Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF2	65122	broad.mit.edu	37	1	12919064	12919064	+	Missense_Mutation	SNP	T	G	G	rs3204790	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12919064T>G	uc001aum.1	+	2	287	c.200T>G	c.(199-201)GTA>GGA	p.V67G		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	67											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCCTCTGGTATCGCTGATG	0.557													3	41	---	---	---	---	PASS
PRAMEF4	400735	broad.mit.edu	37	1	12939664	12939664	+	Missense_Mutation	SNP	A	T	T	rs78455617	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12939664A>T	uc001aun.2	-	4	1209	c.1138T>A	c.(1138-1140)TTT>ATT	p.F380I		NM_001009611	NP_001009611	O60810	PRAM4_HUMAN	PRAME family member 4	380										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTGAGCTCAAAGCAGCGGCTC	0.507													5	93	---	---	---	---	PASS
PRAMEF4	400735	broad.mit.edu	37	1	12939674	12939674	+	Silent	SNP	C	G	G	rs72474510	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12939674C>G	uc001aun.2	-	4	1199	c.1128G>C	c.(1126-1128)CTG>CTC	p.L376L		NM_001009611	NP_001009611	O60810	PRAM4_HUMAN	PRAME family member 4	376										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGCAGCGGCTCAGGGCAGGCA	0.498													5	107	---	---	---	---	PASS
PHTF1	10745	broad.mit.edu	37	1	114301335	114301335	+	5'UTR	SNP	C	T	T	rs61817589	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114301335C>T	uc009wgp.1	-	1					PHTF1_uc001edn.2_5'UTR|PHTF1_uc010own.1_5'UTR|PHTF1_uc001edp.2_5'UTR	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTGTGTCTCCAGCCAGAGAA	0.418													3	47	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612163	120612163	+	5'UTR	SNP	C	A	A	rs55899574	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612163C>A	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTCCGAAGCCCAGGCGCAAA	0.687			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	5	---	---	---	---	PASS
LCE5A	254910	broad.mit.edu	37	1	152484310	152484310	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152484310C>G	uc001ezy.2	+	2	476	c.300C>G	c.(298-300)AGC>AGG	p.S100R	CRCT1_uc001ezz.2_5'Flank	NM_178438	NP_848525	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	100	Cys-rich.				keratinization					ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGGGCTCCAGCTGCTGCCACA	0.682													4	9	---	---	---	---	PASS
TOR3A	64222	broad.mit.edu	37	1	179064559	179064559	+	3'UTR	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179064559C>T	uc001gmd.2	+	6					TOR3A_uc010pnd.1_3'UTR	NM_022371	NP_071766	Q9H497	TOR3A_HUMAN	torsin family 3, member A precursor						chaperone mediated protein folding requiring cofactor	endoplasmic reticulum	ATP binding			pancreas(1)	1						gaggtcccaccgagatagata	0.333													5	4	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196971637	196971637	+	Silent	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196971637G>A	uc001gts.3	+	8	1301	c.1173G>A	c.(1171-1173)CCG>CCA	p.P391P		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	391	Sushi 7.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						TCTGCCCACCGCCACCTCAGA	0.348													7	79	---	---	---	---	PASS
GALNT2	2590	broad.mit.edu	37	1	230338965	230338965	+	Silent	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230338965C>T	uc010pwa.1	+	3	375	c.303C>T	c.(301-303)CGC>CGT	p.R101R	GALNT2_uc010pvy.1_Silent_p.R63R|GALNT2_uc010pvz.1_RNA	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	101	Lumenal (Potential).				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				CTTACGCCCGCAACAAGTTCA	0.552													6	224	---	---	---	---	PASS
CLIP4	79745	broad.mit.edu	37	2	29354154	29354154	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29354154C>T	uc002rmv.2	+	3	403	c.164C>T	c.(163-165)TCA>TTA	p.S55L	CLIP4_uc002rmu.2_Missense_Mutation_p.S55L|CLIP4_uc010ezm.1_Missense_Mutation_p.S55L|CLIP4_uc002rmw.2_RNA|CLIP4_uc010ymn.1_Missense_Mutation_p.S37L	NM_024692	NP_078968	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family,	55										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					AATGATGCATCATGCCAGGAA	0.249													42	99	---	---	---	---	PASS
CEBPZ	10153	broad.mit.edu	37	2	37441066	37441066	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37441066C>T	uc002rpz.2	-	10	2516	c.2486G>A	c.(2485-2487)CGG>CAG	p.R829Q		NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta	829					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)				ATCTGCATCCCGTTTTTGTTT	0.269													9	42	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137814268	137814268	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137814268C>A	uc002tva.1	+	2	325	c.325C>A	c.(325-327)CAC>AAC	p.H109N	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGGACTGCAGCACCGGATGGT	0.547													11	123	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141460073	141460073	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141460073G>T	uc002tvj.1	-	38	7045	c.6073C>A	c.(6073-6075)CGC>AGC	p.R2025S		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2025	Extracellular (Potential).|LDL-receptor class B 21.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCATCCAAGCGAGCCTTTCCA	0.408										TSP Lung(27;0.18)			51	86	---	---	---	---	PASS
RAPH1	65059	broad.mit.edu	37	2	204304794	204304794	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204304794A>G	uc002vad.2	-	14	3344	c.3119T>C	c.(3118-3120)GTT>GCT	p.V1040A		NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains	1040					cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						TTGTTGGAGAACTCCAGGAAG	0.537													53	100	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228155518	228155518	+	Silent	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228155518C>A	uc002vom.1	+	37	3288	c.3126C>A	c.(3124-3126)GGC>GGA	p.G1042G	COL4A3_uc002von.1_Silent_p.G1042G|COL4A3_uc002voo.1_Silent_p.G1042G|COL4A3_uc002vop.1_Silent_p.G1042G|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	1042	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GAAGACCAGGCCTCCCAGGTA	0.488													3	61	---	---	---	---	PASS
PID1	55022	broad.mit.edu	37	2	229890759	229890759	+	Silent	SNP	T	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229890759T>A	uc002vpr.3	-	3	380	c.342A>T	c.(340-342)CCA>CCT	p.P114P	PID1_uc002vps.3_Silent_p.P112P|PID1_uc002vpt.3_Silent_p.P81P|PID1_uc002vpu.3_Silent_p.P32P	NM_001100818	NP_001094288	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	114	PID.					cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		GCTCAATGACTGGCTTTTCTG	0.532													10	88	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38640517	38640517	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38640517C>A	uc003cio.2	-	13	2109	c.1915G>T	c.(1915-1917)GGG>TGG	p.G639W	SCN5A_uc003cin.2_Missense_Mutation_p.G639W|SCN5A_uc003cil.3_Missense_Mutation_p.G639W|SCN5A_uc010hhi.2_Missense_Mutation_p.G639W|SCN5A_uc010hhk.2_Missense_Mutation_p.G639W|SCN5A_uc011ayr.1_Missense_Mutation_p.G639W|SCN5A_uc010hhj.1_Missense_Mutation_p.G250W	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	639			G -> R (in LQT3).		blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	ATCTGGGGCCCGCCTGGCTCC	0.667													3	60	---	---	---	---	PASS
KLHL18	23276	broad.mit.edu	37	3	47376266	47376266	+	Silent	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47376266C>A	uc003crd.2	+	6	981	c.855C>A	c.(853-855)TCC>TCA	p.S285S	KLHL18_uc003crc.2_Silent_p.S285S|KLHL18_uc011bav.1_Silent_p.S173S|KLHL18_uc010hjq.1_Silent_p.S136S	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	285											0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GCTGCACATCCATCGCTGGAC	0.582													3	54	---	---	---	---	PASS
IL17RB	55540	broad.mit.edu	37	3	53886921	53886921	+	Silent	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53886921C>T	uc003dha.2	+	5	417	c.378C>T	c.(376-378)TTC>TTT	p.F126F		NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor	126	Extracellular (Potential).				defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		ACATCGGCTTCCCTGTAGAGC	0.428													10	159	---	---	---	---	PASS
FILIP1L	11259	broad.mit.edu	37	3	99568295	99568295	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99568295T>G	uc003dtm.2	-	5	2688	c.2225A>C	c.(2224-2226)GAT>GCT	p.D742A	C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Missense_Mutation_p.D742A|FILIP1L_uc010hpf.2_Missense_Mutation_p.D318A|FILIP1L_uc010hpg.2_Missense_Mutation_p.D502A|FILIP1L_uc003dtn.2_Missense_Mutation_p.D502A|FILIP1L_uc003dtp.1_Missense_Mutation_p.D502A	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1	742	Potential.					cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						GACTGAGTGATCTCCCTGGAG	0.408													10	393	---	---	---	---	PASS
KCNMB3	27094	broad.mit.edu	37	3	178984502	178984502	+	5'UTR	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178984502G>T	uc003fjp.1	-	1					KCNMB3_uc011bqc.1_5'UTR	NM_171828	NP_741979	Q9NPA1	KCMB3_HUMAN	calcium-activated potassium channel beta 3						detection of calcium ion|platelet activation|regulation of action potential in neuron	voltage-gated potassium channel complex	calcium-activated potassium channel activity|potassium channel regulator activity				0	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)			GCTGCATGAGGCCAGGGGTCT	0.607													7	59	---	---	---	---	PASS
