.1_Missense_Mutation_p.T298M|AFF1_uc003hqk.3_Missense_Mutation_p.T291M|AFF1_uc011cda.1_Intron	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	291						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CAGAAGCCCACGGCTTATGTC	0.557													82	164	---	---	---	---	PASS
NHEDC2	133308	broad.mit.edu	37	4	103966046	103966046	+	Splice_Site	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103966046C>A	uc003hwx.3	-	8	1868	c.996_splice	c.e8+1	p.Q332_splice	NHEDC2_uc010iln.1_Splice_Site_p.Q184_splice|NHEDC2_uc003hwy.2_Splice_Site_p.Q332_splice|NHEDC2_uc011cew.1_Splice_Site_p.Q275_splice|NHEDC2_uc011cex.1_Splice_Site_p.Q275_splice	NM_178833	NP_849155	Q86UD5	NHDC2_HUMAN	Na+/H+ exchanger domain containing 2						sodium ion transport	integral to membrane|mitochondrial membrane	solute:hydrogen antiporter activity				0				OV - Ovarian serous cystadenocarcinoma(123;2.3e-08)		ATTTCTTTCACCTGGTCACGG	0.403													69	121	---	---	---	---	PASS
LARP7	51574	broad.mit.edu	37	4	113575316	113575316	+	Splice_Site	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113575316G>T	uc003iay.2	+	12	1946	c.1668_splice	c.e12+1	p.K556_splice	LARP7_uc003iaz.2_Splice_Site_p.K563_splice|LARP7_uc003iba.2_Splice_Site_p.K477_splice|LARP7_uc003ibb.2_Splice_Site_p.K556_splice	NM_016648	NP_057732	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7						RNA processing	nucleoplasm|ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(3)	3		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CACTGAAAAGGTAATTGATTC	0.338													35	45	---	---	---	---	PASS
FGF2	2247	broad.mit.edu	37	4	123797543	123797543	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123797543C>A	uc003iev.1	+	2	713	c.645C>A	c.(643-645)TAC>TAA	p.Y215*		NM_002006	NP_001997	P09038	FGF2_HUMAN	fibroblast growth factor 2	215					activation of MAPK activity|branching involved in ureteric bud morphogenesis|cell migration involved in sprouting angiogenesis|chemotaxis|chondroblast differentiation|embryonic morphogenesis|fibroblast growth factor receptor signaling pathway|inositol phosphate biosynthetic process|insulin receptor signaling pathway|negative regulation of blood vessel endothelial cell migration|negative regulation of cell death|organ morphogenesis|phosphatidylinositol biosynthetic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cardiac muscle cell proliferation|positive regulation of cell division|positive regulation of cell fate specification|positive regulation of ERK1 and ERK2 cascade|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of phospholipase C activity|Ras protein signal transduction|release of sequestered calcium ion into cytosol|wound healing	extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|lung(1)|central_nervous_system(1)	3					Pentosan Polysulfate(DB00686)	CTAACCGTTACCTGGCTATGA	0.383													30	60	---	---	---	---	PASS
HAND2	9464	broad.mit.edu	37	4	174448478	174448478	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174448478C>A	uc003ith.1	-	2	1542	c.604G>T	c.(604-606)GGC>TGC	p.G202C	HAND2_uc003itg.1_Missense_Mutation_p.R167M	NM_021973	NP_068808	P61296	HAND2_HUMAN	basic helix-loop-helix transcription factor	202					adult heart development|angiogenesis|apoptosis|cardiac neural crest cell development involved in outflow tract morphogenesis|heart looping|in utero embryonic development|negative regulation of cardiac muscle cell apoptosis|noradrenergic neuron differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|regulation of secondary heart field cardioblast proliferation|thymus development	nuclear chromatin|transcription factor complex	activating transcription factor binding|protein homodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|transcription coactivator activity			skin(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CCCGTCCGGCCTTTGGTTTTC	0.493													57	101	---	---	---	---	PASS
CEP72	55722	broad.mit.edu	37	5	644526	644526	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:644526A>G	uc003jbf.2	+	10	1724	c.1652A>G	c.(1651-1653)AAT>AGT	p.N551S		NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa	551	Potential.				G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GCCACGTTAAATTTGCAGATC	0.368													48	364	---	---	---	---	PASS
PAPD7	11044	broad.mit.edu	37	5	6739923	6739923	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6739923C>A	uc003jdx.1	+	4	345	c.216C>A	c.(214-216)AAC>AAA	p.N72K	PAPD7_uc011cmn.1_Missense_Mutation_p.N63K	NM_006999	NP_008930	Q5XG87	PAPD7_HUMAN	DNA polymerase sigma	72					cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1						GGAAGCACAACGTGGCTGAGC	0.587													3	118	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19838948	19838948	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19838948G>A	uc003jgc.2	-	2	525	c.148C>T	c.(148-150)CGT>TGT	p.R50C	CDH18_uc003jgd.2_Missense_Mutation_p.R50C|CDH18_uc011cnm.1_Missense_Mutation_p.R50C	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	50					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTTTGGGACGATGATGGACT	0.418													15	206	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33535093	33535093	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33535093G>T	uc003jia.1	-	23	4614	c.4451C>A	c.(4450-4452)TCC>TAC	p.S1484Y	ADAMTS12_uc010iuq.1_Missense_Mutation_p.S1399Y	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1484	TSP type-1 8.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						ACAGGAAGTGGAACACTGAAA	0.488										HNSCC(64;0.19)			26	146	---	---	---	---	PASS
DNAJC21	134218	broad.mit.edu	37	5	34949772	34949772	+	Intron	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34949772A>G	uc003jjc.2	+						DNAJC21_uc003jjb.2_Missense_Mutation_p.E437G|DNAJC21_uc010iuu.1_Intron|DNAJC21_uc003jjd.2_Intron	NM_001012339	NP_001012339	Q5F1R6	DJC21_HUMAN	DnaJ homology subfamily A member 5 isoform 2						protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding			breast(1)|skin(1)	2	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			atgttGCTTGAAAACAGACAG	0.214													29	112	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35070228	35070228	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35070228C>G	uc003jjm.2	-	7	1213	c.683G>C	c.(682-684)AGT>ACT	p.S228T	PRLR_uc003jjg.1_Missense_Mutation_p.S228T|PRLR_uc003jjh.1_Missense_Mutation_p.S228T|PRLR_uc003jji.1_Missense_Mutation_p.S157T|PRLR_uc003jjj.1_Missense_Mutation_p.S228T|PRLR_uc003jjk.1_Missense_Mutation_p.S157T|PRLR_uc003jjl.3_Missense_Mutation_p.S127T|PRLR_uc010iuw.1_Missense_Mutation_p.S157T	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	228	Extracellular (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ACGCTCACCACTAGGTATCTG	0.413													30	114	---	---	---	---	PASS
WDR70	55100	broad.mit.edu	37	5	37438017	37438017	+	Intron	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37438017G>T	uc003jkv.2	+						WDR70_uc010iva.1_Intron	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70											ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGGTTTTCTTGTTTCAGAATC	0.338													61	60	---	---	---	---	PASS
FYB	2533	broad.mit.edu	37	5	39138759	39138759	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39138759A>T	uc003jls.2	-	5	1461	c.1394T>A	c.(1393-1395)ATA>AAA	p.I465K	FYB_uc003jlt.2_Missense_Mutation_p.I465K|FYB_uc003jlu.2_Missense_Mutation_p.I465K|FYB_uc011cpl.1_Missense_Mutation_p.I475K	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	465	SH2-binding (Potential).|Potential.				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			TAATTCATACATGTCTTCATA	0.289													7	52	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40981579	40981579	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40981579G>A	uc003jmh.2	+	18	2550	c.2436G>A	c.(2434-2436)GAG>GAA	p.E812E		NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	812	Complement control factor I module 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				ACGGCAAGGAGCAGACGATGT	0.547													26	38	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41033217	41033217	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41033217C>A	uc003jmj.3	-	23	2777	c.2287G>T	c.(2287-2289)GGC>TGC	p.G763C	HEATR7B2_uc003jmi.3_Missense_Mutation_p.G318C	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	763							binding			ovary(6)|central_nervous_system(2)	8						ACAGCAATGCCAATCTCAGTG	0.448													29	108	---	---	---	---	PASS
FOXD1	2297	broad.mit.edu	37	5	72743694	72743694	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72743694T>C	uc003kcp.2	-	1	659	c.494A>G	c.(493-495)AAG>AGG	p.K165R		NM_004472	NP_004463	Q16676	FOXD1_HUMAN	forkhead box D1	165	Fork-head.				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|metanephric capsule specification|negative regulation of transcription, DNA-dependent|neural crest cell migration|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		Lung NSC(167;0.00327)|Ovarian(174;0.0175)|Prostate(461;0.151)		OV - Ovarian serous cystadenocarcinoma(47;1.07e-54)		GGCGGGGAACTTCTCCCGGTA	0.627													35	35	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112903001	112903001	+	Intron	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112903001G>A	uc003kqn.2	+							NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		AAAGGTAAAAGATTTTGAATG	0.368													17	48	---	---	---	---	PASS
KLHL3	26249	broad.mit.edu	37	5	136963999	136963999	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136963999G>A	uc010jek.2	-	13	2022	c.1578C>T	c.(1576-1578)TGC>TGT	p.C526C	KLHL3_uc011cyc.1_Silent_p.C261C|KLHL3_uc003lbr.3_Silent_p.C444C|KLHL3_uc011cyd.1_RNA	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3	526	Kelch 5.					cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		CGTTGCGCCGGCACATGTTCA	0.537													4	210	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140736757	140736757	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140736757G>T	uc003ljq.1	+	1	1990	c.1990G>T	c.(1990-1992)GTG>TTG	p.V664L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGB2_uc003ljs.1_5'Flank|PCDHGA4_uc003ljp.1_Missense_Mutation_p.V664L|PCDHGB2_uc011dar.1_5'Flank	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	664	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACTGTGGCTGTGGCCGACAG	0.632													13	22	---	---	---	---	PASS
HK3	3101	broad.mit.edu	37	5	176316651	176316651	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176316651A>G	uc003mfa.2	-	7	817	c.725T>C	c.(724-726)GTT>GCT	p.V242A	HK3_uc003mez.2_5'Flank	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	242	Regulatory.				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCACCTACAACTAGCCCAAC	0.592													42	52	---	---	---	---	PASS
DCDC2	51473	broad.mit.edu	37	6	24178600	24178600	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24178600G>T	uc003ndx.2	-	9	1586	c.1284C>A	c.(1282-1284)GAC>GAA	p.D428E	DCDC2_uc003ndy.2_Missense_Mutation_p.D428E|DCDC2_uc003ndw.2_Missense_Mutation_p.D179E	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	428					cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				TTCTTTCCTTGTCTAGGACCA	0.473													75	372	---	---	---	---	PASS
HIST1H2AM	8336	broad.mit.edu	37	6	27860917	27860917	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27860917C>A	uc003nkb.1	-	1	47	c.11G>T	c.(10-12)CGT>CTT	p.R4L	HIST1H3J_uc003nka.2_5'Flank|HIST1H2BO_uc003nkc.1_5'Flank	NM_003514	NP_003505	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	4					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding			ovary(2)	2						CTGCTTGCCACGTCCAGACAT	0.572													13	68	---	---	---	---	PASS
OR2B3	442184	broad.mit.edu	37	6	29054979	29054979	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29054979C>A	uc003nlx.2	-	1	112	c.47G>T	c.(46-48)GGC>GTC	p.G16V		NM_001005226	NP_001005226			olfactory receptor, family 2, subfamily B,											skin(1)	1						ATCTGAGAAGCCAAGTAGTAT	0.393													30	77	---	---	---	---	PASS
SYNGAP1	8831	broad.mit.edu	37	6	33393613	33393613	+	Silent	SNP	C	T	T	rs147049139		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33393613C>T	uc011dri.1	+	3	423	c.228C>T	c.(226-228)TCC>TCT	p.S76S	SYNGAP1_uc003oeo.1_Silent_p.S61S|SYNGAP1_uc010juy.2_Silent_p.S61S	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	76					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						GGAGCGAGTCCAGTCGCAACA	0.687													3	31	---	---	---	---	PASS
ANKS1A	23294	broad.mit.edu	37	6	34985290	34985290	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34985290G>T	uc003ojx.3	+	11	1606	c.1464G>T	c.(1462-1464)GCG>GCT	p.A488A	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Silent_p.A28A|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	488						cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						AGGACTCTGCGGAGGGGCAGG	0.592													3	60	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38796023	38796023	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38796023G>T	uc003ooe.1	+	28	4096	c.3496G>T	c.(3496-3498)GAT>TAT	p.D1166Y		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AGAAGCAGTTGATACCTTAAG	0.328													66	83	---	---	---	---	PASS
TBCC	6903	broad.mit.edu	37	6	42712981	42712981	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42712981G>A	uc003osl.2	-	1	904	c.831C>T	c.(829-831)AGC>AGT	p.S277S		NM_003192	NP_003183	Q15814	TBCC_HUMAN	beta-tubulin cofactor C	277	C-CAP/cofactor C-like.				'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|photoreceptor connecting cilium	chaperone binding|GTPase activity				0	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			CGATGGCCCTGCTGGTCACCT	0.577													60	86	---	---	---	---	PASS
IL17F	112744	broad.mit.edu	37	6	52109205	52109205	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52109205C>T	uc003pam.1	-	1	94	c.23G>A	c.(22-24)GGC>GAC	p.G8D		NM_052872	NP_443104	Q96PD4	IL17F_HUMAN	interleukin 17F precursor	8					cartilage development|inflammatory response|lymphotoxin A biosynthetic process|negative regulation of angiogenesis|proteoglycan metabolic process|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|regulation of interleukin-2 biosynthetic process|regulation of interleukin-6 biosynthetic process|regulation of interleukin-8 biosynthetic process|regulation of transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|cytokine binding|protein homodimerization activity			ovary(1)	1	Lung NSC(77;0.116)					CATGGCTGGGCCATGCAGGGT	0.453													56	92	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57512471	57512471	+	Splice_Site	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512471G>T	uc003pdx.2	+	15	1387	c.1300_splice	c.e15-1	p.V434_splice		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTCCTTTACAGGTGGGTGATT	0.318													17	150	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75818736	75818736	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75818736C>A	uc003phs.2	-	52	8264	c.8098G>T	c.(8098-8100)GCA>TCA	p.A2700S	COL12A1_uc003pht.2_Missense_Mutation_p.A1536S	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2700	TSP N-terminal.|Nonhelical region (NC3).				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTACTCACTGCGGCTGATTTC	0.313													67	101	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79707136	79707136	+	Silent	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79707136T>A	uc003pir.2	-	19	2422	c.2196A>T	c.(2194-2196)GTA>GTT	p.V732V	PHIP_uc011dyp.1_Silent_p.V732V	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	732					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CTTACCTGGCTACACCAGCTG	0.463													40	118	---	---	---	---	PASS
FAM26D	221301	broad.mit.edu	37	6	116879179	116879179	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116879179G>T	uc003pxa.2	+	4	620	c.321G>T	c.(319-321)AAG>AAT	p.K107N	FAM26D_uc003pwz.2_Missense_Mutation_p.K64N|FAM26D_uc010ked.2_Missense_Mutation_p.K106N	NM_153036	NP_694581	Q5JW98	FA26D_HUMAN	hypothetical protein LOC221301	250						integral to membrane					0		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		GCATAAAGAAGCTATTTGGCT	0.473													47	144	---	---	---	---	PASS
HSF2	3298	broad.mit.edu	37	6	122720903	122720903	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122720903G>T	uc003pyu.2	+	1	208	c.21G>T	c.(19-21)GTG>GTT	p.V7V	HSF2_uc003pyt.3_Silent_p.V7V|HSF2_uc003pyv.2_Silent_p.V7V	NM_004506	NP_004497	Q03933	HSF2_HUMAN	heat shock transcription factor 2 isoform a	7	By similarity.				response to stress|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		GTTCGAACGTGCCGGCTTTCC	0.607													16	61	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123332277	123332277	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123332277G>C	uc003pzi.1	+	3	1406	c.537G>C	c.(535-537)ATG>ATC	p.M179I		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	179	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CACCAAGTATGCTGCGATTAG	0.403													52	120	---	---	---	---	PASS
MED23	9439	broad.mit.edu	37	6	131923346	131923346	+	Intron	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131923346T>C	uc003qcs.1	-						MED23_uc003qcq.2_Intron|MED23_uc011eca.1_Intron|MED23_uc003qct.1_Intron	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		TGTAGTCACATATTCACCGTA	0.358													35	121	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152560737	152560737	+	Silent	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152560737C>G	uc010kiw.2	-	108	20600	c.19998G>C	c.(19996-19998)CTG>CTC	p.L6666L	SYNE1_uc010kiv.2_Silent_p.L1190L|SYNE1_uc003qos.3_Silent_p.L1190L|SYNE1_uc003qot.3_Silent_p.L6595L|SYNE1_uc003qou.3_Silent_p.L6666L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6666	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGAGCCATCAGCTCTGTAT	0.463										HNSCC(10;0.0054)			46	133	---	---	---	---	PASS
RPS6KA2	6196	broad.mit.edu	37	6	166864710	166864710	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166864710C>T	uc003qvb.1	-	13	1306	c.1087G>A	c.(1087-1089)GTC>ATC	p.V363I	RPS6KA2_uc011ego.1_Missense_Mutation_p.V274I|RPS6KA2_uc010kkl.1_Missense_Mutation_p.V274I|RPS6KA2_uc003qvc.1_Missense_Mutation_p.V371I|RPS6KA2_uc003qvd.1_Missense_Mutation_p.V388I	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	363	AGC-kinase C-terminal.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CTCGGGGGGACGCCAGGAGAG	0.493													6	190	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169648983	169648983	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169648983G>T	uc003qwt.2	-	4	386	c.138C>A	c.(136-138)CGC>CGA	p.R46R		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	46	TSP N-terminal.|Heparin-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GGTCGGGCCCGCGGAACTGCT	0.587													28	37	---	---	---	---	PASS
