Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AJAP1	55966	broad.mit.edu	37	1	4772135	4772135	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4772135G>T	uc001alm.1	+	2	586	c.205G>T	c.(205-207)GGA>TGA	p.G69*	AJAP1_uc001aln.2_Nonsense_Mutation_p.G69*	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN	adherens junction associated protein 1	69	Extracellular (Potential).				cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		TTTTAGGAGTGGACAGCCAGC	0.622													10	20	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12918947	12918947	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12918947T>A	uc001aum.1	+	2	170	c.83T>A	c.(82-84)ATG>AAG	p.M28K		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	28											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATCTCTGCCATGGAGGAGCTG	0.607													45	167	---	---	---	---	PASS
EPB41	2035	broad.mit.edu	37	1	29438932	29438932	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29438932C>T	uc001brm.1	+	18	2475	c.2468C>T	c.(2467-2469)ACA>ATA	p.T823I	EPB41_uc001brg.1_Missense_Mutation_p.T600I|EPB41_uc001brh.1_Missense_Mutation_p.T547I|EPB41_uc001bri.1_Missense_Mutation_p.T734I|EPB41_uc001brj.1_Missense_Mutation_p.T560I|EPB41_uc001brl.1_Missense_Mutation_p.T790I|EPB41_uc009vtl.1_Missense_Mutation_p.T517I|EPB41_uc009vtm.1_Missense_Mutation_p.T402I|EPB41_uc009vtn.1_RNA	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	823	Carboxyl-terminal (CTD).				blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		ATTGTGATCACAGGAGATGCT	0.448													35	97	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34254318	34254318	+	Intron	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34254318C>A	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTCAGGCTGGCAGGAGAGAGA	0.517													11	64	---	---	---	---	PASS
GBP4	115361	broad.mit.edu	37	1	89652777	89652777	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89652777C>A	uc001dnb.2	-	9	1535	c.1419G>T	c.(1417-1419)GAG>GAT	p.E473D		NM_052941	NP_443173	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	473						cytoplasm	GTP binding|GTPase activity				0				all cancers(265;0.00723)|Epithelial(280;0.0291)		TCTGGAGGACCTCGTTTGCCT	0.473													20	92	---	---	---	---	PASS
CASQ2	845	broad.mit.edu	37	1	116283338	116283338	+	Intron	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116283338T>C	uc001efx.3	-						CASQ2_uc010owu.1_Intron	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor						heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCACTGTGTATAAATACTTAC	0.468													3	47	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118534064	118534064	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118534064C>T	uc001ehk.2	-	37	5517	c.5449G>A	c.(5449-5451)GCT>ACT	p.A1817T		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1817						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		AGATCAGCAGCATTGCCTCTC	0.363													31	86	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120506351	120506351	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120506351A>G	uc001eik.2	-	11	2017	c.1761T>C	c.(1759-1761)GGT>GGC	p.G587G	NOTCH2_uc001eil.2_Silent_p.G587G|NOTCH2_uc001eim.3_Silent_p.G504G	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	587	Extracellular (Potential).|EGF-like 15; calcium-binding (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGAATCAATACCATCCTGAC	0.488			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				27	288	---	---	---	---	PASS
DCST1	149095	broad.mit.edu	37	1	155007172	155007172	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155007172A>G	uc001fgn.1	+	4	327	c.231A>G	c.(229-231)GAA>GAG	p.E77E	DCST2_uc001fgm.2_5'Flank|DCST2_uc009wpb.2_5'Flank|DCST1_uc010per.1_Silent_p.E102E|DCST1_uc010pes.1_Intron	NM_152494	NP_689707	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1 isoform 1	77	Extracellular (Potential).					integral to membrane	zinc ion binding			ovary(1)|skin(1)	2	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TCTACGAAGAACAGAAGATTA	0.542													130	123	---	---	---	---	PASS
SCAMP3	10067	broad.mit.edu	37	1	155231452	155231452	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155231452C>T	uc001fjs.2	-	2	393	c.140G>A	c.(139-141)CGG>CAG	p.R47Q	RAG1AP1_uc010pey.1_Intron|SCAMP3_uc001fjr.2_5'Flank|SCAMP3_uc001fju.2_Missense_Mutation_p.R47Q|SCAMP3_uc001fjv.2_Missense_Mutation_p.R47Q|SCAMP3_uc001fjt.2_Intron	NM_005698	NP_005689	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3 isoform 1	47	Cytoplasmic (Potential).				post-Golgi vesicle-mediated transport|protein transport	integral to membrane				ovary(3)	3	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCTCACCTCCCGGGTCTCAAA	0.572													135	121	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158632626	158632626	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158632626G>A	uc001fst.1	-	17	2529	c.2330C>T	c.(2329-2331)GCT>GTT	p.A777V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	777	Spectrin 8.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTCTTTCAGAGCTTCAAATCG	0.473													86	69	---	---	---	---	PASS
ATF6	22926	broad.mit.edu	37	1	161790926	161790926	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161790926A>G	uc001gbr.2	+	9	1229	c.1162A>G	c.(1162-1164)ATA>GTA	p.I388V	ATF6_uc001gbq.1_Missense_Mutation_p.I388V	NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6	388	Helical; Signal-anchor for type II membrane protein; (Potential).				positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			ATTGGCATTTATAATACTGAA	0.318													6	229	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176525526	176525526	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176525526A>T	uc001gkz.2	+	2	1232	c.68A>T	c.(67-69)AAC>ATC	p.N23I	PAPPA2_uc001gky.1_Missense_Mutation_p.N23I|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	23					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TGTTCTGCCAACTCTGAGCTG	0.512													155	162	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564569	176564569	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564569G>T	uc001gkz.2	+	3	2993	c.1829G>T	c.(1828-1830)GGT>GTT	p.G610V	PAPPA2_uc001gky.1_Missense_Mutation_p.G610V|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	610	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TATGATGGGGGTGACTGCCGC	0.587													73	55	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186277633	186277633	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186277633C>A	uc001gru.3	+	7	2833	c.2782C>A	c.(2782-2784)CCT>ACT	p.P928T	PRG4_uc001grt.3_Missense_Mutation_p.P887T|PRG4_uc009wyl.2_Missense_Mutation_p.P835T|PRG4_uc009wym.2_Missense_Mutation_p.P794T|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	928					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACGTACTACACCTGAAACTAC	0.413													5	282	---	---	---	---	PASS
IGFN1	91156	broad.mit.edu	37	1	201196167	201196167	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201196167C>A	uc001gwc.2	+	12	3196	c.2424C>A	c.(2422-2424)TTC>TTA	p.F808L	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3						TCACCTGGTTCAAGAATGACC	0.677													78	66	---	---	---	---	PASS
DTL	51514	broad.mit.edu	37	1	212273761	212273761	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212273761C>T	uc009xdc.2	+	14	1743	c.1429C>T	c.(1429-1431)CGG>TGG	p.R477W	DTL_uc010ptb.1_Missense_Mutation_p.R435W|DTL_uc001hiz.3_Missense_Mutation_p.R206W	NM_016448	NP_057532	Q9NZJ0	DTL_HUMAN	denticleless homolog	477					DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		TGCCAAGGCCCGGTCTCCCAT	0.532													22	168	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216737608	216737608	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216737608G>A	uc001hkw.1	-	5	981	c.815C>T	c.(814-816)GCC>GTC	p.A272V	ESRRG_uc001hky.1_Missense_Mutation_p.A249V|ESRRG_uc009xdp.1_Missense_Mutation_p.A249V|ESRRG_uc001hkz.1_Missense_Mutation_p.A210V|ESRRG_uc010puc.1_Missense_Mutation_p.A249V|ESRRG_uc001hla.1_Missense_Mutation_p.A249V|ESRRG_uc001hlb.1_Missense_Mutation_p.A249V|ESRRG_uc010pud.1_Missense_Mutation_p.A80V|ESRRG_uc001hlc.1_Missense_Mutation_p.A249V|ESRRG_uc001hld.1_Missense_Mutation_p.A249V|ESRRG_uc001hkx.1_Missense_Mutation_p.A284V|ESRRG_uc009xdo.1_Missense_Mutation_p.A249V|ESRRG_uc001hle.1_Missense_Mutation_p.A249V	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	272					positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CTCTCGGTCGGCCAAGTCACA	0.463													4	210	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232575068	232575068	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232575068T>C	uc001hvg.2	-	13	3975	c.3817A>G	c.(3817-3819)ATG>GTG	p.M1273V	SIPA1L2_uc001hvf.2_Missense_Mutation_p.M347V	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1273					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GTGGCAGGCATGCAGGGGGCC	0.657													9	107	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237777577	237777577	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777577G>T	uc001hyl.1	+	37	5269	c.5149G>T	c.(5149-5151)GCC>TCC	p.A1717S		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1717	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTATGCCACTGCCAGGCTCAT	0.517													41	39	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228401	21228401	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228401G>T	uc002red.2	-	26	11467	c.11339C>A	c.(11338-11340)GCC>GAC	p.A3780D		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3780					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TAGGTTGAGGGCAAATGATGA	0.398													92	215	---	---	---	---	PASS
DPYSL5	56896	broad.mit.edu	37	2	27164897	27164897	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27164897G>A	uc002rhu.3	+	10	1327	c.1169G>A	c.(1168-1170)CGC>CAC	p.R390H	DPYSL5_uc002rhv.3_Missense_Mutation_p.R390H	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	390					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGTATCCCCGCAAGGGCCGC	0.532											OREG0014510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	218	---	---	---	---	PASS
SPAST	6683	broad.mit.edu	37	2	32289075	32289075	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32289075G>C	uc002roc.2	+	1	396	c.175G>C	c.(175-177)GTA>CTA	p.V59L	SPAST_uc002rod.2_Missense_Mutation_p.V59L	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1	59	Required for interaction with SSNA1 and microtubules.|Required for interaction with RTN1.|Nuclear export signal.|Required for interaction with ATL1.|Helical; (Potential).|Required for midbody localization.				cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CCCGCTGTTTGTAGGCTTCGC	0.498													14	24	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33411958	33411958	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33411958T>A	uc002ros.2	+	6	1237	c.1237T>A	c.(1237-1239)TGC>AGC	p.C413S	LTBP1_uc002rot.2_Missense_Mutation_p.C87S|LTBP1_uc002rou.2_Missense_Mutation_p.C87S|LTBP1_uc002rov.2_Missense_Mutation_p.C87S|LTBP1_uc010ymz.1_Missense_Mutation_p.C87S|LTBP1_uc010yna.1_Missense_Mutation_p.C87S	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	413	EGF-like 2.				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGGTGGCCAGTGCAGTTCAAG	0.438													7	73	---	---	---	---	PASS
CDKL4	344387	broad.mit.edu	37	2	39406321	39406321	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39406321G>T	uc002rrm.2	-	8	934	c.934C>A	c.(934-936)CCG>ACG	p.P312T	CDKL4_uc010fal.1_Intron	NM_001009565	NP_001009565	Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4	312						cytoplasm	ATP binding|cyclin-dependent protein kinase activity			ovary(1)	1		all_hematologic(82;0.248)				CTTTTGAGCGGAAGTACCTGT	0.383													70	219	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49244674	49244674	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49244674A>G	uc002rww.2	-	4	402	c.328T>C	c.(328-330)TAC>CAC	p.Y110H	FSHR_uc002rwx.2_Missense_Mutation_p.Y110H|FSHR_uc010fbn.2_Missense_Mutation_p.Y110H|FSHR_uc010fbo.1_RNA	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	110	Extracellular (Potential).|LRR 3.				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	GGGTTGATGTAGAGCAGGTTG	0.388									Gonadal_Dysgenesis_46_XX				8	84	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71740979	71740979	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71740979C>T	uc002sie.2	+	6	967	c.591C>T	c.(589-591)TAC>TAT	p.Y197Y	DYSF_uc010feg.2_Silent_p.Y228Y|DYSF_uc010feh.2_Silent_p.Y197Y|DYSF_uc002sig.3_Silent_p.Y197Y|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.Y197Y|DYSF_uc010fef.2_Silent_p.Y228Y|DYSF_uc010fei.2_Silent_p.Y228Y|DYSF_uc010fek.2_Silent_p.Y229Y|DYSF_uc010fej.2_Silent_p.Y198Y|DYSF_uc010fel.2_Silent_p.Y198Y|DYSF_uc010feo.2_Silent_p.Y229Y|DYSF_uc010fem.2_Silent_p.Y198Y|DYSF_uc010fen.2_Silent_p.Y229Y|DYSF_uc002sif.2_Silent_p.Y198Y	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	197	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CGCCCCACTACCCCGGGATCA	0.582													9	67	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80136875	80136875	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80136875C>A	uc010ysh.1	+	6	1013	c.1008C>A	c.(1006-1008)AAC>AAA	p.N336K	CTNNA2_uc010yse.1_Missense_Mutation_p.N336K|CTNNA2_uc010ysf.1_Missense_Mutation_p.N336K|CTNNA2_uc010ysg.1_Missense_Mutation_p.N336K	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	336					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CGGAGTGCAACGCCGTGCGGC	0.597													34	74	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80816542	80816542	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80816542C>A	uc010ysh.1	+	14	2126	c.2121C>A	c.(2119-2121)AGC>AGA	p.S707R	CTNNA2_uc010yse.1_Missense_Mutation_p.S707R|CTNNA2_uc010ysf.1_Missense_Mutation_p.S707R|CTNNA2_uc010ysg.1_Missense_Mutation_p.S707R|CTNNA2_uc010ysi.1_Missense_Mutation_p.S339R|CTNNA2_uc010ysj.1_Missense_Mutation_p.S36R	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	707					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GGGACGACAGCGGCAATGATA	0.478													39	95	---	---	---	---	PASS
ELMOD3	84173	broad.mit.edu	37	2	85617334	85617334	+	Missense_Mutation	SNP	C	T	T	rs143405971		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85617334C>T	uc002spf.3	+	14	1554	c.889C>T	c.(889-891)CAT>TAT	p.H297Y	ELMOD3_uc002spg.3_Missense_Mutation_p.H297Y|ELMOD3_uc002sph.3_Missense_Mutation_p.H297Y|ELMOD3_uc010ysn.1_Missense_Mutation_p.H297Y|ELMOD3_uc010yso.1_RNA|ELMOD3_uc010ysp.1_RNA	NM_001135021	NP_001128493	Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3 isoform b	297	ELMO.				phagocytosis	cytoskeleton				ovary(2)	2						CCACCTCGCACATGTCTGGAG	0.557													17	90	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90108535	90108535	+	Intron	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90108535G>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		CTGAGATGGTGTCCCCGTTGC	0.413													13	88	---	---	---	---	PASS
IL1R2	7850	broad.mit.edu	37	2	102640986	102640986	+	Intron	SNP	C	A	A	rs3218975	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102640986C>A	uc002tbm.2	+						IL1R2_uc002tbn.2_Intron|IL1R2_uc002tbo.1_Intron	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor						immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	TGTGCCTTGCCATCCACAGGG	0.582													12	74	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832537	130832537	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832537G>C	uc010fmh.2	-	17	2908	c.2508C>G	c.(2506-2508)ATC>ATG	p.I836M		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	836	Actin-like.					cell cortex	ATP binding			skin(3)|ovary(2)	5						GCACAGCCTGGATGGCCACGT	0.582													51	378	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132021756	132021756	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132021756C>G	uc002tsn.2	+	15	2780	c.2728C>G	c.(2728-2730)CGT>GGT	p.R910G	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.R510G|POTEE_uc002tsl.2_Missense_Mutation_p.R492G|POTEE_uc010fmy.1_Missense_Mutation_p.R374G	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	910	Actin-like.						ATP binding				0						GGAAATCGTGCGTGACATCAA	0.602													40	163	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141130622	141130622	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141130622G>T	uc002tvj.1	-	69	11695	c.10723C>A	c.(10723-10725)CAT>AAT	p.H3575N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3575	Extracellular (Potential).|LDL-receptor class A 27.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAGTCTTCATGGCCATCACAT	0.363										TSP Lung(27;0.18)			76	235	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141130623	141130623	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141130623G>T	uc002tvj.1	-	69	11694	c.10722C>A	c.(10720-10722)GGC>GGA	p.G3574G		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3574	Extracellular (Potential).|LDL-receptor class A 27.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGTCTTCATGGCCATCACATT	0.363										TSP Lung(27;0.18)			74	232	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141242925	141242925	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141242925C>T	uc002tvj.1	-	59	10384	c.9412G>A	c.(9412-9414)GAT>AAT	p.D3138N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3138	Extracellular (Potential).|LDL-receptor class B 29.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCTTGAGGATCTAAAGACAAG	0.338										TSP Lung(27;0.18)			13	137	---	---	---	---	PASS
