Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
UQCRHL	440567	broad.mit.edu	37	1	16133850	16133850	+	3'UTR	SNP	G	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16133850G>T	uc009vol.1	-	1						NM_001089591	NP_001083060			ubiquinol-cytochrome c reductase hinge												0						GAAGGCTGGGGTGAATTAAGT	0.423													26	185	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26699845	26699845	+	Missense_Mutation	SNP	G	A	A	rs150070091		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26699845G>A	uc002rhk.2	-	22	2717	c.2590C>T	c.(2590-2592)CGT>TGT	p.R864C	OTOF_uc002rhh.2_Missense_Mutation_p.R117C|OTOF_uc002rhi.2_Missense_Mutation_p.R174C|OTOF_uc002rhj.2_Missense_Mutation_p.R117C	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	864	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGGGCACACGGGCATAGGCG	0.612													6	59	---	---	---	---	PASS
CNRIP1	25927	broad.mit.edu	37	2	68520911	68520911	+	3'UTR	SNP	C	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68520911C>A	uc002sek.3	-	3					CNRIP1_uc002sej.3_Intron|CNRIP1_uc002sem.1_RNA|CNRIP1_uc002sel.3_RNA	NM_015463	NP_056278	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1								protein binding			liver(1)	1						AATGGTGTGGCATGCCTTGTT	0.433													9	39	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74040747	74040747	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74040747C>A	uc002sjr.1	+	2	362	c.241C>A	c.(241-243)CAG>AAG	p.Q81K		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	81	Ser-rich.									ovary(2)	2						AGCATGGCTACAGCCATCAGC	0.532													4	53	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141259355	141259355	+	Silent	SNP	G	A	A	rs148504930		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141259355G>A	uc002tvj.1	-	55	9723	c.8751C>T	c.(8749-8751)GGC>GGT	p.G2917G		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2917	Extracellular (Potential).|LDL-receptor class A 20.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGAACCATCGCCACAGTCAT	0.408										TSP Lung(27;0.18)			6	103	---	---	---	---	PASS
GLS	2744	broad.mit.edu	37	2	191785692	191785692	+	Intron	SNP	G	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191785692G>T	uc002usf.2	+						GLS_uc002use.2_Intron|GLS_uc002usg.1_5'UTR|GLS_uc002ush.2_5'UTR	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	ATATTGGCTTGAAACTTAACT	0.249													5	12	---	---	---	---	PASS
AGGF1	55109	broad.mit.edu	37	5	76332463	76332463	+	Missense_Mutation	SNP	C	A	A	rs78273685		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76332463C>A	uc003ket.2	+	4	959	c.599C>A	c.(598-600)GCG>GAG	p.A200E	AGGF1_uc003keu.1_RNA	NM_018046	NP_060516	Q8N302	AGGF1_HUMAN	angiogenic factor VG5Q	200					angiogenesis|cell adhesion|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|RNA processing|vasculogenesis	extracellular region|perinuclear region of cytoplasm	eukaryotic cell surface binding|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		GCAGCAGAAGCGGCTGTATCA	0.398													8	177	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140605445	140605445	+	Nonsense_Mutation	SNP	C	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140605445C>T	uc003ljb.2	+	1	2368	c.2368C>T	c.(2368-2370)CGA>TGA	p.R790*	PCDHB14_uc011dal.1_Nonsense_Mutation_p.R637*	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	790	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAGAACTTTCGAAATAGCTT	0.343													13	130	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32948548	32948548	+	3'UTR	SNP	A	C	C			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32948548A>C	uc003ocn.3	+	13					BRD2_uc003ocq.3_3'UTR|BRD2_uc003ocp.3_3'UTR|BRD2_uc010juh.2_3'UTR	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2						spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						CCCCTAGACCACCCTGCCCCA	0.637													7	27	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57393112	57393112	+	Silent	SNP	T	C	C	rs11964288	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57393112T>C	uc003pdx.2	+	9	849	c.762T>C	c.(760-762)AGT>AGC	p.S254S		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	254					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttaaaGTCATTCCTACA	0.259													3	13	---	---	---	---	PASS