UNCX	340260	broad.mit.edu	37	7	1273220	1273220	+	Silent	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1273220C>A	uc011jvw.1	+	2	339	c.339C>A	c.(337-339)ACC>ACA	p.T113T		NM_001080461	NP_001073930	A6NJT0	UNC4_HUMAN	UNC homeobox	113	Homeobox.				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CCAACTTCACCGGCTGGCAGC	0.687													22	11	---	---	---	---	PASS
CHN2	1124	broad.mit.edu	37	7	29407588	29407588	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29407588C>G	uc003szz.2	+	3	566	c.129C>G	c.(127-129)ATC>ATG	p.I43M	CHN2_uc011jzs.1_Missense_Mutation_p.I118M|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_RNA|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Missense_Mutation_p.I56M|CHN2_uc010kvd.2_Missense_Mutation_p.I43M|CHN2_uc011jzu.1_Missense_Mutation_p.I28M	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2	43					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						CCAAGAGAATCATTTGTCCTC	0.403													74	72	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48313492	48313492	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48313492C>A	uc003toq.2	+	17	4254	c.4229C>A	c.(4228-4230)TCC>TAC	p.S1410Y	ABCA13_uc010kyr.2_Missense_Mutation_p.S913Y	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	1410					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TTGTCTAACTCCAGTTTTTCA	0.308													6	54	---	---	---	---	PASS
C7orf42	55069	broad.mit.edu	37	7	66406997	66406997	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66406997C>T	uc003tvk.2	+	2	409	c.145C>T	c.(145-147)CCA>TCA	p.P49S	C7orf42_uc010lah.2_RNA|C7orf42_uc003tvl.2_Missense_Mutation_p.P49S	NM_017994	NP_060464	Q9NWD8	CG042_HUMAN	hypothetical protein LOC55069	49						integral to membrane				ovary(1)	1						GATTAAATCCCCAGAAATGGC	0.537													26	159	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72413685	72413685	+	Silent	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72413685C>G	uc003twk.2	+	11	3153	c.3153C>G	c.(3151-3153)GCC>GCG	p.A1051A	POM121_uc003twj.2_Silent_p.A786A|POM121_uc010lam.1_Silent_p.A786A	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	1051	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				GCGCTCCCGCCAGCTCACAGC	0.662													8	71	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	78119141	78119141	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78119141T>C	uc003ugx.2	-	6	1236	c.982A>G	c.(982-984)ACA>GCA	p.T328A	MAGI2_uc003ugy.2_Missense_Mutation_p.T328A|MAGI2_uc010ldx.1_5'UTR|MAGI2_uc010ldy.1_5'UTR|MAGI2_uc011kgr.1_Missense_Mutation_p.T160A|MAGI2_uc011kgs.1_Missense_Mutation_p.T165A	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	328	WW 1.|Interaction with DDN.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGCCATGATGTTGTCTTTGTG	0.368													114	233	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81381445	81381445	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81381445A>G	uc003uhl.2	-	5	781	c.616T>C	c.(616-618)TGT>CGT	p.C206R	HGF_uc003uhm.2_Missense_Mutation_p.C201R|HGF_uc003uhn.1_Missense_Mutation_p.C206R|HGF_uc003uho.1_Missense_Mutation_p.C201R|HGF_uc003uhp.2_Missense_Mutation_p.C206R	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	206	Kringle 1.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						CCTTCTGAACACTGAGGAATG	0.453													26	77	---	---	---	---	PASS
SAMD9	54809	broad.mit.edu	37	7	92731286	92731286	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92731286T>A	uc003umf.2	-	3	4381	c.4125A>T	c.(4123-4125)CAA>CAT	p.Q1375H	SAMD9_uc003umg.2_Missense_Mutation_p.Q1375H	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1375						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TGACAGTGCATTGTTCTAAGA	0.358													60	226	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94047117	94047117	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94047117G>A	uc003ung.1	+	32	2416	c.1945G>A	c.(1945-1947)GGC>AGC	p.G649S	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_RNA	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	649					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGGTGCTGCTGGCATACCTGG	0.517										HNSCC(75;0.22)			9	12	---	---	---	---	PASS
ACTL6B	51412	broad.mit.edu	37	7	100246273	100246273	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100246273G>A	uc003uvy.2	-	7	682	c.575C>T	c.(574-576)TCC>TTC	p.S192F	ACTL6B_uc003uvx.1_5'UTR|ACTL6B_uc003uvz.2_RNA	NM_016188	NP_057272	O94805	ACL6B_HUMAN	actin-like 6B	192					chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex|SWI/SNF complex	ATP binding|protein binding|structural constituent of cytoskeleton			ovary(1)	1	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TGCCAGAGGGGACTTGACGAT	0.612													7	41	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100551236	100551236	+	RNA	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100551236T>A	uc003uxk.1	+	1		c.487T>A			uc003uxl.1_5'UTR					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		ACTCCCAGCCTCAGTTCTTCA	0.507													67	134	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100675095	100675095	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100675095C>G	uc003uxp.1	+	3	451	c.398C>G	c.(397-399)ACT>AGT	p.T133S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	133	Extracellular (Potential).|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CCCAGTTCTACTGAAGACACT	0.473													67	158	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100682506	100682506	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100682506A>G	uc003uxp.1	+	3	7862	c.7809A>G	c.(7807-7809)ATA>ATG	p.I2603M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2603	Extracellular (Potential).|59 X approximate tandem repeats.|42.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ACACCAGCATACCTGTCACCA	0.453													81	431	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107790506	107790506	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107790506A>G	uc003vfb.2	-	33	4235	c.3764T>C	c.(3763-3765)CTA>CCA	p.L1255P	NRCAM_uc003vfc.2_Missense_Mutation_p.L1134P|NRCAM_uc011kmk.1_Missense_Mutation_p.L1157P|NRCAM_uc003vfd.2_Missense_Mutation_p.L1138P|NRCAM_uc003vfe.2_Missense_Mutation_p.L1126P|NRCAM_uc003vez.2_Missense_Mutation_p.L38P|NRCAM_uc003vfa.2_Missense_Mutation_p.L99P|NRCAM_uc011kmj.1_Missense_Mutation_p.L101P	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	1255	Cytoplasmic (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						ATAGTCAACTAGGCTGTCGTC	0.443													112	267	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122033627	122033627	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122033627C>A	uc010lkp.2	-	20	2919	c.2756G>T	c.(2755-2757)TGT>TTT	p.C919F	CADPS2_uc011knx.1_Missense_Mutation_p.C294F|CADPS2_uc003vkg.3_Missense_Mutation_p.C613F|CADPS2_uc010lkq.2_Missense_Mutation_p.C913F	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	919	Interaction with DRD2.|MHD1.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TTTTCCATTACACAAAAGTGC	0.403													20	77	---	---	---	---	PASS
RNF148	378925	broad.mit.edu	37	7	122341945	122341945	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122341945G>C	uc003vkk.1	-	1	1077	c.860C>G	c.(859-861)CCC>CGC	p.P287R	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron|RNF133_uc003vkj.1_5'Flank|RNF148_uc010lkr.1_3'UTR	NM_198085	NP_932351	Q8N7C7	RN148_HUMAN	ring finger protein 148 precursor	287	RING-type; atypical.					integral to membrane	zinc ion binding				0						TAAAAGCCAGGGGTCAATGCA	0.393													62	112	---	---	---	---	PASS
ZC3HAV1L	92092	broad.mit.edu	37	7	138711516	138711516	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138711516C>A	uc003vum.1	-	4	836	c.824G>T	c.(823-825)GGA>GTA	p.G275V		NM_080660	NP_542391	Q96H79	ZCCHL_HUMAN	zinc finger CCCH-type, antiviral 1-like	275											0						TTCTGCAGCTCCAGCTGCGTG	0.507													33	121	---	---	---	---	PASS
TTC26	79989	broad.mit.edu	37	7	138822649	138822649	+	Silent	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138822649T>C	uc003vus.2	+	3	312	c.198T>C	c.(196-198)TGT>TGC	p.C66C	TTC26_uc003vuq.2_Silent_p.C66C|TTC26_uc011kqm.1_Silent_p.C66C|TTC26_uc003vur.3_Silent_p.C66C|TTC26_uc011kqn.1_Silent_p.C66C|TTC26_uc011kqo.1_Intron|TTC26_uc011kqp.1_5'UTR|TTC26_uc003vut.2_5'UTR|TTC26_uc011kqq.1_Silent_p.C66C	NM_024926	NP_079202	A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26 isoform 1	66	TPR 1.						binding			ovary(1)	1						TTGGATATTGTGCCTTTCACC	0.299													39	150	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142606744	142606744	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142606744T>A	uc003wby.1	-	14	2071	c.1807A>T	c.(1807-1809)ATG>TTG	p.M603L		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	603	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					CGCTCCAGCATCACTGTGGTG	0.597													12	40	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147675073	147675073	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147675073A>G	uc003weu.1	+	15	2891	c.2375A>G	c.(2374-2376)CAA>CGA	p.Q792R		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	792	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CTGCGCTGCCAAGGAGACAGT	0.473										HNSCC(39;0.1)			43	81	---	---	---	---	PASS
CUL1	8454	broad.mit.edu	37	7	148485762	148485762	+	Silent	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148485762A>G	uc010lpg.2	+	14	2119	c.1593A>G	c.(1591-1593)CTA>CTG	p.L531L	CUL1_uc003wey.2_Silent_p.L531L|CUL1_uc003wez.2_Silent_p.L421L|CUL1_uc003wfa.2_Silent_p.L192L	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	531					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAGAACCCCTAGACTGTGAGT	0.428													26	163	---	---	---	---	PASS
ZNF398	57541	broad.mit.edu	37	7	148876570	148876570	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148876570G>C	uc003wfl.2	+	6	1881	c.1606G>C	c.(1606-1608)GAG>CAG	p.E536Q	ZNF398_uc011kul.1_Missense_Mutation_p.E365Q|ZNF398_uc011kum.1_Missense_Mutation_p.E541Q	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform a	536					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			GCACACAGGCGAGCGGCCCTT	0.612													18	40	---	---	---	---	PASS
GIMAP8	155038	broad.mit.edu	37	7	150164377	150164377	+	Silent	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150164377A>T	uc003whj.2	+	2	921	c.591A>T	c.(589-591)GGA>GGT	p.G197G		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	197						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		ATACGAACGGAGGACCCTATC	0.418													57	127	---	---	---	---	PASS
GIMAP2	26157	broad.mit.edu	37	7	150389846	150389846	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150389846G>C	uc003who.2	+	3	560	c.472G>C	c.(472-474)GAT>CAT	p.D158H	GIMAP1_uc003whp.2_Intron	NM_015660	NP_056475	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	158						integral to membrane	GTP binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCCCTGATGGATTACATGCA	0.512													26	66	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150556022	150556022	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150556022G>T	uc003why.1	+	4	5960	c.1742G>T	c.(1741-1743)AGC>ATC	p.S581I	ABP1_uc003whz.1_Missense_Mutation_p.S581I|ABP1_uc003wia.1_Missense_Mutation_p.S581I	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	581					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	CTCTTTACCAGCCCCCAGGAG	0.657													6	13	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154263965	154263965	+	Silent	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154263965T>C	uc003wlk.2	+	5	720	c.591T>C	c.(589-591)GAT>GAC	p.D197D	DPP6_uc003wli.2_Silent_p.D133D|DPP6_uc003wlj.2_Silent_p.D197D|DPP6_uc003wlm.2_Silent_p.D135D|DPP6_uc011kvq.1_Silent_p.D135D	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	197	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TATCTCCAGATAGAGAGTATG	0.284													17	61	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158449109	158449109	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158449109T>A	uc003wnv.1	-	19	2376	c.2231A>T	c.(2230-2232)AAA>ATA	p.K744I	NCAPG2_uc010lqu.1_Missense_Mutation_p.K536I|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Missense_Mutation_p.K744I|NCAPG2_uc011kwe.1_Missense_Mutation_p.K744I|NCAPG2_uc011kwc.1_Missense_Mutation_p.K245I|NCAPG2_uc011kwd.1_Missense_Mutation_p.K187I	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	744					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CACCCTACCTTTAGAAGCTGT	0.433													30	157	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3008986	3008986	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3008986G>T	uc011kwk.1	-	40	6357	c.5967C>A	c.(5965-5967)CCC>CCA	p.P1989P	CSMD1_uc011kwj.1_Silent_p.P1381P|CSMD1_uc003wqe.2_Silent_p.P1145P|CSMD1_uc010lrg.2_Silent_p.P57P	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1989	Extracellular (Potential).|CUB 12.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTGGGAAGCCGGGGCTCAGGA	0.512													5	20	---	---	---	---	PASS
ADAM7	8756	broad.mit.edu	37	8	24342779	24342779	+	Intron	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24342779C>A	uc003xeb.2	+						ADAM7_uc003xec.2_Intron	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		ATTTTTGCATCTTTTTCATAG	0.403													63	97	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25744281	25744281	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25744281G>A	uc003xes.1	-	10	1016	c.999C>T	c.(997-999)TTC>TTT	p.F333F	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	333	IPT/TIG.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		CTGTGTAAATGAACCTTCCTG	0.478													47	64	---	---	---	---	PASS
STAR	6770	broad.mit.edu	37	8	38008285	38008285	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38008285G>A	uc003xkv.1	-	1	316	c.52C>T	c.(52-54)CGC>TGC	p.R18C	STAR_uc010lwc.1_Missense_Mutation_p.R18C	NM_001007243	NP_001007244	P49675	STAR_HUMAN	steroidogenic acute regulatory protein isoform	18					C21-steroid hormone biosynthetic process	mitochondrial intermembrane space	cholesterol transporter activity			ovary(1)	1	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		TTCATGTTGCGCATGTGTCTG	0.418													4	127	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48719888	48719888	+	Splice_Site	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48719888C>T	uc003xqi.2	-	70	9615	c.9558_splice	c.e70-1	p.R3186_splice	PRKDC_uc003xqj.2_Splice_Site_p.R3186_splice|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				AAAGAAACATCTACACAAAGA	0.383								NHEJ					63	122	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77620259	77620259	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77620259C>T	uc003yav.2	+	3	3378	c.2991C>T	c.(2989-2991)CAC>CAT	p.H997H	ZFHX4_uc003yat.1_Silent_p.H997H|ZFHX4_uc003yau.1_Silent_p.H1023H|ZFHX4_uc003yaw.1_Silent_p.H997H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	997						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCACAGGCACGAGGCGGCCC	0.468										HNSCC(33;0.089)			20	120	---	---	---	---	PASS
FABP5	2171	broad.mit.edu	37	8	82196169	82196169	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82196169G>T	uc003yca.1	+	3	362	c.314G>T	c.(313-315)AGC>ATC	p.S105I		NM_001444	NP_001435	Q01469	FABP5_HUMAN	fatty acid binding protein 5	105					epidermis development	cytoplasm	fatty acid binding|protein binding|transporter activity				0	Lung NSC(7;3.57e-05)|all_lung(9;0.00011)		Epithelial(68;0.102)			GGGAAGGAAAGCACAATAACA	0.398													7	37	---	---	---	---	PASS
PDP1	54704	broad.mit.edu	37	8	94934294	94934294	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94934294G>T	uc003yge.2	+	2	276	c.7G>T	c.(7-9)GCA>TCA	p.A3S	PDP1_uc003ygf.2_Missense_Mutation_p.A28S|PDP1_uc010max.2_Missense_Mutation_p.A28S|PDP1_uc011lgm.1_Missense_Mutation_p.A3S|PDP1_uc011lgn.1_Missense_Mutation_p.A62S	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic	3					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						TGCCATGCCAGCACCAACTCA	0.458													20	124	---	---	---	---	PASS
RAD54B	25788	broad.mit.edu	37	8	95412502	95412502	+	Silent	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95412502T>C	uc003ygk.2	-	7	1232	c.1134A>G	c.(1132-1134)CTA>CTG	p.L378L	RAD54B_uc010may.1_Silent_p.L185L|RAD54B_uc003ygl.1_RNA	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:Variant_position_missing_in_O95073_after_alignment					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TTTCACTTCCTAGCCATTTTT	0.338								Direct_reversal_of_damage|Homologous_recombination					34	104	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104928746	104928746	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104928746G>T	uc003yls.2	+	6	1592	c.1351G>T	c.(1351-1353)GTA>TTA	p.V451L	RIMS2_uc003ylp.2_Missense_Mutation_p.V673L|RIMS2_uc003ylw.2_Missense_Mutation_p.V481L|RIMS2_uc003ylq.2_Missense_Mutation_p.V481L|RIMS2_uc003ylr.2_Missense_Mutation_p.V528L|RIMS2_uc003ylt.2_Missense_Mutation_p.V74L|RIMS2_uc003ylu.1_Missense_Mutation_p.V64L|RIMS2_uc003ylv.1_Missense_Mutation_p.V64L	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	751	PDZ.				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGTAGAACTTGTAGTTTCAAG	0.348										HNSCC(12;0.0054)			6	151	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110447466	110447466	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110447466C>G	uc003yne.2	+	29	3492	c.3388C>G	c.(3388-3390)CCC>GCC	p.P1130A		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1130	Extracellular (Potential).|IPT/TIG 4.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGGACATGCCCCCGTTGCTGT	0.413										HNSCC(38;0.096)			86	208	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113293397	113293397	+	Intron	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113293397A>G	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTGAGAATATACTTACTTGTA	0.313										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			43	86	---	---	---	---	PASS