BCL6	604	broad.mit.edu	37	3	187447645	187447645	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187447645C>T	uc003frp.3	-	5	1005	c.548G>A	c.(547-549)AGC>AAC	p.S183N	BCL6_uc011bsf.1_Missense_Mutation_p.S183N|BCL6_uc010hza.2_Missense_Mutation_p.S81N|BCL6_uc003frq.1_Missense_Mutation_p.S183N	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	183					negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		ACTGTACAGGCTGGGGGCAAA	0.602			T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								30	38	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	42895345	42895345	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42895345C>T	uc003gwt.2	+	1	62	c.62C>T	c.(61-63)GCG>GTG	p.A21V		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	21					cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						TTTCGGATCGCGTCCTCTCAC	0.507													45	103	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76813087	76813087	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76813087C>T	uc003hix.2	-	3	457	c.100G>A	c.(100-102)GTG>ATG	p.V34M	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.V34M	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	34	IQ.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AGGCGGGCCACGTAGCGCCGG	0.582													22	79	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79343065	79343065	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79343065C>T	uc003hlb.2	+	34	5029	c.4589C>T	c.(4588-4590)ACG>ATG	p.T1530M	FRAS1_uc003hkw.2_Missense_Mutation_p.T1530M|FRAS1_uc010ijj.1_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1529	CSPG 4.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CGGTATTTCACGCAAGAGGAT	0.547													93	226	---	---	---	---	PASS
TUBB2A	7280	broad.mit.edu	37	6	3156427	3156427	+	Intron	SNP	A	C	C	rs2808003	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3156427A>C	uc003mvc.2	-						TUBB2A_uc003mvb.2_Translation_Start_Site|TUBB2A_uc003mvd.2_Intron	NM_001069	NP_001060	Q13885	TBB2A_HUMAN	tubulin, beta 2						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			skin(1)	1	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CTGCATCCTGAATGTCACTAA	0.502													6	44	---	---	---	---	PASS
GTPBP2	54676	broad.mit.edu	37	6	43589227	43589227	+	3'UTR	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43589227G>A	uc003ovs.2	-	12					GTPBP2_uc010jyv.2_3'UTR|GTPBP2_uc003ovt.1_Intron	NM_019096	NP_061969	Q9BX10	GTPB2_HUMAN	GTP binding protein 2								GTP binding|GTPase activity			liver(1)|skin(1)	2	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			GGGAGCAAGTGGCAGACAGCA	0.552													3	12	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152690064	152690064	+	Intron	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152690064G>A	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kja.1_5'UTR|SYNE1_uc003qov.2_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCAATTTTGCGACATCAGTAT	0.532										HNSCC(10;0.0054)			54	116	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161139389	161139389	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161139389G>A	uc003qtm.3	+	8	914	c.851G>A	c.(850-852)CGC>CAC	p.R284H		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	284	Kringle 3.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GAAAACTATCGCGGGAATGTG	0.493													40	170	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21939032	21939032	+	Silent	SNP	C	A	A	rs56333627	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21939032C>A	uc003svc.2	+	81	13180	c.13149C>A	c.(13147-13149)CTC>CTA	p.L4383L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4383					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TCGTGTGGCTCTCCGGCTTCT	0.557									Kartagener_syndrome				6	272	---	---	---	---	PASS
CLK2P	1197	broad.mit.edu	37	7	23624896	23624896	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23624896G>A	uc003swk.2	-	1	1251	c.601C>T	c.(601-603)CGC>TGC	p.R201C		NR_002711				SubName: Full=cDNA FLJ61616, highly similar to Dual specificity protein kinase CLK2 (EC 2.7.12.1); SubName: Full=CDC-like kinase 2, isoform CRA_c; SubName: Full=Putative uncharacterized protein CLK2;												0						CGAACATAGCGTCCAGCTGAT	0.498													58	125	---	---	---	---	PASS
LOC646762	646762	broad.mit.edu	37	7	29727194	29727194	+	5'Flank	SNP	A	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29727194A>G	uc003tad.3	-						uc003tag.2_RNA|uc003tah.1_Intron	NR_024278				Homo sapiens cDNA: FLJ23070 fis, clone LNG05629.												0						CTGTGTACTTACAAATTTGAG	0.179													4	8	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41739653	41739653	+	Missense_Mutation	SNP	A	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41739653A>T	uc003thq.2	-	1	555	c.320T>A	c.(319-321)ATT>AAT	p.I107N	LOC285954_uc003tht.3_Intron|INHBA_uc003thr.2_Missense_Mutation_p.I107N|LOC285954_uc003ths.2_Intron	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	107					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						CCTCCTTCCAATGTCATCCTC	0.562										TSP Lung(11;0.080)			19	758	---	---	---	---	PASS
ZKSCAN5	23660	broad.mit.edu	37	7	99110202	99110202	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99110202C>G	uc003uqv.2	+	3	665	c.541C>G	c.(541-543)CTG>GTG	p.L181V	ZKSCAN5_uc010lfx.2_Missense_Mutation_p.L181V|ZKSCAN5_uc003uqw.2_Missense_Mutation_p.L181V|ZKSCAN5_uc003uqx.2_Missense_Mutation_p.L181V|ZKSCAN5_uc003uqy.2_5'UTR	NM_145102	NP_659570	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	181					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GCCTCGTCTCCTGGAGGAAAA	0.587													20	35	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149526028	149526028	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149526028G>A	uc010lpk.2	+	109	15082	c.15082G>A	c.(15082-15084)GAG>AAG	p.E5028K	SSPO_uc003wgh.2_RNA	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	5028	VWFC 3.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCTGCAGGGCGAGGAGATGGT	0.667													8	6	---	---	---	---	PASS
FLJ10661	286042	broad.mit.edu	37	8	8095990	8095990	+	RNA	SNP	C	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8095990C>G	uc011kwt.1	+	8		c.1185C>G			FLJ10661_uc010lrq.2_Intron|FLJ10661_uc003wsf.3_Intron	NR_024362				Homo sapiens cDNA FLJ60033 complete cds, highly similar to Protein FAM86A.												0						CCAGGAGCCCCGAGACCTGCA	0.647													2	4	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77764257	77764257	+	Silent	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77764257C>T	uc003yav.2	+	10	5352	c.4965C>T	c.(4963-4965)CAC>CAT	p.H1655H	ZFHX4_uc003yau.1_Silent_p.H1700H|ZFHX4_uc003yaw.1_Silent_p.H1655H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1655	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACTACAGCACGAATTACAAC	0.443										HNSCC(33;0.089)			24	96	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133196585	133196585	+	Silent	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133196585G>A	uc003ytj.2	-	3	732	c.507C>T	c.(505-507)GCC>GCT	p.A169A	KCNQ3_uc010mdt.2_Silent_p.A169A	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	169	Helical; Name=Segment S2; (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			AAGCAAACTCGGCTCCAAAGA	0.512													49	80	---	---	---	---	PASS
FANCG	2189	broad.mit.edu	37	9	35076446	35076446	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35076446C>A	uc003zwb.1	-	8	1551	c.1059G>T	c.(1057-1059)AGG>AGT	p.R353S	FANCG_uc003zwa.1_Missense_Mutation_p.R95S|FANCG_uc010mkj.1_Missense_Mutation_p.R95S|FANCG_uc011lot.1_Missense_Mutation_p.R353S	NM_004629	NP_004620	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	353	TPR 2.				cell cycle checkpoint|DNA repair|mitochondrion organization	mitochondrion|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|large_intestine(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TCTGTAGGCACCTGCTTGCTA	0.532			Mis|N|F|S			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				9	105	---	---	---	---	PASS
NPR2	4882	broad.mit.edu	37	9	35809214	35809214	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35809214G>T	uc003zyd.2	+	21	3048	c.3048G>T	c.(3046-3048)CAG>CAT	p.Q1016H	NPR2_uc010mlb.2_Missense_Mutation_p.Q992H|SPAG8_uc003zye.2_Intron	NM_003995	NP_003986	P20594	ANPRB_HUMAN	natriuretic peptide receptor B precursor	1016	Cytoplasmic (Potential).				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GATGCTTCCAGCTAGAGCTTC	0.547													11	211	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79438435	79438435	+	Intron	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79438435C>A	uc010mpk.2	-						PRUNE2_uc004akn.2_3'UTR	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2						apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						AAATGTATCACAAAGAAGCAA	0.368													25	68	---	---	---	---	PASS