FZD3	7976	broad.mit.edu	37	8	28385111	28385111	+	Silent	SNP	A	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28385111A>T	uc003xgx.2	+	5	1312	c.834A>T	c.(832-834)ACA>ACT	p.T278T	FZD3_uc010lvb.2_Silent_p.T278T	NM_017412	NP_059108	Q9NPG1	FZD3_HUMAN	frizzled 3 precursor	278	Extracellular (Potential).				canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		CCACAGTGACACAAGGATCTC	0.388													9	206	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62212651	62212651	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62212651G>T	uc003xuh.2	+	2	589	c.265G>T	c.(265-267)GAT>TAT	p.D89Y	CLVS1_uc003xug.2_Missense_Mutation_p.D89Y|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Missense_Mutation_p.D89Y	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	89					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						TCACCAAGCGGATGCCTTTAG	0.483													5	91	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106814115	106814115	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106814115C>T	uc003ymd.2	+	8	1828	c.1805C>T	c.(1804-1806)ACC>ATC	p.T602I	ZFPM2_uc011lhs.1_Missense_Mutation_p.T333I	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	602					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ACTGGCCAAACCTCCATAAAC	0.458													16	179	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68414303	68414303	+	RNA	SNP	T	G	G	rs74823923		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68414303T>G	uc004aex.2	+	1		c.858T>G								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		tctctcactttaagtccagag	0.109													3	9	---	---	---	---	PASS
HSD17B3	3293	broad.mit.edu	37	9	99015189	99015189	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99015189C>T	uc004awa.1	-	4	329	c.281G>A	c.(280-282)CGG>CAG	p.R94Q	HSD17B3_uc010msc.1_Missense_Mutation_p.R94Q	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3	94					androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	CCCTGTAGTCCGCTCTACACG	0.423													15	288	---	---	---	---	PASS
ACBD7	414149	broad.mit.edu	37	10	15120540	15120540	+	Missense_Mutation	SNP	A	C	C			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15120540A>C	uc001inv.2	-	4	304	c.256T>G	c.(256-258)TAC>GAC	p.Y86D	ACBD7_uc010qby.1_Intron	NM_001039844	NP_001034933	Q8N6N7	ACBD7_HUMAN	acyl-Coenzyme A binding domain containing 7	86	ACB.						fatty-acyl-CoA binding				0						TAAATTCCGTATTTTTCTATC	0.393													20	212	---	---	---	---	PASS
FAM21B	55747	broad.mit.edu	37	10	47909792	47909792	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47909792C>T	uc009xni.2	+	11	889	c.889C>T	c.(889-891)CGG>TGG	p.R297W	FAM21B_uc001jep.3_Missense_Mutation_p.R192W	NM_018232	NP_060702	Q5SNT6	FA21B_HUMAN	hypothetical protein LOC55747	297					retrograde transport, endosome to Golgi	early endosome membrane|WASH complex				ovary(1)	1						CCCCCAGGATCGGCAAGCTGG	0.498													4	59	---	---	---	---	PASS
RAG1	5896	broad.mit.edu	37	11	36597450	36597450	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36597450G>A	uc001mwu.3	+	2	2720	c.2596G>A	c.(2596-2598)GTG>ATG	p.V866M	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	866					histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				CAAAGAGACTGTGGATGCAGT	0.493									Familial_Hemophagocytic_Lymphohistiocytosis				8	116	---	---	---	---	PASS
FZD10	11211	broad.mit.edu	37	12	130647553	130647553	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130647553C>A	uc001uii.2	+	1	522	c.66C>A	c.(64-66)AGC>AGA	p.S22R	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	22	Extracellular (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CCGCCATCAGCTCCATGGACA	0.667													4	11	---	---	---	---	PASS
WASH3P	374666	broad.mit.edu	37	15	102515335	102515335	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102515335C>G	uc002cdi.2	+	9	1979	c.559C>G	c.(559-561)CTG>GTG	p.L187V	WASH3P_uc002cdl.2_Missense_Mutation_p.L187V|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.L187V|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						GGAGCGAAAGCTGGAGAAGAA	0.652													4	17	---	---	---	---	PASS
OR7A17	26333	broad.mit.edu	37	19	14991753	14991753	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14991753G>A	uc010xob.1	-	1	415	c.415C>T	c.(415-417)CGG>TGG	p.R139W		NM_030901	NP_112163	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Ovarian(108;0.203)					CCACAGAGCCGAGGGTTCATG	0.498													14	135	---	---	---	---	PASS
PBX4	80714	broad.mit.edu	37	19	19681601	19681601	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19681601C>T	uc002nmy.2	-	3	236	c.235G>A	c.(235-237)GCC>ACC	p.A79T	PBX4_uc010xqz.1_RNA|PBX4_uc010xra.1_5'UTR	NM_025245	NP_079521	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4	79							sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2						AGGAGCTGGGCGTCAGGGGGA	0.562													6	83	---	---	---	---	PASS