NOV	4856	broad.mit.edu	37	8	120431546	120431546	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120431546G>A	uc003yoq.2	+	4	959	c.738G>A	c.(736-738)GTG>GTA	p.V246V		NM_002514	NP_002505	P48745	NOV_HUMAN	nephroblastoma overexpressed precursor	246	TSP type-1.				regulation of cell growth		growth factor activity|insulin-like growth factor binding			ovary(2)|skin(2)|kidney(1)	5	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TCTGCATGGTGCGGCCCTGTG	0.562													18	164	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131812707	131812707	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131812707G>A	uc003ytd.3	-	15	3281	c.3025C>T	c.(3025-3027)CGC>TGC	p.R1009C	ADCY8_uc010mds.2_Missense_Mutation_p.R878C	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1009	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TTGAGCAAGCGCAGGCATTCC	0.443										HNSCC(32;0.087)			119	328	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131826349	131826349	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131826349G>A	uc003ytd.3	-	14	3135	c.2879C>T	c.(2878-2880)GCC>GTC	p.A960V	ADCY8_uc010mds.2_Missense_Mutation_p.A829V	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	960	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GAAATGGCGGGCCACATGGCT	0.522										HNSCC(32;0.087)			30	96	---	---	---	---	PASS
WISP1	8840	broad.mit.edu	37	8	134232918	134232918	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134232918C>A	uc003yub.2	+	3	520	c.444C>A	c.(442-444)GAC>GAA	p.D148E	WISP1_uc003yuc.2_Intron|WISP1_uc010meb.2_Intron|WISP1_uc010mec.2_Intron|WISP1_uc010med.2_Intron|WISP1_uc003yud.2_Intron	NM_003882	NP_003873	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	148	VWFC.				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CGTGCATCGACGGCGCGGTGG	0.667													28	135	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164260	139164260	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164260C>T	uc003yuy.2	-	13	2629	c.2458G>A	c.(2458-2460)GGA>AGA	p.G820R	FAM135B_uc003yux.2_Missense_Mutation_p.G721R|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.G382R|FAM135B_uc003yvb.2_Missense_Mutation_p.G382R	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	820										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCATCTGTTCCAGAGTCACCA	0.517										HNSCC(54;0.14)			54	121	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139209863	139209863	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139209863C>A	uc003yuy.2	-	8	890	c.719G>T	c.(718-720)TGG>TTG	p.W240L	FAM135B_uc003yux.2_Missense_Mutation_p.W141L|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	240										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTCTCGGTGCCACTTGTGTGC	0.577										HNSCC(54;0.14)			29	114	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139890011	139890011	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139890011G>C	uc003yvd.2	-	3	1087	c.640C>G	c.(640-642)CGG>GGG	p.R214G		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	214					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGACGGCGCCGCAGCTTGCCC	0.652										HNSCC(7;0.00092)			15	56	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141799601	141799601	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141799601G>T	uc003yvu.2	-	14	1379	c.1149C>A	c.(1147-1149)GGC>GGA	p.G383G	PTK2_uc011ljq.1_Silent_p.G44G|PTK2_uc003yvp.2_Silent_p.G44G|PTK2_uc003yvq.2_5'UTR|PTK2_uc003yvr.2_Silent_p.G282G|PTK2_uc003yvs.2_Silent_p.G383G|PTK2_uc003yvt.2_Silent_p.G405G|PTK2_uc003yvv.2_Silent_p.G270G|PTK2_uc011ljr.1_Silent_p.G383G	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	383					axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			GTGTCCGCATGCCTTGCTTTT	0.527													133	475	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145657681	145657681	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145657681C>A	uc011llg.1	-	23	3737	c.3722G>T	c.(3721-3723)CGA>CTA	p.R1241L	uc011llh.1_5'Flank	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	1241					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GGCCAGGTATCGGAATACAGG	0.622													64	203	---	---	---	---	PASS
JAK2	3717	broad.mit.edu	37	9	5090820	5090820	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5090820G>C	uc010mhm.2	+	21	3081	c.2968G>C	c.(2968-2970)GTT>CTT	p.V990L	JAK2_uc003ziw.2_Missense_Mutation_p.V990L	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	990	Protein kinase 2.				actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		CGAGAACAGAGTTAAAATTGG	0.363		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				666	158	---	---	---	---	PASS
IFNA13	3447	broad.mit.edu	37	9	21367977	21367977	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21367977G>T	uc003zpa.2	-	1	99	c.33C>A	c.(31-33)GCC>GCA	p.A11A		NM_006900	NP_008831	P01562	IFNA1_HUMAN	interferon, alpha 13 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding			ovary(1)	1				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GCACCACCAGGGCCATCAGTA	0.542													40	99	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32631709	32631709	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32631709C>A	uc003zrg.1	-	1	3959	c.3869G>T	c.(3868-3870)GGA>GTA	p.G1290V	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1290					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CCTCATATGTCCAATGGCACC	0.468													98	188	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32631710	32631710	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32631710C>A	uc003zrg.1	-	1	3958	c.3868G>T	c.(3868-3870)GGA>TGA	p.G1290*	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1290					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTCATATGTCCAATGGCACCA	0.473													95	191	---	---	---	---	PASS
SUSD3	203328	broad.mit.edu	37	9	95846984	95846984	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95846984G>T	uc004atb.2	+	5	759	c.723G>T	c.(721-723)CTG>CTT	p.L241L	SUSD3_uc004atc.2_Silent_p.L228L	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN	sushi domain containing 3	241	Cytoplasmic (Potential).					integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6						CCTCTGGGCTGGCCACAGGAA	0.647													23	66	---	---	---	---	PASS
CYLC2	1539	broad.mit.edu	37	9	105767756	105767756	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105767756C>G	uc004bbs.2	+	5	913	c.843C>G	c.(841-843)GAC>GAG	p.D281E		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	281	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				GTAGTACAGACAGTGACTCAA	0.254													15	28	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	118969826	118969826	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118969826G>C	uc004bjn.2	+	3	1951	c.1570G>C	c.(1570-1572)GAG>CAG	p.E524Q	PAPPA_uc011lxp.1_Missense_Mutation_p.E317Q|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	524	Metalloprotease.				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						CTCAGAGGAGGAGTTGGCAGG	0.443													35	66	---	---	---	---	PASS
GOLGA1	2800	broad.mit.edu	37	9	127652688	127652688	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127652688T>C	uc004bpc.2	-	16	1819	c.1477A>G	c.(1477-1479)AGG>GGG	p.R493G	GOLGA1_uc010mws.2_RNA	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97	493	Potential.|Gln-rich.					Golgi cisterna membrane				ovary(1)	1						AACTCTTCCCTTTGCTTCCGC	0.577													62	80	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135140176	135140176	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135140176A>G	uc004cbk.2	-	26	7667	c.7484T>C	c.(7483-7485)CTA>CCA	p.L2495P	SETX_uc004cbj.2_Missense_Mutation_p.L2143P|SETX_uc010mzt.2_Missense_Mutation_p.L2081P	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	2495					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TCCACTGTCTAGCTTGCTGCT	0.507													96	135	---	---	---	---	PASS
GFI1B	8328	broad.mit.edu	37	9	135863681	135863681	+	Silent	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135863681C>A	uc004ccg.2	+	4	487	c.336C>A	c.(334-336)GCC>GCA	p.A112A	GFI1B_uc010mzy.2_Silent_p.A112A	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	112	Interaction with ARIH2.				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		ACACCTTGGCCACAACCTATG	0.627													28	55	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136582496	136582496	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136582496C>G	uc004cep.3	-	8	1236	c.1102G>C	c.(1102-1104)GTC>CTC	p.V368L	SARDH_uc004ceo.2_Missense_Mutation_p.V368L|SARDH_uc011mdn.1_Missense_Mutation_p.V368L|SARDH_uc011mdo.1_Missense_Mutation_p.V200L	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	368					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		AGCACGGGGACCCTGTTGATG	0.612													35	59	---	---	---	---	PASS
C10orf128	170371	broad.mit.edu	37	10	50374902	50374902	+	Intron	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50374902C>T	uc001jhn.3	-						C10orf128_uc001jhl.3_RNA|C10orf128_uc001jhm.3_Intron|C10orf128_uc010qgo.1_Intron|C10orf128_uc001jho.3_Intron	NM_001010863	NP_001010863	Q5T292	CJ128_HUMAN	hypothetical protein LOC170371 precursor							integral to membrane				lung(1)	1						GCCCGAGCACCACATCCCTCA	0.607													46	70	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55913039	55913039	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55913039G>A	uc001jju.1	-	14	2000	c.1605C>T	c.(1603-1605)GAC>GAT	p.D535D	PCDH15_uc010qhq.1_Silent_p.D540D|PCDH15_uc010qhr.1_Silent_p.D535D|PCDH15_uc010qhs.1_Silent_p.D547D|PCDH15_uc010qht.1_Silent_p.D542D|PCDH15_uc010qhu.1_Silent_p.D535D|PCDH15_uc001jjv.1_Silent_p.D513D|PCDH15_uc010qhv.1_Silent_p.D535D|PCDH15_uc010qhw.1_Silent_p.D498D|PCDH15_uc010qhx.1_Silent_p.D535D|PCDH15_uc010qhy.1_Silent_p.D540D|PCDH15_uc010qhz.1_Silent_p.D535D|PCDH15_uc010qia.1_Silent_p.D513D|PCDH15_uc010qib.1_Silent_p.D513D|PCDH15_uc001jjw.2_Silent_p.D535D	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	535	Cadherin 5.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTCGTCTGCGTCGACTGCAG	0.453										HNSCC(58;0.16)			55	88	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69934038	69934038	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69934038C>A	uc001jnm.3	+	12	2374	c.2189C>A	c.(2188-2190)ACG>AAG	p.T730K	MYPN_uc001jnn.3_Missense_Mutation_p.T455K|MYPN_uc001jno.3_Missense_Mutation_p.T730K|MYPN_uc009xpt.2_Missense_Mutation_p.T730K|MYPN_uc010qit.1_Missense_Mutation_p.T436K|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	730						nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						TTCCCCTCCACGAACACCACC	0.552													88	205	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71697382	71697382	+	Intron	SNP	T	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71697382T>G	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	CCCTCTCCCTTTCCTCCAGGG	0.547													12	53	---	---	---	---	PASS
NODAL	4838	broad.mit.edu	37	10	72195131	72195131	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72195131G>C	uc001jrc.2	-	2	844	c.802C>G	c.(802-804)CCC>GCC	p.P268A		NM_018055	NP_060525	Q96S42	NODAL_HUMAN	nodal precursor	268					growth	extracellular space	cytokine activity|growth factor activity			large_intestine(1)|kidney(1)	2						TACTGCTTGGGGTAGATGATC	0.547													13	67	---	---	---	---	PASS
PPRC1	23082	broad.mit.edu	37	10	103908180	103908180	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103908180G>T	uc001kum.2	+	10	4491	c.4452G>T	c.(4450-4452)TCG>TCT	p.S1484S	PPRC1_uc001kun.2_Silent_p.S1364S|PPRC1_uc010qqj.1_Silent_p.S1220S|PPRC1_uc009xxa.2_RNA	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor	1484	Arg-rich.|Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		cctcttcttcgtcatcatctt	0.433													71	80	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108437122	108437122	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108437122C>G	uc001kym.2	-	13	1789	c.1781G>C	c.(1780-1782)GGT>GCT	p.G594A	SORCS1_uc001kyl.2_Missense_Mutation_p.G594A|SORCS1_uc009xxs.2_Missense_Mutation_p.G594A|SORCS1_uc001kyn.1_Missense_Mutation_p.G594A|SORCS1_uc001kyo.2_Missense_Mutation_p.G594A	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	594	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CAGGACTCCACCTTGATCCAG	0.473													31	55	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115350407	115350407	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115350407G>A	uc001laj.2	-	40	5050	c.4886C>T	c.(4885-4887)CCC>CTC	p.P1629L	NRAP_uc009xyb.2_Missense_Mutation_p.P382L|NRAP_uc001lak.2_Missense_Mutation_p.P1594L|NRAP_uc001lal.3_Missense_Mutation_p.P1629L	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1629						fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GGTGGGCTGGGGCAGGGGCTG	0.657													29	44	---	---	---	---	PASS
OR51B4	79339	broad.mit.edu	37	11	5322388	5322388	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5322388T>A	uc010qza.1	-	1	789	c.789A>T	c.(787-789)AAA>AAT	p.K263N	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033179	NP_149419	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGTGCATGTTTCCCAAACC	0.423													27	77	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17547921	17547921	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17547921A>T	uc001mnf.2	-	8	756	c.647T>A	c.(646-648)CTG>CAG	p.L216Q	USH1C_uc001mne.2_Missense_Mutation_p.L216Q|USH1C_uc009yhb.2_Missense_Mutation_p.L216Q|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.L180Q	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a	216	PDZ 2.				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						GGAGCCTACCAGGCTGATGAA	0.617													6	69	---	---	---	---	PASS
MYOD1	4654	broad.mit.edu	37	11	17741325	17741325	+	5'UTR	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17741325A>G	uc001mni.2	+	1						NM_002478	NP_002469	P15172	MYOD1_HUMAN	myogenic differentiation 1						muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|skeletal muscle tissue development	nuclear chromatin|transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity			breast(2)|ovary(1)	3						CGCCACCGCCAGGATATGGAG	0.647													12	94	---	---	---	---	PASS
LDHAL6A	160287	broad.mit.edu	37	11	18498018	18498018	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18498018G>C	uc001mop.1	+	6	941	c.680G>C	c.(679-681)TGG>TCG	p.W227S	LDHAL6A_uc001moq.2_Missense_Mutation_p.W227S	NM_001144071	NP_001137543	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A	227					glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	CCTGAGCAGTGGGAAAATGTC	0.423													76	130	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50004035	50004035	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50004035C>A	uc010ria.1	-	1	3	c.3G>T	c.(1-3)ATG>ATT	p.M1I		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TTTTCTTCTCCATCTATGTAG	0.318													30	86	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55418580	55418580	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55418580G>T	uc001nhs.1	+	1	201	c.201G>T	c.(199-201)GTG>GTT	p.V67V		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				TGTCTTTTGTGGACATTTGTT	0.423													73	375	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55418609	55418609	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55418609C>A	uc001nhs.1	+	1	230	c.230C>A	c.(229-231)CCC>CAC	p.P77H		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	77	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				GTCACAGCTCCCAAGATGATT	0.428													157	337	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55419050	55419050	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55419050G>A	uc001nhs.1	+	1	671	c.671G>A	c.(670-672)AGA>AAA	p.R224K		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	224	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				GTTTCCCTGAGAAAGCAGTCA	0.483													89	205	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55432892	55432892	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55432892C>T	uc001nht.3	+	3	515	c.250C>T	c.(250-252)CTC>TTC	p.L84F	OR4C6_uc010rik.1_Missense_Mutation_p.L84F	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	84	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TGTAGACACCCTCTCCAAGAG	0.488													85	172	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55594993	55594993	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55594993A>G	uc001nhy.1	+	1	299	c.299A>G	c.(298-300)CAA>CGA	p.Q100R		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	100	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TGCATGGTGCAATTCTACTTG	0.468										HNSCC(27;0.073)			144	145	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904440	55904440	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904440T>A	uc010riz.1	-	1	755	c.755A>T	c.(754-756)TAT>TTT	p.Y252F		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	252	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					CATTGTCCCATAGAAAACCGT	0.413													106	128	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56185406	56185406	+	Silent	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56185406C>A	uc010rji.1	-	1	303	c.303G>T	c.(301-303)CTG>CTT	p.L101L		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	101	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GAAAACAACCCAGTTGGGTTG	0.453													58	60	---	---	---	---	PASS
SERPING1	710	broad.mit.edu	37	11	57369607	57369607	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57369607G>T	uc001nkp.1	+	4	841	c.650G>T	c.(649-651)GGT>GTT	p.G217V	SERPING1_uc001nkq.1_Missense_Mutation_p.G217V|SERPING1_uc010rju.1_Missense_Mutation_p.G165V|SERPING1_uc010rjv.1_Missense_Mutation_p.G222V|SERPING1_uc001nkr.1_Missense_Mutation_p.G217V|SERPING1_uc009ymi.1_Missense_Mutation_p.G217V|SERPING1_uc009ymj.1_Missense_Mutation_p.G217V|SERPING1_uc001nks.1_5'UTR	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	217					blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						ACGACCAAAGGTGTCACCTCA	0.587									Hereditary_Angioedema				21	130	---	---	---	---	PASS
OR9I1	219954	broad.mit.edu	37	11	57886593	57886593	+	Silent	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57886593T>A	uc001nml.1	-	1	324	c.324A>T	c.(322-324)GCA>GCT	p.A108A	OR9Q1_uc001nmj.2_Intron	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Breast(21;0.0589)				ACTCTGTGCCTGCACAGATGG	0.542													57	51	---	---	---	---	PASS
OR9I1	219954	broad.mit.edu	37	11	57886914	57886914	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57886914C>A	uc001nml.1	-	1	3	c.3G>T	c.(1-3)ATG>ATT	p.M1I	OR9Q1_uc001nmj.2_Intron	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Breast(21;0.0589)				TATTCTTGGCCATGGAGACAA	0.413													10	106	---	---	---	---	PASS
OR1S2	219958	broad.mit.edu	37	11	57970847	57970847	+	Silent	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57970847T>C	uc010rkb.1	-	1	807	c.807A>G	c.(805-807)GTA>GTG	p.V269V		NM_001004459	NP_001004459	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S,	269	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)				AGTACACGCCTACAGTGGTTC	0.502													18	236	---	---	---	---	PASS