GRB14	2888	broad.mit.edu	37	2	165383553	165383553	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165383553C>T	uc002ucl.2	-	4	1115	c.574G>A	c.(574-576)GCC>ACC	p.A192T	GRB14_uc010zcv.1_Missense_Mutation_p.A105T|GRB14_uc002ucm.2_RNA	NM_004490	NP_004481	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	192	Ras-associating.				blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity			ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						TCATATTTGGCATAATTTTTT	0.333													55	126	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166732682	166732682	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166732682C>G	uc002udk.2	-	28	3999	c.3866G>C	c.(3865-3867)TGT>TCT	p.C1289S	TTC21B_uc002udj.1_RNA	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	1289	TPR 19.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TACCTGGTGACATATGTCAAT	0.289													25	72	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	169985205	169985205	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169985205C>T	uc002ues.2	-	79	14149	c.13936G>A	c.(13936-13938)GCA>ACA	p.A4646T		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4646	Cytoplasmic (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACAAGATTTGCGGTGTCTTTA	0.398													83	261	---	---	---	---	PASS
HOXD12	3238	broad.mit.edu	37	2	176965138	176965138	+	Intron	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176965138G>C	uc010zev.1	+						HOXD12_uc010zew.1_Intron	NM_021193	NP_067016	P35452	HXD12_HUMAN	homeobox D12							nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GCCGGTTTGGGCCGGGATGGG	0.647													15	22	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179546138	179546138	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179546138G>T	uc010zfg.1	-	134	29704	c.29480C>A	c.(29479-29481)CCC>CAC	p.P9827H	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P6488H|TTN_uc010fre.1_Intron|TTN_uc002una.1_5'Flank|TTN_uc010frf.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10754							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTAGGAATGGGCACTGGTAC	0.353													4	47	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179572473	179572473	+	Silent	SNP	C	T	T	rs2742338		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179572473C>T	uc010zfg.1	-	97	25313	c.25089G>A	c.(25087-25089)GTG>GTA	p.V8363V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.V5024V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9290							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTGAGCTGCACGTATTCTC	0.463													21	124	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179596699	179596699	+	Splice_Site	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179596699C>A	uc010zfg.1	-	55	13396	c.13172_splice	c.e55-1	p.E4391_splice	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Splice_Site_p.E1052_splice	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAGGTGACTCTACAGTAAAA	0.443													26	162	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179610753	179610753	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179610753A>G	uc002unb.2	-	46	16598	c.16374T>C	c.(16372-16374)TGT>TGC	p.C5458C	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTCTCCTACACAATTCACAG	0.408													43	323	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196673406	196673406	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196673406C>A	uc002utj.3	-	53	10184	c.10083G>T	c.(10081-10083)TTG>TTT	p.L3361F		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3361					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TAAAACATACCAAACTATCAT	0.318													21	117	---	---	---	---	PASS
COQ10B	80219	broad.mit.edu	37	2	198338507	198338507	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198338507A>G	uc002uuh.1	+	5	630	c.576A>G	c.(574-576)CTA>CTG	p.L192L	COQ10B_uc010fsl.1_Silent_p.L164L	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor	192						mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			GATCACTTCTACATTCCCAGC	0.274													18	77	---	---	---	---	PASS
DYTN	391475	broad.mit.edu	37	2	207572048	207572048	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207572048G>T	uc002vbr.1	-	3	391	c.274C>A	c.(274-276)CTT>ATT	p.L92I		NM_001093730	NP_001087199	A2CJ06	DYTN_HUMAN	dystrotelin	92						plasma membrane	zinc ion binding			ovary(1)|central_nervous_system(1)	2				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		GTCGTGAGAAGGCTCAGAGTG	0.522													3	26	---	---	---	---	PASS
SGPP2	130367	broad.mit.edu	37	2	223386573	223386573	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223386573C>T	uc010zlo.1	+	3	466	c.466C>T	c.(466-468)CTG>TTG	p.L156L	SGPP2_uc010zlp.1_Silent_p.L28L	NM_152386	NP_689599	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphotase 2	156					sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		GGAAAAGAGACTGATCGCTGA	0.512													20	104	---	---	---	---	PASS
IQCA1	79781	broad.mit.edu	37	2	237240243	237240243	+	Intron	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237240243G>A	uc002vvz.1	-						IQCA1_uc002vwb.2_Intron|IQCA1_uc002vwa.1_Intron|IQCA1_uc010zni.1_Intron	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1								ATP binding			ovary(1)	1						CCACAGAACTGTTGTATCCAG	0.478													5	29	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10452492	10452492	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10452492C>T	uc003bvt.2	-	3	646	c.207G>A	c.(205-207)CCG>CCA	p.P69P	ATP2B2_uc003bvv.2_Silent_p.P69P|ATP2B2_uc003bvw.2_Silent_p.P69P|ATP2B2_uc010hdp.2_Silent_p.P69P|ATP2B2_uc010hdo.2_5'UTR	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	69	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GAGCGGTGCCCGGCAAACCTG	0.527													41	310	---	---	---	---	PASS
PLCL2	23228	broad.mit.edu	37	3	17052614	17052614	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17052614G>T	uc011awc.1	+	5	1857	c.1752G>T	c.(1750-1752)ATG>ATT	p.M584I	PLCL2_uc011awd.1_Missense_Mutation_p.M466I	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2 isoform 1	592					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4						GAGCAGAAATGTCTCAGAGGA	0.428													51	71	---	---	---	---	PASS
CCR5	1234	broad.mit.edu	37	3	46414954	46414954	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46414954T>A	uc003cpo.3	+	3	683	c.561T>A	c.(559-561)TAT>TAA	p.Y187*	CCR5_uc010hjd.2_Nonsense_Mutation_p.Y187*	NM_001100168	NP_001093638	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5	187	Extracellular (Potential).				cell-cell signaling|cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|entry into host cell|immune response|inflammatory response|initiation of viral infection	endosome|external side of plasma membrane|integral to plasma membrane	actin binding|C-C chemokine receptor activity|coreceptor activity|phosphatidylinositol phospholipase C activity			lung(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	ACAGTCAGTATCAATTCTGGA	0.448													185	309	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48629339	48629339	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48629339C>A	uc003ctz.2	-	10	1350	c.1349G>T	c.(1348-1350)CGT>CTT	p.R450L		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	450	Nonhelical region (NC1).|Fibronectin type-III 3.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACCAGTCTCACGCCGCCATTC	0.637													37	61	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97852251	97852251	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97852251C>A	uc011bgt.1	+	1	710	c.710C>A	c.(709-711)GCC>GAC	p.A237D		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						GTAAGGAAAGCCTTTTCCACC	0.403													30	193	---	---	---	---	PASS
OR5H1	26341	broad.mit.edu	37	3	97852252	97852252	+	Silent	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97852252C>A	uc011bgt.1	+	1	711	c.711C>A	c.(709-711)GCC>GCA	p.A237A		NM_001005338	NP_001005338	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						TAAGGAAAGCCTTTTCCACCT	0.403													31	196	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107492320	107492320	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107492320A>G	uc010hpr.2	+	11	2079	c.1752A>G	c.(1750-1752)CTA>CTG	p.L584L	BBX_uc003dwk.3_Silent_p.L584L|BBX_uc003dwl.3_Intron|BBX_uc010hps.1_Silent_p.L605L|BBX_uc003dwm.3_Silent_p.L584L|BBX_uc003dwo.3_5'Flank	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	584					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			AAGATGCACTACCACCCAGCC	0.468													11	119	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130159661	130159661	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130159661C>T	uc010htj.1	+	35	6973	c.6479C>T	c.(6478-6480)TCG>TTG	p.S2160L	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.S199L	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2160	Nonhelical region.				axon guidance|cell adhesion	collagen					0						TTTTTATACTCGGTCAGGCGT	0.323													16	30	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739004	138739004	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739004C>T	uc003esy.1	-	1	765	c.500G>A	c.(499-501)CGG>CAG	p.R167Q		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	167										breast(1)	1						GGAGTCCATCCGGAGCTCCGG	0.647													14	112	---	---	---	---	PASS
PLS1	5357	broad.mit.edu	37	3	142388315	142388315	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142388315G>C	uc010huv.2	+	3	313	c.154G>C	c.(154-156)GTG>CTG	p.V52L	PLS1_uc003euz.2_Missense_Mutation_p.V52L|PLS1_uc003eva.2_Missense_Mutation_p.V52L	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1	52	EF-hand 2.					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						TGGCTACAAGGTGCGCGAGAT	0.388													38	405	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164905833	164905833	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164905833G>T	uc003fej.3	-	2	3230	c.2786C>A	c.(2785-2787)GCC>GAC	p.A929D	SLITRK3_uc003fek.2_Missense_Mutation_p.A929D	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	929	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						TTTGAGCCTGGCATCCTGCTG	0.493										HNSCC(40;0.11)			157	321	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178916936	178916936	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178916936G>T	uc003fjk.2	+	2	480	c.323G>T	c.(322-324)CGT>CTT	p.R108L		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	108	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R108H(5)|p.G106_R108del(2)|p.R108P(1)|p.R108del(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GTAGGCAACCGTGAAGAAAAG	0.338		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			40	246	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179478921	179478921	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179478921C>T	uc003fkh.2	+	17	2051	c.1970C>T	c.(1969-1971)TCA>TTA	p.S657L		NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	657	UBA 1.				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GATGAGTCATCAGTGATGCAG	0.507													23	272	---	---	---	---	PASS
IL1RAP	3556	broad.mit.edu	37	3	190366465	190366465	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190366465C>T	uc003fsm.1	+	12	1890	c.1684C>T	c.(1684-1686)CTC>TTC	p.L562F	IL1RAP_uc010hzg.1_Missense_Mutation_p.L562F|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Missense_Mutation_p.L562F|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform	562	Cytoplasmic (Potential).				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		TGAGCAGGGCCTCTCGTATTC	0.483													13	95	---	---	---	---	PASS
MUC20	200958	broad.mit.edu	37	3	195452920	195452920	+	Silent	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195452920C>A	uc010hzo.2	+	3	1059	c.933C>A	c.(931-933)TCC>TCA	p.S311S	MUC20_uc010hzp.2_Silent_p.S276S|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	482	Involved in oligomerization.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		AGACCCTGTCCACAGCCGGCA	0.617													4	33	---	---	---	---	PASS
PDE6B	5158	broad.mit.edu	37	4	658691	658691	+	Silent	SNP	C	T	T	rs149031864	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:658691C>T	uc003gap.2	+	18	2204	c.2151C>T	c.(2149-2151)TGC>TGT	p.C717C	PDE6B_uc003gao.3_Silent_p.C717C|PDE6B_uc011buy.1_Silent_p.C438C|PDE6B_uc011buz.1_Silent_p.C149C	NM_000283	NP_000274	P35913	PDE6B_HUMAN	phosphodiesterase 6B isoform 1	717					cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						TGACAGCCTGCGACCTGTCTG	0.547													25	157	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36214041	36214041	+	Silent	SNP	T	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36214041T>G	uc003gsq.1	-	5	1448	c.1110A>C	c.(1108-1110)ACA>ACC	p.T370T	ARAP2_uc003gsr.1_Silent_p.T370T	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	370					regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TAAAAGAGTTTGTTGCAGTAG	0.313													16	66	---	---	---	---	PASS
N4BP2	55728	broad.mit.edu	37	4	40099026	40099026	+	Silent	SNP	T	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40099026T>G	uc003guy.3	+	3	404	c.66T>G	c.(64-66)GTT>GTG	p.V22V	N4BP2_uc010ifq.2_5'UTR	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	22						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						CTAAGGAAGTTGTCGTATCCA	0.438													68	181	---	---	---	---	PASS
CHRNA9	55584	broad.mit.edu	37	4	40350899	40350899	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40350899G>T	uc003gva.1	+	4	382	c.366G>T	c.(364-366)AAG>AAT	p.K122N		NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9	122	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)	TGACCTTCAGGGCTGATGATG	0.522													45	178	---	---	---	---	PASS
C4orf14	84273	broad.mit.edu	37	4	57843150	57843150	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57843150T>A	uc003hck.2	-	1	677	c.602A>T	c.(601-603)TAC>TTC	p.Y201F	POLR2B_uc003hcl.1_5'Flank|POLR2B_uc011cae.1_5'Flank|POLR2B_uc011caf.1_5'Flank	NM_032313	NP_115689	Q8NC60	CD014_HUMAN	hypothetical protein LOC84273	201							GTP binding			ovary(1)|breast(1)	2	Glioma(25;0.08)|all_neural(26;0.181)					CAGCTCCAGGTACTGCTCGCG	0.731													8	23	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68938144	68938144	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68938144A>G	uc003hdt.1	-	5	460	c.411T>C	c.(409-411)GAT>GAC	p.D137D	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	137	SEA.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GTTCAGCACTATCAGTAGATG	0.318													38	131	---	---	---	---	PASS
RUFY3	22902	broad.mit.edu	37	4	71650542	71650542	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71650542G>T	uc003hfq.2	+	10	1612	c.1017G>T	c.(1015-1017)GGG>GGT	p.G339G	RUFY3_uc003hfp.3_Silent_p.G399G|RUFY3_uc011cax.1_Silent_p.G357G|RUFY3_uc003hfr.2_Silent_p.G339G|RUFY3_uc011cay.1_Silent_p.G275G	NM_014961	NP_055776	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3 isoform 2	339	Potential.				negative regulation of axonogenesis	filopodium|growth cone					0		all_hematologic(202;0.248)	Lung(101;0.235)			CTGCAGAAGGGCAAGCACTAA	0.323													6	22	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90830530	90830530	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90830530G>T	uc003hst.2	+	2	798	c.727G>T	c.(727-729)GGA>TGA	p.G243*	MMRN1_uc010iku.2_Nonsense_Mutation_p.G209*|MMRN1_uc011cds.1_5'UTR	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	243	EMI.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CTGGACCGGTGGATCCTGTCC	0.423													19	81	---	---	---	---	PASS
NHEDC1	150159	broad.mit.edu	37	4	103866467	103866467	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103866467T>A	uc003hww.2	-	6	658	c.536A>T	c.(535-537)CAT>CTT	p.H179L	NHEDC1_uc003hwu.2_Missense_Mutation_p.H179L|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912	Q4ZJI4	NHDC1_HUMAN	Na+/H+ exchanger domain containing 1 isoform 1	179						integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)		GACCTTCAAATGCCTCAAAGC	0.368													53	170	---	---	---	---	PASS
SGMS2	166929	broad.mit.edu	37	4	108816990	108816990	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108816990C>G	uc003hyl.3	+	3	836	c.281C>G	c.(280-282)ACC>AGC	p.T94S	uc003hym.1_Intron|SGMS2_uc003hyn.2_Missense_Mutation_p.T94S|SGMS2_uc003hyo.2_Missense_Mutation_p.T94S	NM_001136258	NP_001129730	Q8NHU3	SMS2_HUMAN	sphingomyelin synthase 2	94	Helical; (Potential).				sphingomyelin biosynthetic process	integral to Golgi membrane|integral to plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			lung(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)	Choline(DB00122)	GTCTTGACAACCGTCATGATC	0.453													38	184	---	---	---	---	PASS
SEC24D	9871	broad.mit.edu	37	4	119652646	119652646	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119652646T>C	uc003ici.3	-	21	2965	c.2693A>G	c.(2692-2694)AAG>AGG	p.K898R	SEC24D_uc003ich.3_RNA|SEC24D_uc003icj.3_Missense_Mutation_p.K899R|SEC24D_uc003ick.2_Missense_Mutation_p.K60R	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D	898					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0						CATTGTACTCTTGACATCTAA	0.338													34	145	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177098242	177098242	+	Silent	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177098242T>A	uc003iuj.2	+	29	3756	c.3600T>A	c.(3598-3600)CCT>CCA	p.P1200P	WDR17_uc003iuk.2_Silent_p.P1176P|WDR17_uc003ium.3_Silent_p.P1161P|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Silent_p.P411P	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	1200										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGTCAGTACCTTTAAAAATTG	0.363													26	72	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177138061	177138061	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177138061G>T	uc003iuq.1	-	6	786	c.770C>A	c.(769-771)GCA>GAA	p.A257E	ASB5_uc003iup.1_Missense_Mutation_p.A204E	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	257	ANK 6.				intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		ATTGATATCTGCTCCAAATTC	0.408													73	240	---	---	---	---	PASS
TLR3	7098	broad.mit.edu	37	4	187004704	187004704	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187004704A>G	uc003iyq.2	+	4	1965	c.1864A>G	c.(1864-1866)ATA>GTA	p.I622V	TLR3_uc011ckz.1_Missense_Mutation_p.I345V|TLR3_uc003iyr.2_Missense_Mutation_p.I345V	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	622	LRR 22.|Lumenal (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)|prostate(1)|lung(1)|breast(1)	5		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		GAAGAATCTCATAACATCCGT	0.383													54	174	---	---	---	---	PASS