MDS2	259283	broad.mit.edu	37	1	23908221	23908221	+	Intron	DEL	C	-	-	rs10634856		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23908221delC	uc001bhi.3	+											Homo sapiens MDS2 gene.											ovary(2)	2						AGGCTCAAttctttttttttt	0.119			T	ETV6	MDS								11	6	---	---	---	---	
TINAGL1	64129	broad.mit.edu	37	1	32044601	32044602	+	Intron	DEL	GT	-	-	rs28555101		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32044601_32044602delGT	uc001bta.2	+						TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Intron|TINAGL1_uc010ogj.1_Intron|TINAGL1_uc010ogk.1_Intron	NM_022164	NP_071447	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1						endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		GTGACAGCTGgtgtgtgtgtgt	0.233													2	4	---	---	---	---	
AKNAD1	254268	broad.mit.edu	37	1	109391939	109391940	+	Intron	INS	-	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109391939_109391940insA	uc001dwa.2	-						AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_Intron	NM_152763	NP_689976	Q5T1N1	AKND1_HUMAN	hypothetical protein LOC254268											ovary(3)	3						cccacatctacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145368208	145368213	+	Intron	DEL	TCTCTG	-	-	rs72354261		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145368208_145368213delTCTCTG	uc001end.3	+						NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GGTCACTTTCtctctgtctctgtctc	0.320													6	3	---	---	---	---	
SPRR2D	6703	broad.mit.edu	37	1	153015760	153015761	+	5'Flank	INS	-	AT	AT	rs1750310		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153015760_153015761insAT	uc001fbb.2	-						SPRR2D_uc009wnz.2_Intron	NM_006945	NP_008876	P22532	SPR2D_HUMAN	small proline-rich protein 2D						keratinization	cornified envelope|cytoplasm					0	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			cacacacacacCCCTCATGGGT	0.337													4	2	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766826	206766827	+	Intron	DEL	GA	-	-	rs113332386		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766826_206766827delGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagcgcgagagagagaga	0.213													7	8	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	-	-	rs35817759		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240255569_240255571delGGC	uc010pyd.1	+	1	385_387	c.160_162delGGC	c.(160-162)GGCdel	p.G59del	FMN2_uc010pye.1_In_Frame_Del_p.G59del	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	59					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.557													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34146643	34146646	+	IGR	DEL	TATG	-	-	rs74708446	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34146643_34146646delTATG								MYADML (193359 upstream) : None (None downstream)																							cacacacacatatgcacacacaca	0.373													4	3	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54131014	54131015	+	Intron	INS	-	T	T	rs72533956		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54131014_54131015insT	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			attaaaaaaaagaacagatatg	0.069													4	4	---	---	---	---	
GCC2	9648	broad.mit.edu	37	2	109067337	109067337	+	Intron	DEL	C	-	-	rs12468089	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109067337delC	uc002tec.2	+						GCC2_uc002ted.2_Intron	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2						Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						gactctgtctcaaaaaaaaaa	0.144													4	2	---	---	---	---	
CDCA7	83879	broad.mit.edu	37	2	174229327	174229328	+	Intron	INS	-	TAT	TAT	rs143428036	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174229327_174229328insTAT	uc002uid.1	+						CDCA7_uc002uic.1_Intron|CDCA7_uc010zej.1_Intron|CDCA7_uc010zek.1_Intron	NM_145810	NP_665809	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7 isoform 2						regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.116)			ACTGGGCTTGGTATTACAAAAG	0.302													6	3	---	---	---	---	
INPP5D	3635	broad.mit.edu	37	2	234103862	234103863	+	Intron	INS	-	A	A	rs151215689	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234103862_234103863insA	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		tggatccactgcaggcataact	0.158													3	3	---	---	---	---	
SNED1	25992	broad.mit.edu	37	2	241992218	241992218	+	Intron	DEL	G	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241992218delG	uc002wah.1	+							NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GGTAAGGCCTGGGGGGCCCAA	0.657													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180605394	180605395	+	IGR	INS	-	T	T			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180605394_180605395insT								CCDC39 (149732 upstream) : FXR1 (25057 downstream)																							TTTGACTAAGGTTTTTTTTTTT	0.272													4	2	---	---	---	---	