OR5B12	390191	broad.mit.edu	37	11	58207151	58207151	+	Silent	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58207151A>T	uc010rkh.1	-	1	474	c.474T>A	c.(472-474)ACT>ACA	p.T158T		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AAGTGTTCCCAGTATGAATGG	0.453													19	87	---	---	---	---	PASS
OR4D10	390197	broad.mit.edu	37	11	59245658	59245658	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59245658G>A	uc001nnz.1	+	1	756	c.756G>A	c.(754-756)GTG>GTA	p.V252V		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	252	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TGCATTTCGTGCCCTGCATCT	0.547													46	203	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62287588	62287588	+	Silent	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62287588A>T	uc001ntl.2	-	5	14601	c.14301T>A	c.(14299-14301)CCT>CCA	p.P4767P	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4767					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				CATCCACATCAGGGGTGTTGA	0.522													72	261	---	---	---	---	PASS
CTSW	1521	broad.mit.edu	37	11	65647766	65647766	+	Intron	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65647766G>T	uc001ogc.1	+						CTSW_uc001ogb.1_Intron	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein						immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)		aggtatcacagggcacataca	0.234													3	52	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83544666	83544666	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83544666C>A	uc001paj.2	-	12	1701	c.1398G>T	c.(1396-1398)CAG>CAT	p.Q466H	DLG2_uc001pai.2_Missense_Mutation_p.Q363H|DLG2_uc010rsy.1_Missense_Mutation_p.Q433H|DLG2_uc010rsz.1_Missense_Mutation_p.Q466H|DLG2_uc010rta.1_Missense_Mutation_p.Q466H|DLG2_uc001pak.2_Missense_Mutation_p.Q571H|DLG2_uc010rtb.1_Missense_Mutation_p.Q433H|DLG2_uc001pal.1_Missense_Mutation_p.Q466H|DLG2_uc001pam.1_Missense_Mutation_p.Q505H	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	466	PDZ 3.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CCGATAGGATCTGGTCTCCTC	0.433													20	108	---	---	---	---	PASS
NAALAD2	10003	broad.mit.edu	37	11	89907028	89907028	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89907028C>A	uc001pdf.3	+	14	1556	c.1447C>A	c.(1447-1449)CTG>ATG	p.L483M	NAALAD2_uc009yvx.2_Missense_Mutation_p.L450M|NAALAD2_uc009yvy.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	483	Extracellular (Potential).|NAALADase.				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GAGTAAATCACTGTATGAAAG	0.368													38	154	---	---	---	---	PASS
FOLR4	390243	broad.mit.edu	37	11	94039700	94039700	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94039700G>T	uc010rud.1	+	2	160	c.160G>T	c.(160-162)GCC>TCC	p.A54S		NM_001080486	NP_001073955	A6ND01	FOLR4_HUMAN	folate receptor 4 (delta) homolog	54						extracellular region	folic acid binding|receptor activity			ovary(1)	1						GAAGGACAATGCCTGCTGCAC	0.547													70	261	---	---	---	---	PASS
TRPC6	7225	broad.mit.edu	37	11	101325744	101325744	+	Intron	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101325744C>G	uc001pgk.3	-						TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Intron	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AAAATCCATGCTTACCTGATA	0.294													14	79	---	---	---	---	PASS
THY1	7070	broad.mit.edu	37	11	119290968	119290968	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119290968G>A	uc001pwq.2	-	2	200	c.166C>T	c.(166-168)CGT>TGT	p.R56C	uc001pwo.2_Intron|uc001pwp.1_Intron|THY1_uc001pwr.2_Missense_Mutation_p.R56C|THY1_uc001pws.2_RNA	NM_006288	NP_006279	P04216	THY1_HUMAN	Thy-1 cell surface antigen preproprotein	56	Ig-like V-type.				angiogenesis|cell-cell adhesion|cytoskeleton organization|focal adhesion assembly|negative regulation of axonogenesis|negative regulation of cell migration|negative regulation of protein kinase activity|negative regulation of T cell receptor signaling pathway|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell activation|retinal cone cell development|T cell receptor signaling pathway	endoplasmic reticulum|growth cone|integral to plasma membrane|membrane raft	GPI anchor binding|integrin binding|Rho GTPase activator activity				0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		TTTGTCTCACGGGTCAGGCTG	0.562													34	212	---	---	---	---	PASS
THY1	7070	broad.mit.edu	37	11	119290969	119290969	+	Silent	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119290969G>T	uc001pwq.2	-	2	199	c.165C>A	c.(163-165)ACC>ACA	p.T55T	uc001pwo.2_Intron|uc001pwp.1_Intron|THY1_uc001pwr.2_Silent_p.T55T|THY1_uc001pws.2_RNA	NM_006288	NP_006279	P04216	THY1_HUMAN	Thy-1 cell surface antigen preproprotein	55	Ig-like V-type.			LT -> AP (in Ref. 5).	angiogenesis|cell-cell adhesion|cytoskeleton organization|focal adhesion assembly|negative regulation of axonogenesis|negative regulation of cell migration|negative regulation of protein kinase activity|negative regulation of T cell receptor signaling pathway|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell activation|retinal cone cell development|T cell receptor signaling pathway	endoplasmic reticulum|growth cone|integral to plasma membrane|membrane raft	GPI anchor binding|integrin binding|Rho GTPase activator activity				0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		TTGTCTCACGGGTCAGGCTGA	0.562													33	213	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120852810	120852810	+	Intron	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120852810T>C	uc001pxn.2	+						GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	ATCACTTTCTTACAGGCCTGG	0.328													56	377	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	120989112	120989112	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120989112G>T	uc010rzo.1	+	6	888	c.888G>T	c.(886-888)GAG>GAT	p.E296D		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	296	VWFC.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ACTGCCAGGAGGCTTCCTGTA	0.547													26	112	---	---	---	---	PASS
ZNF202	7753	broad.mit.edu	37	11	123597180	123597180	+	Missense_Mutation	SNP	C	T	T	rs150835875		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123597180C>T	uc001pzd.1	-	9	1872	c.1472G>A	c.(1471-1473)CGC>CAC	p.R491H	ZNF202_uc001pzc.1_Missense_Mutation_p.R267H|ZNF202_uc001pze.1_Missense_Mutation_p.R491H|ZNF202_uc001pzf.1_Missense_Mutation_p.R491H	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202	491	C2H2-type 3.				lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TGAAGTCCAGCGGAAGTGCTT	0.458													50	249	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123893774	123893774	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123893774C>A	uc010sad.1	+	1	55	c.55C>A	c.(55-57)CCA>ACA	p.P19T		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	19	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCCCCATGCCCCAGGGCTGGA	0.572													30	295	---	---	---	---	PASS
VSIG2	23584	broad.mit.edu	37	11	124620721	124620721	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124620721G>T	uc001qas.2	-	3	392	c.316C>A	c.(316-318)CTG>ATG	p.L106M	VSIG2_uc001qat.2_Missense_Mutation_p.L106M	NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	106	Extracellular (Potential).|Ig-like V-type.					integral to plasma membrane|membrane fraction				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		GTCAGTTTCAGTGTGGCCACC	0.532													15	76	---	---	---	---	PASS
PKNOX2	63876	broad.mit.edu	37	11	125301131	125301131	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125301131T>C	uc001qbu.2	+	13	1576	c.1262T>C	c.(1261-1263)ATG>ACG	p.M421T	PKNOX2_uc010saz.1_Missense_Mutation_p.M392T|PKNOX2_uc010sba.1_Missense_Mutation_p.M392T|PKNOX2_uc010sbb.1_Missense_Mutation_p.M357T|PKNOX2_uc001qbv.2_Missense_Mutation_p.M186T	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	421						nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CAGCAGGCTATGATGGCTGCA	0.403													10	21	---	---	---	---	PASS
SLC6A12	6539	broad.mit.edu	37	12	311986	311986	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:311986A>T	uc001qhz.2	-	6	953	c.410T>A	c.(409-411)CTT>CAT	p.L137H	SLC6A12_uc001qia.2_Missense_Mutation_p.L137H|SLC6A12_uc001qib.2_Missense_Mutation_p.L137H|SLC6A12_uc009zdh.1_Missense_Mutation_p.L137H|SLC6A12_uc009zdi.1_RNA	NM_003044	NP_003035	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter	137	Helical; Name=3; (Potential).				cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			AGCCCAGGCAAGGATGATGAT	0.507													34	106	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1988147	1988147	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1988147A>T	uc001qjp.2	-	15	1850	c.1619T>A	c.(1618-1620)CTG>CAG	p.L540Q	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.L428Q	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	540	Cache.|Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CAGCTTCATCAGCTCTCTCAG	0.622													18	48	---	---	---	---	PASS
APOBEC1	339	broad.mit.edu	37	12	7805076	7805076	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7805076G>A	uc001qtb.2	-	3	434	c.400C>T	c.(400-402)CTT>TTT	p.L134F	APOBEC1_uc001qtc.2_Missense_Mutation_p.L89F|APOBEC1_uc010sgf.1_Missense_Mutation_p.L134F	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	134					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						CTGTTAACAAGGTCCCTGAGA	0.423													47	144	---	---	---	---	PASS
ABCD2	225	broad.mit.edu	37	12	40012715	40012715	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40012715C>A	uc001rmb.2	-	1	1129	c.703G>T	c.(703-705)GTA>TTA	p.V235L		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	235	ABC transmembrane type-1.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						GTCAGCATTACATCTAAAATA	0.473													67	283	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43833798	43833798	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43833798C>T	uc010skx.1	-	17	2365	c.2365G>A	c.(2365-2367)GTG>ATG	p.V789M	ADAMTS20_uc001rno.1_5'Flank|ADAMTS20_uc001rnp.1_5'Flank	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	789	Spacer.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTTCCTTGCACATTGATTTCT	0.313													8	10	---	---	---	---	PASS
VDR	7421	broad.mit.edu	37	12	48238617	48238617	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48238617T>A	uc001rqm.2	-	11	1478	c.1196A>T	c.(1195-1197)AAG>ATG	p.K399M	VDR_uc001rql.2_Missense_Mutation_p.K449M|VDR_uc001rqn.2_Missense_Mutation_p.K399M|VDR_uc010slq.1_Missense_Mutation_p.K367M	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor	399	Ligand-binding.				decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GCGGTACTGCTTGGAGTGCTC	0.597													23	36	---	---	---	---	PASS
CACNB3	784	broad.mit.edu	37	12	49217127	49217127	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49217127G>T	uc001rsl.1	+	2	247	c.46G>T	c.(46-48)GGT>TGT	p.G16C	CACNB3_uc010slx.1_Missense_Mutation_p.G3C|CACNB3_uc010sly.1_Missense_Mutation_p.G3C|CACNB3_uc010slz.1_Missense_Mutation_p.G15C|CACNB3_uc001rsk.1_5'UTR	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3	16					axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	CCCAACCCAGGGTTCAGCCGA	0.612													21	47	---	---	---	---	PASS
CSRNP2	81566	broad.mit.edu	37	12	51470288	51470288	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51470288G>A	uc001rxu.1	-	2	355	c.57C>T	c.(55-57)GGC>GGT	p.G19G		NM_030809	NP_110436	Q9H175	CSRN2_HUMAN	TGF-beta induced apoptosis protein 12	19					apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						AAACTGATGAGCCCACATCCA	0.532													48	86	---	---	---	---	PASS
AGAP2	116986	broad.mit.edu	37	12	58126629	58126629	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58126629C>G	uc001spq.2	-	6	1683	c.1683G>C	c.(1681-1683)GAG>GAC	p.E561D	AGAP2_uc001spp.2_Missense_Mutation_p.E561D|AGAP2_uc001spr.2_Missense_Mutation_p.E225D	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	561	G domain.				axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						TACACTCACCCTCCTGGAAGA	0.557													186	314	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78571420	78571420	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78571420C>G	uc001syp.2	+	28	5491	c.5318C>G	c.(5317-5319)CCA>CGA	p.P1773R	NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1773						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GTCTGGCCACCAAAGAAACGA	0.428										HNSCC(70;0.22)			19	41	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80761356	80761356	+	5'UTR	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80761356G>C	uc009zsg.1	+	8					uc001szd.2_Missense_Mutation_p.C126S					RecName: Full=Uncharacterized protein C12orf64;																		GATGATGTGTGTGTATTTCAA	0.313													3	15	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104089529	104089529	+	Silent	SNP	G	T	T	rs146946520	byFrequency	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104089529G>T	uc001tjw.2	+	33	3675	c.3489G>T	c.(3487-3489)GCG>GCT	p.A1163A		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1163	Extracellular (Potential).|FAS1 4.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						ATAATCTGGCGAATGCAATTG	0.468													37	60	---	---	---	---	PASS
USP30	84749	broad.mit.edu	37	12	109523484	109523484	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109523484C>T	uc010sxi.1	+	13	1406	c.1302C>T	c.(1300-1302)TAC>TAT	p.Y434Y	USP30_uc001tnu.3_Silent_p.Y403Y|USP30_uc001tnw.3_Silent_p.Y151Y	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	434	Cytoplasmic (Potential).				ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						CCTCCACATACCTCTTCCGGC	0.453													83	131	---	---	---	---	PASS
RAD9B	144715	broad.mit.edu	37	12	110969437	110969437	+	3'UTR	SNP	T	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110969437T>G	uc001trf.3	+	12					RAD9B_uc001trg.3_3'UTR|RAD9B_uc010sya.1_Missense_Mutation_p.I326R|RAD9B_uc001tre.3_3'UTR|RAD9B_uc001trd.3_3'UTR	NM_152442	NP_689655	Q6WBX8	RAD9B_HUMAN	RAD9 homolog B						cell cycle checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding			pancreas(1)|skin(1)	2						TTATCTGACATAGAACAGTAT	0.368													14	16	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124343715	124343715	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124343715A>T	uc001uft.3	+	37	6320	c.6295A>T	c.(6295-6297)ATG>TTG	p.M2099L		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2099	AAA 2 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGTGGTTCAAATGTTCGAGAC	0.443													25	22	---	---	---	---	PASS
PAN3	255967	broad.mit.edu	37	13	28841467	28841467	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28841467G>C	uc001urz.2	+	11	1291	c.1283G>C	c.(1282-1284)GGA>GCA	p.G428A	PAN3_uc010tdo.1_Missense_Mutation_p.G574A|PAN3_uc001ury.2_Missense_Mutation_p.G262A|PAN3_uc001urx.2_Missense_Mutation_p.G374A	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	574	Protein kinase.|Interaction with PAN2.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		TTCCATGCTGGAGGAGAAACT	0.388													38	83	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20837529	20837529	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20837529G>A	uc001vxe.2	-	53	7670	c.7630C>T	c.(7630-7632)CAT>TAT	p.H2544Y	TEP1_uc010ahj.1_RNA|TEP1_uc010ahk.2_Missense_Mutation_p.H1887Y|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.H2436Y	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2544					telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GTCTTTAGATGTGGTGTTGGC	0.413													79	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22192164	22192164	+	RNA	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22192164C>T	uc001wbn.2	+	1		c.157C>T								Homo sapiens mRNA for T cell receptor alpha variable 3, partial cds, clone: SEB 36.																		TCGATGCTTGCGATGCTCTTC	0.547													173	215	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22251724	22251724	+	Intron	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22251724A>T	uc010tmf.1	+											SubName: Full=Putative uncharacterized protein ENSP00000374943;																		GTAGATGCACAGTACTCCCTA	0.483													16	47	---	---	---	---	PASS
HOMEZ	57594	broad.mit.edu	37	14	23746090	23746090	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23746090G>T	uc001wja.2	-	2	495	c.347C>A	c.(346-348)TCT>TAT	p.S116Y	HOMEZ_uc001wjb.2_Missense_Mutation_p.S118Y	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein	116						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TATTTCTTCAGATGACCAGCT	0.517													25	281	---	---	---	---	PASS
HOMEZ	57594	broad.mit.edu	37	14	23746113	23746113	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23746113G>A	uc001wja.2	-	2	472	c.324C>T	c.(322-324)CTC>CTT	p.L108L	HOMEZ_uc001wjb.2_Silent_p.L110L	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein	108	Homeobox 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TACCACAGCGGAGGCGCTGGG	0.498													43	268	---	---	---	---	PASS
HOMEZ	57594	broad.mit.edu	37	14	23746358	23746358	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23746358G>A	uc001wja.2	-	2	227	c.79C>T	c.(79-81)CCT>TCT	p.P27S	HOMEZ_uc001wjb.2_Missense_Mutation_p.P29S	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein	27						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TCTTTATTAGGAGGCATGGTG	0.517													6	28	---	---	---	---	PASS
CMTM5	116173	broad.mit.edu	37	14	23848084	23848084	+	Intron	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23848084C>A	uc010akm.2	+						CMTM5_uc001wjs.2_Intron|CMTM5_uc001wjt.2_Intron|CMTM5_uc010akn.2_Intron|CMTM5_uc001wju.2_Intron|CMTM5_uc010ako.2_Intron	NM_138460	NP_612469	Q96DZ9	CKLF5_HUMAN	chemokine-like factor superfamily 5 isoform a						chemotaxis	extracellular space|integral to membrane	cytokine activity				0	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		GCAGTGTGAGCGCTCTGTCTC	0.572													4	44	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360618	42360618	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360618C>A	uc001wvm.2	+	4	2749	c.1551C>A	c.(1549-1551)TGC>TGA	p.C517*	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	517	Extracellular (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		ATGTGCGTTGCCATTTCATGC	0.433										HNSCC(30;0.082)			76	324	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360619	42360619	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360619C>T	uc001wvm.2	+	4	2750	c.1552C>T	c.(1552-1554)CAT>TAT	p.H518Y	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	518	Extracellular (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGTGCGTTGCCATTTCATGCA	0.438										HNSCC(30;0.082)			76	327	---	---	---	---	PASS