AHRR	57491	broad.mit.edu	37	5	427954	427954	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:427954G>T	uc003jav.2	+	9	851	c.807G>T	c.(805-807)CTG>CTT	p.L269L	AHRR_uc003jaw.2_Silent_p.L247L|AHRR_uc010isy.2_Silent_p.L97L|AHRR_uc010isz.2_Silent_p.L247L|AHRR_uc003jax.2_Silent_p.L10L|AHRR_uc003jay.2_Silent_p.L107L	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor	251					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TAAAATTCCTGTTTGGACAGA	0.562													30	73	---	---	---	---	PASS
TERT	7015	broad.mit.edu	37	5	1253951	1253951	+	Intron	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1253951G>A	uc003jcb.1	-						TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TCTGGGCTGCGGGGCCAAAAT	0.667									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				6	14	---	---	---	---	PASS
CLPTM1L	81037	broad.mit.edu	37	5	1339043	1339043	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1339043G>A	uc003jch.2	-	4	577	c.531C>T	c.(529-531)AAC>AAT	p.N177N	CLPTM1L_uc003jcg.2_Silent_p.N44N	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like	177	Extracellular (Potential).				apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CCGCCATCACGTTCAGCGCCA	0.612													23	37	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26890631	26890631	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26890631A>G	uc003jgs.1	-	8	1465	c.1296T>C	c.(1294-1296)GGT>GGC	p.G432G	CDH9_uc011cnv.1_Silent_p.G25G	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	432	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CTGAGTGAATACCAAAAATAC	0.398													19	256	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35727898	35727898	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35727898G>T	uc003jjo.2	+	21	3147	c.3036G>T	c.(3034-3036)TGG>TGT	p.W1012C	SPEF2_uc003jjp.1_Missense_Mutation_p.W498C	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1012					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAGAAGAATGGGTCTATGTGA	0.428													33	226	---	---	---	---	PASS
ESM1	11082	broad.mit.edu	37	5	54281101	54281101	+	Missense_Mutation	SNP	C	G	G	rs139399038		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54281101C>G	uc003jpk.2	-	1	314	c.245G>C	c.(244-246)AGG>ACG	p.R82T	ESM1_uc010ivt.2_Missense_Mutation_p.R82T	NM_007036	NP_008967	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1 isoform a	82	IGFBP N-terminal.				angiogenesis|regulation of cell growth	extracellular region	growth factor activity|insulin-like growth factor binding				0		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			AGGCTGACACCTCAGCCCCGG	0.587													262	648	---	---	---	---	PASS
GZMK	3003	broad.mit.edu	37	5	54320153	54320153	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54320153G>C	uc003jpl.1	+	1	47	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_002104	NP_002095	P49863	GRAK_HUMAN	granzyme K precursor	1					proteolysis	extracellular region	serine-type endopeptidase activity				0		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TCTTTAAAATGACTAAGTTTT	0.318													150	329	---	---	---	---	PASS
IQGAP2	10788	broad.mit.edu	37	5	75858347	75858347	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75858347G>T	uc003kek.2	+	3	495	c.273G>T	c.(271-273)AAG>AAT	p.K91N		NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	91	CH.				small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		CAGAGAAAAAGATCTATGATG	0.403													36	102	---	---	---	---	PASS
CTNNA1	1495	broad.mit.edu	37	5	138260946	138260946	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138260946C>T	uc003ldh.2	+	13	1844	c.1749C>T	c.(1747-1749)GTC>GTT	p.V583V	CTNNA1_uc011cyx.1_Silent_p.V480V|CTNNA1_uc011cyy.1_Silent_p.V460V|CTNNA1_uc003ldi.2_Silent_p.V281V|CTNNA1_uc003ldj.2_Silent_p.V583V|CTNNA1_uc003ldl.2_Silent_p.V213V	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	583					adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCTCCACAGTCATGCCACGTT	0.552													19	38	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147466029	147466029	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147466029A>G	uc003lox.2	+	5	417	c.344A>G	c.(343-345)TAT>TGT	p.Y115C	SPINK5_uc010jgq.1_RNA|SPINK5_uc010jgs.1_Missense_Mutation_p.Y87C|SPINK5_uc010jgr.2_Missense_Mutation_p.Y96C|SPINK5_uc003low.2_Missense_Mutation_p.Y115C|SPINK5_uc003loy.2_Missense_Mutation_p.Y115C	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform	115	Kazal-like 2.				anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGATTATTATGAAGCTGTT	0.383													71	152	---	---	---	---	PASS
SPINK5	11005	broad.mit.edu	37	5	147481344	147481344	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147481344G>T	uc003lox.2	+	15	1376	c.1303G>T	c.(1303-1305)GAG>TAG	p.E435*	SPINK5_uc010jgs.1_Nonsense_Mutation_p.E407*|SPINK5_uc010jgr.2_Nonsense_Mutation_p.E416*|SPINK5_uc003low.2_Nonsense_Mutation_p.E435*|SPINK5_uc003loy.2_Nonsense_Mutation_p.E435*	NM_006846	NP_006837	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5 isoform	435	Kazal-like 7.				anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATTTCACAGGAGTTGTGTAG	0.423													38	77	---	---	---	---	PASS
NIPAL4	348938	broad.mit.edu	37	5	156899445	156899445	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156899445G>A	uc003lwx.3	+	6	994	c.878G>A	c.(877-879)TGC>TAC	p.C293Y	ADAM19_uc003lww.1_Intron|NIPAL4_uc011ddq.1_Missense_Mutation_p.C274Y	NM_001099287	NP_001092757	Q0D2K0	NIPA4_HUMAN	ichthyin protein	293	Helical; (Potential).					integral to membrane	receptor activity				0						ATCATCATCTGCTCTGTGATC	0.552											OREG0016979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	69	193	---	---	---	---	PASS
LCP2	3937	broad.mit.edu	37	5	169675696	169675696	+	3'UTR	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169675696A>G	uc003man.1	-	21					C5orf58_uc003mal.2_Intron|LCP2_uc011des.1_3'UTR|LCP2_uc011det.1_3'UTR	NM_005565	NP_005556	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CTCGGCTATAACTTGCTATGG	0.488													82	211	---	---	---	---	PASS
FAM153B	202134	broad.mit.edu	37	5	175530260	175530260	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175530260C>A	uc003mdk.2	+	13	752	c.695C>A	c.(694-696)TCC>TAC	p.S232Y		NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134	232										ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		CAGGAGCTGTCCAGTTACAAC	0.468													35	328	---	---	---	---	PASS
FAM153B	202134	broad.mit.edu	37	5	175530261	175530261	+	Silent	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175530261C>G	uc003mdk.2	+	13	753	c.696C>G	c.(694-696)TCC>TCG	p.S232S		NM_001079529	NP_001072997	P0C7A2	F153B_HUMAN	hypothetical protein LOC202134	232										ovary(1)	1	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		AGGAGCTGTCCAGTTACAACG	0.468													35	336	---	---	---	---	PASS
FAM153A	285596	broad.mit.edu	37	5	177161904	177161904	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177161904G>T	uc010jkp.1	-	14	885	c.464C>A	c.(463-465)TCC>TAC	p.S155Y	FAM153A_uc011dgd.1_Intron|FAM153A_uc003mib.1_RNA|FAM153A_uc003mic.2_Missense_Mutation_p.S155Y	NM_173663	NP_775934	Q9UHL3	F153A_HUMAN	hypothetical protein LOC285596	155										skin(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTGTAACTGGACAGCTCCTG	0.463													3	32	---	---	---	---	PASS
F13A1	2162	broad.mit.edu	37	6	6182228	6182228	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6182228G>A	uc003mwv.2	-	11	1575	c.1452C>T	c.(1450-1452)TTC>TTT	p.F484F	F13A1_uc011dib.1_Silent_p.F421F	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	484					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TACCTTCTTGGAATTTGTAAG	0.383													36	106	---	---	---	---	PASS
TBC1D7	51256	broad.mit.edu	37	6	13305333	13305333	+	Nonstop_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13305333T>C	uc003naj.2	-	8	973	c.882A>G	c.(880-882)TGA>TGG	p.*294W	TBC1D7_uc011dis.1_Intron|TBC1D7_uc003nan.2_Nonstop_Mutation_p.*294W|TBC1D7_uc003nal.2_Nonstop_Mutation_p.*294W|TBC1D7_uc003nam.2_Nonstop_Mutation_p.*294W|TBC1D7_uc003nao.2_Nonstop_Mutation_p.*267W|TBC1D7_uc010jpd.2_Nonstop_Mutation_p.*248W	NM_016495	NP_057579	Q9P0N9	TBCD7_HUMAN	TBC1 domain family, member 7 isoform a	294					positive regulation of protein ubiquitination	cytoplasmic membrane-bounded vesicle	protein binding|Rab GTPase activator activity			ovary(1)	1	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)			GCGGGTGCGTTCAGCTTGAAT	0.532													25	92	---	---	---	---	PASS
KDM1B	221656	broad.mit.edu	37	6	18212751	18212751	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18212751G>T	uc003nco.1	+	11	1365	c.1290G>T	c.(1288-1290)CAG>CAT	p.Q430H	KDM1B_uc003ncn.1_Missense_Mutation_p.Q401H|KDM1B_uc003ncp.1_5'UTR|KDM1B_uc003ncq.1_5'UTR	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1	633					multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding			skin(1)	1						CTTTACTACAGAAAGGTGCCA	0.413													31	311	---	---	---	---	PASS
ZNF184	7738	broad.mit.edu	37	6	27420101	27420101	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27420101T>C	uc003njj.2	-	5	2048	c.1237A>G	c.(1237-1239)ACT>GCT	p.T413A	ZNF184_uc010jqv.2_Missense_Mutation_p.T413A|ZNF184_uc003nji.2_Missense_Mutation_p.T413A	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	413					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TTTTCACCAGTATGAATCATA	0.403													51	194	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39847149	39847149	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39847149C>T	uc003oow.2	+	14	1897	c.1741C>T	c.(1741-1743)CTC>TTC	p.L581F	DAAM2_uc010jxc.2_Missense_Mutation_p.L581F|DAAM2_uc003oox.2_Missense_Mutation_p.L581F	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	581	FH1.|Pro-rich.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					GGGCCTGCCCCTCCCTCAGGA	0.507													19	65	---	---	---	---	PASS
POU3F2	5454	broad.mit.edu	37	6	99284000	99284000	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99284000G>T	uc003ppe.2	+	1	1421	c.1251G>T	c.(1249-1251)GGG>GGT	p.G417G		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	417					positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		CTCCCGGAGGGACTCTGCCGG	0.617													26	80	---	---	---	---	PASS
POPDC3	64208	broad.mit.edu	37	6	105606478	105606478	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105606478T>A	uc003prb.2	-	4	1145	c.743A>T	c.(742-744)GAC>GTC	p.D248V	uc003pqz.2_Intron|POPDC3_uc003pra.2_RNA	NM_022361	NP_071756	Q9HBV1	POPD3_HUMAN	popeye protein 3	248						integral to membrane				skin(3)|ovary(2)	5		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				ATATACCCTGTCATTCAAGGC	0.398													57	219	---	---	---	---	PASS
NR2E1	7101	broad.mit.edu	37	6	108501625	108501625	+	Splice_Site	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108501625T>A	uc003psg.2	+	6	1494	c.739_splice	c.e6+2	p.G247_splice		NM_003269	NP_003260	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		CTGTATCTGGTAAGAATTGCA	0.358													32	154	---	---	---	---	PASS
C6orf170	221322	broad.mit.edu	37	6	121577239	121577239	+	Silent	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121577239T>C	uc003pyo.1	-	16	1994	c.1926A>G	c.(1924-1926)GCA>GCG	p.A642A	C6orf170_uc003pyq.1_RNA|C6orf170_uc003pyp.1_Silent_p.A161A	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	642					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		CCTTTTTCCATGCCTTTGCTA	0.313													27	96	---	---	---	---	PASS
HSF2	3298	broad.mit.edu	37	6	122737378	122737378	+	Silent	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122737378C>G	uc003pyu.2	+	5	655	c.468C>G	c.(466-468)TCC>TCG	p.S156S	HSF2_uc003pyt.3_Silent_p.S156S|HSF2_uc003pyv.2_Silent_p.S156S	NM_004506	NP_004497	Q03933	HSF2_HUMAN	heat shock transcription factor 2 isoform a	156	Hydrophobic repeat HR-A/B.				response to stress|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		AGAATGAGTCCCTTTGGAAGG	0.338													20	64	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123637596	123637596	+	Intron	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123637596C>A	uc003pzj.1	-						TRDN_uc010kem.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		TACAAAATATCCTTACCTGCT	0.328													7	52	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123637597	123637597	+	Intron	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123637597C>A	uc003pzj.1	-						TRDN_uc010kem.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		ACAAAATATCCTTACCTGCTT	0.328													8	52	---	---	---	---	PASS
ENPP3	5169	broad.mit.edu	37	6	131971206	131971206	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131971206G>T	uc003qcu.3	+	4	541	c.194G>T	c.(193-195)GGA>GTA	p.G65V	ENPP3_uc010kfn.1_RNA|ENPP3_uc011ecc.1_Missense_Mutation_p.G31V|ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Missense_Mutation_p.G65V	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	65	Extracellular (Potential).|SMB 1.				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TCATTTAGAGGACTGGAGAAC	0.443													56	199	---	---	---	---	PASS
STX7	8417	broad.mit.edu	37	6	132785134	132785134	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132785134G>A	uc003qdg.2	-	9	941	c.691C>T	c.(691-693)CAG>TAG	p.Q231*	STX7_uc011ecg.1_RNA|STX7_uc011ech.1_Nonsense_Mutation_p.Q56*	NM_003569	NP_003560	O15400	STX7_HUMAN	syntaxin 7	231	Cytoplasmic (Potential).				intracellular protein transport|post-Golgi vesicle-mediated transport	early endosome membrane|integral to membrane	SNAP receptor activity				0	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		TAAATTACCTGATAATCTGCT	0.388													61	220	---	---	---	---	PASS
MAP7	9053	broad.mit.edu	37	6	136682314	136682314	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136682314T>G	uc003qgz.2	-	12	1776	c.1530A>C	c.(1528-1530)CAA>CAC	p.Q510H	MAP7_uc011edf.1_Missense_Mutation_p.Q495H|MAP7_uc011edg.1_Missense_Mutation_p.Q540H|MAP7_uc010kgu.2_Missense_Mutation_p.Q532H|MAP7_uc011edh.1_Missense_Mutation_p.Q495H|MAP7_uc010kgv.2_Missense_Mutation_p.Q532H|MAP7_uc010kgs.2_Missense_Mutation_p.Q364H|MAP7_uc011edi.1_Missense_Mutation_p.Q364H|MAP7_uc010kgq.1_Missense_Mutation_p.Q416H|MAP7_uc003qha.1_Missense_Mutation_p.Q473H	NM_003980	NP_003971	Q14244	MAP7_HUMAN	microtubule-associated protein 7	510	Potential.				establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		CCTCTCTCTTTTGTCTGGAAA	0.547													17	57	---	---	---	---	PASS
NMBR	4829	broad.mit.edu	37	6	142400042	142400042	+	Splice_Site	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142400042T>C	uc003qiu.2	-	2	564	c.423_splice	c.e2-1	p.R141_splice		NM_002511	NP_002502	P28336	NMBR_HUMAN	neuromedin B receptor						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	cytoplasm|integral to plasma membrane	bombesin receptor activity			central_nervous_system(3)|breast(1)	4	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		GCTCTGTACCTGGGAAAATGA	0.338													8	92	---	---	---	---	PASS
SLC22A2	6582	broad.mit.edu	37	6	160662610	160662610	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160662610C>G	uc003qtf.2	-	9	1567	c.1397G>C	c.(1396-1398)GGC>GCC	p.G466A	SLC22A2_uc003qte.1_Missense_Mutation_p.G466A	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	466	Helical; (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		GATGTGGACGCCAAGATTCCT	0.453													32	92	---	---	---	---	PASS
C7orf28A	51622	broad.mit.edu	37	7	5965287	5965287	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5965287C>T	uc003spf.2	+	15	1508	c.1418C>T	c.(1417-1419)ACG>ATG	p.T473M		NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622	473						lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		CTTTGTGCAACGCAGTTCAAC	0.403													39	247	---	---	---	---	PASS
DAGLB	221955	broad.mit.edu	37	7	6474584	6474584	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6474584C>A	uc003sqa.2	-	4	657	c.487G>T	c.(487-489)GCT>TCT	p.A163S	DAGLB_uc011jwt.1_5'UTR|DAGLB_uc011jwu.1_Intron|DAGLB_uc003sqb.2_Intron|DAGLB_uc003sqc.2_Intron|DAGLB_uc011jwv.1_RNA|DAGLB_uc003sqd.3_Missense_Mutation_p.A122S|DAGLB_uc011jww.1_Intron	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1	163	Cytoplasmic (Potential).				lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GAATATGGAGCCATTTTCCCC	0.512													58	129	---	---	---	---	PASS
PRPS1L1	221823	broad.mit.edu	37	7	18067168	18067168	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18067168C>A	uc003stz.2	-	1	319	c.238G>T	c.(238-240)GCT>TCT	p.A80S		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	80					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					CTAGCTGAAGCAATCTTGCAG	0.493													148	369	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31692223	31692223	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31692223G>A	uc003tcj.1	+	14	3908	c.2915G>A	c.(2914-2916)TGT>TAT	p.C972Y	CCDC129_uc011kad.1_Missense_Mutation_p.C982Y|CCDC129_uc003tci.1_Missense_Mutation_p.C823Y|CCDC129_uc011kae.1_Missense_Mutation_p.C998Y|CCDC129_uc003tck.1_Missense_Mutation_p.C880Y	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	972											0						CAGACTTCATGTTCTAAAATC	0.512													17	46	---	---	---	---	PASS