SMC2	10592	broad.mit.edu	37	9	106889711	106889711	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106889711G>A	uc004bbv.2	+	20	3028	c.2740G>A	c.(2740-2742)GAC>AAC	p.D914N	SMC2_uc004bbw.2_Missense_Mutation_p.D914N|SMC2_uc011lvl.1_Missense_Mutation_p.D914N|SMC2_uc004bbx.2_Missense_Mutation_p.D914N|SMC2_uc004bby.2_RNA	NM_001042551	NP_001036016	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	914	Potential.				cell division|mitotic chromosome condensation|symbiosis, encompassing mutualism through parasitism	condensin complex|cytoplasm|nuclear chromosome	ATP binding|protein heterodimerization activity			ovary(4)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|breast(1)	9						TAAGGAATTAGACCACAACAT	0.363													53	82	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137707834	137707834	+	Silent	SNP	G	A	A	rs3827848	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137707834G>A	uc004cfe.2	+	52	4504	c.4122G>A	c.(4120-4122)ACG>ACA	p.T1374T		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1374	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCGGGCAGACGGTGAGTCCAC	0.552													4	99	---	---	---	---	PASS
UBAC1	10422	broad.mit.edu	37	9	138837764	138837764	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138837764G>C	uc004cgt.2	-	6	842	c.624C>G	c.(622-624)AAC>AAG	p.N208K	UBAC1_uc004cgs.1_Missense_Mutation_p.N208K|UBAC1_uc004cgu.2_RNA	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1	208	UBA 1.					Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		TGGTGGCTCTGTTCTCCGGAA	0.662													14	46	---	---	---	---	PASS
ZNF485	220992	broad.mit.edu	37	10	44104090	44104090	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44104090T>G	uc010qfc.1	+	3	247	c.53T>G	c.(52-54)GTG>GGG	p.V18G	ZNF485_uc010qfd.1_Intron	NM_145312	NP_660355	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	18	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GATGTGGCTGTGGCCTTTACC	0.562													11	17	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89690802	89690802	+	Splice_Site	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89690802G>A	uc001kfb.2	+	5	1241	c.210_splice	c.e5-1	p.L70_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(4)|p.L70fs*7(2)|p.Y27fs*1(2)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTTTCTTTTAGTTGTGCTGAA	0.254		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			32	23	---	---	---	---	PASS
CRTAC1	55118	broad.mit.edu	37	10	99642555	99642555	+	Missense_Mutation	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99642555C>A	uc001kou.1	-	13	2019	c.1663G>T	c.(1663-1665)GGC>TGC	p.G555C	CRTAC1_uc001kov.2_Missense_Mutation_p.G544C|CRTAC1_uc001kot.1_Intron	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	555						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		ATGCAATGGCCATTTTCCTGC	0.577													17	33	---	---	---	---	PASS
ENTPD7	57089	broad.mit.edu	37	10	101455823	101455823	+	Silent	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101455823C>T	uc001kqa.3	+	9	1132	c.954C>T	c.(952-954)AAC>AAT	p.N318N	ENTPD7_uc009xwl.2_Silent_p.N320N	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	318	Vesicular (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		TCGGAGGCAACTTTGCCCGGC	0.453													11	169	---	---	---	---	PASS
TLX1	3195	broad.mit.edu	37	10	102896459	102896459	+	Missense_Mutation	SNP	C	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102896459C>G	uc001ksw.2	+	3	1020	c.782C>G	c.(781-783)GCG>GGG	p.A261G		NM_005521	NP_005512	P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	261						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CGGCAGACTGCGGAGGAACGG	0.652			T	TRB@|TRD@	T-ALL								5	64	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	128019025	128019025	+	Missense_Mutation	SNP	C	G	G	rs3740199	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128019025C>G	uc001ljk.2	-	2	555	c.142G>C	c.(142-144)GGG>CGG	p.G48R	ADAM12_uc010qul.1_Missense_Mutation_p.G48R|ADAM12_uc001ljm.2_Missense_Mutation_p.G48R|ADAM12_uc001ljn.2_Missense_Mutation_p.G48R|ADAM12_uc001ljl.3_Missense_Mutation_p.G48R	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	48					cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TCCCCACTCCCAACAGAGGCA	0.468													4	174	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	20101630	20101630	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20101630G>T	uc010rdm.1	+	27	5729	c.5368G>T	c.(5368-5370)GCA>TCA	p.A1790S	NAV2_uc001mpp.2_Missense_Mutation_p.A1670S|NAV2_uc001mpr.3_Missense_Mutation_p.A1734S|NAV2_uc001mpt.2_Missense_Mutation_p.A783S|NAV2_uc009yhx.2_Missense_Mutation_p.A798S|NAV2_uc009yhy.1_Missense_Mutation_p.A696S|NAV2_uc009yhz.2_Missense_Mutation_p.A379S|NAV2_uc001mpu.2_Missense_Mutation_p.A172S	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	1790						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						TGCCCAGTCTGCAGACCTCCG	0.562													13	39	---	---	---	---	PASS
TCN1	6947	broad.mit.edu	37	11	59633903	59633903	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59633903A>G	uc001noj.2	-	1	139	c.41T>C	c.(40-42)CTG>CCG	p.L14P		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	14					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AAAAGAAAACAGTAAGAGCCC	0.413													49	109	---	---	---	---	PASS
EML3	256364	broad.mit.edu	37	11	62378665	62378665	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62378665G>A	uc001ntu.1	-	3	654	c.346C>T	c.(346-348)CCT>TCT	p.P116S	EML3_uc001ntr.1_Missense_Mutation_p.P88S|EML3_uc001nts.1_Missense_Mutation_p.P88S|EML3_uc001ntt.1_Silent_p.S12S|EML3_uc010rly.1_Missense_Mutation_p.P116S|EML3_uc009yny.1_5'UTR|ROM1_uc001ntv.2_5'Flank	NM_153265	NP_694997	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like	116						cytoplasm|microtubule	protein binding			ovary(1)	1						GTCCCGCTAGGCTCTTCGCTG	0.697													4	30	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95712225	95712225	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95712225G>A	uc001pfw.1	-	5	4643	c.3358C>T	c.(3358-3360)CCT>TCT	p.P1120S		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	1120					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TTTAGGGCAGGGCCCATGTTA	0.423			T	MECT1|CRTC3	salivary gland mucoepidermoid								27	133	---	---	---	---	PASS
MMP12	4321	broad.mit.edu	37	11	102737090	102737090	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102737090G>T	uc001phk.2	-	8	1046	c.1001C>A	c.(1000-1002)GCT>GAT	p.A334D		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	334	Hemopexin-like 2.				positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	TTCATAAGCAGCTTCAATGCC	0.353													3	22	---	---	---	---	PASS
SIDT2	51092	broad.mit.edu	37	11	117052139	117052139	+	Missense_Mutation	SNP	G	C	C			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117052139G>C	uc001pqh.1	+	2	232	c.191G>C	c.(190-192)GGC>GCC	p.G64A	SIDT2_uc010rxe.1_Missense_Mutation_p.G64A|SIDT2_uc001pqg.2_Missense_Mutation_p.G64A|SIDT2_uc001pqi.1_Missense_Mutation_p.G64A	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor	64	Extracellular (Potential).					integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		CAGACAGAGGGCGTGCGTGTG	0.597											OREG0021368	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	42	---	---	---	---	PASS
CCDC15	80071	broad.mit.edu	37	11	124857794	124857794	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124857794C>T	uc001qbm.3	+	8	1931	c.1672C>T	c.(1672-1674)CAG>TAG	p.Q558*		NM_025004	NP_079280	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	558						centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		ACCCAAATGTCAGGACCAGGA	0.433													16	481	---	---	---	---	PASS
SLC37A2	219855	broad.mit.edu	37	11	124947149	124947149	+	Silent	SNP	G	A	A	rs12276567	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124947149G>A	uc001qbn.2	+	3	416	c.165G>A	c.(163-165)TCG>TCA	p.S55S	SLC37A2_uc010sau.1_Silent_p.S55S	NM_001145290	NP_001138762	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glycerol-3-phosphate	55					carbohydrate transport|transmembrane transport	integral to membrane				ovary(2)	2	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		AGAACTGCTCGGAGCAGATCA	0.542													5	274	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9571603	9571603	+	Intron	SNP	A	C	C	rs115703819	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9571603A>C	uc010sgs.1	-						DDX12_uc001qvx.3_Intron|DDX12_uc001qvy.1_3'UTR	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						ACCCCCCCTCACCTTCCTCAG	0.612													2	12	---	---	---	---	PASS
FGFR1OP2	26127	broad.mit.edu	37	12	27107226	27107226	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27107226G>T	uc001rhm.2	+	2	477	c.135G>T	c.(133-135)CAG>CAT	p.Q45H	FGFR1OP2_uc001rhl.2_Missense_Mutation_p.Q45H|FGFR1OP2_uc001rhn.2_Missense_Mutation_p.Q45H	NM_015633	NP_056448	Q9NVK5	FGOP2_HUMAN	FGFR1 oncogene partner 2	45	Potential.					cytoplasm					0	Colorectal(261;0.0847)					CCATGAAACAGGTTTGATTTT	0.348													3	65	---	---	---	---	PASS