SDCCAG1	9147	broad.mit.edu	37	14	50266381	50266381	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50266381C>A	uc001wxc.2	-	24	2456	c.2388G>T	c.(2386-2388)TTG>TTT	p.L796F	SDCCAG1_uc010anj.1_Missense_Mutation_p.L796F|SDCCAG1_uc001wwz.2_5'Flank|SDCCAG1_uc001wxa.2_Missense_Mutation_p.L76F|SDCCAG1_uc010tqi.1_Missense_Mutation_p.L775F|SDCCAG1_uc001wxe.2_Missense_Mutation_p.L754F|SDCCAG1_uc001wxd.1_Missense_Mutation_p.L201F	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1	796						cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		CTTTTGAAGCCAATTTCTGGA	0.328													23	117	---	---	---	---	PASS
SLC8A3	6547	broad.mit.edu	37	14	70530612	70530612	+	Intron	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70530612C>A	uc001xly.2	-						SLC8A3_uc001xlu.2_Intron|SLC8A3_uc001xlv.2_Intron|SLC8A3_uc001xlw.2_Intron|SLC8A3_uc001xlx.2_Missense_Mutation_p.A607S|SLC8A3_uc001xlz.2_Intron|SLC8A3_uc010ara.2_Intron|SLC8A3_uc001xma.2_Intron	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTCTCATATGCCTCATCATCA	0.413													16	89	---	---	---	---	PASS
DPF3	8110	broad.mit.edu	37	14	73238591	73238591	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73238591G>A	uc001xnc.2	-	2	56	c.43C>T	c.(43-45)CAG>TAG	p.Q15*	DPF3_uc001xnf.2_RNA|DPF3_uc010ari.1_Nonsense_Mutation_p.Q15*|DPF3_uc010ttq.1_Nonsense_Mutation_p.Q25*	NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	15					chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TTGTAGAACTGGTCCCCGAGC	0.587													6	22	---	---	---	---	PASS
TTC7B	145567	broad.mit.edu	37	14	91252558	91252558	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91252558C>T	uc001xyp.2	-	2	358	c.236G>A	c.(235-237)CGC>CAC	p.R79H		NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	79							binding			ovary(2)	2		Melanoma(154;0.222)				CAGATGCTTGCGGACCTCAGT	0.642													15	59	---	---	---	---	PASS
CYP46A1	10858	broad.mit.edu	37	14	100166358	100166358	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100166358C>T	uc001ygo.2	+	5	363	c.363C>T	c.(361-363)TTC>TTT	p.F121F	CYP46A1_uc001ygn.1_Silent_p.F83F	NM_006668	NP_006659	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46	121					bile acid biosynthetic process|cholesterol catabolic process|nervous system development|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol 24-hydroxylase activity|electron carrier activity|heme binding|steroid hydroxylase activity				0		Melanoma(154;0.0866)|all_epithelial(191;0.179)				ACAGACTCTTCGGCCAAGGCT	0.423													12	57	---	---	---	---	PASS
DIO3	1735	broad.mit.edu	37	14	102028122	102028122	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102028122G>A	uc010txq.1	+	1	435	c.211G>A	c.(211-213)GAC>AAC	p.D71N	DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	NM_001362	NP_001353	P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	71	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(303;0.185)				GCCTCCCGATGACCCGCCCAT	0.642													12	78	---	---	---	---	PASS
PACS2	23241	broad.mit.edu	37	14	105849743	105849743	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105849743C>T	uc001yqt.2	+	16	1836	c.1661C>T	c.(1660-1662)GCG>GTG	p.A554V	PACS2_uc001yqs.2_Missense_Mutation_p.A479V|PACS2_uc001yqv.2_Missense_Mutation_p.A558V|PACS2_uc001yqu.2_Missense_Mutation_p.A558V	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	554					apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		ATCGCCGTGGCGGGAGCGCAG	0.642													16	63	---	---	---	---	PASS
SPRED1	161742	broad.mit.edu	37	15	38591692	38591692	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38591692G>T	uc001zka.3	+	2	486	c.151G>T	c.(151-153)GAA>TAA	p.E51*		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain	51	WH1.				inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CCCTCATCAGGAAGAGAATGG	0.438									Legius_syndrome				37	78	---	---	---	---	PASS
FRMD5	84978	broad.mit.edu	37	15	44211710	44211710	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44211710G>A	uc001ztl.2	-	4	453	c.276C>T	c.(274-276)TTC>TTT	p.F92F	FRMD5_uc001ztk.1_Silent_p.F3F|FRMD5_uc001ztm.2_5'UTR|FRMD5_uc001ztn.2_5'UTR	NM_032892	NP_116281	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5 isoform 2	92	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		ACTTCACACGGAAGCACATGG	0.522													95	160	---	---	---	---	PASS
C15orf33	196951	broad.mit.edu	37	15	49620760	49620760	+	3'UTR	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49620760T>C	uc001zxl.2	-	16					GALK2_uc001zxi.1_3'UTR|GALK2_uc001zxj.1_3'UTR|GALK2_uc010ufb.1_3'UTR|GALK2_uc001zxk.2_RNA|GALK2_uc010ufc.1_3'UTR	NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951											ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)		CATTTCTGGTTTCTCTTAGTA	0.254													20	23	---	---	---	---	PASS
CYP11A1	1583	broad.mit.edu	37	15	74637456	74637456	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74637456C>T	uc002axt.2	-	3	709	c.554G>A	c.(553-555)CGC>CAC	p.R185H	CYP11A1_uc002axs.2_Missense_Mutation_p.R27H|CYP11A1_uc010bjm.1_Missense_Mutation_p.R27H|CYP11A1_uc010bjn.1_RNA|CYP11A1_uc010bjo.1_Missense_Mutation_p.R185H|CYP11A1_uc010bjp.1_5'Flank|CYP11A1_uc010ulj.1_Intron|CYP11A1_uc010bjq.2_Missense_Mutation_p.R185H	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,	185					C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	CTTCTTGATGCGCCTGTGCAG	0.582													4	82	---	---	---	---	PASS
RCN2	5955	broad.mit.edu	37	15	77236139	77236139	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77236139A>G	uc002bcd.2	+	4	709	c.488A>G	c.(487-489)CAG>CGG	p.Q163R	RCN2_uc002bce.2_Missense_Mutation_p.Q235R|RCN2_uc010bks.2_Missense_Mutation_p.Q116R	NM_002902	NP_002893	Q14257	RCN2_HUMAN	reticulocalbin 2 precursor	163	EF-hand 3.|3; possibly ancestral (Potential).					endoplasmic reticulum lumen	calcium ion binding				0						AAAGCTAACCAGGATTCAGGT	0.308													18	60	---	---	---	---	PASS
AGPHD1	123688	broad.mit.edu	37	15	78805425	78805425	+	Splice_Site	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78805425G>T	uc010unc.1	+	2	109	c.-4_splice	c.e2-1		AGPHD1_uc002bdt.2_Splice_Site|AGPHD1_uc010ble.2_Splice_Site	NM_001013619	NP_001013641	A2RU49	AGPD1_HUMAN	aminoglycoside phosphotransferase domain							cytoplasm	kinase activity				0						TGTTCCCCTAGACATAATGTC	0.398													3	49	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20693666	20693666	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20693666T>C	uc002dhm.1	-	3	591	c.523A>G	c.(523-525)ATA>GTA	p.I175V	ACSM1_uc002dhn.1_RNA|ACSM1_uc010bwg.1_Missense_Mutation_p.I175V	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	175					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						TGAGAAGCTATGGAGTCCACC	0.522													38	62	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21078624	21078624	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21078624C>A	uc010vbe.1	-	24	3498	c.3498G>T	c.(3496-3498)AAG>AAT	p.K1166N		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1166	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ATAGTCTCTTCTTCTCCAAGT	0.438													20	75	---	---	---	---	PASS
CLN3	1201	broad.mit.edu	37	16	28497820	28497820	+	Intron	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28497820G>T	uc002dpo.2	-						uc010vct.1_Intron|CLN3_uc002dpl.2_Intron|CLN3_uc010vcu.1_Intron|CLN3_uc002dpn.2_Intron|CLN3_uc002dpm.2_Intron|CLN3_uc010vcv.1_Intron|CLN3_uc010byd.2_Intron|CLN3_uc002dpp.2_Intron|CLN3_uc002dpt.1_Intron|CLN3_uc002dpq.1_Intron|CLN3_uc010bye.1_Intron|CLN3_uc002dpr.1_Intron|CLN3_uc010byf.1_Intron|CLN3_uc002dps.1_Intron|CLN3_uc002dpu.1_Intron|CLN3_uc002dpw.1_Intron|CLN3_uc010vcw.1_Intron|CLN3_uc002dqa.2_Intron|CLN3_uc010vcx.1_Intron|CLN3_uc002dpx.1_Intron|CLN3_uc002dpy.1_Intron|CLN3_uc002dpz.1_Intron	NM_000086	NP_000077	Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3						amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding				0						CCCTGGGAAGGAGAACACAGG	0.657													8	20	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76587245	76587245	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76587245G>A	uc002feu.1	+	24	3893	c.3508G>A	c.(3508-3510)GCA>ACA	p.A1170T	CNTNAP4_uc002fev.1_Missense_Mutation_p.A1034T|CNTNAP4_uc010chb.1_Missense_Mutation_p.A1097T|CNTNAP4_uc002fex.1_Missense_Mutation_p.A1173T	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	1170	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						CTGCCTCTCTGCAGTGCAGCT	0.547													4	10	---	---	---	---	PASS
FAM101B	359845	broad.mit.edu	37	17	293122	293122	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:293122G>C	uc002frj.2	-	2	542	c.268C>G	c.(268-270)CCC>GCC	p.P90A		NM_182705	NP_874364	Q8N5W9	F101B_HUMAN	hypothetical protein LOC359845	160											0		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		AAGCGGGTGGGCCTGTGGCGT	0.642													10	36	---	---	---	---	PASS
FAM101B	359845	broad.mit.edu	37	17	293123	293123	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:293123C>A	uc002frj.2	-	2	541	c.267G>T	c.(265-267)AGG>AGT	p.R89S		NM_182705	NP_874364	Q8N5W9	F101B_HUMAN	hypothetical protein LOC359845	159											0		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		AGCGGGTGGGCCTGTGGCGTG	0.642													10	36	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578176	7578176	+	Splice_Site	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578176C>A	uc002gim.2	-	6	866	c.672_splice	c.e6+1	p.E224_splice	TP53_uc002gig.1_Splice_Site_p.E224_splice|TP53_uc002gih.2_Splice_Site_p.E224_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.E92_splice|TP53_uc010cng.1_Splice_Site_p.E92_splice|TP53_uc002gii.1_Splice_Site_p.E92_splice|TP53_uc010cnh.1_Splice_Site_p.E224_splice|TP53_uc010cni.1_Splice_Site_p.E224_splice|TP53_uc002gij.2_Splice_Site_p.E224_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Splice_Site_p.E131_splice|TP53_uc002gio.2_Splice_Site_p.E92_splice|TP53_uc010vug.1_Missense_Mutation_p.V186F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(26)|p.0?(7)|p.V225fs*24(1)|p.E224_V225insXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCAAACCAGACCTCAGGCGGC	0.517		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			13	37	---	---	---	---	PASS
CNTROB	116840	broad.mit.edu	37	17	7836605	7836605	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7836605G>C	uc002gjq.2	+	2	1127	c.208G>C	c.(208-210)GGC>CGC	p.G70R	TRAPPC1_uc002gjo.1_5'Flank|CNTROB_uc002gjp.2_Missense_Mutation_p.G70R|CNTROB_uc002gjr.2_5'Flank	NM_053051	NP_444279	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	70					centriole replication|centrosome separation|cytokinesis	centriole	protein domain specific binding			breast(1)|central_nervous_system(1)	2		Prostate(122;0.173)				AGGGTTAGACGGCTTCGCCCA	0.562													16	109	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10212613	10212613	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10212613G>T	uc002gmk.1	-	35	5197	c.5107C>A	c.(5107-5109)CGC>AGC	p.R1703S		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1703	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						GACAGCCTGCGGGTCCGCTCC	0.667													21	20	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10222343	10222343	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10222343T>C	uc002gmk.1	-	27	3592	c.3502A>G	c.(3502-3504)AAC>GAC	p.N1168D		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1168	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CTCTTCTTGTTCATCTCAATC	0.582													94	152	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10351439	10351439	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10351439G>A	uc002gmn.2	-	34	4772	c.4661C>T	c.(4660-4662)TCT>TTT	p.S1554F	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1554	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						ATGCTCAAGAGATGCCTTAAT	0.328													37	66	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10401147	10401147	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10401147C>G	uc002gmo.2	-	31	4363	c.4269G>C	c.(4267-4269)CAG>CAC	p.Q1423H	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1423	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TCTGGAGCCTCTGCTTCGTCT	0.473													20	103	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10411670	10411670	+	Intron	SNP	T	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10411670T>G	uc002gmo.2	-						uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult							muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TTAATTATATTGATAATTACC	0.303													38	75	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11833311	11833311	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11833311C>G	uc002gne.2	+	63	12074	c.12006C>G	c.(12004-12006)ATC>ATG	p.I4002M	DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Missense_Mutation_p.I314M	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	4002	AAA 6 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGGGCCACATCATCCCCCAGG	0.592													24	35	---	---	---	---	PASS
ULK2	9706	broad.mit.edu	37	17	19687201	19687201	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19687201C>A	uc002gwm.3	-	22	2778	c.2269G>T	c.(2269-2271)GGG>TGG	p.G757W	ULK2_uc002gwn.2_Missense_Mutation_p.G757W	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	757					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					AGAGAGCCCCCGGAGTTGCTG	0.592													22	26	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37564132	37564132	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37564132G>C	uc002hrv.3	-	17	4554	c.4342C>G	c.(4342-4344)CCC>GCC	p.P1448A	MED1_uc010wee.1_Missense_Mutation_p.P1276A|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1448	Ser-rich.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CTATGGCTGGGAGAGCCACGC	0.488										HNSCC(31;0.082)			30	35	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37866733	37866733	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37866733C>T	uc002hso.2	+	7	1138	c.900C>T	c.(898-900)CCC>CCT	p.P300P	ERBB2_uc002hsm.2_Silent_p.P270P|ERBB2_uc010cwa.2_Silent_p.P285P|ERBB2_uc002hsp.2_Silent_p.P103P|ERBB2_uc010cwb.2_Silent_p.P300P|ERBB2_uc010wek.1_Intron|ERBB2_uc002hsl.2_Silent_p.P270P|ERBB2_uc002hsn.1_Silent_p.P300P	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	300	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	CTGCCTGTCCCTGTGAGTGCC	0.537		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			29	34	---	---	---	---	PASS
LRRC37A2	474170	broad.mit.edu	37	17	44626194	44626194	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44626194C>A	uc002ikn.1	+	9	3692	c.3689C>A	c.(3688-3690)GCC>GAC	p.A1230D	ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Missense_Mutation_p.A191D|LRRC37A2_uc010dax.1_Missense_Mutation_p.A160D	NM_001006607	NP_001006608	A6NM11	L37A2_HUMAN	c114 SLIT-like testicular protein precursor	1230	Extracellular (Potential).					integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GCGGGAAACGCCGTCTACACC	0.587													54	266	---	---	---	---	PASS
SAMD14	201191	broad.mit.edu	37	17	48191655	48191655	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48191655C>T	uc002iqg.2	-	8	1137	c.838G>A	c.(838-840)GAT>AAT	p.D280N	SAMD14_uc002iqd.2_Missense_Mutation_p.D63N|SAMD14_uc002iqe.2_Missense_Mutation_p.D63N|SAMD14_uc002iqf.2_Missense_Mutation_p.D308N	NM_174920	NP_777580	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	280											0						GTGGAGTCATCACTCAGAGTG	0.577													22	41	---	---	---	---	PASS
SOX9	6662	broad.mit.edu	37	17	70119805	70119805	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70119805C>A	uc002jiw.2	+	3	1179	c.807C>A	c.(805-807)GAC>GAA	p.D269E	uc002jiv.2_5'Flank	NM_000346	NP_000337	P48436	SOX9_HUMAN	transcription factor SOX9	269					cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription				0		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CCCCTATCGACTTCCGCGACG	0.652													4	162	---	---	---	---	PASS
CD300LF	146722	broad.mit.edu	37	17	72691910	72691910	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72691910A>T	uc002jlg.2	-	6	774	c.671T>A	c.(670-672)CTT>CAT	p.L224H	RAB37_uc002jlc.2_Intron|RAB37_uc010dfu.2_Intron|RAB37_uc002jld.2_Intron|CD300LF_uc002jlf.2_Missense_Mutation_p.L227H|CD300LF_uc010dfw.2_RNA|CD300LF_uc002jlh.2_Silent_p.A239A|CD300LF_uc002jli.2_Silent_p.A189A|CD300LF_uc010wra.1_Missense_Mutation_p.L239H|CD300LF_uc002jlj.1_Silent_p.A234A	NM_139018	NP_620587	Q8TDQ1	CLM1_HUMAN	NK inhibitory receptor precursor	224	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			upper_aerodigestive_tract(1)	1						GGCAGAGGAAAGCTTCGTGGT	0.637													55	44	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74023265	74023265	+	Silent	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74023265C>A	uc002jqi.2	-	1	243	c.15G>T	c.(13-15)CTG>CTT	p.L5L	EVPL_uc010wss.1_Silent_p.L5L|EVPL_uc010wst.1_5'UTR	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	5	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						AGCCTTTGCTCAGCCCCTTGA	0.493													23	22	---	---	---	---	PASS
CDH2	1000	broad.mit.edu	37	18	25589781	25589781	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25589781C>G	uc002kwg.2	-	5	1061	c.602G>C	c.(601-603)GGA>GCA	p.G201A	CDH2_uc010xbn.1_Missense_Mutation_p.G170A	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	201	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4						CTGGTCAGCTCCTGGCCCAGT	0.483													35	100	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	49867170	49867170	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49867170C>G	uc002lfe.1	+	1	600	c.13C>G	c.(13-15)CTT>GTT	p.L5V		NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	5					apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGAGAATAGTCTTAGATGTGT	0.413													59	156	---	---	---	---	PASS
CNDP2	55748	broad.mit.edu	37	18	72183637	72183637	+	Intron	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72183637G>T	uc002llm.1	+						CNDP2_uc002lln.1_Intron|CNDP2_uc010dqs.2_Intron	NM_018235	NP_060705	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2							cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity			ovary(2)|skin(1)	3		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		GGCATGTGGGGCTGGGACACG	0.617													11	27	---	---	---	---	PASS
ATP9B	374868	broad.mit.edu	37	18	77105425	77105425	+	Intron	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77105425C>G	uc002lmx.2	+						ATP9B_uc002lmw.1_Intron|ATP9B_uc002lmz.1_Intron|ATP9B_uc002lna.2_Intron|ATP9B_uc002lnb.1_5'Flank|ATP9B_uc010drb.2_5'Flank	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B						ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CTTTGTTTTCCAGGTTTGTCT	0.507													56	142	---	---	---	---	PASS