SFRP4	6424	broad.mit.edu	37	7	37951816	37951816	+	Silent	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37951816T>C	uc003tfo.3	-	4	1082	c.696A>G	c.(694-696)CGA>CGG	p.R232R		NM_003014	NP_003005	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related  protein 4 precursor	232	NTR.				brain development|cell differentiation|decidualization|embryo development|epithelium development|gonad development|mammary gland involution|menstrual cycle phase|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell proliferation|negative regulation of JNK cascade|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of sodium-dependent phosphate transport|phosphate ion homeostasis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epidermal cell differentiation|positive regulation of gene expression|positive regulation of receptor internalization|vasculature development|Wnt receptor signaling pathway	cell surface|cytoplasm|extracellular space|nucleus	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1						GGACTTGAGTTCGAGGGATGG	0.483													52	142	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48335404	48335404	+	Silent	SNP	T	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48335404T>G	uc003toq.2	+	21	9088	c.9063T>G	c.(9061-9063)ACT>ACG	p.T3021T	ABCA13_uc010kys.1_Silent_p.T95T	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3021					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						AAAATGCCACTGGCCAGGACT	0.488													96	195	---	---	---	---	PASS
PSPH	5723	broad.mit.edu	37	7	56087413	56087413	+	Missense_Mutation	SNP	A	G	G	rs104894036		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56087413A>G	uc003trg.2	-	4	518	c.155T>C	c.(154-156)ATG>ACG	p.M52T	PSPH_uc003trh.2_Missense_Mutation_p.M52T|PSPH_uc003tri.2_Missense_Mutation_p.M52T|PSPH_uc003trj.2_Missense_Mutation_p.M81T	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	52			M -> T (in PSPHD).		L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGCCCCGCCCATGGCTCGCCG	0.612													9	62	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77764482	77764482	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77764482C>G	uc003ugx.2	-	17	3141	c.2887G>C	c.(2887-2889)GCA>CCA	p.A963P	MAGI2_uc003ugy.2_Missense_Mutation_p.A949P|MAGI2_uc010ldx.1_Missense_Mutation_p.A556P	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	963	PDZ 5.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CAGCGATCTGCAGGACTCCCA	0.463													72	104	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88966071	88966071	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88966071C>A	uc011khi.1	+	4	4313	c.3775C>A	c.(3775-3777)CAC>AAC	p.H1259N		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1259						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TATCCCTGCACACCCCACTTT	0.478										HNSCC(36;0.09)			137	309	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100551426	100551426	+	RNA	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100551426C>T	uc003uxk.1	+	1		c.677C>T			uc003uxl.1_5'UTR					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		TGACTACAACCACAGACTTTC	0.488													86	144	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120911349	120911349	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120911349G>A	uc003vjq.3	+	22	3180	c.2733G>A	c.(2731-2733)CAG>CAA	p.Q911Q		NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	911						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					GTGAAGTACAGAACTTATGGA	0.318													35	126	---	---	---	---	PASS
PTPRZ1	5803	broad.mit.edu	37	7	121612615	121612615	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121612615G>T	uc003vjy.2	+	4	720	c.325G>T	c.(325-327)GAC>TAC	p.D109Y	PTPRZ1_uc003vjz.2_Missense_Mutation_p.D109Y	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	109	Extracellular (Potential).|Alpha-carbonic anhydrase.				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TCTCACTAATGACTACCGTGT	0.338													37	190	---	---	---	---	PASS
FEZF1	389549	broad.mit.edu	37	7	121942911	121942911	+	Silent	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121942911T>A	uc003vkd.2	-	3	1085	c.1011A>T	c.(1009-1011)ATA>ATT	p.I337I	FEZF1_uc003vkc.2_Silent_p.I287I|uc010lko.1_5'Flank	NM_001024613	NP_001019784	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1 isoform 1	337	C2H2-type 3.				cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)	3						AGCCCGCGTGTATTCGGGTAT	0.408													72	266	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123136839	123136839	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123136839T>A	uc003vkn.2	-	7	1722	c.1145A>T	c.(1144-1146)GAA>GTA	p.E382V	IQUB_uc003vko.2_Missense_Mutation_p.E382V|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.E382V	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	382										ovary(3)|large_intestine(1)	4						TTCTTCTTTTTCTCTTATCTT	0.338													70	110	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126544700	126544700	+	Silent	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126544700A>G	uc003vlr.2	-	3	1076	c.765T>C	c.(763-765)CGT>CGC	p.R255R	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.R255R|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_5'UTR	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	255	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	GTCTTGGTTCACGTGGGATTT	0.393										HNSCC(24;0.065)			47	215	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700864	136700864	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700864C>A	uc003vtf.1	+	4	1875	c.1252C>A	c.(1252-1254)CCC>ACC	p.P418T	CHRM2_uc003vtg.1_Missense_Mutation_p.P418T|CHRM2_uc003vtj.1_Missense_Mutation_p.P418T|CHRM2_uc003vtk.1_Missense_Mutation_p.P418T|CHRM2_uc003vtl.1_Missense_Mutation_p.P418T|CHRM2_uc003vtm.1_Missense_Mutation_p.P418T|CHRM2_uc003vti.1_Missense_Mutation_p.P418T|CHRM2_uc003vto.1_Missense_Mutation_p.P418T|CHRM2_uc003vtn.1_Missense_Mutation_p.P418T|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	418	Extracellular (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	ACCTTGCATCCCCAACACTGT	0.463													116	280	---	---	---	---	PASS
PRSS37	136242	broad.mit.edu	37	7	141536980	141536980	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141536980C>G	uc003vws.1	-	4	871	c.499G>C	c.(499-501)GAA>CAA	p.E167Q	PRSS37_uc011krk.1_Missense_Mutation_p.E154Q|PRSS37_uc011krl.1_Missense_Mutation_p.E166Q|PRSS37_uc003vwt.1_Missense_Mutation_p.E154Q	NM_001008270	NP_001008271	A4D1T9	PRS37_HUMAN	protease, serine, 37 precursor	167	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			skin(1)	1						TTTCCTTGTTCTGTTTTTTGG	0.433													47	182	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142120058	142120058	+	Intron	SNP	C	A	A	rs141013676	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142120058C>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011kru.1_Missense_Mutation_p.D37Y					SubName: Full=V_segment translation product; Flags: Fragment;																		AGAGTTACATCCTGTCCCCTC	0.468													44	59	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	158334283	158334283	+	Intron	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158334283C>T	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|uc003wnu.1_RNA|PTPRN2_uc011kwa.1_Missense_Mutation_p.E6K	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		AGTGAATATTCAGATTCCACA	0.443													51	83	---	---	---	---	PASS
ADAM32	203102	broad.mit.edu	37	8	39089565	39089565	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39089565T>A	uc003xmt.3	+	15	1790	c.1545T>A	c.(1543-1545)TTT>TTA	p.F515L	ADAM32_uc011lch.1_Missense_Mutation_p.F416L|ADAM32_uc003xmu.3_Missense_Mutation_p.F409L|ADAM32_uc003xmv.2_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32	515	Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			ATGCTCCATTTGCCTGCTATG	0.338													45	113	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48772318	48772318	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48772318C>A	uc003xqi.2	-	47	6118	c.6061G>T	c.(6061-6063)GGT>TGT	p.G2021C	PRKDC_uc003xqj.2_Missense_Mutation_p.G2021C|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	2021		Cleavage; by caspase-3 (Probable).			cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				TAGGAAGGACCATCTGAAATA	0.313								NHEJ					36	93	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61765230	61765230	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61765230G>T	uc003xue.2	+	30	6545	c.6068G>T	c.(6067-6069)AGG>ATG	p.R2023M		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2023					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCCATGTGTAGGCGAGTATGT	0.393													26	69	---	---	---	---	PASS
SLCO5A1	81796	broad.mit.edu	37	8	70585503	70585503	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70585503C>A	uc003xyl.2	-	10	2855	c.2148G>T	c.(2146-2148)TGG>TGT	p.W716C	SLCO5A1_uc010lzb.2_Missense_Mutation_p.W661C|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_3'UTR	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	716	Extracellular (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			ATTCCTGTTGCCAGAGCATGC	0.478													30	331	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763271	77763271	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763271G>T	uc003yav.2	+	10	4366	c.3979G>T	c.(3979-3981)GAC>TAC	p.D1327Y	ZFHX4_uc003yau.1_Missense_Mutation_p.D1372Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.D1327Y	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1327						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GAAAATCCCCGACACACTGCA	0.423										HNSCC(33;0.089)			16	78	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77768135	77768135	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77768135A>C	uc003yav.2	+	10	9230	c.8843A>C	c.(8842-8844)AAG>ACG	p.K2948T	ZFHX4_uc003yau.1_Missense_Mutation_p.K2993T|ZFHX4_uc003yaw.1_Missense_Mutation_p.K2948T	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2948						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACATAGGGAAGCCTTTCATG	0.468										HNSCC(33;0.089)			9	48	---	---	---	---	PASS
IMPA1	3612	broad.mit.edu	37	8	82588523	82588523	+	Intron	SNP	A	T	T	rs72422225		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82588523A>T	uc003ych.2	-						IMPA1_uc011lfq.1_Intron|IMPA1_uc011lfr.1_Intron	NM_005536	NP_005527	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1 isoform						inositol phosphate dephosphorylation|phosphatidylinositol biosynthetic process|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(1)	1					Lithium(DB01356)	ATCTTTTTTTAAAAAAAAGGA	0.229													14	33	---	---	---	---	PASS
AGTPBP1	23287	broad.mit.edu	37	9	88203244	88203244	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88203244T>C	uc011ltd.1	-	20	2905	c.2872A>G	c.(2872-2874)ATG>GTG	p.M958V	AGTPBP1_uc004aod.3_Missense_Mutation_p.M584V|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Missense_Mutation_p.M918V|AGTPBP1_uc011lte.1_Missense_Mutation_p.M970V	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	958					C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						GGATTTAACATAGGGACAATT	0.343													27	86	---	---	---	---	PASS
PTGR1	22949	broad.mit.edu	37	9	114325433	114325433	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114325433C>A	uc004bfh.2	-	10	1061	c.958G>T	c.(958-960)GAT>TAT	p.D320Y	ZNF483_uc004bfg.2_Intron|PTGR1_uc011lwr.1_Intron|PTGR1_uc004bfi.3_Missense_Mutation_p.D320Y|PTGR1_uc004bfj.3_3'UTR	NM_012212	NP_036344	Q14914	PTGR1_HUMAN	prostaglandin reductase 1 isoform 1	320					leukotriene metabolic process	cytoplasm	15-oxoprostaglandin 13-oxidase activity|2-alkenal reductase activity|alcohol dehydrogenase (NAD) activity|zinc ion binding				0						CCCAAATTATCTCCTTTCAGC	0.353													35	105	---	---	---	---	PASS
TRAF1	7185	broad.mit.edu	37	9	123675887	123675887	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123675887C>A	uc004bku.1	-	5	996	c.424G>T	c.(424-426)GAG>TAG	p.E142*	TRAF1_uc011lyg.1_Nonsense_Mutation_p.E20*|TRAF1_uc010mvl.1_Nonsense_Mutation_p.E142*	NM_005658	NP_005649	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	142					apoptosis|positive regulation of NF-kappaB transcription factor activity|protein complex assembly|regulation of apoptosis|signal transduction	cytoplasm	protein binding|zinc ion binding			skin(2)|ovary(1)	3						AGGTTCTGCTCCAGGGCCATG	0.652											OREG0005350	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=TRAF1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	21	72	---	---	---	---	PASS
OR1J4	26219	broad.mit.edu	37	9	125282113	125282113	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125282113A>G	uc011lyw.1	+	1	694	c.694A>G	c.(694-696)AAG>GAG	p.K232E		NM_001004452	NP_001004452	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCCATCTACTAAGGGCATCTT	0.463													49	143	---	---	---	---	PASS
PTGES2	80142	broad.mit.edu	37	9	130889721	130889721	+	Silent	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130889721C>A	uc004bti.2	-	1	754	c.276G>T	c.(274-276)GCG>GCT	p.A92A	PTGES2_uc004btj.2_RNA|PTGES2_uc004btk.2_Intron|PTGES2_uc004btl.2_Intron|PTGES2_uc004btm.2_Intron|LOC389791_uc004btn.2_5'Flank	NM_025072	NP_079348	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2	92	Glutaredoxin.|Cytoplasmic (Potential).				cell redox homeostasis|prostaglandin biosynthetic process	Golgi membrane|integral to membrane|mitochondrion|perinuclear region of cytoplasm	electron carrier activity|prostaglandin-E synthase activity|protein binding|protein disulfide oxidoreductase activity				0						GCCTTACCTGCGCGGCTGAGC	0.527													3	15	---	---	---	---	PASS
AIF1L	83543	broad.mit.edu	37	9	133989952	133989952	+	Intron	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133989952T>A	uc004cab.1	+						AIF1L_uc004cad.1_Intron|AIF1L_uc004cae.1_Intron|AIF1L_uc004cac.1_Intron|AIF1L_uc011mce.1_Intron	NM_031426	NP_113614	Q9BQI0	AIF1L_HUMAN	ionized calcium binding adapter molecule 2							actin cytoskeleton|cytoplasm|focal adhesion|ruffle membrane	actin filament binding|calcium ion binding				0						GTTTTTGCTCTGTGATTTCCA	0.507													63	174	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137717724	137717724	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137717724G>T	uc004cfe.2	+	63	5423	c.5041G>T	c.(5041-5043)GTC>TTC	p.V1681F	uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1681	Fibrillar collagen NC1.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GTCGACATGCGTCTTCCCTGA	0.577													12	51	---	---	---	---	PASS
PITRM1	10531	broad.mit.edu	37	10	3182869	3182869	+	Intron	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3182869C>A	uc010qah.1	-						PITRM1_uc001igr.1_Intron|PITRM1_uc001igs.1_Intron|PITRM1_uc001igt.1_Intron|PITRM1_uc009xhv.1_Intron|PITRM1_uc001igu.1_Intron|PITRM1_uc010qai.1_Intron|uc001igv.1_5'Flank			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;						proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						TGAACTAGAGCAAAACTCACC	0.408													5	22	---	---	---	---	PASS
APBB1IP	54518	broad.mit.edu	37	10	26830517	26830517	+	Silent	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26830517C>A	uc001iss.2	+	11	1372	c.1051C>A	c.(1051-1053)CGA>AGA	p.R351R	APBB1IP_uc009xks.1_Silent_p.R351R	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	351	PH.				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						TCAGACATCTCGAGATCTGGC	0.338													14	46	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27382415	27382415	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27382415G>C	uc001ith.2	-	3	566	c.394C>G	c.(394-396)CTG>GTG	p.L132V	ANKRD26_uc009xku.1_Missense_Mutation_p.L132V	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	132	ANK 3.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TGTTCTAGCAGAATAGTTGCA	0.418													13	131	---	---	---	---	PASS
MASTL	84930	broad.mit.edu	37	10	27444546	27444546	+	Intron	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27444546G>T	uc001itm.2	+						YME1L1_uc001iti.2_5'Flank|YME1L1_uc001itj.2_5'Flank|YME1L1_uc010qdl.1_5'Flank|YME1L1_uc009xkv.2_5'Flank|YME1L1_uc001itk.1_5'Flank|MASTL_uc001itl.2_Intron|MASTL_uc009xkw.1_Intron|MASTL_uc009xkx.1_Intron	NM_032844	NP_116233	Q96GX5	GWL_HUMAN	microtubule associated serine/threonine						cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						GTAAAGGTAGGAAGTCAACGA	0.587													24	46	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50952155	50952155	+	Silent	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50952155T>A	uc001jie.2	-	14	1888	c.1746A>T	c.(1744-1746)GTA>GTT	p.V582V	OGDHL_uc009xog.2_Silent_p.V609V|OGDHL_uc010qgt.1_Silent_p.V525V|OGDHL_uc010qgu.1_Silent_p.V373V|OGDHL_uc009xoh.2_Silent_p.V373V	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	582					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						GCTCCCCATCTACGTTGAAGA	0.627													16	37	---	---	---	---	PASS
ANXA7	310	broad.mit.edu	37	10	75147502	75147502	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75147502C>T	uc001jtz.2	-	8	717	c.644G>A	c.(643-645)CGT>CAT	p.R215H	ANXA7_uc001jua.2_Missense_Mutation_p.R193H|ANXA7_uc001jub.2_Missense_Mutation_p.R153H|ANXA7_uc010qki.1_Missense_Mutation_p.R103H|ANXA7_uc009xre.2_Missense_Mutation_p.R122H|ANXA7_uc009xrf.1_Missense_Mutation_p.R135H	NM_004034	NP_004025	P20073	ANXA7_HUMAN	annexin VII isoform 2	215	Annexin 1.						calcium ion binding|calcium-dependent phospholipid binding|calcium-dependent protein binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					ATCATTGGAACGGTTGGCCAC	0.458													32	178	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87966375	87966375	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87966375G>A	uc001kdl.1	-	3	367	c.266C>T	c.(265-267)GCC>GTC	p.A89V	GRID1_uc009xsu.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	89	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	CGTGACCAAGGCCAAAATCCC	0.592										Multiple Myeloma(13;0.14)			10	46	---	---	---	---	PASS
C10orf4	118924	broad.mit.edu	37	10	95454663	95454663	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95454663T>C	uc001kiz.1	-	5	449	c.251A>G	c.(250-252)TAT>TGT	p.Y84C	C10orf4_uc001kiv.1_RNA|C10orf4_uc001kja.1_Missense_Mutation_p.Y84C|C10orf4_uc001kjb.1_Missense_Mutation_p.Y84C|C10orf4_uc009xuh.1_Missense_Mutation_p.Y85C	NM_145246	NP_660289	Q70Z53	F10C1_HUMAN	FRA10AC1 protein	84						nucleus	protein binding				0		Colorectal(252;0.122)				GTATAAAATATAGTCATTTAC	0.328													83	304	---	---	---	---	PASS