ZNF641	121274	broad.mit.edu	37	12	48737263	48737263	+	Silent	SNP	C	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48737263C>A	uc001rrn.1	-	6	975	c.810G>T	c.(808-810)GGG>GGT	p.G270G	ZNF641_uc001rro.1_Silent_p.G256G|ZNF641_uc010sls.1_Silent_p.G247G	NM_152320	NP_689533	Q96N77	ZN641_HUMAN	zinc finger protein 641	270	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2						CAAACTGTTTCCCACACTGGG	0.527													6	123	---	---	---	---	PASS
INHBC	3626	broad.mit.edu	37	12	57843267	57843267	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57843267C>T	uc001snv.1	+	2	648	c.521C>T	c.(520-522)GCC>GTC	p.A174V		NM_005538	NP_005529	P55103	INHBC_HUMAN	inhibin beta C chain preproprotein	174					growth	extracellular region	growth factor activity|hormone activity|transforming growth factor beta receptor binding				0						GAGGTGGATGCCAGTGGCTGG	0.577													4	124	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101433785	101433785	+	Missense_Mutation	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101433785G>A	uc010svm.1	+	11	1522	c.950G>A	c.(949-951)CGA>CAA	p.R317Q	ANO4_uc001thw.2_Missense_Mutation_p.R282Q|ANO4_uc001thx.2_Missense_Mutation_p.R317Q	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	317	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GAAAACCACCGACATCTACTC	0.438										HNSCC(74;0.22)			104	249	---	---	---	---	PASS
DAO	1610	broad.mit.edu	37	12	109290787	109290787	+	Silent	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109290787C>T	uc001tnr.3	+	8	771	c.618C>T	c.(616-618)GAC>GAT	p.D206D	DAO_uc001tnq.3_Silent_p.D140D|DAO_uc009zvb.2_RNA|DAO_uc001tns.3_Intron	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	206					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						AACAGGTGGACGCCCCTTGGA	0.547													34	55	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120615277	120615277	+	Silent	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120615277G>A	uc001txo.2	-	9	824	c.811C>T	c.(811-813)CTG>TTG	p.L271L		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	271	HEAT 1.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGACTCCTCAGTAAGGACTTC	0.448													19	66	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131593399	131593399	+	Missense_Mutation	SNP	G	A	A	rs141128784		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131593399G>A	uc001uit.3	+	18	2577	c.2018G>A	c.(2017-2019)CGT>CAT	p.R673H	GPR133_uc010tbm.1_Missense_Mutation_p.R705H|GPR133_uc009zyo.2_Intron|GPR133_uc001uiv.1_Missense_Mutation_p.R192H|GPR133_uc009zyp.2_RNA	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	673	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		AGCAAGCACCGTTACTACTat	0.299													26	163	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133357412	133357412	+	Missense_Mutation	SNP	T	C	C	rs2291260	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133357412T>C	uc001ukz.1	-	18	4113	c.3554A>G	c.(3553-3555)AAG>AGG	p.K1185R	GOLGA3_uc001ula.1_Missense_Mutation_p.K1185R	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	1185	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CACCTTCTCCTTCTCCTTCTC	0.557													4	149	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21971365	21971365	+	Missense_Mutation	SNP	A	C	C			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21971365A>C	uc001wbc.2	-	3	766	c.674T>G	c.(673-675)ATA>AGA	p.I225R	METTL3_uc001wbb.2_Missense_Mutation_p.I70R|METTL3_uc010tlw.1_RNA|METTL3_uc010tlx.1_Missense_Mutation_p.I225R|METTL3_uc001wbd.1_Missense_Mutation_p.I225R	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	225					gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		AAGGCTCTCTATCTCCAGATC	0.443													97	210	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24530760	24530760	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24530760C>T	uc001wlj.2	+	27	2516	c.2359C>T	c.(2359-2361)CGG>TGG	p.R787W	LRRC16B_uc001wlk.2_5'Flank	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	787										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		TGTGGCCATGCGGGTGGCCGA	0.612													3	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	23114213	23114213	+	RNA	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23114213C>T	uc001yvf.2	-	2		c.218G>A								Homo sapiens cDNA clone IMAGE:5275816.																		TTCAACCATTCGGTGTCAAGG	0.433													4	58	---	---	---	---	PASS
SPSB3	90864	broad.mit.edu	37	16	1831441	1831441	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1831441A>G	uc002cmr.2	-	1	77	c.44T>C	c.(43-45)CTG>CCG	p.L15P	NUBP2_uc002cmw.3_5'Flank|NUBP2_uc002cmx.3_5'Flank|NUBP2_uc010brx.2_5'Flank|SPSB3_uc002cms.2_5'UTR|SPSB3_uc002cmt.2_5'UTR|SPSB3_uc002cmu.2_Missense_Mutation_p.L15P|SPSB3_uc002cmv.2_5'UTR|SPSB3_uc010uvm.1_Missense_Mutation_p.L15P	NM_080861	NP_543137	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box	15					intracellular signal transduction						0						GGCTGCACTCAGGACGAAGTG	0.617													16	19	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9892213	9892213	+	Silent	SNP	G	T	T	rs148846694	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9892213G>T	uc002czo.3	-	11	2825	c.2277C>A	c.(2275-2277)ACC>ACA	p.T759T	GRIN2A_uc010uym.1_Silent_p.T759T|GRIN2A_uc010uyn.1_Silent_p.T602T|GRIN2A_uc002czr.3_Silent_p.T759T	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	759	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TTCCATAACCGGTGGTGGCAA	0.547													3	86	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57756742	57756742	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57756742A>G	uc002emi.2	+	10	1486	c.1397A>G	c.(1396-1398)GAG>GGG	p.E466G	CCDC135_uc002emj.2_Missense_Mutation_p.E466G|CCDC135_uc002emk.2_Missense_Mutation_p.E401G	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	466						cytoplasm				central_nervous_system(1)	1						ACCACCTATGAGGACTTGCAG	0.597													3	75	---	---	---	---	PASS
GOT2	2806	broad.mit.edu	37	16	58750604	58750604	+	Silent	SNP	G	A	A	rs1058192	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58750604G>A	uc002eof.1	-	7	930	c.816C>T	c.(814-816)TGC>TGT	p.C272C	GOT2_uc010vim.1_Silent_p.C229C	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	272					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ATTGGCAGAGGCAAACATTAA	0.502													4	67	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3992020	3992020	+	Silent	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3992020C>T	uc002fxe.2	-	13	2257	c.2193G>A	c.(2191-2193)ACG>ACA	p.T731T	ZZEF1_uc002fxk.1_Silent_p.T731T	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	731							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TGAGGAGCAACGTGGCCCCAC	0.547													8	57	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16097899	16097899	+	5'UTR	SNP	C	T	T	rs149293452	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16097899C>T	uc002gpo.2	-	2					NCOR1_uc002gpn.2_5'UTR|NCOR1_uc002gpp.1_5'UTR|NCOR1_uc002gpr.2_5'UTR|NCOR1_uc002gps.1_5'UTR|NCOR1_uc010coz.1_5'UTR|NCOR1_uc010cpb.1_5'UTR|NCOR1_uc010cpa.1_5'UTR|NCOR1_uc002gpu.2_5'UTR	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTAAAGAAGTCCTCACCAGAC	0.393													4	17	---	---	---	---	PASS
GAS2L2	246176	broad.mit.edu	37	17	34072555	34072555	+	Missense_Mutation	SNP	G	A	A	rs3744374	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34072555G>A	uc002hjv.1	-	6	1989	c.1961C>T	c.(1960-1962)GCC>GTC	p.A654V		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	654					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTCTTGGATGGCTTTGTCATA	0.627													5	189	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35937637	35937637	+	Missense_Mutation	SNP	T	C	C	rs12602536	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35937637T>C	uc002hoa.2	-	7	747	c.664A>G	c.(664-666)ACT>GCT	p.T222A	SYNRG_uc010wde.1_Intron|SYNRG_uc010wdf.1_Intron|SYNRG_uc002hoc.2_Intron|SYNRG_uc002hoe.2_Intron|SYNRG_uc002hod.2_Intron|SYNRG_uc010wdg.1_Intron|SYNRG_uc002hob.2_Missense_Mutation_p.T222A|SYNRG_uc002hof.2_5'Flank|SYNRG_uc010cvd.1_Intron|SYNRG_uc002hog.1_Missense_Mutation_p.T356A|SYNRG_uc010wdh.1_Missense_Mutation_p.T323A	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	222					endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						ACTTCAGAAGTATTTAATTTA	0.428													6	353	---	---	---	---	PASS
AFG3L2	10939	broad.mit.edu	37	18	12340252	12340252	+	Missense_Mutation	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12340252G>T	uc002kqz.1	-	15	2041	c.1928C>A	c.(1927-1929)ACA>AAA	p.T643K		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	643					cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	AGCACCAGTTGTAATTCTTCC	0.393													10	272	---	---	---	---	PASS
ZNF564	163050	broad.mit.edu	37	19	12637186	12637186	+	3'UTR	SNP	T	C	C			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12637186T>C	uc002mty.2	-	4					ZNF709_uc002mtx.3_Intron	NM_144976	NP_659413	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						cccaaacaagtctgaaaccca	0.144													3	61	---	---	---	---	PASS