KIAA1530	57654	broad.mit.edu	37	4	1348691	1348692	+	Intron	INS	-	G	G	rs138445940	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1348691_1348692insG	uc003gde.3	+							NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654												0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			GTGCCATGCATGGGGGGGGTCC	0.639													11	7	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21305687	21305692	+	Intron	DEL	AGAGAC	-	-	rs33955327	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21305687_21305692delAGAGAC	uc003gqh.1	-						KCNIP4_uc003gqf.1_5'Flank|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				agagagagagagagacagagagagag	0.194													7	4	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85658148	85658148	+	Intron	DEL	A	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85658148delA	uc003hpd.2	-							NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTCAGATGCtaaaaaaaaaaa	0.284													4	2	---	---	---	---	
TFAP2A	7020	broad.mit.edu	37	6	10415409	10415411	+	5'UTR	DEL	GAG	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10415409_10415411delGAG	uc003myr.2	-	1					TFAP2A_uc003myq.2_5'Flank|TFAP2A_uc003mys.2_RNA|TFAP2A_uc011dih.1_5'UTR|TFAP2A_uc003myt.2_Intron|TFAP2A_uc003myu.1_5'UTR|TFAP2A_uc003myv.1_5'Flank|TFAP2A_uc011dii.1_Intron|uc003myw.2_Intron|uc003myx.2_Intron|uc003myy.1_Intron	NM_003220	NP_003211	P05549	AP2A_HUMAN	transcription factor AP-2 alpha isoform a						ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				agaggagggcgaggaggaggagg	0.202											OREG0017182	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	11931274	11931275	+	IGR	INS	-	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11931274_11931275insA								C6orf105 (151994 upstream) : HIVEP1 (81449 downstream)																							gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26463977	26463979	+	Intron	DEL	TTG	-	-	rs71925201		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26463977_26463979delTTG	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron|BTN2A1_uc010jqk.1_5'Flank	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						AAACCtgtttttgttgttgttgt	0.315													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58776529	58776530	+	IGR	INS	-	A	A	rs9377903		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58776529_58776530insA								GUSBL2 (488805 upstream) : None (None downstream)																							atttccaagcggatatttagag	0.000													429	8	---	---	---	---	
TMEM30A	55754	broad.mit.edu	37	6	75974812	75974813	+	Intron	INS	-	G	G			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75974812_75974813insG	uc003phw.2	-						TMEM30A_uc003phx.2_Intron	NM_018247	NP_060717	Q9NV96	CC50A_HUMAN	transmembrane protein 30A isoform 1							integral to membrane					0						gactccatctcGGGGGGAAAAA	0.149													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	97917073	97917076	+	Intron	DEL	CTTC	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97917073_97917076delCTTC	uc003ppd.1	+											Homo sapiens cDNA FLJ34046 fis, clone FCBBF2007610.																		gcctccctttcttccttccttcct	0.206													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	138156122	138156123	+	Intron	INS	-	AGGC	AGGC	rs56232106	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138156122_138156123insAGGC	uc003qhq.1	-											Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796.																		ggaaggaaggaaggcaggctct	0.035													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61968770	61968770	+	IGR	DEL	G	-	-	rs61713499		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61968770delG								None (None upstream) : LOC643955 (782902 downstream)																							ttgaaacactgtttttgcgga	0.000													270	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150606830	150606831	+	IGR	INS	-	G	G	rs146968730		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150606830_150606831insG								ABP1 (48451 upstream) : KCNH2 (35219 downstream)																							gtggtgtgtgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