ALDH18A1	5832	broad.mit.edu	37	10	97376254	97376254	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97376254C>G	uc001kkz.2	-	13	1827	c.1585G>C	c.(1585-1587)GTC>CTC	p.V529L	ALDH18A1_uc001kky.2_Missense_Mutation_p.V527L|ALDH18A1_uc010qog.1_Missense_Mutation_p.V418L|ALDH18A1_uc010qoh.1_Missense_Mutation_p.V317L	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1	529	Gamma-glutamyl phosphate reductase.				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	GCCTCCTTGACTCCATGGATT	0.552													4	11	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108924028	108924028	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108924028G>T	uc001kym.2	-	1	265	c.257C>A	c.(256-258)GCG>GAG	p.A86E	SORCS1_uc001kyl.2_Missense_Mutation_p.A86E|SORCS1_uc009xxs.2_Missense_Mutation_p.A86E|SORCS1_uc001kyn.1_Missense_Mutation_p.A86E|SORCS1_uc001kyo.2_Missense_Mutation_p.A86E	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	86	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CAGGGATAGCGCTCGGTCCCC	0.711													9	11	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115374062	115374062	+	Intron	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115374062G>A	uc001laj.2	-						NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Intron|NRAP_uc001lal.3_Intron	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGTACTAAAGGGAAAGAGAGC	0.453													45	179	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	116930885	116930885	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116930885T>C	uc001lcg.2	+	8	1569	c.1183T>C	c.(1183-1185)TGG>CGG	p.W395R	ATRNL1_uc001lce.2_RNA|ATRNL1_uc001lcf.2_Missense_Mutation_p.W395R|ATRNL1_uc009xyq.2_Silent_p.H365H	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	395	Kelch 2.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TAGTCAGTCATGGAGTACAAA	0.373													84	234	---	---	---	---	PASS
MMP21	118856	broad.mit.edu	37	10	127464327	127464327	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127464327T>G	uc001liu.2	-	1	64	c.64A>C	c.(64-66)ACC>CCC	p.T22P		NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein	22					proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TCGGGCTGGGTGGGCCAGGGA	0.682													6	33	---	---	---	---	PASS
PTDSS2	81490	broad.mit.edu	37	11	487414	487414	+	Intron	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:487414C>G	uc001lpj.2	+							NM_030783	NP_110410	Q9BVG9	PTSS2_HUMAN	phosphatidylserine synthase 2							integral to membrane					0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)	ACCCTGTCGCCCACAGGACAA	0.652													24	80	---	---	---	---	PASS
SYT9	143425	broad.mit.edu	37	11	7334800	7334800	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7334800G>A	uc001mfe.2	+	3	909	c.672G>A	c.(670-672)CTG>CTA	p.L224L	SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	224	Cytoplasmic (Potential).|C2 1.					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		GTGGGAAACTGAACTTCATTT	0.413													28	143	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18743146	18743146	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18743146C>T	uc009yht.2	-	4	504	c.314G>A	c.(313-315)GGC>GAC	p.G105D	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	105	Ig-like 1.									ovary(4)|large_intestine(2)|kidney(1)	7						GATGGGGATGCCGCTCTCCCT	0.592											OREG0020822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	259	---	---	---	---	PASS
MYBPC3	4607	broad.mit.edu	37	11	47361293	47361293	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47361293A>G	uc001nfa.3	-	20	2031	c.1976T>C	c.(1975-1977)ATT>ACT	p.I659T	MYBPC3_uc010rhl.1_RNA	NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	658	Ig-like C2-type 5.				cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		TACAACCACAATGGTGTCTGG	0.552													18	43	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55432897	55432897	+	Silent	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55432897C>G	uc001nht.3	+	3	520	c.255C>G	c.(253-255)TCC>TCG	p.S85S	OR4C6_uc010rik.1_Silent_p.S85S	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						ACACCCTCTCCAAGAGCACTA	0.488													59	204	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735331	55735331	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735331C>T	uc010rit.1	-	1	609	c.609G>A	c.(607-609)CTG>CTA	p.L203L		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	203	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					CAACAATCAACAGAAATGGCA	0.423													23	62	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57077504	57077504	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57077504A>C	uc001njr.2	-	5	2993	c.2681T>G	c.(2680-2682)CTG>CGG	p.L894R	TNKS1BP1_uc001njs.2_Missense_Mutation_p.L894R|TNKS1BP1_uc009ymd.1_Missense_Mutation_p.L345R	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	894	Acidic.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				ATAAGCACCCAGAGAATCTCT	0.537													108	315	---	---	---	---	PASS
OR4D9	390199	broad.mit.edu	37	11	59283148	59283148	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59283148A>T	uc010rkv.1	+	1	763	c.763A>T	c.(763-765)ATC>TTC	p.I255F		NM_001004711	NP_001004711	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D,	255	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CGTGCCCTGCATCTATGTCTA	0.547													100	347	---	---	---	---	PASS
SLC22A9	114571	broad.mit.edu	37	11	63176158	63176158	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63176158A>G	uc001nww.2	+	9	1676	c.1408A>G	c.(1408-1410)ATG>GTG	p.M470V	SLC22A9_uc001nwx.2_Intron	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	470	Helical; (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						GGCAAGAGCTATGGGGATCAA	0.438													37	85	---	---	---	---	PASS
SNX15	29907	broad.mit.edu	37	11	64806067	64806067	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64806067C>G	uc001oci.3	+	10	1341	c.688C>G	c.(688-690)CAT>GAT	p.H230D	SNX15_uc009ypy.2_Missense_Mutation_p.H230D|SNX15_uc001ocj.2_Missense_Mutation_p.H230D|SNX15_uc001ock.2_Intron|SAC3D1_uc010rnv.1_5'Flank|SAC3D1_uc001ocm.2_5'Flank	NM_013306	NP_037438	Q9NRS6	SNX15_HUMAN	sorting nexin 15 isoform A	230					cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity			ovary(1)	1						CAGCCCCACCCATGTGGCTGA	0.632													8	34	---	---	---	---	PASS
GAL3ST3	89792	broad.mit.edu	37	11	65812855	65812855	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65812855G>T	uc001ogv.2	-	1	192	c.32C>A	c.(31-33)GCC>GAC	p.A11D	GAL3ST3_uc001ogw.2_Missense_Mutation_p.A11D	NM_033036	NP_149025	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	11	Cytoplasmic (Potential).				monosaccharide metabolic process|oligosaccharide metabolic process|poly-N-acetyllactosamine metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|carbohydrate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity			ovary(1)	1						CATCTTGGTGGCCTGCTGCAG	0.637											OREG0021093	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	46	---	---	---	---	PASS
CHORDC1	26973	broad.mit.edu	37	11	89944446	89944446	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89944446C>A	uc001pdg.2	-	5	780	c.370G>T	c.(370-372)GCC>TCC	p.A124S	CHORDC1_uc009yvz.2_Missense_Mutation_p.A105S	NM_012124	NP_036256	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain-containing	124	Interaction with HSP90AA1 and HSP90AB1 (By similarity).				chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				TTTAGGGAGGCAGATATTTTT	0.279													28	196	---	---	---	---	PASS
HTR3B	9177	broad.mit.edu	37	11	113780125	113780125	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113780125C>A	uc001pok.2	+	2	228	c.161C>A	c.(160-162)ACC>AAC	p.T54N	HTR3B_uc001pol.2_Missense_Mutation_p.T43N	NM_006028	NP_006019	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B	54	Extracellular (Potential).				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)		TACAACTGGACCAAGGCCACC	0.448													35	148	---	---	---	---	PASS
HTR3B	9177	broad.mit.edu	37	11	113780126	113780126	+	Silent	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113780126C>A	uc001pok.2	+	2	229	c.162C>A	c.(160-162)ACC>ACA	p.T54T	HTR3B_uc001pol.2_Silent_p.T43T	NM_006028	NP_006019	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B	54	Extracellular (Potential).				synaptic transmission	integral to plasma membrane|postsynaptic membrane	serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)		ACAACTGGACCAAGGCCACCA	0.443													36	149	---	---	---	---	PASS
GRAMD1B	57476	broad.mit.edu	37	11	123476080	123476080	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123476080C>G	uc001pyx.2	+	9	1117	c.788C>G	c.(787-789)TCC>TGC	p.S263C	GRAMD1B_uc001pyw.2_Missense_Mutation_p.S270C|GRAMD1B_uc010rzw.1_Missense_Mutation_p.S223C|GRAMD1B_uc010rzx.1_Missense_Mutation_p.S223C|GRAMD1B_uc009zbe.1_Missense_Mutation_p.S259C|GRAMD1B_uc001pyy.2_5'Flank	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	263						integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GACAGCTCATCCAAGAGCAGC	0.517													7	80	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294351	124294351	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294351G>T	uc010sak.1	-	1	417	c.417C>A	c.(415-417)GTC>GTA	p.V139V		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	139	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GCAGAAAGCAGACCCTTGGGG	0.517													30	104	---	---	---	---	PASS
KCNJ5	3762	broad.mit.edu	37	11	128786380	128786380	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128786380C>T	uc001qet.2	+	3	1328	c.1014C>T	c.(1012-1014)ACC>ACT	p.T338T	KCNJ5_uc009zck.2_Silent_p.T338T|KCNJ5_uc001qew.2_Silent_p.T338T	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	338	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)	CAGTCCTCACCTTGGAAAAGG	0.537													54	165	---	---	---	---	PASS
LDHB	3945	broad.mit.edu	37	12	21796970	21796970	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21796970C>G	uc001rfc.2	-	3	338	c.320G>C	c.(319-321)CGG>CCG	p.R107P	LDHB_uc001rfd.2_Missense_Mutation_p.R107P|LDHB_uc001rfe.2_Missense_Mutation_p.R107P	NM_002300	NP_002291	P07195	LDHB_HUMAN	L-lactate dehydrogenase B	107		Substrate.	R -> W (in GUA1; LDHB deficiency; inactive).		glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity			breast(2)|ovary(1)	3					NADH(DB00157)	CAGATTGAGCCGACTCTCCCC	0.403													33	99	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26217646	26217646	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26217646C>T	uc001rgx.2	+	3	540	c.319C>T	c.(319-321)CCC>TCC	p.P107S	RASSF8_uc001rgy.2_Missense_Mutation_p.P107S|RASSF8_uc001rgz.2_Missense_Mutation_p.P107S|RASSF8_uc009zjd.1_Missense_Mutation_p.P107S|RASSF8_uc009zje.1_Missense_Mutation_p.P107S	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	107					signal transduction						0	Colorectal(261;0.0847)					GCAGAGTCTGCCCCCCTTAGC	0.478													6	226	---	---	---	---	PASS
SLC11A2	4891	broad.mit.edu	37	12	51386099	51386099	+	Silent	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51386099T>C	uc001rxe.3	-	13	1318	c.1221A>G	c.(1219-1221)TCA>TCG	p.S407S	SLC11A2_uc001rxd.3_Silent_p.S256S|SLC11A2_uc001rxc.3_Silent_p.S407S|SLC11A2_uc001rxf.2_RNA|SLC11A2_uc001rxg.1_Silent_p.S20S|SLC11A2_uc010smx.1_Silent_p.S403S|SLC11A2_uc001rxh.1_Silent_p.S407S|SLC11A2_uc001rxj.1_Silent_p.S407S|SLC11A2_uc001rxi.2_Silent_p.S407S|SLC11A2_uc001rxk.1_Silent_p.S436S|SLC11A2_uc010smy.1_Silent_p.S370S	NM_000617	NP_000608	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled	407	Cytoplasmic (Potential).				activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1						GGGCAAAGCGTGACCACTTTA	0.473													25	101	---	---	---	---	PASS
KRT71	112802	broad.mit.edu	37	12	52946483	52946483	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52946483G>A	uc001sao.2	-	1	449	c.379C>T	c.(379-381)CGT>TGT	p.R127C		NM_033448	NP_258259	Q3SY84	K2C71_HUMAN	keratin 71	127	Head.						structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.194)		TCCTGGGCACGCACTTTCTGG	0.592													26	123	---	---	---	---	PASS
CALCOCO1	57658	broad.mit.edu	37	12	54118511	54118511	+	Silent	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54118511C>A	uc001sef.2	-	3	321	c.177G>T	c.(175-177)CGG>CGT	p.R59R	CALCOCO1_uc010som.1_Silent_p.R59R|CALCOCO1_uc010son.1_Intron|CALCOCO1_uc001seh.2_Silent_p.R59R|CALCOCO1_uc009znd.2_Silent_p.R59R|CALCOCO1_uc001seg.2_5'UTR|CALCOCO1_uc010soo.1_Silent_p.R59R	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	59	N-terminal AD (CTNNB1 binding site) (By similarity).				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						TGTGGTAATCCCGAACACAGG	0.498													7	42	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57864530	57864530	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57864530G>T	uc001snx.2	+	12	2085	c.2007G>T	c.(2005-2007)GTG>GTT	p.V669V	GLI1_uc009zpq.2_Silent_p.V541V	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	669					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			CACCCACTGTGGCAGGGGGAG	0.612													26	57	---	---	---	---	PASS
MBD6	114785	broad.mit.edu	37	12	57921292	57921292	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57921292C>T	uc001soj.1	+	8	2309	c.2085C>T	c.(2083-2085)CCC>CCT	p.P695P	MBD6_uc001sok.1_Silent_p.P562P|MBD6_uc001sol.1_RNA	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	695	Pro-rich.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						TTTCTTAGCCCTGTGTCCTGA	0.353													51	147	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78225350	78225350	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78225350T>G	uc001syp.2	+	1	282	c.109T>G	c.(109-111)TGT>GGT	p.C37G	NAV3_uc001syo.2_Missense_Mutation_p.C37G	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	37						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GTCACAGCACTGTTCTTCAAG	0.473										HNSCC(70;0.22)			67	227	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100887129	100887129	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100887129C>A	uc001thq.1	+	4	543	c.28C>A	c.(28-30)CAT>AAT	p.H10N	NR1H4_uc001thp.1_Missense_Mutation_p.H10N|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.H10N|NR1H4_uc010svk.1_Missense_Mutation_p.H10N	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	Error:Variant_position_missing_in_Q96RI1_after_alignment					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TCTCATTGAACATTCCCATTT	0.289													4	31	---	---	---	---	PASS
ASCL4	121549	broad.mit.edu	37	12	108169075	108169075	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108169075T>C	uc001tmr.2	+	1	914	c.83T>C	c.(82-84)CTG>CCG	p.L28P		NM_203436	NP_982260	Q6XD76	ASCL4_HUMAN	achaete-scute complex-like 4	27					regulation of transcription from RNA polymerase II promoter|skin development|transcription, DNA-dependent	nucleus	DNA binding			central_nervous_system(1)	1						CCGGGGACCCTGCCCGGACTC	0.711													30	108	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109696835	109696835	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109696835G>T	uc001tob.2	+	47	6537	c.6418G>T	c.(6418-6420)GCC>TCC	p.A2140S	ACACB_uc001toc.2_Missense_Mutation_p.A2140S|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Missense_Mutation_p.A806S	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	2140	Carboxyltransferase.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	AACCGCCCAGGCCGTCAAGGA	0.562													65	280	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23914497	23914497	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23914497C>G	uc001uon.2	-	10	4107	c.3518G>C	c.(3517-3519)TGG>TCG	p.W1173S	SACS_uc001uoo.2_Missense_Mutation_p.W1026S|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1173					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ATCTCCTTTCCAGACCAAAGA	0.408													15	81	---	---	---	---	PASS
SLC7A1	6541	broad.mit.edu	37	13	30091895	30091895	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30091895T>C	uc001uso.2	-	10	1712	c.1325A>G	c.(1324-1326)CAG>CGG	p.Q442R		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	442	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	ACTGGCCATCTGGTATACCAG	0.502													15	135	---	---	---	---	PASS
FSCB	84075	broad.mit.edu	37	14	44975752	44975752	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44975752G>A	uc001wvn.2	-	1	748	c.439C>T	c.(439-441)CCT>TCT	p.P147S		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	147						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		TTTTCTACAGGGGGGATGTTC	0.413													97	276	---	---	---	---	PASS
KIAA0831	22863	broad.mit.edu	37	14	55848689	55848689	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55848689G>A	uc001xbx.1	-	6	904	c.868C>T	c.(868-870)CAG>TAG	p.Q290*	FBXO34_uc001xbv.2_Intron|KIAA0831_uc001xbw.1_Nonsense_Mutation_p.Q177*	NM_014924	NP_055739	Q6ZNE5	BAKOR_HUMAN	Barkor	290					autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0						CCAGGCCCCTGGGTTGTTTTC	0.373													45	90	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64430698	64430698	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64430698A>T	uc001xgm.2	+	10	1200	c.970A>T	c.(970-972)ACC>TCC	p.T324S	SYNE2_uc001xgl.2_Missense_Mutation_p.T324S	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	324	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGAGAATGATACCTACTTTAA	0.323													7	23	---	---	---	---	PASS
FAM161B	145483	broad.mit.edu	37	14	74409247	74409247	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74409247G>A	uc001xpd.1	-	4	1203	c.1097C>T	c.(1096-1098)CCT>CTT	p.P366L		NM_152445	NP_689658			hypothetical protein LOC145483											ovary(1)	1						ATTCACCCGAGGCTGGAATCT	0.552													41	226	---	---	---	---	PASS