SLC5A5	6528	broad.mit.edu	37	19	18001748	18001748	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18001748C>T	uc002nhr.3	+	14	2052	c.1705C>T	c.(1705-1707)CGG>TGG	p.R569W		NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide	569	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4						GGACCTCGCACGGCAGACAGC	0.602													76	154	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271812	22271812	+	Silent	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271812G>A	uc010ecx.2	+	4	1429	c.1260G>A	c.(1258-1260)CAG>CAA	p.Q420Q	ZNF257_uc010ecy.2_Silent_p.Q388Q	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	420	C2H2-type 9; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCCTTACTCAGCATAAGATAA	0.363													3	71	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271820	22271820	+	Missense_Mutation	SNP	T	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271820T>G	uc010ecx.2	+	4	1437	c.1268T>G	c.(1267-1269)ATA>AGA	p.I423R	ZNF257_uc010ecy.2_Missense_Mutation_p.I391R	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	423	C2H2-type 9; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				CAGCATAAGATAATTCATACT	0.383													3	72	---	---	---	---	PASS
ZNF492	57615	broad.mit.edu	37	19	22836805	22836805	+	Missense_Mutation	SNP	G	A	A	rs139107317	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22836805G>A	uc002nqw.3	+	3	362	c.118G>A	c.(118-120)GCT>ACT	p.A40T		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	40	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				TGAGATGGTAGCTGAACCCCC	0.408													6	189	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3672817	3672817	+	Missense_Mutation	SNP	G	A	A	rs149916347		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3672817G>A	uc002wja.2	-	16	4063	c.4063C>T	c.(4063-4065)CGG>TGG	p.R1355W	SIGLEC1_uc002wjb.1_5'UTR|SIGLEC1_uc002wiz.3_Missense_Mutation_p.R1355W	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1355	Ig-like C2-type 14.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CTGGAGTCCCGGAAGGAGGAC	0.612													13	30	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11098863	11098863	+	5'UTR	SNP	A	G	G	rs75318310	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11098863A>G	uc002yit.1	-	1					BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccagcctccaactcccccttc	0.000													3	8	---	---	---	---	PASS
CXADR	1525	broad.mit.edu	37	21	18924180	18924180	+	Silent	SNP	G	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18924180G>A	uc002yki.2	+	3	442	c.324G>A	c.(322-324)ACG>ACA	p.T108T	CXADR_uc002ykh.1_Silent_p.T108T|CXADR_uc010gld.1_Silent_p.T108T|CXADR_uc010gle.1_Intron|CXADR_uc002ykj.1_Silent_p.T81T	NM_001338	NP_001329	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	108	Extracellular (Potential).|Ig-like C2-type 1.				blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		TAAATGTAACGAATTTACAAC	0.358													20	149	---	---	---	---	PASS
KRTAP10-2	386679	broad.mit.edu	37	21	45970406	45970406	+	3'UTR	SNP	C	G	G	rs112247714	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45970406C>G	uc002zfi.1	-	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2							keratin filament				large_intestine(1)	1						GCCCGCCCGGCGGGAGGTCAG	0.692													2	9	---	---	---	---	PASS
FTCD	10841	broad.mit.edu	37	21	47570139	47570139	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47570139G>T	uc002zif.2	-	7	844	c.800C>A	c.(799-801)TCA>TAA	p.S267*	FTCD_uc002zig.2_Nonsense_Mutation_p.S267*|FTCD_uc002zih.2_Nonsense_Mutation_p.S267*|FTCD_uc010gqf.2_Nonsense_Mutation_p.S267*|FTCD_uc010gqg.1_Nonsense_Mutation_p.S136*	NM_006657	NP_006648	O95954	FTCD_HUMAN	formiminotransferase cyclodeaminase	267	Formiminotransferase C-subdomain (By similarity).				folic acid-containing compound metabolic process|histidine catabolic process	centriole|cytosol|Golgi apparatus	folic acid binding|formimidoyltetrahydrofolate cyclodeaminase activity|glutamate formimidoyltransferase activity			pancreas(1)|skin(1)	2	Breast(49;0.214)			Colorectal(79;0.235)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	CACCAGCTGTGAGCCCACCAC	0.672													3	18	---	---	---	---	PASS
SDF2L1	23753	broad.mit.edu	37	22	21997279	21997279	+	Missense_Mutation	SNP	C	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21997279C>T	uc002zvf.2	+	2	400	c.316C>T	c.(316-318)CTC>TTC	p.L106F		NM_022044	NP_071327	Q9HCN8	SDF2L_HUMAN	stromal cell-derived factor 2-like 1 precursor	106	MIR 2.					endoplasmic reticulum lumen|membrane					0	Colorectal(54;0.105)					GGCGGTGAGGCTCACGCATGT	0.706											OREG0026342	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38155502	38155502	+	Intron	SNP	A	C	C			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38155502A>C	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atv.2_Missense_Mutation_p.T422P|TRIOBP_uc003atw.2_Intron|TRIOBP_uc003atx.1_Intron|TRIOBP_uc010gxh.2_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					gcccaaggtcaccccgcctgc	0.109													9	69	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18842131	18842131	+	Missense_Mutation	SNP	A	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18842131A>G	uc004cyq.2	+	17	2073	c.1592A>G	c.(1591-1593)AAC>AGC	p.N531S	PPEF1_uc004cyp.2_Missense_Mutation_p.N503S|PPEF1_uc004cyr.2_Missense_Mutation_p.N469S|PPEF1_uc004cys.2_Missense_Mutation_p.N531S|PPEF1_uc011mja.1_Missense_Mutation_p.N466S|PPEF1_uc011mjb.1_Missense_Mutation_p.N475S	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	531					detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					AATCTGGTAAACATAGACCAA	0.423													97	51	---	---	---	---	PASS
FRMD7	90167	broad.mit.edu	37	X	131212512	131212512	+	Silent	SNP	A	G	G	rs5977623	byFrequency	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131212512A>G	uc004ewn.2	-	12	1711	c.1533T>C	c.(1531-1533)ATT>ATC	p.I511I	FRMD7_uc011muy.1_Silent_p.I496I	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	511					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CCTCTGCTCTAATTGGGGACC	0.488													5	290	---	---	---	---	PASS
HES3	390992	broad.mit.edu	37	1	6305634	6305634	+	3'UTR	DEL	C	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6305634delC	uc009vly.1	+	4						NM_001024598	NP_001019769	Q5TGS1	HES3_HUMAN	hairy and enhancer of split 3						transcription, DNA-dependent	nucleus	DNA binding				0	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		ACTGCCAGGACCCCCCAGTCG	0.672													5	6	---	---	---	---	
TARDBP	23435	broad.mit.edu	37	1	11077260	11077260	+	Intron	DEL	T	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11077260delT	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		GTTACCtttcttttttttttt	0.025													4	2	---	---	---	---	
TRIT1	54802	broad.mit.edu	37	1	40312703	40312703	+	Intron	DEL	T	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40312703delT	uc010oiz.1	-						TRIT1_uc001cec.3_Intron|TRIT1_uc001ced.3_Intron|TRIT1_uc001cee.3_Intron|TRIT1_uc001cef.3_Intron|TRIT1_uc001ceg.3_Intron|TRIT1_uc001ceh.3_Intron|TRIT1_uc009vvv.2_Intron|TRIT1_uc001cei.3_Intron|TRIT1_uc001ceq.2_Intron|TRIT1_uc001cek.2_Intron|TRIT1_uc009vvx.2_Intron|TRIT1_uc001cel.2_Intron|TRIT1_uc001cem.2_Intron|TRIT1_uc001cen.2_Intron|TRIT1_uc001ceo.2_Intron|TRIT1_uc001cep.2_Intron	NM_017646	NP_060116	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1 precursor						tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			ATGCAAATAATTTTTTTTTTT	0.388													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121485005	121485008	+	IGR	DEL	TGTT	-	-	rs28831473		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121485005_121485008delTGTT								LOC647121 (171319 upstream) : None (None downstream)																							ggaaacgctctgtttgtaaagtct	0.000													1356	9	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	153982268	153982269	+	Intron	INS	-	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153982268_153982269insA	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			gacccagtctcaaaaaaaaaaa	0.129													3	5	---	---	---	---	
MAEL	84944	broad.mit.edu	37	1	166973742	166973742	+	Intron	DEL	A	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166973742delA	uc001gdy.1	+						MAEL_uc001gdz.1_Intron|MAEL_uc009wvf.1_Intron	NM_032858	NP_116247	Q96JY0	MAEL_HUMAN	maelstrom homolog						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|multicellular organismal development|piRNA metabolic process|spermatogenesis	piP-body	DNA binding			skin(1)	1						TGAAGACTGCAAAAGCTAAAC	0.313													2	6	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183211974	183211975	+	Intron	INS	-	T	T	rs78578269		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183211974_183211975insT	uc001gqa.2	+							NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						CTTCAGTCCTCTTTTTTTTTTT	0.396													4	2	---	---	---	---	