SHC2	25759	broad.mit.edu	37	19	440878	440878	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:440878G>A	uc002loq.3	-	2	523	c.523C>T	c.(523-525)CGC>TGC	p.R175C	SHC2_uc002lop.3_5'Flank	NM_012435	NP_036567	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing)	175	PID.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol					0		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCTGCGTGCGCGTGTTAAAG	0.647													45	54	---	---	---	---	PASS
TLE6	79816	broad.mit.edu	37	19	2989088	2989088	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2989088C>T	uc002lwu.2	+	11	801	c.401C>T	c.(400-402)GCA>GTA	p.A134V	TLE6_uc002lwt.2_Missense_Mutation_p.A257V|TLE6_uc010dtg.2_Missense_Mutation_p.A257V|TLE6_uc002lwv.2_Missense_Mutation_p.A38V	NM_024760	NP_079036	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6 isoform 2	134					regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTGAAGATGCATGGAAGAGG	0.592													33	36	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7812352	7812352	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7812352C>A	uc002mht.2	-	1	113	c.46G>T	c.(46-48)GAG>TAG	p.E16*	CD209_uc010xju.1_Nonsense_Mutation_p.E16*|CD209_uc010dvp.2_5'UTR|CD209_uc002mhr.2_5'UTR|CD209_uc002mhs.2_5'UTR|CD209_uc002mhu.2_Nonsense_Mutation_p.E16*|CD209_uc010dvq.2_Nonsense_Mutation_p.E16*|CD209_uc002mhq.2_5'UTR|CD209_uc002mhv.2_Nonsense_Mutation_p.E16*|CD209_uc002mhx.2_Missense_Mutation_p.V16L|CD209_uc002mhw.2_Missense_Mutation_p.V16L|CD209_uc010dvr.2_Nonsense_Mutation_p.E16*	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	16	Endocytosis signal (Potential).|Cytoplasmic (Probable).				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						CCAGCCTCACCCAGGAGGCCC	0.597													97	176	---	---	---	---	PASS
ZNF561	93134	broad.mit.edu	37	19	9721953	9721953	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9721953C>A	uc002mlu.2	-	6	589	c.384G>T	c.(382-384)AGG>AGT	p.R128S	ZNF561_uc010dwu.2_Missense_Mutation_p.R59S|ZNF561_uc010xkr.1_5'UTR	NM_152289	NP_689502	Q8N587	ZN561_HUMAN	zinc finger protein 561	128	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAAACTGTTCCCTGAAGACCT	0.418													43	104	---	---	---	---	PASS
ZNF561	93134	broad.mit.edu	37	19	9721954	9721954	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9721954C>A	uc002mlu.2	-	6	588	c.383G>T	c.(382-384)AGG>ATG	p.R128M	ZNF561_uc010dwu.2_Missense_Mutation_p.R59M|ZNF561_uc010xkr.1_Translation_Start_Site	NM_152289	NP_689502	Q8N587	ZN561_HUMAN	zinc finger protein 561	128	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAACTGTTCCCTGAAGACCTC	0.413													43	105	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602887	10602887	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602887G>C	uc002moq.1	-	3	847	c.691C>G	c.(691-693)CTC>GTC	p.L231V	KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.L231V	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	231	BACK.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CGGCTGATGAGGGTCACCAGT	0.612													32	49	---	---	---	---	PASS
PIK3R2	5296	broad.mit.edu	37	19	18279624	18279624	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18279624G>A	uc002nia.1	+	15	2409	c.1897G>A	c.(1897-1899)GAG>AAG	p.E633K	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	633	SH2 2.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						CACGCAGGCAGAGGAGATGCT	0.657													12	28	---	---	---	---	PASS
TM6SF2	53345	broad.mit.edu	37	19	19377390	19377390	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19377390G>T	uc002nmd.1	-	9	883	c.833C>A	c.(832-834)CCT>CAT	p.P278H	HAPLN4_uc002nmc.2_5'UTR	NM_001001524	NP_001001524	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	278	Helical; (Potential).					integral to membrane					0			Epithelial(12;0.0151)			GCCGCAGAAAGGCAGGACATA	0.612													4	62	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22363828	22363828	+	Missense_Mutation	SNP	C	A	A	rs149990770	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22363828C>A	uc002nqs.1	-	3	1009	c.691G>T	c.(691-693)GGC>TGC	p.G231C		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	231	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AAAGCTTTGCCACATTCTTCA	0.353													11	169	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22942386	22942386	+	Nonsense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22942386T>A	uc010xrh.1	-	4	388	c.388A>T	c.(388-390)AAG>TAG	p.K130*		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CGTAAATTCTTATGTCCACAT	0.338													27	55	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30935603	30935603	+	Silent	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935603C>T	uc002nsu.1	+	2	1272	c.1134C>T	c.(1132-1134)TGC>TGT	p.C378C	ZNF536_uc010edd.1_Silent_p.C378C	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	378	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GCCAGATCTGCGGCCGGCGCT	0.602													44	92	---	---	---	---	PASS
WDR88	126248	broad.mit.edu	37	19	33642152	33642152	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33642152T>G	uc002nui.2	+	6	823	c.745T>G	c.(745-747)TCA>GCA	p.S249A		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	249	WD 4.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					GGCTTCTGTCTCATTGGACAG	0.552													3	30	---	---	---	---	PASS
DMKN	93099	broad.mit.edu	37	19	36004081	36004081	+	Silent	SNP	G	T	T	rs61742823	byFrequency	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36004081G>T	uc002nzm.3	-	1	480	c.297C>A	c.(295-297)GTC>GTA	p.V99V	DMKN_uc002nzj.2_5'Flank|DMKN_uc002nzk.3_5'Flank|DMKN_uc002nzl.3_5'Flank|DMKN_uc002nzo.3_Silent_p.V99V|DMKN_uc002nzn.3_Silent_p.V99V|DMKN_uc002nzw.2_5'Flank|DMKN_uc002nzr.2_5'Flank|DMKN_uc002nzp.2_5'Flank|DMKN_uc002nzq.2_5'Flank|DMKN_uc002nzt.2_5'Flank|DMKN_uc002nzs.2_5'Flank|DMKN_uc002nzu.2_5'Flank|DMKN_uc002nzv.2_5'Flank|DMKN_uc010xsv.1_5'Flank|DMKN_uc010xsw.1_5'Flank|DMKN_uc002nzx.3_5'Flank|DMKN_uc002nzy.3_5'Flank|DMKN_uc002nzz.2_5'Flank|DMKN_uc002oac.3_Silent_p.V99V|DMKN_uc010eeb.2_Silent_p.V99V|DMKN_uc002oaa.3_Silent_p.V99V|DMKN_uc002oab.3_Silent_p.V99V	NM_033317	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine isoform 2 precursor	99	Gly-rich.					extracellular region				large_intestine(1)|ovary(1)|skin(1)	3	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTGCTTCCCCGACCCTGTTGC	0.597													7	107	---	---	---	---	PASS
KIRREL2	84063	broad.mit.edu	37	19	36351813	36351813	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36351813G>T	uc002ocb.3	+	8	1143	c.931G>T	c.(931-933)GGG>TGG	p.G311W	KIRREL2_uc002obz.3_Missense_Mutation_p.G311W|KIRREL2_uc002oca.3_Missense_Mutation_p.G261W|KIRREL2_uc002occ.3_Missense_Mutation_p.G258W|KIRREL2_uc002ocd.3_Missense_Mutation_p.G308W	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	311	Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCGTCCAGTTGGGCCGATTCT	0.652													10	41	---	---	---	---	PASS
ZNF461	92283	broad.mit.edu	37	19	37129880	37129880	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37129880A>G	uc002oem.2	-	6	1595	c.1367T>C	c.(1366-1368)CTC>CCC	p.L456P	ZNF461_uc002oen.2_Missense_Mutation_p.L425P|ZNF461_uc010xtj.1_Missense_Mutation_p.L433P	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	456	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ATGTCTTTTGAGGTGTGAACA	0.398													3	93	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40581177	40581177	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40581177C>T	uc002omy.2	-	6	1397	c.1172G>A	c.(1171-1173)TGT>TAT	p.C391Y	ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.C391Y|ZNF780A_uc010xvh.1_Missense_Mutation_p.C392Y	NM_001010880	NP_001010880	O75290	Z780A_HUMAN	zinc finger protein 780A isoform b	391	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					ACATTCCTTACATTCAAACGG	0.408													127	231	---	---	---	---	PASS
EML2	24139	broad.mit.edu	37	19	46127984	46127984	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46127984C>T	uc002pcn.2	-	9	869	c.834G>A	c.(832-834)TGG>TGA	p.W278*	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Nonsense_Mutation_p.W162*|EML2_uc010xxl.1_Nonsense_Mutation_p.W425*|EML2_uc010xxm.1_Nonsense_Mutation_p.W479*|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Nonsense_Mutation_p.W278*|EML2_uc010ekj.2_Intron|EML2_uc010ekk.1_RNA	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	278	WD 4.				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GACCTTTGCCCCAAACATAGA	0.517													5	41	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54386432	54386432	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54386432G>T	uc002qcq.1	+	2	468	c.186G>T	c.(184-186)CAG>CAT	p.Q62H	PRKCG_uc010eqz.1_Missense_Mutation_p.Q62H|PRKCG_uc010yef.1_Missense_Mutation_p.Q62H|PRKCG_uc010yeg.1_Missense_Mutation_p.Q62H|PRKCG_uc010yeh.1_5'Flank	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	62	Phorbol-ester/DAG-type 1.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		TCGGAAAGCAGGGCCTGCAAT	0.642													38	47	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54401724	54401724	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54401724G>A	uc002qcq.1	+	11	1405	c.1123G>A	c.(1123-1125)GAG>AAG	p.E375K	PRKCG_uc010yef.1_3'UTR|PRKCG_uc010yeg.1_Missense_Mutation_p.E375K|PRKCG_uc010yeh.1_Missense_Mutation_p.E262K	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	375	Protein kinase.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		GGGCTCTGATGAGCTCTACGC	0.602													42	71	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55341403	55341403	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55341403G>T	uc002qhk.3	+	8	1189	c.1126G>T	c.(1126-1128)GAG>TAG	p.E376*	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Nonsense_Mutation_p.E301*|KIR3DL1_uc010esf.2_Nonsense_Mutation_p.E281*|KIR3DL1_uc010yfo.1_Nonsense_Mutation_p.E318*|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	376	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		AATGGACCAAGAGCCTGCAGG	0.532													74	106	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10621761	10621761	+	Silent	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10621761A>T	uc002wnw.2	-	24	3564	c.3048T>A	c.(3046-3048)ATT>ATA	p.I1016I		NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	1016	Extracellular (Potential).				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						TTATACTTACAATGGCCACAT	0.408									Alagille_Syndrome				57	134	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13868482	13868482	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13868482C>A	uc010gcf.2	-	8	760	c.678G>T	c.(676-678)TTG>TTT	p.L226F	SEL1L2_uc002woq.3_Missense_Mutation_p.L87F|SEL1L2_uc010zrl.1_Missense_Mutation_p.L226F|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	226	Sel1-like 4.|Extracellular (Potential).					integral to membrane	binding			ovary(2)	2						TGATTCCCGACAAATATCTGT	0.299													39	210	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20493357	20493357	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20493357C>G	uc002wrz.2	-	32	4799	c.4656G>C	c.(4654-4656)ATG>ATC	p.M1552I	RALGAPA2_uc010gcx.2_Missense_Mutation_p.M1256I|RALGAPA2_uc010zsg.1_Missense_Mutation_p.M1000I|RALGAPA2_uc002wsa.1_Missense_Mutation_p.M324I	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1552					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						GGTCATAGTTCATGCCACATG	0.398													45	151	---	---	---	---	PASS
MYLK2	85366	broad.mit.edu	37	20	30408096	30408096	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30408096C>G	uc002wwq.2	+	3	322	c.220C>G	c.(220-222)CAA>GAA	p.Q74E		NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase	74					cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AACTAGCAGCCAAGGCCCCAA	0.662													14	52	---	---	---	---	PASS
C20orf160	140706	broad.mit.edu	37	20	30616834	30616834	+	Missense_Mutation	SNP	C	G	G	rs139147006		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30616834C>G	uc002wxf.2	+	7	1119	c.1106C>G	c.(1105-1107)GCG>GGG	p.A369G	C20orf160_uc002wxg.2_5'UTR	NM_080625	NP_542192	Q9NUG4	CT160_HUMAN	hypothetical protein LOC140706	Error:Variant_position_missing_in_Q9NUG4_after_alignment										central_nervous_system(3)|ovary(1)	4						CATGTTACAGCGGCACGTCCA	0.602													28	84	---	---	---	---	PASS
HCK	3055	broad.mit.edu	37	20	30689186	30689186	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30689186G>T	uc002wxh.2	+	13	1616	c.1445G>T	c.(1444-1446)TGC>TTC	p.C482F	HCK_uc010gdy.2_Missense_Mutation_p.C461F|HCK_uc002wxi.2_Missense_Mutation_p.C460F	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	482	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCAGAGAACTGCCCAGAGGAG	0.547													9	52	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31678516	31678516	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31678516C>A	uc010zue.1	+	8	1069	c.1054C>A	c.(1054-1056)CTG>ATG	p.L352M		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	352						cytoplasm|extracellular region	lipid binding				0						GCCTGCAGCTCTGATTCCTCT	0.597													10	59	---	---	---	---	PASS
TOP1	7150	broad.mit.edu	37	20	39704813	39704813	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39704813A>G	uc002xjl.2	+	4	404	c.158A>G	c.(157-159)GAA>GGA	p.E53G	TOP1_uc010gge.1_RNA	NM_003286	NP_003277	P11387	TOP1_HUMAN	DNA topoisomerase I	53	Lys-rich.				DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)	TTTTACAGTGAACATAAAGAT	0.224			T	NUP98	AML*								32	111	---	---	---	---	PASS
SPINLW1	57119	broad.mit.edu	37	20	44171511	44171511	+	Intron	SNP	A	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44171511A>C	uc002xou.2	-						SPINLW1_uc010zxc.1_Intron|SPINLW1_uc002xot.2_Intron|SPINLW1_uc002xov.1_3'UTR	NM_020398	NP_065131	O95925	EPPI_HUMAN	serine peptidase inhibitor-like, with Kunitz and							extracellular region	serine-type endopeptidase inhibitor activity			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				ATACATCTGCAGAGAGACTCC	0.428													17	108	---	---	---	---	PASS
SPINT4	391253	broad.mit.edu	37	20	44351115	44351115	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44351115C>A	uc002xpe.1	+	1	128	c.109C>A	c.(109-111)CTC>ATC	p.L37I		NM_178455	NP_848550	Q6UDR6	SPIT4_HUMAN	serine peptidase inhibitor, Kunitz type 4	37						extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2		Myeloproliferative disorder(115;0.028)				ATGTGGAGACCTCAAAGGTAT	0.388													27	88	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47265955	47265955	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47265955C>A	uc002xtw.1	-	25	3211	c.3188G>T	c.(3187-3189)GGC>GTC	p.G1063V	PREX1_uc002xtv.1_Missense_Mutation_p.G360V	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1063					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GAAGCTGAGGCCCCGGTCTTC	0.592													15	68	---	---	---	---	PASS
SYCP2	10388	broad.mit.edu	37	20	58494628	58494628	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58494628T>C	uc002yaz.2	-	5	461	c.322A>G	c.(322-324)AAG>GAG	p.K108E	SYCP2_uc010gju.1_Missense_Mutation_p.K9E	NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	108					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ATAATGTCCTTGGATTTTTCA	0.294													23	78	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18021972	18021972	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18021972A>G	uc010gqw.1	+	15	2200	c.2074A>G	c.(2074-2076)ATA>GTA	p.I692V	CECR2_uc010gqv.1_Missense_Mutation_p.I551V|CECR2_uc002zml.2_Missense_Mutation_p.I551V	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	734					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		GCTTGGGCAGATAAGTGGCCC	0.602													9	42	---	---	---	---	PASS
ATP6V1E1	529	broad.mit.edu	37	22	18077343	18077343	+	Silent	SNP	T	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18077343T>G	uc002zmr.1	-	8	757	c.570A>C	c.(568-570)ATA>ATC	p.I190I	ATP6V1E1_uc002zms.1_Silent_p.I160I|ATP6V1E1_uc002zmt.1_Silent_p.I168I	NM_001696	NP_001687	P36543	VATE1_HUMAN	vacuolar H+ ATPase E1 isoform a	190					cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|cytosol|endosome|proton-transporting two-sector ATPase complex, catalytic domain	protein binding|proton-transporting ATPase activity, rotational mechanism			large_intestine(1)|central_nervous_system(1)	2		all_epithelial(15;0.206)		Lung(27;0.19)		TGGAAACCTTTATTTTACGAT	0.433													14	16	---	---	---	---	PASS
CLTCL1	8218	broad.mit.edu	37	22	19203623	19203623	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19203623G>A	uc002zpb.2	-	19	3138	c.3063C>T	c.(3061-3063)CAC>CAT	p.H1021H	CLTCL1_uc011agv.1_Silent_p.H1021H|CLTCL1_uc011agw.1_Silent_p.H1021H|CLTCL1_uc002zpe.2_5'Flank|CLTCL1_uc002zpd.1_5'Flank	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1	1021	Proximal segment.|Heavy chain arm.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					AGCCTCACCTGTGCTCGCTGA	0.478			T	?	ALCL								17	68	---	---	---	---	PASS
RIMBP3	85376	broad.mit.edu	37	22	20457269	20457269	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20457269C>A	uc002zsd.3	-	1	4518	c.4033G>T	c.(4033-4035)GCT>TCT	p.A1345S		NM_015672	NP_056487			RIMS binding protein 3												0	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			TCAAGGGCAGCCTTTTCCTGA	0.557													3	39	---	---	---	---	PASS
PRAME	23532	broad.mit.edu	37	22	22890587	22890587	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22890587T>A	uc002zwf.2	-	5	1588	c.1432A>T	c.(1432-1434)AGC>TGC	p.S478C	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.S462C|PRAME_uc010gtr.2_Missense_Mutation_p.S478C|PRAME_uc002zwg.2_Missense_Mutation_p.S478C|PRAME_uc002zwh.2_Missense_Mutation_p.S478C|PRAME_uc002zwi.2_Missense_Mutation_p.S478C|PRAME_uc002zwj.2_Missense_Mutation_p.S478C|PRAME_uc002zwk.2_Missense_Mutation_p.S478C	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	478	Mediates interaction with RARA.				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		CAGACCATGCTGGGCCGCCCC	0.582													58	224	---	---	---	---	PASS
TMEM211	255349	broad.mit.edu	37	22	25331525	25331525	+	Silent	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25331525G>A	uc003abk.1	-	3	190	c.165C>T	c.(163-165)ATC>ATT	p.I55I		NM_001001663	NP_001001663	Q6ICI0	TM211_HUMAN	transmembrane protein 211	126	Helical; (Potential).					integral to membrane					0						AGGCAAGGCCGATTGGGAAAA	0.517													4	177	---	---	---	---	PASS