GALNT11	63917	broad.mit.edu	37	7	151800066	151800067	+	Intron	INS	-	A	A	rs139499307		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151800066_151800067insA	uc010lqg.1	+						GALNT11_uc011kvm.1_Intron|GALNT11_uc003wku.2_Intron|GALNT11_uc003wkv.1_Intron|GALNT11_uc011kvn.1_Intron	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	N-acetylgalactosaminyltransferase 11							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		gactccgtctcaaaaaaaaaaa	0.193													11	6	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48614649	48614660	+	Intron	DEL	TCTCTCTCTCTT	-	-	rs3885622	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48614649_48614660delTCTCTCTCTCTT	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				tctctctctctctctctctctTacacacacac	0.170													4	2	---	---	---	---	
COLEC10	10584	broad.mit.edu	37	8	120103625	120103625	+	Intron	DEL	A	-	-	rs33915063		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120103625delA	uc003yoo.2	+							NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor							collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			aatctctaccaaaaaaaaaaa	0.000													3	5	---	---	---	---	
SUGT1P1	441394	broad.mit.edu	37	9	33449647	33449649	+	Intron	DEL	AAA	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33449647_33449649delAAA	uc010mjq.1	-						AQP3_uc003zsv.1_5'Flank|AQP3_uc003zsx.2_5'Flank|AQP3_uc010mju.2_5'Flank	NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0						actccatctcaaaaaaaaaaaaa	0.227													4	2	---	---	---	---	
SUSD1	64420	broad.mit.edu	37	9	114928204	114928206	+	Intron	DEL	AAG	-	-	rs10594519		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114928204_114928206delAAG	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0						gaagaaagaaaagaaagaaagaa	0.044													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42530673	42530674	+	IGR	INS	-	A	A	rs58302682		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42530673_42530674insA								None (None upstream) : LOC441666 (296641 downstream)																							tctctctaaagaacgttcaact	0.000													19	9	---	---	---	---	
C10orf11	83938	broad.mit.edu	37	10	77948694	77948695	+	Intron	DEL	AC	-	-	rs71914711		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77948694_77948695delAC	uc001jxi.2	+							NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					gattgcatgtacacacacacac	0.045													4	3	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93695546	93695546	+	Intron	DEL	T	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93695546delT	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				AAGTAAGAACTTTTTTTTTTC	0.328													78	7	---	---	---	---	
BTBD16	118663	broad.mit.edu	37	10	124034362	124034363	+	Intron	INS	-	A	A	rs145626712	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124034362_124034363insA	uc001lgc.1	+						BTBD16_uc001lgd.1_Intron	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16											skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				CACCTGCTTACAAAAAAAACAA	0.351													4	5	---	---	---	---	
BRSK2	9024	broad.mit.edu	37	11	1467277	1467291	+	Intron	DEL	GCTGGGCTGGGCTGG	-	-	rs141282726		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1467277_1467291delGCTGGGCTGGGCTGG	uc001lti.2	+						BRSK2_uc009ycv.1_Intron|BRSK2_uc001lth.1_Intron|BRSK2_uc001ltj.2_Intron|BRSK2_uc001ltk.2_Intron|BRSK2_uc001ltl.2_Intron|BRSK2_uc001ltm.2_Intron|BRSK2_uc001ltn.2_Intron|BRSK2_uc010qwx.1_Intron	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2						establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		actgggcttagctgggctgggctgggctgggcttg	0.265													4	2	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892815	76892816	+	Intron	INS	-	TTG	TTG			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892815_76892816insTTG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CTTCTCAAGtttttttttttgt	0.297													4	2	---	---	---	---	
CDON	50937	broad.mit.edu	37	11	125871412	125871413	+	Intron	DEL	AG	-	-	rs34580130		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125871412_125871413delAG	uc009zbw.2	-						CDON_uc001qdb.3_Intron|CDON_uc001qdc.3_Intron	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ATTTTGAGTCAGAGTTAATGAA	0.238													2	4	---	---	---	---	
ACSM4	341392	broad.mit.edu	37	12	7476751	7476752	+	Intron	INS	-	A	A			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7476751_7476752insA	uc001qsx.1	+							NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						gactctgtctcaaaaaaaaaaa	0.168													6	5	---	---	---	---	