FLVCR1	28982	broad.mit.edu	37	1	213058892	213058892	+	Intron	DEL	C	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213058892delC	uc001hjt.2	+							NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular						cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		ACAAGTGtttctttttttttt	0.134													8	5	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220355434	220355434	+	Intron	DEL	T	-	-	rs11343960		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220355434delT	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		ATAATATTACTTCTATTAAAT	0.139													3	3	---	---	---	---	
CPSF3	51692	broad.mit.edu	37	2	9611342	9611343	+	Intron	INS	-	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9611342_9611343insA	uc002qzo.1	+						CPSF3_uc002qzp.1_Intron|CPSF3_uc002qzq.1_Intron	NM_016207	NP_057291	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		gactccatctcaaaaaaaaaaa	0.129													7	4	---	---	---	---	
CRIM1	51232	broad.mit.edu	37	2	36776050	36776050	+	3'UTR	DEL	T	-	-	rs11309348		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36776050delT	uc002rpd.2	+	17						NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor						nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TGACCAAGTGTTTTCTTAGAA	0.418													3	3	---	---	---	---	
THUMPD2	80745	broad.mit.edu	37	2	39995470	39995471	+	Intron	INS	-	G	G			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39995470_39995471insG	uc002rru.2	-						THUMPD2_uc002rrv.2_Intron|THUMPD2_uc010ynt.1_Intron|THUMPD2_uc010ynu.1_Intron	NM_025264	NP_079540	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2								methyltransferase activity			skin(1)	1		all_hematologic(82;0.248)				TTTTTATAACTGTAAAATAAAA	0.292													41	23	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61527958	61527959	+	Intron	INS	-	A	A	rs75802951		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61527958_61527959insA	uc002sbe.2	-							NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			aaaaaaTGAACAAAAAAAAAAA	0.114													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	237782227	237782234	+	IGR	DEL	CCTTCCTT	-	-	rs28568974		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237782227_237782234delCCTTCCTT								CXCR7 (291235 upstream) : COPS8 (211850 downstream)																							tcccttcctcccttcctttcttcctccc	0.135													4	3	---	---	---	---	
METTL6	131965	broad.mit.edu	37	3	15455865	15455865	+	Intron	DEL	T	-	-	rs72352627		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15455865delT	uc003bzs.1	-						METTL6_uc011avp.1_Intron|METTL6_uc010hen.1_5'Flank	NM_152396	NP_689609	Q8TCB7	METL6_HUMAN	methyltransferase like 6								methyltransferase activity				0						AAGACACttcttttttttttt	0.209													4	2	---	---	---	---	
ACTR8	93973	broad.mit.edu	37	3	53910919	53910920	+	Intron	INS	-	T	T	rs140862872		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53910919_53910920insT	uc003dhd.2	-						ACTR8_uc003dhb.2_Intron|ACTR8_uc003dhc.2_Intron	NM_022899	NP_075050	Q9H981	ARP8_HUMAN	actin-related protein 8						cell division|DNA recombination|DNA repair|mitosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex	protein binding			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		ATGCTCAAGTGTTTTTTTTTCC	0.347													2	4	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124426269	124426270	+	Intron	INS	-	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124426269_124426270insT	uc003ehg.2	+						KALRN_uc003ehk.2_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						tccttccttccttccttccttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4147283	4147283	+	IGR	DEL	G	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4147283delG								LOC348926 (190135 upstream) : OTOP1 (43247 downstream)																							CACTGGGCATGGGGCCCCCAA	0.617													5	6	---	---	---	---	
GPR125	166647	broad.mit.edu	37	4	22422867	22422868	+	Intron	INS	-	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22422867_22422868insA	uc003gqm.1	-						GPR125_uc010ieo.1_Intron|GPR125_uc003gqn.1_Intron|GPR125_uc003gqo.2_Intron	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				ACTGGCAGAATAAAAAAAAAAA	0.356													9	4	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	40895049	40895050	+	Intron	INS	-	A	A	rs72604395		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40895049_40895050insA	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						GAATCTGTGTCCTTAGCTACTG	0.535													3	4	---	---	---	---	
CDKL2	8999	broad.mit.edu	37	4	76530541	76530542	+	Intron	DEL	AC	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76530541_76530542delAC	uc003hiq.2	-						CDKL2_uc011cbp.1_Intron|CDKL2_uc010iix.1_Intron	NM_003948	NP_003939	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2						sex differentiation|signal transduction	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(2)|stomach(2)|breast(2)|skin(1)	7			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ccatctcaaaacacacacacac	0.114													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	95332244	95332245	+	IGR	INS	-	AAGG	AAGG	rs141921585	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95332244_95332245insAAGG								HPGDS (68217 upstream) : PDLIM5 (40793 downstream)																							aaagaaagaaaaaggaaggaag	0.074													5	5	---	---	---	---	
CBR4	84869	broad.mit.edu	37	4	169911113	169911113	+	3'UTR	DEL	A	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169911113delA	uc003iry.2	-	5					CBR4_uc011cjy.1_Intron	NM_032783	NP_116172	Q8N4T8	CBR4_HUMAN	carbonic reductase 4						fatty acid biosynthetic process|protein homotetramerization	mitochondrial matrix	NADPH binding|NADPH dehydrogenase (quinone) activity|protein binding|quinone binding				0		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		AACTTAGACCAAAAAAAAAAA	0.189													6	5	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37349361	37349361	+	Intron	DEL	A	-	-	rs74712044		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37349361delA	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAAGTAAGACAAAAAAAAAAA	0.279													8	4	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70914316	70914319	+	Intron	DEL	CTTC	-	-	rs72121574		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70914316_70914319delCTTC	uc003kbs.3	+						MCCC2_uc010iyv.1_Intron|MCCC2_uc003kbt.3_Intron|MCCC2_uc003kbu.1_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	ttctttccttcttccttccttcct	0.010													4	2	---	---	---	---	
PCDHGB3	56102	broad.mit.edu	37	5	140751730	140751739	+	Frame_Shift_Del	DEL	AGGTGGTGGC	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140751730_140751739delAGGTGGTGGC	uc003ljw.1	+	1	1769_1778	c.1769_1778delAGGTGGTGGC	c.(1768-1779)AAGGTGGTGGCGfs	p.K590fs	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Frame_Shift_Del_p.K590fs|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	590_593	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTGACCAAGGTGGTGGCGGTGGACGCA	0.657													81	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8323263	8323264	+	IGR	INS	-	TTCCTTCT	TTCCTTCT	rs139963481	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8323263_8323264insTTCCTTCT								EEF1E1 (220435 upstream) : SLC35B3 (88469 downstream)																							tctttctttccttccttctttc	0.000													6	3	---	---	---	---	
HDAC2	3066	broad.mit.edu	37	6	114266377	114266377	+	Intron	DEL	G	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114266377delG	uc003pwd.1	-						HDAC2_uc003pwc.1_Intron|HDAC2_uc003pwe.1_Intron	NM_001527	NP_001518	Q92769	HDAC2_HUMAN	histone deacetylase 2						blood coagulation|dendrite development|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|maintenance of chromatin silencing|negative regulation of apoptosis|negative regulation of cell cycle|negative regulation of neuron projection development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of proteolysis|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|ESC/E(Z) complex|NuRD complex|Sin3 complex	chromatin binding|enzyme binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|sequence-specific DNA binding|transcription factor binding			skin(2)|ovary(1)|central_nervous_system(1)	4		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Vorinostat(DB02546)	aaaaaaAAAAGAATAATCAGT	0.129													6	3	---	---	---	---	
ACAT2	39	broad.mit.edu	37	6	160199454	160199455	+	Intron	DEL	TT	-	-	rs71808548		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160199454_160199455delTT	uc010kjy.2	+						ACAT2_uc011efw.1_Intron	NM_005891	NP_005882	Q9BWD1	THIC_HUMAN	acetyl-Coenzyme A acetyltransferase 2							mitochondrion|nucleolus	acetyl-CoA C-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTTCCCAAGGTTTaaaaaaaaa	0.317													6	5	---	---	---	---	
DDC	1644	broad.mit.edu	37	7	50547726	50547727	+	Intron	INS	-	T	T	rs150698812	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50547726_50547727insT	uc003tpf.3	-						DDC_uc010kza.2_Intron|DDC_uc003tpg.3_Intron	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid						cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	TGGGGAGGGCGTCTtagaataa	0.342													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61969348	61969348	+	IGR	DEL	C	-	-	rs28878810		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61969348delC								None (None upstream) : LOC643955 (782324 downstream)																							ggggtttcttcctttcatgct	0.000													1161	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61969534	61969534	+	IGR	DEL	A	-	-	rs56839084		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61969534delA								None (None upstream) : LOC643955 (782138 downstream)																							taataaccagacagaatcatt	0.000													1025	12	---	---	---	---	