BPIL2	254240	broad.mit.edu	37	22	32838705	32838705	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32838705A>T	uc003amn.2	-	6	608	c.608T>A	c.(607-609)ATT>AAT	p.I203N	BPIL2_uc010gwo.2_Missense_Mutation_p.I17N|BPIL2_uc011amb.1_Translation_Start_Site	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	203						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						TTCACTTGCAATAATGGGACA	0.438													4	96	---	---	---	---	PASS
MCM5	4174	broad.mit.edu	37	22	35799497	35799497	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35799497A>C	uc003anu.3	+	4	479	c.385A>C	c.(385-387)AAG>CAG	p.K129Q	MCM5_uc010gwr.2_5'UTR|MCM5_uc003anv.3_Intron	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	129					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1						GGTCATGCTCAAGTCGGACGC	0.453													80	151	---	---	---	---	PASS
IL2RB	3560	broad.mit.edu	37	22	37539628	37539628	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37539628A>C	uc003aqv.1	-	3	267	c.136T>G	c.(136-138)TGT>GGT	p.C46G		NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor	46	Extracellular (Potential).				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CTCCAGACACAGGAGATGTTG	0.592													28	105	---	---	---	---	PASS
PLA2G6	8398	broad.mit.edu	37	22	38531000	38531000	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38531000C>A	uc003auy.1	-	6	1025	c.889G>T	c.(889-891)GCA>TCA	p.A297S	PLA2G6_uc003auz.1_Missense_Mutation_p.A297S|PLA2G6_uc003ava.1_Missense_Mutation_p.A297S|PLA2G6_uc003avb.2_Missense_Mutation_p.A297S|PLA2G6_uc010gxk.1_RNA|PLA2G6_uc011ano.1_Missense_Mutation_p.A262S	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a	297	ANK 5.				cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	CTCACCTCTGCGTTCTTGGCC	0.657													43	65	---	---	---	---	PASS
APOBEC3D	140564	broad.mit.edu	37	22	39427729	39427729	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39427729A>G	uc011aoe.1	+	6	847	c.793A>G	c.(793-795)AGG>GGG	p.R265G	APOBEC3D_uc011aof.1_Missense_Mutation_p.R81G|APOBEC3D_uc003awu.3_Missense_Mutation_p.R81G|APOBEC3D_uc003awt.3_Missense_Mutation_p.R265G|APOBEC3D_uc010gxu.2_Missense_Mutation_p.R61G	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	265					negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0	Melanoma(58;0.04)					TCATGCAGAAAGGTGCTTCCT	0.577													162	242	---	---	---	---	PASS
CSF2RA	1438	broad.mit.edu	37	X	1422807	1422807	+	Intron	SNP	T	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1422807T>C	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	AACCTGTGTGTCTCTCCAGGT	0.373													132	241	---	---	---	---	PASS
GK	2710	broad.mit.edu	37	X	30737553	30737553	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30737553G>A	uc004dch.3	+	15	1251	c.1072G>A	c.(1072-1074)GTA>ATA	p.V358I	GK_uc010ngj.2_Missense_Mutation_p.V352I|GK_uc004dci.3_Missense_Mutation_p.V352I|GK_uc011mjz.1_Missense_Mutation_p.V153I|GK_uc011mka.1_Missense_Mutation_p.V195I|GK_uc010ngk.2_Missense_Mutation_p.V147I	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a	358					glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						TGCTAAAGAAGTAGGTACTTC	0.328													28	51	---	---	---	---	PASS
NYX	60506	broad.mit.edu	37	X	41307170	41307170	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41307170C>A	uc004dfh.2	+	1	458	c.28C>A	c.(28-30)CTT>ATT	p.L10I	NYX_uc011mku.1_Missense_Mutation_p.L5I	NM_022567	NP_072089	Q9GZU5	NYX_HUMAN	nyctalopin precursor	10					response to stimulus|visual perception	intracellular|proteinaceous extracellular matrix				lung(2)	2						GTTGGTCCTGCTTCTGCATGG	0.597													3	39	---	---	---	---	PASS
UBA1	7317	broad.mit.edu	37	X	47072255	47072255	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47072255G>A	uc004dhj.3	+	22	2790	c.2639G>A	c.(2638-2640)CGG>CAG	p.R880Q	UBA1_uc004dhk.3_Missense_Mutation_p.R880Q|UBA1_uc004dhm.2_Missense_Mutation_p.R328Q	NM_153280	NP_695012	P22314	UBA1_HUMAN	ubiquitin-activating enzyme E1	880					cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity			ovary(1)	1						TCTGCAGACCGGCACAAGGTG	0.493													12	55	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47101681	47101681	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47101681G>T	uc004dhp.2	+	10	1509	c.1509G>T	c.(1507-1509)ATG>ATT	p.M503I	USP11_uc004dhq.2_Missense_Mutation_p.M230I	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	503					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TTATCCCCATGGATCCGCGCC	0.542													14	22	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50127723	50127723	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50127723C>A	uc010njr.1	-	16	2507	c.2447G>T	c.(2446-2448)CGA>CTA	p.R816L		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	816					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					CTTACGGCGTCGTGGGCTTGT	0.398													94	156	---	---	---	---	PASS
ATP7A	538	broad.mit.edu	37	X	77244009	77244009	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77244009C>T	uc004ecx.3	+	3	552	c.392C>T	c.(391-393)CCT>CTT	p.P131L	ATP7A_uc004ecw.2_Missense_Mutation_p.P131L	NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	131	Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						ACAATAATCCCTTCTATAGTG	0.413													195	313	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154158967	154158967	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154158967T>A	uc004fmt.2	-	14	3269	c.3098A>T	c.(3097-3099)CAC>CTC	p.H1033L		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	1033	B.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GCCATCAATGTGAGTCTTTCT	0.323													80	157	---	---	---	---	PASS
MASP2	10747	broad.mit.edu	37	1	11106454	11106455	+	Intron	INS	-	G	G	rs142927705	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11106454_11106455insG	uc001aru.2	-						MASP2_uc001arv.2_Intron|MASP2_uc001arw.2_3'UTR|MASP2_uc001arx.1_Intron	NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform						complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		AGGTCACGGCTGTTTTGGTCTT	0.535													3	3	---	---	---	---	
SPATA21	374955	broad.mit.edu	37	1	16729987	16729987	+	Intron	DEL	C	-	-	rs57948110		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16729987delC	uc001ayn.2	-						SPATA21_uc001ayl.1_Intron|SPATA21_uc010occ.1_Intron	NM_198546	NP_940948	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding			ovary(2)|breast(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		tcttttttttctttttttttt	0.010													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20952456	20952456	+	IGR	DEL	A	-	-	rs151080214		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20952456delA								CDA (7058 upstream) : PINK1 (7492 downstream)																							gccttggaagaaaaggaaggg	0.000													4	2	---	---	---	---	
ALPL	249	broad.mit.edu	37	1	21904263	21904263	+	3'UTR	DEL	C	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21904263delC	uc001bet.2	+	12					ALPL_uc010odn.1_3'UTR|ALPL_uc010odo.1_3'UTR|ALPL_uc010odp.1_3'UTR|ALPL_uc001beu.3_3'UTR	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase						response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	AGAAAGGGGACCCAAGAAACC	0.642													5	3	---	---	---	---	
GPBP1L1	60313	broad.mit.edu	37	1	46095130	46095131	+	Intron	INS	-	G	G	rs113420988		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46095130_46095131insG	uc001coq.2	-						GPBP1L1_uc001coo.2_Intron	NM_021639	NP_067652	Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					AGGTAATCCCCCCCCCCCCCAC	0.470													3	8	---	---	---	---	
FAAH	2166	broad.mit.edu	37	1	46872228	46872228	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46872228delT	uc001cpu.2	+						FAAH_uc001cpv.2_Intron	NM_001441	NP_001432	O00519	FAAH1_HUMAN	fatty acid amide hydrolase						fatty acid catabolic process	cytoplasm|cytoskeleton|endomembrane system|integral to membrane|organelle membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|fatty acid amide hydrolase activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	ATCCTCAGGCTTTTTTTTTTT	0.328													4	2	---	---	---	---	
RPF1	80135	broad.mit.edu	37	1	84948418	84948418	+	Intron	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84948418delA	uc001djv.3	+							NM_025065	NP_079341	Q9H9Y2	RPF1_HUMAN	RNA processing factor 1						rRNA processing|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|rRNA binding				0						CAGATTGTTTAAAAAAAAAAA	0.333													3	3	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669701	+	Intron	DEL	T	-	-	rs77020055		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701delT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCttttttttttt	0.149													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148855824	148855826	+	IGR	DEL	GGG	-	-	rs59129261		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855824_148855826delGGG								NBPF16 (97513 upstream) : LOC645166 (72460 downstream)																							gcgggggggcgggaaaaagccgc	0.360													4	2	---	---	---	---	
NEK7	140609	broad.mit.edu	37	1	198247384	198247385	+	Intron	INS	-	TCT	TCT	rs146890152	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198247384_198247385insTCT	uc001gun.3	+							NM_133494	NP_598001	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4						ATGTAAATTAATCTGCTTGACT	0.267													3	3	---	---	---	---	
SDCCAG8	10806	broad.mit.edu	37	1	243456562	243456562	+	Intron	DEL	C	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243456562delC	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron|SDCCAG8_uc001hzx.2_Intron|SDCCAG8_uc001hzy.1_Intron	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TCTTTTTTTtctttttctctt	0.199													27	12	---	---	---	---	
OR2T35	403244	broad.mit.edu	37	1	248801602	248801603	+	Frame_Shift_Ins	INS	-	CA	CA			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248801602_248801603insCA	uc001ies.1	-	1	957_958	c.957_958insTG	c.(955-960)GTGATCfs	p.V319fs		NM_001001827	NP_001001827	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T,	319_320	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTTCCTGATCACAGTCGCCA	0.545													6	3	---	---	---	---	
SOS1	6654	broad.mit.edu	37	2	39238036	39238037	+	Intron	INS	-	CTT	CTT	rs145279921		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39238036_39238037insCTT	uc002rrk.3	-						SOS1_uc002rrj.3_Intron	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1						apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				ttttttttaaactttttttttt	0.139									Noonan_syndrome				4	3	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	88091357	88091357	+	Intron	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88091357delA	uc010fhc.1	-						RGPD1_uc002ssm.1_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						accctgtcttaaaaaaaaaaa	0.194													2	5	---	---	---	---	
CD28	940	broad.mit.edu	37	2	204571184	204571190	+	5'Flank	DEL	TAGAAGT	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204571184_204571190delTAGAAGT	uc002vah.3	+						CD28_uc002vag.1_5'Flank|CD28_uc010zio.1_5'Flank|CD28_uc010ftx.2_5'Flank|CD28_uc002vaj.3_5'Flank	NM_006139	NP_006130	P10747	CD28_HUMAN	CD28 antigen precursor						cell surface receptor linked signaling pathway|cytokine biosynthetic process|humoral immune response|positive regulation of anti-apoptosis|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation of translation|positive regulation of viral genome replication|regulation of defense response to virus by virus|regulatory T cell differentiation|T cell costimulation|viral reproduction	cytosol|external side of plasma membrane|integral to plasma membrane	coreceptor activity|protease binding|SH3/SH2 adaptor activity				0						TCTTTAAAAATAGAAGTAAAAGTCTAA	0.362													4	2	---	---	---	---	
C2orf80	389073	broad.mit.edu	37	2	209030330	209030331	+	3'UTR	INS	-	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209030330_209030331insT	uc002vcr.2	-	9					CRYGA_uc002vcq.3_5'Flank	NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073											skin(1)	1						TAAGGTCACAGTTTTTTTTTTT	0.347													5	4	---	---	---	---	
C3orf24	115795	broad.mit.edu	37	3	10146617	10146621	+	Intron	DEL	TTATT	-	-	rs113292025		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10146617_10146621delTTATT	uc003buz.2	-						C3orf24_uc003bva.1_Intron	NM_173472	NP_775743	Q96PS1	CC024_HUMAN	hypothetical protein LOC115795												0				OV - Ovarian serous cystadenocarcinoma(96;0.196)		ATATTAGTAAttattttattttatt	0.180													4	3	---	---	---	---	
CTDSPL	10217	broad.mit.edu	37	3	37988456	37988456	+	Intron	DEL	G	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37988456delG	uc003chg.2	+						CTDSPL_uc003chh.2_Intron	NM_001008392	NP_001008393	O15194	CTDSL_HUMAN	small CTD phosphatase 3 isoform 1							nucleus	metal ion binding|phosphoprotein phosphatase activity				0		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		TCTGGGGTCTGGGGGGCAACT	0.493													5	3	---	---	---	---	
MAP4	4134	broad.mit.edu	37	3	47956039	47956040	+	Intron	INS	-	A	A	rs75464745		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47956039_47956040insA	uc003csb.2	-						MAP4_uc003csc.3_Intron|MAP4_uc011bbf.1_Intron|MAP4_uc003csf.3_Intron	NM_002375	NP_002366	P27816	MAP4_HUMAN	microtubule-associated protein 4 isoform 1						negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)		gactctgtctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
MST1	4485	broad.mit.edu	37	3	49724049	49724049	+	Intron	DEL	C	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49724049delC	uc003cxg.2	-						MST1_uc011bcs.1_Intron|MST1_uc010hkx.2_Intron|MST1_uc011bct.1_Intron|MST1_uc011bcu.1_Intron|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth						proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCTCTTACCTCCCCGGCCAAG	0.672													5	3	---	---	---	---	
MORC1	27136	broad.mit.edu	37	3	108703391	108703392	+	Intron	INS	-	GG	GG	rs145625526	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108703391_108703392insGG	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TGAAAAGGTTTGGGGGTAAGGT	0.337													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117134395	117134396	+	IGR	DEL	AC	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117134395_117134396delAC								LOC285194 (698510 upstream) : None (None downstream)																							acactcacatacacacacaACC	0.054													5	6	---	---	---	---	
A4GNT	51146	broad.mit.edu	37	3	137850015	137850015	+	Frame_Shift_Del	DEL	G	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137850015delG	uc003ers.2	-	2	286	c.84delC	c.(82-84)AGCfs	p.S28fs		NM_016161	NP_057245	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	28	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity			central_nervous_system(1)	1						AGAAGAGGCAGCTGGACTTCA	0.557													72	63	---	---	---	---	
SRP72	6731	broad.mit.edu	37	4	57340709	57340709	+	Intron	DEL	T	-	-	rs112716931		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57340709delT	uc003hbv.2	+						SRP72_uc010ihe.2_Intron|SRP72_uc003hbw.1_Intron	NM_006947	NP_008878	O76094	SRP72_HUMAN	signal recognition particle 72kDa						response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)					tttctctctcttttttttttt	0.149													5	3	---	---	---	---	
CLPTM1L	81037	broad.mit.edu	37	5	1342124	1342125	+	Intron	INS	-	GTGT	GTGT	rs71598674		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1342124_1342125insGTGT	uc003jch.2	-						CLPTM1L_uc003jcg.2_5'Flank	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CTTTACGAGTCgtgtgtgtgtg	0.416													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1649912	1649913	+	IGR	DEL	TC	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1649912_1649913delTC								LOC728613 (15792 upstream) : MRPL36 (148587 downstream)																							tttctctctttctctctctctc	0.000													4	2	---	---	---	---	
CCT5	22948	broad.mit.edu	37	5	10250047	10250047	+	5'Flank	DEL	C	-	-	rs2607301		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10250047delC	uc003jeq.2	+						FAM173B_uc003jeo.2_5'Flank|FAM173B_uc003jep.2_5'Flank|FAM173B_uc010itr.2_5'Flank|CCT5_uc011cmq.1_5'Flank|CCT5_uc003jer.2_5'Flank|CCT5_uc010its.2_5'Flank|CCT5_uc011cmr.1_5'Flank|CCT5_uc011cms.1_5'Flank|CCT5_uc011cmt.1_5'Flank	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)						'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2						aaaaaaaaaaCCGGAAATGGG	0.423													4	8	---	---	---	---	
ST8SIA4	7903	broad.mit.edu	37	5	100151125	100151128	+	Intron	DEL	CTTC	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100151125_100151128delCTTC	uc003knk.2	-							NM_005668	NP_005659	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			large_intestine(1)|central_nervous_system(1)	2		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		tccttcctttcttccttccttcct	0.142													4	2	---	---	---	---	
YTHDC2	64848	broad.mit.edu	37	5	112927991	112927991	+	Intron	DEL	G	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112927991delG	uc003kqn.2	+							NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		ATATGCACATGGGAAACAGGG	0.313													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123556070	123556070	+	IGR	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123556070delA								CSNK1G3 (603608 upstream) : ZNF608 (416540 downstream)																							TTAACTATACAAAAAAAAAAA	0.363													4	2	---	---	---	---	
UHRF1BP1	54887	broad.mit.edu	37	6	34791316	34791317	+	Intron	INS	-	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34791316_34791317insT	uc003oju.3	+						UHRF1BP1_uc010jvm.1_Intron|UHRF1BP1_uc010jvn.2_Intron	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1											ovary(3)	3						ttcttcttctgttttttttttt	0.000													4	2	---	---	---	---	
KIF6	221458	broad.mit.edu	37	6	39327973	39327973	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39327973delT	uc003oot.2	-						KIF6_uc003oos.2_Intron|KIF6_uc010jwz.1_Intron|KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						TCAGGCAGAATTTTAGGCATG	0.453													6	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51893317	51893318	+	Intron	INS	-	T	T	rs5876250		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51893317_51893318insT	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCTAACAACTAttttttttttt	0.153													4	3	---	---	---	---	
GPR31	2853	broad.mit.edu	37	6	167571409	167571410	+	5'Flank	INS	-	C	C			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167571409_167571410insC	uc011egq.1	-							NM_005299	NP_005290	O00270	GPR31_HUMAN	G protein-coupled receptor 31							integral to plasma membrane	G-protein coupled receptor activity				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		AAAGGCCTTTTCCTGCCACAGA	0.490													2	4	---	---	---	---	