SNORD114-1	767577	broad.mit.edu	37	14	101416168	101416168	+	5'Flank	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101416168C>T	uc001yir.2	+						SNORD114-2_uc001yis.2_5'Flank	NR_003193				Homo sapiens small nucleolar RNA, C/D box 114-1 (SNORD114-1), non-coding RNA.												0						TAGAGTCAATCTTGGACCTAT	0.333													27	58	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105412026	105412026	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105412026G>A	uc010axc.1	-	7	9882	c.9762C>T	c.(9760-9762)GAC>GAT	p.D3254D	AHNAK2_uc001ypx.2_Silent_p.D3154D	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3254						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCTTTCAGGTCCAGCTTGG	0.607													9	139	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105412521	105412521	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105412521G>A	uc010axc.1	-	7	9387	c.9267C>T	c.(9265-9267)GAC>GAT	p.D3089D	AHNAK2_uc001ypx.2_Silent_p.D2989D	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3089						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCTTTCAGGTCCAGCTTGG	0.612													5	68	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33922213	33922213	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33922213T>A	uc001zhi.2	+	22	2822	c.2752T>A	c.(2752-2754)TAT>AAT	p.Y918N	RYR3_uc010bar.2_Missense_Mutation_p.Y918N	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	918	4 X approximate repeats.|1.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGAGAAGAACTATAACCTGCA	0.343													11	23	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42143250	42143250	+	Intron	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42143250C>G	uc001zos.2	-							NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5						actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CATGTCTCTCCGCTCACCTTA	0.632													7	11	---	---	---	---	PASS
TRPM7	54822	broad.mit.edu	37	15	50866825	50866825	+	Intron	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50866825A>G	uc001zyt.3	-						TRPM7_uc001zyr.2_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AAAAAAATTAAAGATTTACCT	0.303													50	203	---	---	---	---	PASS
SCG3	29106	broad.mit.edu	37	15	51973965	51973965	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51973965G>C	uc002abh.2	+	1	421	c.13G>C	c.(13-15)GGG>CGG	p.G5R	SCG3_uc010ufz.1_5'UTR	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor	5					platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)		GGGGTTCCTCGGGACCGGCAC	0.522													14	56	---	---	---	---	PASS
LIPC	3990	broad.mit.edu	37	15	58830668	58830668	+	Silent	SNP	C	T	T	rs146362585	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58830668C>T	uc010bga.1	+	4	833	c.225C>T	c.(223-225)TGC>TGT	p.C75C	LIPC_uc010bfz.1_Silent_p.C75C|LIPC_uc002afa.1_Silent_p.C75C|LIPC_uc010bgb.1_Intron|LIPC_uc010ugy.1_Silent_p.C75C	NM_000236	NP_000227	P11150	LIPC_HUMAN	lipase C precursor	75					cholesterol homeostasis|chylomicron remnant clearance|fatty acid biosynthetic process|high-density lipoprotein particle remodeling|intermediate-density lipoprotein particle remodeling|low-density lipoprotein particle remodeling|phosphatidylcholine catabolic process|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein binding|heparin binding|low-density lipoprotein particle binding|phospholipase activity|triglyceride lipase activity			ovary(1)	1		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		TACAGGAGTGCGGCTTCAACT	0.473													5	228	---	---	---	---	PASS
DPP8	54878	broad.mit.edu	37	15	65759121	65759121	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65759121T>A	uc002aov.2	-	14	3346	c.1768A>T	c.(1768-1770)AAC>TAC	p.N590Y	DPP8_uc002aow.2_Missense_Mutation_p.N590Y|DPP8_uc010uiv.1_RNA|DPP8_uc002aox.2_Missense_Mutation_p.N574Y|DPP8_uc002aoy.2_Missense_Mutation_p.N590Y|DPP8_uc002aoz.2_Missense_Mutation_p.N574Y|DPP8_uc010bhj.2_Missense_Mutation_p.N590Y|DPP8_uc002apa.2_Missense_Mutation_p.N487Y|DPP8_uc010bhi.2_5'UTR|DPP8_uc010bhk.1_Missense_Mutation_p.N159Y	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1	590					immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						TTCTTCTGGTTACTATACTTA	0.383													27	96	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70961109	70961109	+	Silent	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70961109T>C	uc002asr.2	-	16	2018	c.1914A>G	c.(1912-1914)TCA>TCG	p.S638S	UACA_uc010uke.1_Silent_p.S529S|UACA_uc002asq.2_Silent_p.S625S|UACA_uc010bin.1_Silent_p.S613S	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	638	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						CATTTGATAATGAGCTCTTCA	0.358													47	164	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86124328	86124328	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86124328A>C	uc002blv.1	+	7	3199	c.3029A>C	c.(3028-3030)CAA>CCA	p.Q1010P	AKAP13_uc002blt.1_Missense_Mutation_p.Q1010P|AKAP13_uc002blu.1_Missense_Mutation_p.Q1010P|AKAP13_uc010bne.1_5'Flank	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1010					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						CTGCTGACTCAAGGTGGGGCT	0.562													35	109	---	---	---	---	PASS
SV2B	9899	broad.mit.edu	37	15	91824968	91824968	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91824968A>T	uc002bqv.2	+	9	1775	c.1384A>T	c.(1384-1386)ATG>TTG	p.M462L	SV2B_uc010uqv.1_Missense_Mutation_p.M311L|SV2B_uc002bqu.3_RNA	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	462	Extracellular (Potential).				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GTTCACAAGAATGTACTTTAA	0.373													27	159	---	---	---	---	PASS
OR4F6	390648	broad.mit.edu	37	15	102346591	102346591	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102346591G>T	uc010utr.1	+	1	669	c.669G>T	c.(667-669)GTG>GTT	p.V223V		NM_001005326	NP_001005326	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TTATTTTGGTGACTGTTCAGA	0.363													71	291	---	---	---	---	PASS
SLC5A11	115584	broad.mit.edu	37	16	24902389	24902389	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24902389G>A	uc002dmu.2	+	9	1096	c.864G>A	c.(862-864)ACG>ACA	p.T288T	SLC5A11_uc002dms.2_Silent_p.T224T|SLC5A11_uc010vcd.1_Silent_p.T253T|SLC5A11_uc002dmt.2_Intron|SLC5A11_uc010vce.1_Silent_p.T218T|SLC5A11_uc010bxt.2_Silent_p.T224T	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	288	Helical; (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		ACTGGTGCACGGATCAGGTAC	0.507													46	188	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48134806	48134806	+	Silent	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48134806G>C	uc002efc.1	-	21	3361	c.3015C>G	c.(3013-3015)GGC>GGG	p.G1005G	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	1005	ABC transmembrane type-1 2.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				TCTCCTTCTTGCCATAGGCGT	0.612													21	42	---	---	---	---	PASS
KIAA0174	9798	broad.mit.edu	37	16	71958710	71958710	+	Silent	SNP	A	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71958710A>T	uc002fbj.1	+	11	1213	c.930A>T	c.(928-930)GCA>GCT	p.A310A	KIAA0174_uc010cgh.1_Silent_p.A310A|KIAA0174_uc002fbk.1_Missense_Mutation_p.H296L|KIAA0174_uc002fbm.1_Silent_p.A297A|KIAA0174_uc002fbl.1_Silent_p.A266A|KIAA0174_uc002fbn.1_Silent_p.A149A|KIAA0174_uc010cgi.1_Silent_p.A68A|KIAA0174_uc010cgj.1_Intron|KIAA0174_uc010vml.1_RNA			P53990	IST1_HUMAN	SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;	295	Interaction with VTA1.				cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1						TCTCTTCTGCACAGATTGTTG	0.418													26	82	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	G	G	rs28934576	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577120C>G	uc002gim.2	-	8	1012	c.818G>C	c.(817-819)CGT>CCT	p.R273P	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141P|TP53_uc010cng.1_Missense_Mutation_p.R141P|TP53_uc002gii.1_Missense_Mutation_p.R141P|TP53_uc010cnh.1_Missense_Mutation_p.R273P|TP53_uc010cni.1_Missense_Mutation_p.R273P|TP53_uc002gij.2_Missense_Mutation_p.R273P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACAAACACGCACCTCAAA	0.542	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			39	24	---	---	---	---	PASS
C17orf68	80169	broad.mit.edu	37	17	8141724	8141724	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8141724C>T	uc002gkq.3	-	3	480	c.421G>A	c.(421-423)GTC>ATC	p.V141I	C17orf68_uc010cnv.2_RNA	NM_025099	NP_079375	Q2NKJ3	CTC1_HUMAN	alpha accessory factor 132	141					positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding				0						CAGCTCAGGACGCCAGTGTTA	0.488													108	134	---	---	---	---	PASS
TNFRSF13B	23495	broad.mit.edu	37	17	16855826	16855826	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16855826C>A	uc002gqs.1	-	2	146	c.133G>T	c.(133-135)GGT>TGT	p.G45C	TNFRSF13B_uc010vwt.1_Intron|TNFRSF13B_uc002gqt.1_Intron|TNFRSF13B_uc010vwu.1_Missense_Mutation_p.G45C	NM_012452	NP_036584	O14836	TR13B_HUMAN	tumor necrosis factor receptor 13B	45	TNFR-Cys 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding|receptor activity			kidney(2)	2						ATGCAGGTACCCAGCAGAGGA	0.602									IgA_Deficiency_Selective				41	41	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34186068	34186068	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34186068G>C	uc002hke.1	-	9	912	c.763C>G	c.(763-765)CAA>GAA	p.Q255E	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Missense_Mutation_p.Q215E|C17orf66_uc010wcm.1_Missense_Mutation_p.Q221E	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	255							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		TCCCCGACTTGAGTCCTCTGT	0.443													55	63	---	---	---	---	PASS
MED24	9862	broad.mit.edu	37	17	38192031	38192031	+	Silent	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38192031C>T	uc002htt.2	-	5	583	c.270G>A	c.(268-270)CGG>CGA	p.R90R	MED24_uc010wes.1_5'Flank|MED24_uc010wet.1_RNA|MED24_uc002hts.2_Silent_p.R115R|MED24_uc002htu.2_Silent_p.R77R|MED24_uc010cwn.2_Silent_p.R77R|MED24_uc010weu.1_Intron|MED24_uc010wev.1_Silent_p.R40R|MED24_uc010wew.1_Silent_p.R19R|MED24_uc010wex.1_Intron|MED24_uc010wez.1_5'Flank|MED24_uc010wfa.1_Silent_p.R40R|MED24_uc010wfb.1_Silent_p.R102R|MED24_uc010wfc.1_Silent_p.R27R	NM_014815	NP_055630	O75448	MED24_HUMAN	mediator complex subunit 24 isoform 1	90					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1	Colorectal(19;0.000442)					CACACAGGTCCCGAGAAAAGT	0.532													34	48	---	---	---	---	PASS
GPR142	350383	broad.mit.edu	37	17	72363714	72363714	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72363714G>T	uc010wqy.1	+	1	70	c.70G>T	c.(70-72)GCT>TCT	p.A24S	GPR142_uc010wqx.1_5'UTR	NM_181790	NP_861455	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	24	Extracellular (Potential).					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GGACATCACTGCTGTCCTGGG	0.493													57	79	---	---	---	---	PASS
LRRC30	339291	broad.mit.edu	37	18	7231835	7231835	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7231835C>A	uc010wzk.1	+	1	699	c.699C>A	c.(697-699)AGC>AGA	p.S233R		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	233	LRR 8.									ovary(1)|liver(1)	2						TGGTCACCAGCCTGGAGCTGC	0.577													46	92	---	---	---	---	PASS
LRRC30	339291	broad.mit.edu	37	18	7231836	7231836	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7231836C>A	uc010wzk.1	+	1	700	c.700C>A	c.(700-702)CTG>ATG	p.L234M		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	234	LRR 8.									ovary(1)|liver(1)	2						GGTCACCAGCCTGGAGCTGCT	0.577													45	93	---	---	---	---	PASS
RALBP1	10928	broad.mit.edu	37	18	9535926	9535926	+	Silent	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9535926G>A	uc002kob.2	+	10	2182	c.1959G>A	c.(1957-1959)ACG>ACA	p.T653T	RALBP1_uc002koc.2_Silent_p.T653T	NM_006788	NP_006779	Q15311	RBP1_HUMAN	ralA binding protein 1	653					chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1						GGAAGGAGACGTCCATCTGAG	0.622													9	17	---	---	---	---	PASS
MEP1B	4225	broad.mit.edu	37	18	29770033	29770033	+	5'UTR	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29770033C>T	uc002kxj.3	+	1						NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor						digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						GAAGCTACAACATGGATTTAT	0.333													12	50	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50278510	50278510	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50278510G>T	uc002lfe.1	+	2	765	c.178G>T	c.(178-180)GAC>TAC	p.D60Y	DCC_uc010xdr.1_5'UTR	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	60	Extracellular (Potential).|Ig-like C2-type 1.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGTCCTCCTCGACTGCTCCGC	0.507													3	87	---	---	---	---	PASS
SERPINB12	89777	broad.mit.edu	37	18	61232707	61232707	+	Silent	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61232707G>C	uc010xen.1	+	6	675	c.675G>C	c.(673-675)ACG>ACC	p.T225T	SERPINB12_uc010xeo.1_Silent_p.T245T	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	225					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0						AGATGATGACGCAAAAAGGCC	0.488													47	161	---	---	---	---	PASS
TMX3	54495	broad.mit.edu	37	18	66344201	66344201	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66344201G>A	uc002lkf.2	-	16	1469	c.1334C>T	c.(1333-1335)CCC>CTC	p.P445L	TMX3_uc010xez.1_Missense_Mutation_p.P304L	NM_019022	NP_061895	Q96JJ7	TMX3_HUMAN	thioredoxin domain containing 10 precursor	445	Cytoplasmic (Potential).				cell redox homeostasis|glycerol ether metabolic process	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			skin(1)	1						TACATCCTTGGGCTCCTGCAC	0.363													26	192	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72345210	72345210	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72345210C>A	uc002llw.2	+	1	2292	c.2235C>A	c.(2233-2235)AGC>AGA	p.S745R	ZNF407_uc010xfc.1_Missense_Mutation_p.S745R|ZNF407_uc010dqu.1_Missense_Mutation_p.S745R|ZNF407_uc002llu.2_Missense_Mutation_p.S744R	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	745					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ATTCATTGAGCAAAGAAGGAA	0.318													12	76	---	---	---	---	PASS
PQLC1	80148	broad.mit.edu	37	18	77710719	77710719	+	Intron	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77710719C>A	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		AAGCCCCCAACTTACCAGAAG	0.602													16	41	---	---	---	---	PASS
MIER2	54531	broad.mit.edu	37	19	326584	326584	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:326584C>G	uc002lok.1	-	6	517	c.508G>C	c.(508-510)GAT>CAT	p.D170H		NM_017550	NP_060020	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family	170					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTCTTCATCAGCCAGGAAA	0.562													3	152	---	---	---	---	PASS
C19orf35	374872	broad.mit.edu	37	19	2278808	2278808	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2278808G>T	uc002lvn.2	-	3	487	c.387C>A	c.(385-387)CAC>CAA	p.H129Q	SPPL2B_uc010dsw.1_Intron	NM_198532	NP_940934	Q6ZS72	CS035_HUMAN	hypothetical protein LOC374872	129										pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCCGGGCTGTGCAGATCGC	0.701													7	13	---	---	---	---	PASS
SAFB2	9667	broad.mit.edu	37	19	5587258	5587258	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5587258T>A	uc002mcd.2	-	21	3070	c.2858A>T	c.(2857-2859)TAC>TTC	p.Y953F		NM_014649	NP_055464	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	953	Interacts with SAFB1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		TGGGACTTAGTAGCGGCGGGT	0.483													12	57	---	---	---	---	PASS
ECSIT	51295	broad.mit.edu	37	19	11616987	11616987	+	3'UTR	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11616987C>A	uc002msb.2	-	8					ZNF653_uc002mrz.1_5'Flank|ECSIT_uc002msa.1_RNA|ECSIT_uc010dyc.1_3'UTR|ECSIT_uc010dyd.2_3'UTR|ECSIT_uc010xma.1_3'UTR	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate						innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						CGTGCCCTCGCGCCGGCTCAG	0.632													23	183	---	---	---	---	PASS
TNPO2	30000	broad.mit.edu	37	19	12812151	12812151	+	3'UTR	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12812151C>A	uc002muo.2	-	24					TNPO2_uc002mup.2_3'UTR|TNPO2_uc002muq.2_3'UTR|TNPO2_uc002mur.2_3'UTR	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)						intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						TGGCAGTCTCCATGATCACCT	0.577													16	46	---	---	---	---	PASS
ASNA1	439	broad.mit.edu	37	19	12858298	12858298	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12858298G>T	uc002muv.2	+	6	821	c.807G>T	c.(805-807)AAG>AAT	p.K269N	ASNA1_uc002muw.2_Missense_Mutation_p.K268N	NM_004317	NP_004308	O43681	ASNA_HUMAN	arsA arsenite transporter, ATP-binding, homolog	269					response to arsenic-containing substance	endoplasmic reticulum|nucleolus|soluble fraction	arsenite-transporting ATPase activity|ATP binding|metal ion binding			ovary(2)	2					Adenosine triphosphate(DB00171)	CCAAGTGCAAGATTGACACAC	0.527													14	71	---	---	---	---	PASS
GCDH	2639	broad.mit.edu	37	19	13004297	13004297	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13004297G>A	uc002mvq.2	+	6	412	c.335G>A	c.(334-336)GGA>GAA	p.G112E	GCDH_uc010xms.1_Missense_Mutation_p.G79E|GCDH_uc002mvp.2_Missense_Mutation_p.G112E|GCDH_uc010xmt.1_5'UTR|GCDH_uc010xmu.1_Missense_Mutation_p.G68E	NM_000159	NP_000150	Q92947	GCDH_HUMAN	glutaryl-Coenzyme A dehydrogenase isoform a	112					lysine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|glutaryl-CoA dehydrogenase activity|protein binding				0						CTACCACCAGGATATGGCTGT	0.597													16	67	---	---	---	---	PASS
CILP2	148113	broad.mit.edu	37	19	19656165	19656165	+	Silent	SNP	G	T	T	rs149585848	byFrequency	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19656165G>T	uc002nmv.3	+	8	2896	c.2811G>T	c.(2809-2811)CGG>CGT	p.R937R	CILP2_uc002nmw.3_Silent_p.R943R	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	937						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						AGGAGTTCCGGGCCTGCTTCC	0.657													7	23	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039383	31039383	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039383G>T	uc002nsu.1	+	4	2995	c.2857G>T	c.(2857-2859)GAT>TAT	p.D953Y	ZNF536_uc010edd.1_Missense_Mutation_p.D953Y	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	953					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CCACGGAGTGGATGGTGGTGA	0.542													73	268	---	---	---	---	PASS