CDHR3	222256	broad.mit.edu	37	7	105668981	105668986	+	Intron	DEL	GTTCTG	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105668981_105668986delGTTCTG	uc003vdl.3	+						CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Intron|CDHR3_uc011klt.1_Intron|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						ACTTCTGCCTGTTCTGTTCTCTGCAG	0.519													37	9	---	---	---	---	
COPG2	26958	broad.mit.edu	37	7	130146342	130146342	+	3'UTR	DEL	C	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130146342delC	uc003vqh.1	-	14						NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					AAAAAAAAAACAACCCATGCG	0.378													5	3	---	---	---	---	
GIMAP5	55340	broad.mit.edu	37	7	150438187	150438188	+	Intron	DEL	AC	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150438187_150438188delAC	uc003whr.1	+						GIMAP5_uc010lpu.2_Intron	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5							integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		acacacacagacacacacacac	0.351													4	2	---	---	---	---	
LOXL2	4017	broad.mit.edu	37	8	23166099	23166100	+	Intron	INS	-	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23166099_23166100insA	uc003xdh.1	-						LOXL2_uc010lty.1_Intron	NM_002318	NP_002309	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2 precursor						aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CAGGTCTGAGCAAAAAAATCCC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49826831	49826831	+	IGR	DEL	A	-	-	rs141577976		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49826831delA								EFCAB1 (178961 upstream) : SNAI2 (3408 downstream)																							ggaaaaaggcaaaaaaaAAAa	0.070													8	4	---	---	---	---	
RSPO2	340419	broad.mit.edu	37	8	109001381	109001383	+	In_Frame_Del	DEL	GAA	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109001381_109001383delGAA	uc003yms.2	-	3	842_844	c.184_186delTTC	c.(184-186)TTCdel	p.F62del	RSPO2_uc003ymq.2_5'UTR|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor	62					Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CTCTTCGAAGGAAGAAGAACAAC	0.468													108	47	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6602378	6602378	+	Intron	DEL	T	-	-	rs10975676		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6602378delT	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	TGATTACTGAttttttttttt	0.174													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68413605	68413606	+	RNA	DEL	CT	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413605_68413606delCT	uc004aex.2	+	1		c.160_161delCT								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		TTTGCTGAAACTCTGGGGTTGA	0.609													6	4	---	---	---	---	
PIP5K1B	8395	broad.mit.edu	37	9	71534252	71534252	+	Intron	DEL	A	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71534252delA	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		aggaacaaacaaaaaaaaaag	0.254													4	2	---	---	---	---	
SH3GLB2	56904	broad.mit.edu	37	9	131783167	131783168	+	Intron	INS	-	AC	AC	rs150940718	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131783167_131783168insAC	uc004bwv.2	-						SH3GLB2_uc004bww.2_Intron|SH3GLB2_uc004bwx.1_Intron|SH3GLB2_uc011mbm.1_Intron	NM_020145	NP_064530	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2						filopodium assembly|signal transduction	cytoplasm|nucleus	cytoskeletal adaptor activity|SH3 domain binding				0						acaaaaacaaaaCACACACACA	0.158													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42385728	42385743	+	IGR	DEL	AATCATCATCAAATCA	-	-	rs67183761		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42385728_42385743delAATCATCATCAAATCA								None (None upstream) : LOC441666 (441572 downstream)																							cattaaatggaatcatcatcaaatcaaatctaatgg	0.042													37	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42396712	42396712	+	IGR	DEL	T	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42396712delT								None (None upstream) : LOC441666 (430603 downstream)																							ttgaacggaatcaaatggaat	0.000													136	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42600053	42600053	+	IGR	DEL	T	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42600053delT								None (None upstream) : LOC441666 (227262 downstream)																							ttgaacggaattgaatggaat	0.000													272	7	---	---	---	---	
DNA2	1763	broad.mit.edu	37	10	70204483	70204483	+	Intron	DEL	A	-	-	rs142671149		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70204483delA	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN	DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0						agtccgtctcaaaaaaaaaaa	0.075													6	5	---	---	---	---	
SEC23IP	11196	broad.mit.edu	37	10	121662074	121662076	+	Intron	DEL	ATC	-	-	rs72318530		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121662074_121662076delATC	uc001leu.1	+						SEC23IP_uc010qtc.1_Intron	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125						Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		gcaatgtgtaatcatcacatcag	0.054													5	3	---	---	---	---	
ARAP1	116985	broad.mit.edu	37	11	72422739	72422740	+	Intron	INS	-	T	T	rs34376640		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72422739_72422740insT	uc001osu.2	-						ARAP1_uc001osv.2_Intron|ARAP1_uc001osr.2_Intron|ARAP1_uc001oss.2_Intron|ARAP1_uc009yth.2_Intron|ARAP1_uc010rre.1_Intron	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						TAGCACAtctcttttttttttt	0.228													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	86736377	86736378	+	IGR	INS	-	AA	AA			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86736377_86736378insAA								FZD4 (69944 upstream) : TMEM135 (12687 downstream)																							gactccatctcaaaaaaaaaaa	0.149													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	117907821	117907821	+	Intron	DEL	C	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117907821delC	uc001prx.1	-						uc001pry.1_Intron|uc001prz.1_Intron|uc009yzs.1_Intron|uc001psa.1_Intron					Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit26-03-15-R.																		gtctctcagtcccccctctca	0.000													3	3	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31688008	31688009	+	Intron	DEL	AA	-	-	rs71659981		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31688008_31688009delAA	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc001rkj.2_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						actctgtctcaaaaaaaaaaaa	0.163													4	2	---	---	---	---	
POU6F1	5463	broad.mit.edu	37	12	51585179	51585179	+	Intron	DEL	C	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51585179delC	uc001rxy.2	-						POU6F1_uc001rxz.2_Intron|POU6F1_uc001rya.2_Intron	NM_002702	NP_002693	Q14863	PO6F1_HUMAN	POU class 6 homeobox 1						brain development|heart development|muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGATAATCTTCAGAGGACCTC	0.478													2	4	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	71003525	71003526	+	Intron	DEL	TT	-	-	rs35267294		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71003525_71003526delTT	uc001swb.3	-						PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron|PTPRB_uc001swd.3_Intron|PTPRB_uc009zrr.1_Intron|PTPRB_uc001swe.2_Intron	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTCTGACCCCTTCTCGGGCCAC	0.569													1	5	---	---	---	---	
ANKS1B	56899	broad.mit.edu	37	12	99175092	99175093	+	Intron	DEL	AC	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99175092_99175093delAC	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc010svd.1_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc009ztq.2_Intron|ANKS1B_uc010sve.1_Intron|ANKS1B_uc001tgh.3_Intron|ANKS1B_uc001tgi.2_Intron|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Intron|ANKS1B_uc010svf.1_Intron|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		AACAACAACAacacacacacac	0.292													4	2	---	---	---	---	
B3GNT4	79369	broad.mit.edu	37	12	122691205	122691209	+	Frame_Shift_Del	DEL	CTATC	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122691205_122691209delCTATC	uc001ubx.2	+	3	625_629	c.407_411delCTATC	c.(406-411)GCTATCfs	p.A136fs	B3GNT4_uc001uby.2_Frame_Shift_Del_p.A111fs	NM_030765	NP_110392	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal	136_137	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		CGACGTGCGGCTATCCGCAGCACGT	0.629													169	9	---	---	---	---	