HECW1	23072	broad.mit.edu	37	7	43276761	43276761	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43276761delT	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						ggtaggtaggtaggtaggtag	0.199													6	3	---	---	---	---	
GRB10	2887	broad.mit.edu	37	7	50778445	50778445	+	Intron	DEL	C	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50778445delC	uc003tpi.2	-						GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					CGGGGTATCTCCACACCTTCC	0.512									Russell-Silver_syndrome				37	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65226819	65226819	+	Intron	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226819delA	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		AATGGGGACCAAAAAAAAAAT	0.353													5	3	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66772495	66772495	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66772495delT	uc003tvt.3	+						STAG3L4_uc010laj.2_Intron	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				GCTTGATTCCTTTTTTTTTTT	0.274													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	76179245	76179245	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76179245delT	uc003ufr.2	+						uc003ufs.1_Intron					Homo sapiens cDNA clone IMAGE:5165566.																		TTTGGGGACCTTAGAGTGTGG	0.637													4	2	---	---	---	---	
ZNF394	84124	broad.mit.edu	37	7	99097021	99097022	+	Intron	INS	-	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99097021_99097022insA	uc003uqs.2	-						ZNF394_uc003uqt.2_Intron|ZNF394_uc003uqu.1_Intron	NM_032164	NP_115540	Q53GI3	ZN394_HUMAN	zinc finger protein 394						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					agaacaacaagaaaaaaaaaaa	0.168													3	3	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104719584	104719584	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104719584delT	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron|MLL5_uc003vco.1_Intron|MLL5_uc010ljd.1_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						CTATGAAGTCttttttttttt	0.204													4	2	---	---	---	---	
DEFB4A	1673	broad.mit.edu	37	8	7752467	7752467	+	Intron	DEL	T	-	-	rs113684211		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7752467delT	uc003wsd.2	+							NM_004942	NP_004933	O15263	DFB4A_HUMAN	defensin, beta 4 precursor						chemotaxis|defense response to bacterium|G-protein coupled receptor protein signaling pathway|immune response	extracellular region					0						cctctctctctttttttctgt	0.174													4	2	---	---	---	---	
SLC20A2	6575	broad.mit.edu	37	8	42287889	42287890	+	Intron	INS	-	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42287889_42287890insT	uc010lxl.2	-						SLC20A2_uc010lxm.2_Intron|SLC20A2_uc003xpe.2_Intron|SLC20A2_uc011lcu.1_Intron	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2						interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			gtttttctttctttttttttga	0.079													4	4	---	---	---	---	
SDR16C5	195814	broad.mit.edu	37	8	57219251	57219251	+	Frame_Shift_Del	DEL	C	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57219251delC	uc003xsy.1	-	5	1332	c.694delG	c.(694-696)GAAfs	p.E232fs	SDR16C5_uc010lyk.1_Frame_Shift_Del_p.E232fs|SDR16C5_uc010lyl.1_Frame_Shift_Del_p.E188fs	NM_138969	NP_620419	Q8N3Y7	RDHE2_HUMAN	epidermal retinal dehydrogenase 2	232					detection of light stimulus involved in visual perception|keratinocyte proliferation|retinal metabolic process|retinol metabolic process	endoplasmic reticulum membrane|integral to membrane|integral to membrane of membrane fraction	binding|retinol dehydrogenase activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GTACAACCTTCAAACATTCCA	0.303													113	49	---	---	---	---	
FAM92A1	137392	broad.mit.edu	37	8	94731097	94731098	+	Intron	INS	-	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94731097_94731098insT	uc010maq.2	+						FAM92A1_uc003yfv.3_Intron|FAM92A1_uc003yfx.3_Intron|FAM92A1_uc003yfw.3_Intron|FAM92A1_uc010mar.2_Intron	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392												0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TGATTAATATCttttttttttt	0.149													5	3	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134129131	134129131	+	Intron	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134129131delA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ggggaaagttaaaaaaaaaaa	0.055													3	4	---	---	---	---	
ANKRD20A4	728747	broad.mit.edu	37	9	69389918	69389918	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69389918delT	uc004afn.2	+						ANKRD20A4_uc010mnw.1_Intron	NM_001098805	NP_001092275	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4												0						GAATTATTAATTTTTTTCTGC	0.274													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	123007117	123007117	+	IGR	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123007117delA								DBC1 (875378 upstream) : MIR147 (140 downstream)																							GCATGAATATAAAAAAAAACT	0.279													8	11	---	---	---	---	
GAPVD1	26130	broad.mit.edu	37	9	128069548	128069548	+	Intron	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128069548delA	uc010mwx.2	+						GAPVD1_uc004bpo.2_Intron|GAPVD1_uc011lzs.1_Intron|GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc010mwy.1_Intron	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						actttgtctcaaaaaaaaaaa	0.104													5	3	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14709868	14709872	+	Intron	DEL	AGTAG	-	-	rs113901025		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14709868_14709872delAGTAG	uc001ina.1	-						FAM107B_uc010qbu.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						ATAAATGCCAAGTAGAGTAGAGTAA	0.434													4	2	---	---	---	---	
SYT15	83849	broad.mit.edu	37	10	46968899	46968912	+	Intron	DEL	CACACACACACACA	-	-	rs72038340	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46968899_46968912delCACACACACACACA	uc001jea.2	-						SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_Intron|SYT15_uc010qfp.1_5'Flank	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a							integral to membrane|plasma membrane					0						cacacacacgcacacacacacacacacacacaca	0.271													8	4	---	---	---	---	
C10orf71	118461	broad.mit.edu	37	10	50534969	50534970	+	In_Frame_Ins	INS	-	ACACACACACAC	ACACACACACAC	rs66701434		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50534969_50534970insACACACACACAC	uc010qgp.1	+	4	2407_2408	c.2068_2069insACACACACACAC	c.(2068-2070)AAC>AACACACACACACAC	p.702_703insTHTH		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	Error:Variant_position_missing_in_Q711Q0_after_alignment											0						CAAAACAAGCAacacacacaca	0.406													4	2	---	---	---	---	
ARHGAP19	84986	broad.mit.edu	37	10	99019585	99019586	+	Intron	INS	-	TGTTTTGTTT	TGTTTTGTTT	rs147834614	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99019585_99019586insTGTTTTGTTT	uc001knb.2	-						ARHGAP19_uc001kmy.2_Intron|ARHGAP19_uc001kna.2_Intron|ARHGAP19_uc009xvi.2_Intron|ARHGAP19_uc009xvj.2_Intron|ARHGAP19_uc009xvk.2_Intron	NM_032900	NP_116289	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	GTPase activator activity				0		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		attaaaaaacctgttttgtttt	0.104													4	2	---	---	---	---	
PLEKHA1	59338	broad.mit.edu	37	10	124189011	124189018	+	Intron	DEL	TGTGTGTG	-	-	rs140551676		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124189011_124189018delTGTGTGTG	uc001lge.1	+						PLEKHA1_uc001lgf.1_Intron|PLEKHA1_uc001lgg.1_Intron	NM_001001974	NP_001001974	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A						B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CTGCTGCCTTtgtgtgtgtgtgtgtgtg	0.337													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27505351	27505352	+	IGR	INS	-	AAA	AAA	rs11030023	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27505351_27505352insAAA								LGR4 (11017 upstream) : LIN7C (10619 downstream)																							aacaaacaaacaaaaaaacaCA	0.218													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	47212650	47212651	+	IGR	INS	-	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47212650_47212651insA								PACSIN3 (4692 upstream) : DDB2 (23842 downstream)																							aactccgtctcaaaaaaaaaag	0.084													6	3	---	---	---	---	
SLC22A12	116085	broad.mit.edu	37	11	64358835	64358835	+	5'UTR	DEL	C	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64358835delC	uc001oam.1	+	1					SLC22A12_uc009ypr.1_5'UTR|SLC22A12_uc001oal.1_5'UTR|SLC22A12_uc009yps.1_5'UTR|SLC22A12_uc001oan.1_5'UTR|SLC22A12_uc009ypt.2_5'Flank	NM_144585	NP_653186	Q96S37	S22AC_HUMAN	urate anion exchanger 1 isoform a						cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity			ovary(1)	1						GTTGGAGCCACCCCAAGTGAC	0.637													10	5	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69998440	69998441	+	Intron	INS	-	AA	AA	rs71463662		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69998440_69998441insAA	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						gactccatctcaaaaaaaaaaa	0.119													9	5	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73077165	73077166	+	Intron	DEL	TG	-	-	rs112101560		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73077165_73077166delTG	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						CTAGGATAGTtgtgtgtgtgtg	0.386													4	3	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	12131480	12131481	+	Intron	INS	-	AGA	AGA	rs12313511		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12131480_12131481insAGA	uc001raa.1	+							NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				gagagacagagggggggggagg	0.124			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76082490	76082491	+	IGR	INS	-	T	T	rs141632958		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76082490_76082491insT								KRR1 (177072 upstream) : PHLDA1 (336737 downstream)																							cattctTTTTCTTTTTTTTTTT	0.218													8	4	---	---	---	---	
HCFC2	29915	broad.mit.edu	37	12	104487554	104487555	+	Intron	INS	-	T	T	rs11411208		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104487554_104487555insT	uc001tkj.3	+						HCFC2_uc009zul.2_Intron	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2						regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						AAATGAGGCAATTTTTTTTTTT	0.322													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145990	119145991	+	IGR	INS	-	TGA	TGA			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145990_119145991insTGA								SUDS3 (290151 upstream) : SRRM4 (273405 downstream)																							gatggtggtggtgatggtggtg	0.000													4	3	---	---	---	---	
MTMR6	9107	broad.mit.edu	37	13	25831641	25831642	+	Intron	INS	-	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25831641_25831642insA	uc001uqf.3	-						MTMR6_uc001uqe.1_Intron	NM_004685	NP_004676	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6							cytoplasm|nuclear envelope	calcium-activated potassium channel activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			ovary(2)|skin(2)	4		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		agcaaacaaacaaaaaaaaaac	0.248													4	2	---	---	---	---	
GZMB	3002	broad.mit.edu	37	14	25101878	25101879	+	Intron	INS	-	T	T	rs144943417	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25101878_25101879insT	uc001wps.2	-						GZMB_uc010ama.2_Intron|GZMB_uc010amb.2_Intron	NM_004131	NP_004122	P10144	GRAB_HUMAN	granzyme B precursor						activation of pro-apoptotic gene products|cleavage of lamin|cytolysis|induction of apoptosis by intracellular signals	cytosol|immunological synapse|nucleus	protein binding|serine-type endopeptidase activity				0				GBM - Glioblastoma multiforme(265;0.028)		AGTTTGTATTCTATGCCAAAGT	0.495													3	4	---	---	---	---	
RASGRP1	10125	broad.mit.edu	37	15	38792549	38792549	+	Intron	DEL	G	-	-	rs12904148	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38792549delG	uc001zke.3	-						RASGRP1_uc010bbe.2_Intron|RASGRP1_uc010bbf.2_Intron|RASGRP1_uc010bbg.2_Intron|RASGRP1_uc001zkd.3_Intron	NM_005739	NP_005730	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 isoform a						cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding			large_intestine(1)|ovary(1)	2		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GGttttttttgttttgttttt	0.179													8	5	---	---	---	---	
ZNF280D	54816	broad.mit.edu	37	15	57138419	57138420	+	Intron	INS	-	A	A			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57138419_57138420insA	uc002adw.1	-							NM_001002843	NP_001002843	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		tgatacactacaaaaaaaaaat	0.084													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60165316	60165317	+	IGR	INS	-	T	T			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60165316_60165317insT								BNIP2 (183674 upstream) : FOXB1 (131104 downstream)																							TCAGTTTTTGCTTTTTTTTACA	0.376													11	6	---	---	---	---	
IGDCC3	9543	broad.mit.edu	37	15	65628268	65628268	+	Frame_Shift_Del	DEL	G	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65628268delG	uc002aos.2	-	3	688	c.436delC	c.(436-438)CAGfs	p.Q146fs		NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	146	Extracellular (Potential).|Ig-like C2-type 2.									ovary(3)	3						ACGGTGGCCTGGGGATGCACG	0.597													56	37	---	---	---	---	
CP110	9738	broad.mit.edu	37	16	19553060	19553063	+	Intron	DEL	GAAG	-	-	rs149433681		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19553060_19553063delGAAG	uc002dgl.3	+						CP110_uc002dgk.3_Intron			O43303	CP110_HUMAN	RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;						centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0						AGGGAAGGGAGAAGGAAGGAAGGA	0.196													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33365420	33365420	+	IGR	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33365420delA								SLC6A10P (468957 upstream) : MIR1826 (600088 downstream)																							TACAAACTATAAAAAAACAGA	0.358													8	4	---	---	---	---	
CRISPLD2	83716	broad.mit.edu	37	16	84883327	84883328	+	Intron	INS	-	TT	TT	rs145902233	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84883327_84883328insTT	uc010voh.1	+						CRISPLD2_uc010vog.1_Intron|CRISPLD2_uc002fio.2_Intron|CRISPLD2_uc002fim.2_Intron|CRISPLD2_uc002fin.3_Intron	NM_031476	NP_113664	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain							extracellular region|transport vesicle					0						ACTACAAACtcttttttttctt	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255950	87255951	+	Intron	INS	-	CAT	CAT			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255950_87255951insCAT	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		accaccatcaccaccaccacca	0.000													4	2	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49084472	49084473	+	Intron	DEL	GT	-	-	rs35415974		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49084472_49084473delGT	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CAACATTAGGgtgtgtgtgtgt	0.356													11	7	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482169	59482169	+	Intron	DEL	C	-	-	rs35619711		TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482169delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R354fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						GAGGTGGCGGCGGGGGGTCCT	0.706													4	3	---	---	---	---	
RPRD1A	55197	broad.mit.edu	37	18	33607447	33607448	+	Intron	INS	-	TA	TA	rs142934701	by1000genomes	TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33607447_33607448insTA	uc002kzf.1	-						RPRD1A_uc002kze.1_Intron|RPRD1A_uc002kzg.2_Intron|RPRD1A_uc010dmw.2_Intron|RPRD1A_uc010dmx.2_Intron	NM_018170	NP_060640	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing											ovary(1)|breast(1)	2						GGAGGCTAtactatgttaggtg	0.168													7	7	---	---	---	---	
OR10H3	26532	broad.mit.edu	37	19	15852089	15852089	+	5'Flank	DEL	C	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15852089delC	uc010xoq.1	+							NM_013938	NP_039226	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ccagaaagTTCCACCAGTTGT	0.204													9	12	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16623674	16623674	+	Intron	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16623674delA	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						gtctcaaaccaaaaaaaaaaa	0.204													5	4	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16625198	16625198	+	Intron	DEL	A	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16625198delA	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						ctgtctccagaaaaaaaaaaa	0.284													4	2	---	---	---	---	
TPTE	7179	broad.mit.edu	37	21	10943201	10943202	+	Intron	DEL	TG	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10943201_10943202delTG	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		cgtgcgtgcatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
CSNK1E	1454	broad.mit.edu	37	22	38695782	38695782	+	Intron	DEL	G	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38695782delG	uc003avj.2	-						CSNK1E_uc003avk.2_Intron|CSNK1E_uc003avl.1_Intron|CSNK1E_uc003avm.1_Intron|CSNK1E_uc003avo.2_Intron|CSNK1E_uc003avp.1_Intron|CSNK1E_uc003avq.1_Intron	NM_152221	NP_689407	P49674	KC1E_HUMAN	casein kinase 1 epsilon						DNA repair|G2/M transition of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|signal transduction	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Melanoma(58;0.045)					caaagtgccaggactgcaggc	0.219													31	26	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53653172	53653173	+	Intron	DEL	GT	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53653172_53653173delGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						ATACATACACgtgtgtgtgtgt	0.272													4	2	---	---	---	---	
NONO	4841	broad.mit.edu	37	X	70512052	70512052	+	Intron	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70512052delT	uc004dzo.2	+						BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Intron|NONO_uc004dzp.2_Intron|NONO_uc011mpv.1_Intron|NONO_uc004dzq.2_5'Flank	NM_001145408	NP_001138880	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding						DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)					CCTTTGGAACttttttttttt	0.174			T	TFE3	papillary renal cancer								2	4	---	---	---	---	
XIST	7503	broad.mit.edu	37	X	73067240	73067240	+	RNA	DEL	T	-	-			TCGA-60-2723-01A-01D-1522-08	TCGA-60-2723-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73067240delT	uc004ebm.1	-	1		c.5349delA				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						ATTGTCTTACttttttttttt	0.239													4	2	---	---	---	---	