LRP3	4037	broad.mit.edu	37	19	33697590	33697590	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33697590A>T	uc010edh.2	+	6	1769	c.1676A>T	c.(1675-1677)CAG>CTG	p.Q559L	LRP3_uc010xrp.1_3'UTR|LRP3_uc002nuk.3_Missense_Mutation_p.Q433L	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	559	Cytoplasmic (Potential).				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CTCATCGCCCAGGGCCTCATT	0.672													33	131	---	---	---	---	PASS
MAG	4099	broad.mit.edu	37	19	35802819	35802819	+	Splice_Site	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35802819A>G	uc002nyy.1	+	10	1766	c.1617_splice	c.e10-2	p.K539_splice	MAG_uc002nyx.1_Splice_Site_p.K539_splice|MAG_uc010eds.1_Splice_Site_p.K514_splice|MAG_uc002nyz.1_Splice_Site_p.K539_splice	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCTGCCCTGCAGAAAGAACGT	0.597													5	17	---	---	---	---	PASS
MAG	4099	broad.mit.edu	37	19	35804366	35804366	+	3'UTR	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35804366G>T	uc002nyy.1	+	11					MAG_uc002nyx.1_3'UTR|MAG_uc010eds.1_3'UTR|MAG_uc002nyz.1_Intron	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GAAGGAGCTGGGGGCAGCCTG	0.647													9	40	---	---	---	---	PASS
ZFP30	22835	broad.mit.edu	37	19	38125950	38125950	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38125950C>T	uc002ogv.1	-	6	2008	c.1492G>A	c.(1492-1494)GAA>AAA	p.E498K	ZFP30_uc002ogw.1_Missense_Mutation_p.E498K|ZFP30_uc002ogx.1_Missense_Mutation_p.E498K|ZFP30_uc010xtt.1_Missense_Mutation_p.E497K	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog	498	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTTACATTCCTTACATTTG	0.338													26	120	---	---	---	---	PASS
RPS16	6217	broad.mit.edu	37	19	39926481	39926481	+	Intron	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39926481G>A	uc002olk.2	-						RPS16_uc002oll.2_Intron|RPS16_uc002olm.2_Intron	NM_001020	NP_001011	P62249	RS16_HUMAN	ribosomal protein S16						endocrine pancreas development|ribosomal small subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome			skin(1)	1	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;4.14e-26)|all cancers(26;2.68e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TCCGGCGTCTGGCTCACCTTG	0.667													14	77	---	---	---	---	PASS
PLA2G4C	8605	broad.mit.edu	37	19	48607849	48607849	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48607849T>C	uc002phx.2	-	4	651	c.253A>G	c.(253-255)ACT>GCT	p.T85A	PLA2G4C_uc002phw.2_Missense_Mutation_p.T20A|PLA2G4C_uc010elr.2_Missense_Mutation_p.T85A|PLA2G4C_uc010xzd.1_Missense_Mutation_p.T95A|PLA2G4C_uc002phy.3_Missense_Mutation_p.T85A	NM_003706	NP_003697	Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC isoform 1 precursor	85	PLA2c.				arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding			ovary(1)|skin(1)	2		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		GCTTACCAAGTGGATCCAGAG	0.403													41	140	---	---	---	---	PASS
IGLON5	402665	broad.mit.edu	37	19	51827045	51827045	+	Silent	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51827045C>A	uc002pwc.2	+	3	288	c.288C>A	c.(286-288)TCC>TCA	p.S96S		NM_001101372	NP_001094842	A6NGN9	IGLO5_HUMAN	IgLON family member 5 precursor	96	Ig-like C2-type 1.					extracellular region					0						AGGAGTTCTCCATCCTCATCA	0.642													7	39	---	---	---	---	PASS
VN1R2	317701	broad.mit.edu	37	19	53762509	53762509	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53762509A>C	uc002qbi.2	+	1	965	c.881A>C	c.(880-882)CAG>CCG	p.Q294P		NM_173856	NP_776255	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	294	Cytoplasmic (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0				GBM - Glioblastoma multiforme(134;0.00301)		CACAAACAGCAGGTACAACAC	0.483													44	211	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56538777	56538777	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56538777G>T	uc002qmj.2	+	7	1178	c.1178G>T	c.(1177-1179)AGT>ATT	p.S393I	NLRP5_uc002qmi.2_Missense_Mutation_p.S374I	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	393	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTCATACGCAGTCTGCTGAGG	0.552													13	31	---	---	---	---	PASS
CHGB	1114	broad.mit.edu	37	20	5903744	5903744	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5903744G>A	uc002wmg.2	+	4	1260	c.954G>A	c.(952-954)ATG>ATA	p.M318I	CHGB_uc010zqz.1_Missense_Mutation_p.M1I	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	318						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						ACGTCAGCATGGCCAGTTTAG	0.542													19	79	---	---	---	---	PASS
CHGB	1114	broad.mit.edu	37	20	5903745	5903745	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5903745G>T	uc002wmg.2	+	4	1261	c.955G>T	c.(955-957)GCC>TCC	p.A319S	CHGB_uc010zqz.1_Missense_Mutation_p.A2S	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	319						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						CGTCAGCATGGCCAGTTTAGG	0.542													19	78	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7894954	7894954	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7894954G>T	uc002wmw.1	-	3	426	c.402C>A	c.(400-402)TAC>TAA	p.Y134*	HAO1_uc010gbu.2_Nonsense_Mutation_p.Y134*	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	134	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						CTCGGTCCTTGTAGATATACA	0.537													21	74	---	---	---	---	PASS
TM9SF4	9777	broad.mit.edu	37	20	30729590	30729590	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30729590G>T	uc002wxj.2	+	5	655	c.420G>T	c.(418-420)GTG>GTT	p.V140V	TM9SF4_uc010ztr.1_Silent_p.V66V|TM9SF4_uc010zts.1_Silent_p.V47V|TM9SF4_uc002wxk.2_Silent_p.V123V|TM9SF4_uc010gdz.2_Silent_p.V47V	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	140						integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ACCTGCCTGTGGCCACCCGGC	0.587													31	154	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36640671	36640671	+	Silent	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36640671C>G	uc002xhl.2	-	3	1757	c.1548G>C	c.(1546-1548)GTG>GTC	p.V516V	KIAA0406_uc002xhm.2_Silent_p.V516V	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	516							binding				0		Myeloproliferative disorder(115;0.00874)				TCCGGTAAACCACAGATTGAT	0.423													37	107	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37531435	37531435	+	Silent	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37531435G>T	uc002xje.2	+	6	885	c.696G>T	c.(694-696)CTG>CTT	p.L232L	PPP1R16B_uc010ggc.2_Silent_p.L232L	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	232	ANK 3.				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				GTGCCACACTGGTGAGGAGAT	0.612													18	107	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37531436	37531436	+	Splice_Site	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37531436G>T	uc002xje.2	+	6	885	c.696_splice	c.e6+1	p.L232_splice	PPP1R16B_uc010ggc.2_Splice_Site_p.L232_splice	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor						regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TGCCACACTGGTGAGGAGATG	0.617													17	105	---	---	---	---	PASS
C21orf91	54149	broad.mit.edu	37	21	19165739	19165739	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19165739T>A	uc002yko.3	-	5	978	c.887A>T	c.(886-888)AAC>ATC	p.N296I	C21orf91_uc002ykm.2_5'Flank|C21orf91_uc002ykn.2_5'Flank|C21orf91_uc002ykq.3_Missense_Mutation_p.N295I|C21orf91_uc002ykp.3_3'UTR	NM_001100420	NP_001093890	Q9NYK6	EURL_HUMAN	early undifferentiated retina and lens isoform	296										ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		AGGTCAGTTGTTTATGGGTAG	0.453													13	28	---	---	---	---	PASS
RNF160	26046	broad.mit.edu	37	21	30357092	30357092	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30357092G>T	uc002ymr.2	-	4	648	c.635C>A	c.(634-636)GCA>GAA	p.A212E	RNF160_uc010gll.1_RNA	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	166							ligase activity|zinc ion binding				0						TGCATCTTTTGCTGCAAACGC	0.398													5	140	---	---	---	---	PASS
KRTAP21-2	337978	broad.mit.edu	37	21	32119451	32119451	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32119451C>A	uc011adh.1	-	1	70	c.70G>T	c.(70-72)GGA>TGA	p.G24*		NM_181617	NP_853648	Q3LI59	KR212_HUMAN	keratin associated protein 21-2	24						intermediate filament					0						caaccatatccacagccggaa	0.129													41	61	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26736444	26736444	+	Silent	SNP	C	T	T	rs141142000		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26736444C>T	uc003acb.2	+	10	2214	c.2058C>T	c.(2056-2058)GGC>GGT	p.G686G	SEZ6L_uc003acc.2_Silent_p.G686G|SEZ6L_uc011akc.1_Silent_p.G686G|SEZ6L_uc003acd.2_Silent_p.G686G|SEZ6L_uc011akd.1_Silent_p.G686G|SEZ6L_uc003ace.2_Silent_p.G686G|SEZ6L_uc003acf.1_Silent_p.G459G|SEZ6L_uc010gvc.1_Silent_p.G459G	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	686	CUB 3.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						TCTACGATGGCGACGAGGTCA	0.517													80	335	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37470639	37470639	+	Intron	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37470639G>C	uc003aqs.1	-						TMPRSS6_uc003aqt.1_Intron	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6						angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						ATGCGCGGGCGGGTTACTCAC	0.572													17	31	---	---	---	---	PASS
CACNA1I	8911	broad.mit.edu	37	22	40078600	40078600	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40078600C>G	uc003ayc.2	+	35	5764	c.5764C>G	c.(5764-5766)CTG>GTG	p.L1922V	CACNA1I_uc003ayd.2_Missense_Mutation_p.L1887V|CACNA1I_uc003aye.2_Missense_Mutation_p.L1837V|CACNA1I_uc003ayf.2_Missense_Mutation_p.L1802V	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	1922	Cytoplasmic (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	AGAGAACTTCCTGTGTGAGAT	0.617													38	61	---	---	---	---	PASS
CRLF2	64109	broad.mit.edu	37	X	1317468	1317468	+	Intron	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1317468G>C	uc004cpm.1	-									Q9HC73	CRLF2_HUMAN	Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGTCGCTTGGGTATGTGTCTG	0.532			Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								46	125	---	---	---	---	PASS
MAGEB2	4113	broad.mit.edu	37	X	30237233	30237233	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30237233C>A	uc004dbz.2	+	2	639	c.536C>A	c.(535-537)ACC>AAC	p.T179N		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	179	MAGE.						protein binding			ovary(1)	1						CACACTTACACCTTCATCGAC	0.522													18	23	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32481678	32481678	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32481678T>A	uc004dda.1	-	25	3554	c.3310A>T	c.(3310-3312)AGT>TGT	p.S1104C	DMD_uc004dcz.2_Missense_Mutation_p.S981C|DMD_uc004dcy.1_Missense_Mutation_p.S1100C|DMD_uc004ddb.1_Missense_Mutation_p.S1096C|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1104	Spectrin 7.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	p.L1104I(1)		ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTGTTTAGACTGGGCTGAATT	0.363													3	10	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148939	34148939	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148939C>A	uc004ddg.2	-	1	1490	c.1457G>T	c.(1456-1458)CGT>CTT	p.R486L		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	486										ovary(4)|central_nervous_system(1)	5						GGACCTCCGACGTGTCTTGGG	0.637													24	51	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50051889	50051889	+	Silent	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50051889G>C	uc004dox.3	+	6	1018	c.720G>C	c.(718-720)CGG>CGC	p.R240R	CCNB3_uc004doy.2_Silent_p.R240R|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	240					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					CAAGTCAGCGGAAGCAGTCCT	0.418													29	40	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53246997	53246997	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53246997T>A	uc004drz.2	-	4	1036	c.503A>T	c.(502-504)CAG>CTG	p.Q168L	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Missense_Mutation_p.Q101L|KDM5C_uc004dsa.2_Missense_Mutation_p.Q168L	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	168	ARID.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						GGCTCCAGACTGGTACATTTC	0.502			N|F|S		clear cell renal carcinoma								24	30	---	---	---	---	PASS
ACRC	93953	broad.mit.edu	37	X	70832780	70832780	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70832780T>G	uc004eae.2	+	13	2525	c.2024T>G	c.(2023-2025)GTC>GGC	p.V675G	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	675						nucleus				ovary(3)	3	Renal(35;0.156)					GGGTCTCTGGTCATGGTGCCA	0.473													26	30	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73066617	73066617	+	RNA	SNP	C	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73066617C>A	uc004ebm.1	-	1		c.5972G>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						ACCATGCTGTCCTTCAAAAGG	0.438													46	44	---	---	---	---	PASS
FAM133A	286499	broad.mit.edu	37	X	92964597	92964597	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92964597A>T	uc004efr.1	+	4	492	c.179A>T	c.(178-180)GAA>GTA	p.E60V		NM_173698	NP_775969	Q8N9E0	F133A_HUMAN	hypothetical protein LOC286499	60	Lys-rich.										0						GCATTAGCTGAATTTGAAGAA	0.303													25	26	---	---	---	---	PASS
SERPINA7	6906	broad.mit.edu	37	X	105280897	105280897	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105280897G>C	uc004eme.1	-	1	169	c.153C>G	c.(151-153)TTC>TTG	p.F51L	SERPINA7_uc010npd.2_Missense_Mutation_p.F51L|SERPINA7_uc010npe.1_Missense_Mutation_p.F51L	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	51					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	GGTACAGATTGAATGCAAAGT	0.468													81	118	---	---	---	---	PASS
ALG13	79868	broad.mit.edu	37	X	110979954	110979954	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110979954A>G	uc011msy.1	+	23	2576	c.2542A>G	c.(2542-2544)ATT>GTT	p.I848V	ALG13_uc011msx.1_Missense_Mutation_p.I744V|ALG13_uc011msz.1_Missense_Mutation_p.I770V|ALG13_uc011mta.1_Missense_Mutation_p.I744V|ALG13_uc011mtb.1_Missense_Mutation_p.I744V			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);	848					dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						GATGGGAAATATTGCAGCAGT	0.383													76	102	---	---	---	---	PASS
GPC4	2239	broad.mit.edu	37	X	132445456	132445456	+	Intron	SNP	T	C	C			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132445456T>C	uc004exc.1	-						GPC4_uc011mvg.1_Intron	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor						anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)					GTTTACCTAATGTGTGAAAAG	0.463													54	70	---	---	---	---	PASS
SPATA21	374955	broad.mit.edu	37	1	16729987	16729987	+	Intron	DEL	C	-	-	rs57948110		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16729987delC	uc001ayn.2	-						SPATA21_uc001ayl.1_Intron|SPATA21_uc010occ.1_Intron	NM_198546	NP_940948	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding			ovary(2)|breast(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		tcttttttttctttttttttt	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38733363	38733364	+	IGR	INS	-	CCTTCCTCCTT	CCTTCCTCCTT	rs142813208	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38733363_38733364insCCTTCCTCCTT								POU3F1 (220913 upstream) : RRAGC (571651 downstream)																							tttcctccctcctctctcttcc	0.000													3	3	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766820	206766823	+	Intron	DEL	GAGC	-	-	rs141098886		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766820_206766823delGAGC	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagagagagcgcgagagaga	0.211													9	5	---	---	---	---	
HEATR1	55127	broad.mit.edu	37	1	236732198	236732199	+	Intron	INS	-	A	A	rs117530059		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236732198_236732199insA	uc001hyd.1	-						HEATR1_uc009xgh.1_Intron	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			aaaaaaaaaacaaaaaaaaaaa	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132768083	132768084	+	IGR	INS	-	G	G	rs111469343	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132768083_132768084insG								C2orf27B (208849 upstream) : NCRNA00164 (137080 downstream)																							TCTTGATGTTAACTATcagctg	0.218													4	5	---	---	---	---	
TANC1	85461	broad.mit.edu	37	2	159992513	159992514	+	Intron	INS	-	TGTG	TGTG	rs13011527		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992513_159992514insTGTG	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uah.1_5'Flank	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						TACTGAAATTTtgtgtgtgtgt	0.371													6	3	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169712115	169712116	+	Intron	INS	-	A	A	rs74552507		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169712115_169712116insA	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron|NOSTRIN_uc002uek.2_5'Flank	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						GTTGTGTGAACaaaaaaaaaaa	0.248													2	6	---	---	---	---	
GLS	2744	broad.mit.edu	37	2	191759678	191759678	+	Intron	DEL	T	-	-	rs3217036		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191759678delT	uc002usf.2	+						GLS_uc002usd.2_Intron|GLS_uc002use.2_Intron	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GTGTTAATGATTTTTTTTCTA	0.353													6	4	---	---	---	---	
SATB2	23314	broad.mit.edu	37	2	200173311	200173312	+	Intron	DEL	AT	-	-	rs3748904	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200173311_200173312delAT	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						acacacacacatacacatacac	0.356													4	2	---	---	---	---	