B3GNT4	79369	broad.mit.edu	37	12	122691220	122691221	+	Frame_Shift_Ins	INS	-	CT	CT			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122691220_122691221insCT	uc001ubx.2	+	3	640_641	c.422_423insCT	c.(421-423)TGGfs	p.W141fs	B3GNT4_uc001uby.2_Frame_Shift_Ins_p.W116fs	NM_030765	NP_110392	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal	141	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		CGCAGCACGTGGGGCAGGGTGG	0.644													133	22	---	---	---	---	
PHF11	51131	broad.mit.edu	37	13	50081034	50081034	+	Intron	DEL	C	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50081034delC	uc001vdb.2	+						PHF11_uc010tgl.1_Intron|PHF11_uc001vdc.2_Intron|PHF11_uc001vdd.2_Intron	NM_001040443	NP_001035533	Q9UIL8	PHF11_HUMAN	PHD finger protein 11 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		GGGAGCAtttctttttttttt	0.184													5	3	---	---	---	---	
TDRD3	81550	broad.mit.edu	37	13	61141478	61141479	+	Intron	INS	-	TTTTC	TTTTC	rs141427579	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61141478_61141479insTTTTC	uc001via.2	+						TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		TATCCCTGCCTttttcttttct	0.287													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20147555	20147556	+	IGR	INS	-	CACT	CACT			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20147555_20147556insCACT								P704P (127283 upstream) : OR4Q3 (68031 downstream)																							GCCCCAAAAACCAGTCAATGAA	0.455													106	10	---	---	---	---	
AKAP6	9472	broad.mit.edu	37	14	33294193	33294194	+	Intron	INS	-	A	A	rs144813756	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33294193_33294194insA	uc001wrq.2	+							NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TGAAGCAAAAGAAAAAAAAAAC	0.322													4	2	---	---	---	---	
SEL1L	6400	broad.mit.edu	37	14	81943647	81943648	+	Intron	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs140905448	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81943647_81943648insTGTGTGTGTG	uc010tvv.1	-							NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ACGTTTTGCAAtgtgtgtgtgt	0.257													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14704328	14704328	+	Intron	DEL	A	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14704328delA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						agactgtctcaaaaaaaaaaa	0.144													4	3	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15132211	15132212	+	Intron	INS	-	AAAGTTG	AAAGTTG	rs147448533	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15132211_15132212insAAAGTTG	uc002ddc.2	+						NTAN1_uc002ddd.2_Intron|NTAN1_uc010uzo.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TTAGTAAGAAAAAAGTTGATTG	0.361													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16733409	16733410	+	IGR	DEL	TG	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16733409_16733410delTG								LOC162632 (25590 upstream) : TNFRSF13B (99439 downstream)																							AGGTGAAGACTGTGGGAGAGAG	0.604													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518737	21518737	+	IGR	DEL	A	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518737delA								C17orf51 (41006 upstream) : FAM27L (306633 downstream)																							TATTGGTAGCAAAACAGCCAT	0.259													3	4	---	---	---	---	
LRRC37B2	147172	broad.mit.edu	37	17	28959641	28959642	+	Intron	INS	-	A	A			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28959641_28959642insA	uc002hfl.3	+						LRRC37B2_uc010csj.1_Intron|LRRC37B2_uc010wbq.1_Intron|LRRC37B2_uc010csi.2_Intron					RecName: Full=Putative LRRC37B-like protein 2;												0						ACACATTCCAGAAAAAAATAGC	0.386													8	4	---	---	---	---	
IKZF3	22806	broad.mit.edu	37	17	37995406	37995406	+	Intron	DEL	T	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37995406delT	uc002hsu.2	-						IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Intron|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Intron|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Intron|IKZF3_uc002htb.2_Intron|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_Intron	NM_012481	NP_036613	Q9UKT9	IKZF3_HUMAN	aiolos isoform 1						B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ATTTTTCTTCTTTTTTTTTTT	0.139													4	2	---	---	---	---	
MAPT	4137	broad.mit.edu	37	17	44069148	44069148	+	Intron	DEL	T	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44069148delT	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				aatccctaccttttttttttt	0.000													8	5	---	---	---	---	
ACOX1	51	broad.mit.edu	37	17	73944639	73944640	+	Intron	INS	-	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73944639_73944640insT	uc002jqf.2	-						ACOX1_uc010wsq.1_Intron|ACOX1_uc002jqe.2_Intron|ACOX1_uc010wsr.1_Intron	NM_007292	NP_009223	Q15067	ACOX1_HUMAN	acyl-Coenzyme A oxidase 1 isoform b						fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|prostaglandin metabolic process|very long-chain fatty acid metabolic process	peroxisomal matrix	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity|flavin adenine dinucleotide binding|protein N-terminus binding			ovary(1)	1						ttatttttttcttttttttttt	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	29339530	29339530	+	IGR	DEL	A	-	-	rs145174847		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29339530delA								B4GALT6 (74844 upstream) : MCART2 (129 downstream)																							aaaacaaaacaaaaaaaaaCC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68373387	68373390	+	IGR	DEL	TTCT	-	-	rs72394695		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68373387_68373390delTTCT								SOCS6 (375953 upstream) : None (None downstream)																							ccttccttccttctttccttcctt	0.074													4	2	---	---	---	---	
GPR108	56927	broad.mit.edu	37	19	6736019	6736019	+	Intron	DEL	C	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6736019delC	uc002mfp.2	-						GPR108_uc002mfn.2_Intron|GPR108_uc002mfo.3_Intron|GPR108_uc010duw.2_Intron	NM_001080452	NP_001073921	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108 isoform 1							integral to membrane					0						GTAGAGACCTCCCAGCTATCC	0.368											OREG0025202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27732215	27732216	+	IGR	INS	-	C	C	rs74197760		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27732215_27732216insC								None (None upstream) : LOC148189 (549186 downstream)																							agaaaaggaaatatcttcgtat	0.000													913	11	---	---	---	---	
ETV2	2116	broad.mit.edu	37	19	36135279	36135280	+	Intron	INS	-	T	T	rs147503261	by1000genomes	TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36135279_36135280insT	uc002oas.2	+						ETV2_uc002oar.2_Intron|ETV2_uc002oat.2_Intron|ETV2_uc002oau.2_Intron	NM_014209	NP_055024	O00321	ETV2_HUMAN	ets variant gene 2								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGCCAAATCCGCCCCGTCTCT	0.673													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54637428	54637429	+	IGR	DEL	CT	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54637428_54637429delCT								PRPF31 (2278 upstream) : CNOT3 (4020 downstream)																							ctctccctccctctctccacct	0.094													7	5	---	---	---	---	
CYTSA	23384	broad.mit.edu	37	22	24665687	24665688	+	5'Flank	INS	-	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24665687_24665688insT	uc002zzw.2	+						CYTSA_uc002zzv.3_5'Flank|CYTSA_uc011ajq.1_5'Flank	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A						cell cycle|cell division						0						CACACACAttcttttttttttg	0.243													4	3	---	---	---	---	
ASPHD2	57168	broad.mit.edu	37	22	26839376	26839377	+	3'UTR	INS	-	T	T	rs35706917		TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26839376_26839377insT	uc003acg.2	+	4						NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2						peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						ATTTCCTTAGATTTTTTTTTTT	0.416													9	4	---	---	---	---	
SMC1B	27127	broad.mit.edu	37	22	45750241	45750242	+	Intron	INS	-	GTATGTAT	GTATGTAT			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45750241_45750242insGTATGTAT	uc003bgc.2	-						SMC1B_uc003bgd.2_Intron	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes						chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GTTCTGATAGGgtatgtatgta	0.149													4	3	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1501563	1501564	+	3'UTR	INS	-	T	T			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1501563_1501564insT	uc004cps.2	+	12					IL3RA_uc011mhd.1_3'UTR	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGATAAAGTGATTTTTTTTTTT	0.426													5	5	---	---	---	---	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Translation_Start_Site	DEL	TCCTCGAGGCAGCC	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	uc010njt.2	-	1						NM_018159	NP_060629	Q96G61	NUD11_HUMAN	nudix-type motif 11							cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.584										HNSCC(48;0.14)			7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58827381	58827381	+	IGR	DEL	A	-	-			TCGA-CH-5791-01A-11D-1576-08	TCGA-CH-5791-10A-01D-1576-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58827381delA								None (None upstream) : None (None downstream)																							tttccattccatttgatttga	0.000													256	7	---	---	---	---	