USP13	8975	broad.mit.edu	37	3	179400035	179400036	+	Intron	INS	-	AAA	AAA	rs138981545	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179400035_179400036insAAA	uc003fkh.2	+						USP13_uc003fkf.2_Intron	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TGACTAATTGGAAAAAAAAAAC	0.317													5	3	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195711343	195711344	+	Intron	INS	-	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195711343_195711344insT	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AAAGACTTCTCTGTGAGCTTTG	0.381													12	9	---	---	---	---	
PCGF3	10336	broad.mit.edu	37	4	758636	758637	+	Intron	INS	-	C	C	rs139234446	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:758636_758637insC	uc011bva.1	+						PCGF3_uc003gbd.1_Intron|PCGF3_uc003gbe.2_Intron|PCGF3_uc010ibh.2_Intron|PCGF3_uc003gbg.1_Intron|PCGF3_uc003gbh.2_Intron	NM_006315	NP_006306	Q3KNV8	PCGF3_HUMAN	ring finger protein 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	PcG protein complex	zinc ion binding				0						ACATGAACCAGCCCCCCCCACC	0.525													5	3	---	---	---	---	
RFC1	5981	broad.mit.edu	37	4	39304919	39304919	+	Intron	DEL	A	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39304919delA	uc003gty.1	-						RFC1_uc003gtx.1_Intron	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit						DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						GTTGTTAAAGAAAAAAAAAAA	0.393													5	3	---	---	---	---	
ADCY2	108	broad.mit.edu	37	5	7804743	7804744	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7804743_7804744insT	uc003jdz.1	+	22	2888_2889	c.2821_2822insT	c.(2821-2823)ATTfs	p.I941fs	ADCY2_uc011cmo.1_Frame_Shift_Ins_p.I761fs|ADCY2_uc010itm.1_Frame_Shift_Ins_p.I137fs	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	941	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						GATTAAGACCATTGGCAGCACA	0.525													85	46	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80404654	80404657	+	Intron	DEL	TGTG	-	-	rs143382125		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80404654_80404657delTGTG	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TTACCTACTCtgtgtgtgtgtgtg	0.275													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29770234	29770235	+	IGR	INS	-	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29770234_29770235insA								HCG4 (9384 upstream) : HLA-G (24521 downstream)																							AAAGAGGAGTTGGGCAGAGGGG	0.470													4	3	---	---	---	---	
BAT1	7919	broad.mit.edu	37	6	31500745	31500746	+	Intron	INS	-	G	G			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31500745_31500746insG	uc003ntt.2	-						BAT1_uc003ntq.2_5'Flank|BAT1_uc003ntr.2_Frame_Shift_Ins_p.P33fs|BAT1_uc003nts.2_Intron|BAT1_uc011dnn.1_Intron|BAT1_uc003ntu.2_Intron|BAT1_uc003ntv.2_Intron	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1						intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						ggggTTAAACCTGGGGGGGTGG	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	88994114	88994114	+	IGR	DEL	C	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88994114delC								CNR1 (118347 upstream) : RNGTT (325875 downstream)																							cttaacatatccatcacctca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	109610747	109610748	+	IGR	INS	-	A	A	rs57726962		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109610747_109610748insA								C6orf182 (125634 upstream) : CD164 (76970 downstream)																							agactcgccttaaaaaaaaaaa	0.178													9	4	---	---	---	---	
PHF14	9678	broad.mit.edu	37	7	11101395	11101395	+	Intron	DEL	T	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11101395delT	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		ttgttttttgttttttttttt	0.279													4	2	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144380279	144380279	+	Intron	DEL	T	-	-	rs137896700		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144380279delT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	tttctgcatcttttttttttt	0.129													7	4	---	---	---	---	
PBK	55872	broad.mit.edu	37	8	27690781	27690798	+	Intron	DEL	GGTGGATCACCTGAGGTC	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27690781_27690798delGGTGGATCACCTGAGGTC	uc003xgi.2	-						PBK_uc011lap.1_Intron	NM_018492	NP_060962	Q96KB5	TOPK_HUMAN	PDZ binding kinase						mitosis		ATP binding|protein binding|protein serine/threonine kinase activity				0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|KIRC - Kidney renal clear cell carcinoma(542;0.101)|Kidney(114;0.121)|Colorectal(74;0.141)		ggctgaggtgggtggatcacctgaggtcggtggatcac	0.064													9	5	---	---	---	---	
GOLGA7	51125	broad.mit.edu	37	8	41363690	41363691	+	Intron	INS	-	T	T	rs149330272	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41363690_41363691insT	uc003xnu.2	+						GOLGA7_uc003xnv.2_Intron|GOLGA7_uc003xnw.2_Intron	NM_016099	NP_057183	Q7Z5G4	GOGA7_HUMAN	golgi autoantigen, golgin subfamily a, 7							Golgi membrane				breast(1)	1	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			TGTCTCCAACATTTTTTTTTAA	0.431													2	4	---	---	---	---	
TAF2	6873	broad.mit.edu	37	8	120815932	120815932	+	Intron	DEL	A	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120815932delA	uc003you.2	-							NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2						G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			agactgtctgaaaaaaaaaaa	0.100													5	4	---	---	---	---	
SPTAN1	6709	broad.mit.edu	37	9	131360553	131360554	+	Intron	INS	-	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131360553_131360554insT	uc004bvl.3	+						SPTAN1_uc011mbg.1_Intron|SPTAN1_uc011mbh.1_Intron|SPTAN1_uc004bvm.3_Intron|SPTAN1_uc004bvn.3_Intron	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1						actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						TAATCCCCCCCTTTTTTTTTTT	0.243													4	2	---	---	---	---	
DDX21	9188	broad.mit.edu	37	10	70730242	70730242	+	Intron	DEL	T	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70730242delT	uc001jov.1	+						DDX21_uc001jow.1_Intron	NM_004728	NP_004719	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21							nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)	3						AGGAAGCTACttttttttttt	0.179													3	3	---	---	---	---	
HPSE2	60495	broad.mit.edu	37	10	100995724	100995727	+	5'Flank	DEL	CTCG	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100995724_100995727delCTCG	uc001kpn.1	-						HPSE2_uc009xwc.1_5'Flank|HPSE2_uc001kpo.1_5'Flank|HPSE2_uc009xwd.1_5'Flank	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ctctctctctctcgctcgctcgct	0.304													3	3	---	---	---	---	
PAX6	5080	broad.mit.edu	37	11	31815969	31815992	+	Intron	DEL	CACACACACACACACACACACACA	-	-	rs35883677		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31815969_31815992delCACACACACACACACACACACACA	uc001mtd.3	-						PAX6_uc001mte.3_Intron|PAX6_uc001mtg.3_Intron|PAX6_uc001mtf.3_Intron|PAX6_uc001mth.3_Intron|PAX6_uc009yjr.2_Intron	NM_001127612	NP_001121084	P26367	PAX6_HUMAN	paired box gene 6 isoform a						blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity			lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9	Lung SC(675;0.225)					acacacacaccacacacacacacacacacacacacacacacaca	0.214									Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				4	2	---	---	---	---	
RTN3	10313	broad.mit.edu	37	11	63517791	63517791	+	Intron	DEL	G	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63517791delG	uc001nxq.2	+						RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Intron|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Intron|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b						apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						GCAGCTGATTGGTGGCATGAA	0.408													7	5	---	---	---	---	
C11orf85	283129	broad.mit.edu	37	11	64708307	64708308	+	Intron	INS	-	TTT	TTT	rs56019033		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64708307_64708308insTTT	uc001ocb.1	-						C11orf85_uc001occ.1_Intron|C11orf85_uc001ocd.1_Intron	NM_001037225	NP_001032302	Q3KP22	CK085_HUMAN	hypothetical protein LOC283129												0						ttttttctttcttttttttttt	0.173													5	3	---	---	---	---	
BUD13	84811	broad.mit.edu	37	11	116628178	116628178	+	Intron	DEL	T	-	-	rs72287764		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116628178delT	uc001ppn.2	-						BUD13_uc001ppo.2_Intron	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1											large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		tgaccggctattttttttttt	0.000													4	2	---	---	---	---	
FOXRED1	55572	broad.mit.edu	37	11	126141134	126141135	+	Intron	INS	-	AAGG	AAGG	rs141438450	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126141134_126141135insAAGG	uc001qdi.2	+						SRPR_uc001qdh.2_5'Flank|SRPR_uc010sbm.1_5'Flank|FOXRED1_uc010sbn.1_Intron|FOXRED1_uc010sbo.1_Intron|FOXRED1_uc010sbp.1_Intron|FOXRED1_uc010sbq.1_Intron|FOXRED1_uc001qdj.2_Intron|FOXRED1_uc010sbr.1_Intron|FOXRED1_uc001qdk.2_5'UTR	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing							integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		CAATGCATGAAGAGACTGATGG	0.342													4	2	---	---	---	---	
DPY19L2	283417	broad.mit.edu	37	12	63991415	63991416	+	Intron	INS	-	T	T	rs138201669	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63991415_63991416insT	uc001srp.1	-						DPY19L2_uc009zqk.1_Intron	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		tagaggctatctttttttttta	0.050													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110072831	110072833	+	IGR	DEL	CAC	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072831_110072833delCAC								MVK (37761 upstream) : C12orf34 (79357 downstream)																							ccaccaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114365048	114365053	+	Intron	DEL	AAAACA	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114365048_114365053delAAAACA	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					AACCCCCATCaaaacaaaaacaaaaa	0.403													3	4	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119957645	119957646	+	Intron	DEL	GA	-	-	rs61938141		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119957645_119957646delGA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GGAATTTTAGGAGAGAGAGAGA	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131962149	131962150	+	IGR	INS	-	ATA	ATA	rs149149753	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131962149_131962150insATA								LOC116437 (264674 upstream) : SFRS8 (233485 downstream)																							tggtaatggtggtgatgatggt	0.045													3	3	---	---	---	---	
PAN3	255967	broad.mit.edu	37	13	28834855	28834855	+	Intron	DEL	T	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28834855delT	uc001urz.2	+						PAN3_uc010tdo.1_Intron|PAN3_uc001ury.2_Intron|PAN3_uc001urx.2_Intron	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GAAACCTGTCTTTTAAAAAAA	0.249													4	2	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	49034086	49034087	+	Intron	DEL	TT	-	-	rs66874620		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49034086_49034087delTT	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	tctttctttctttttctttctt	0.079		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			4	2	---	---	---	---	
COX16	51241	broad.mit.edu	37	14	70793016	70793016	+	3'UTR	DEL	A	-	-	rs71744102		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70793016delA	uc001xmb.2	-	4						NM_016468	NP_057552	Q9P0S2	COX16_HUMAN	COX16 cytochrome c oxidase assembly homolog							integral to membrane|mitochondrial membrane					0						atttttatttaaaaaaaaaaa	0.353													5	4	---	---	---	---	
PAPOLA	10914	broad.mit.edu	37	14	96987154	96987155	+	Intron	INS	-	TA	TA			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96987154_96987155insTA	uc001yfq.2	+						PAPOLA_uc001yfo.2_Intron|PAPOLA_uc001yfp.2_Intron|PAPOLA_uc001yfr.2_Intron|PAPOLA_uc010twv.1_Intron|PAPOLA_uc010avp.2_Intron	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha						mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		AACAGTGCCTGTATATATATAT	0.238													2	4	---	---	---	---	
MYO5A	4644	broad.mit.edu	37	15	52635118	52635119	+	Intron	INS	-	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52635118_52635119insA	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010ugd.1_Intron|MYO5A_uc002abz.1_5'Flank|MYO5A_uc002aca.1_Intron|MYO5A_uc002acb.1_Intron|MYO5A_uc002acc.1_Intron	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		gtctaaaaaagaaaaaaaaaaa	0.144													4	2	---	---	---	---	
USP7	7874	broad.mit.edu	37	16	8994680	8994680	+	Intron	DEL	A	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8994680delA	uc002czl.2	-						USP7_uc010uyk.1_Intron|USP7_uc002czj.2_Intron|USP7_uc010uyj.1_Intron|USP7_uc002czk.2_Intron	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7						interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TACAACAGGTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46404945	46404970	+	IGR	DEL	TTCGACGATGATTCCATTCGATTCCG	-	-	rs61126254		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46404945_46404970delTTCGACGATGATTCCATTCGATTCCG								None (None upstream) : ANKRD26P1 (98279 downstream)																							ttcaattccattcgacgatgattccattcgattccgtttgatgatt	0.000													4	2	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	69293	69294	+	Intron	INS	-	TTTCT	TTTCT	rs146351269	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69293_69294insTTTCT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		cggccTAATAGTTTCATTTCTT	0.099													4	2	---	---	---	---	
PFAS	5198	broad.mit.edu	37	17	8171691	8171691	+	Intron	DEL	A	-	-	rs76845148		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8171691delA	uc002gkr.2	+						PFAS_uc010vuv.1_Intron|PFAS_uc002gks.2_Intron	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase						'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	attccatctcaaaaaaaaaaa	0.065													4	2	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20254235	20254235	+	Intron	DEL	T	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20254235delT	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AGAGGAATTGTTTTTTTTTTT	0.249													4	2	---	---	---	---	
C17orf56	146705	broad.mit.edu	37	17	79204128	79204134	+	Intron	DEL	TGAGTGC	-	-	rs150422103		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79204128_79204134delTGAGTGC	uc002jzu.1	-						C17orf56_uc002jzr.1_Intron|C17orf56_uc002jzs.1_Intron|C17orf56_uc002jzt.1_Intron|C17orf56_uc002jzv.1_Intron|uc002jzw.1_RNA	NM_144679	NP_653280	Q96N21	CQ056_HUMAN	hypothetical protein LOC146705							integral to membrane					0	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			cagtgtaCTGTGAGTGCTGCAGAGTTT	0.338											OREG0024811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21452335	21452335	+	IGR	DEL	A	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21452335delA								ZNF431 (83530 upstream) : ZNF708 (21628 downstream)																							AGCTGCCCAGAGAGGGCACCA	0.612													3	3	---	---	---	---	
ZNF98	148198	broad.mit.edu	37	19	22583776	22583777	+	Intron	INS	-	A	A			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22583776_22583777insA	uc002nqt.2	-							NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				caaaacaaaacaaaaaaaaaac	0.000													4	2	---	---	---	---	
C19orf2	8725	broad.mit.edu	37	19	30447192	30447193	+	Intron	INS	-	T	T			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30447192_30447193insT	uc002nsr.2	+						C19orf2_uc002nsq.2_Intron|C19orf2_uc002nss.2_Intron	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a						protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)		ccagagtagtctttttTTTTTT	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	28516210	28516211	+	IGR	DEL	GC	-	-	rs148404345		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28516210_28516211delGC								ADAMTS5 (176771 upstream) : NCRNA00113 (578487 downstream)																							CGGCCAGCGGGCGCGCGCGGAA	0.693													4	2	---	---	---	---	
SFRS15	57466	broad.mit.edu	37	21	33057323	33057323	+	Intron	DEL	T	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33057323delT	uc002ypd.2	-						SFRS15_uc002ype.2_Intron|SFRS15_uc010glu.2_Intron|SFRS15_uc002ypf.1_Frame_Shift_Del_p.T517fs	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform							nucleus	nucleotide binding|RNA binding				0						ggggggggggtggggCAAGGA	0.299													4	2	---	---	---	---	
ETS2	2114	broad.mit.edu	37	21	40182119	40182125	+	Intron	DEL	GGTTGTA	-	-	rs115486003	by1000genomes	TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40182119_40182125delGGTTGTA	uc002yxg.2	+						ETS2_uc002yxf.2_Intron	NM_005239	NP_005230	P15036	ETS2_HUMAN	v-ets erythroblastosis virus E26 oncogene						positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)|pancreas(1)	4		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				ccagaaaactggttgtagccctagctt	0.135													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																							accaccaccatcaccaccacca	0.025													4	4	---	---	---	---	
C22orf31	25770	broad.mit.edu	37	22	29456182	29456183	+	Intron	INS	-	T	T	rs71910260		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29456182_29456183insT	uc003aej.1	-							NM_015370	NP_056185	O95567	CV031_HUMAN	hypothetical protein LOC25770												0						tcatgcctggcttttttttttt	0.000													4	2	---	---	---	---	
RRP7B	91695	broad.mit.edu	37	22	42971734	42971735	+	Intron	INS	-	G	G	rs142480316		TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42971734_42971735insG	uc003bcs.2	-						RRP7B_uc003bct.2_Intron					Homo sapiens cDNA FLJ90011 fis, clone HEMBA1000443, highly similar to Gastric cancer antigen Zg14.												0						CATCTGCCCCTGGGGGGTGATG	0.644													4	2	---	---	---	---	
ASMTL	8623	broad.mit.edu	37	X	1547216	1547216	+	Intron	DEL	A	-	-			TCGA-66-2755-01A-01D-1522-08	TCGA-66-2755-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1547216delA	uc004cpx.1	-						ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Intron|ASMTL_uc011mhf.1_Intron	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like						melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTGGCATCTCaaaaaaaaaaa	0.050													2	4	---	---	---	---	