AEBP2	121536	broad.mit.edu	37	12	19671151	19671152	+	Intron	DEL	TC	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19671151_19671152delTC	uc001ref.2	+						AEBP2_uc001ree.2_3'UTR|AEBP2_uc001reg.1_Intron	NM_001114176	NP_001107648	Q6ZN18	AEBP2_HUMAN	AE binding protein 2 isoform b						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					GTCAACCCCttctttttttttt	0.307													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145415	119145416	+	IGR	INS	-	TGGTGA	TGGTGA	rs28483306		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145415_119145416insTGGTGA								SUDS3 (289576 upstream) : SRRM4 (273980 downstream)																							gatggtgatggtggtggtggtg	0.000													5	4	---	---	---	---	
CHFR	55743	broad.mit.edu	37	12	133447138	133447138	+	Intron	DEL	T	-	-	rs11147125		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133447138delT	uc001ulf.2	-						CHFR_uc001ulc.1_Intron|CHFR_uc001ule.2_Intron|CHFR_uc010tbs.1_Intron|CHFR_uc001uld.2_Intron|CHFR_uc010tbt.1_Intron	NM_001161344	NP_001154816	Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains						cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		aaaaaaaaaaTgggagactga	0.000													36	7	---	---	---	---	
FAM177A1	283635	broad.mit.edu	37	14	35546674	35546674	+	Intron	DEL	C	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35546674delC	uc001wsp.2	+						FAM177A1_uc001wsq.2_Intron	NM_001079519	NP_001072987	Q8N128	F177A_HUMAN	hypothetical protein LOC283635 isoform 2												0						TTTTCAAGttctttttttttt	0.129													4	2	---	---	---	---	
ANKDD1A	348094	broad.mit.edu	37	15	65234868	65234868	+	Intron	DEL	A	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65234868delA	uc002aoa.2	+						ANKDD1A_uc002aoc.2_Intron|ANKDD1A_uc010bha.2_Intron	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1						TTGAGGAATCACTTTTTTTTT	0.373													4	2	---	---	---	---	
DPP8	54878	broad.mit.edu	37	15	65792757	65792757	+	Intron	DEL	A	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65792757delA	uc002aov.2	-						DPP8_uc002aow.2_Intron|DPP8_uc010uiv.1_Intron|DPP8_uc002aox.2_Intron|DPP8_uc002aoy.2_Intron|DPP8_uc002aoz.2_Intron|DPP8_uc010bhj.2_Intron|DPP8_uc002apa.2_Intron	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1						immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						attctgtctcaaaaaaaaaaa	0.149													6	3	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78316386	78316386	+	Intron	DEL	T	-	-	rs1992470	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78316386delT	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						GGAAAAAAAATAAGTGTGCAG	0.483													7	7	---	---	---	---	
TMC3	342125	broad.mit.edu	37	15	81636087	81636087	+	Intron	DEL	A	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81636087delA	uc002bgo.1	-						TMC3_uc010blr.1_Intron|TMC3_uc002bgp.2_Intron	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2						AAAAACAGACAAAAAAAAAAA	0.274													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1075451	1075474	+	IGR	DEL	GGTGTGGAGGGTGCTGAGGTCCCC	-	-	rs72269290	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1075451_1075474delGGTGTGGAGGGTGCTGAGGTCCCC								SOX8 (38473 upstream) : LOC146336 (38610 downstream)																							TGAGGTCCCTGGTGTGGAGGGTGCTGAGGTCCCCGGCTTGGAGG	0.701													4	2	---	---	---	---	
EARS2	124454	broad.mit.edu	37	16	23535968	23535968	+	Intron	DEL	T	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23535968delT	uc002dlt.3	-						EARS2_uc002dlr.3_Intron|EARS2_uc002dls.3_Intron	NM_001083614	NP_001077083	Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2 precursor						glutamyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|glutamate-tRNA ligase activity|RNA binding				0				GBM - Glioblastoma multiforme(48;0.0353)	L-Glutamic Acid(DB00142)	ACCACCGCCCttttttttttt	0.274													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46391827	46391849	+	IGR	DEL	GATGATTCCACTCGAGTCCATTC	-	-	rs9708865		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46391827_46391849delGATGATTCCACTCGAGTCCATTC								None (None upstream) : ANKRD26P1 (111400 downstream)																							tccattcgatgatgattccactcgagtccattcgatgattcca	0.000													60	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	50040205	50040220	+	IGR	DEL	AGAAAGAAAGAAAGAA	-	-	rs62792261	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50040205_50040220delAGAAAGAAAGAAAGAA								ZNF423 (179287 upstream) : TMEM188 (18969 downstream)																							agagagagagagaaagaaagaaagaaagaaagaaag	0.120													4	2	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15500091	15500094	+	Intron	DEL	AGTC	-	-	rs79640825		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15500091_15500094delAGTC	uc002gor.1	-						CDRT1_uc010vvy.1_Intron|CDRT1_uc010vvz.1_Intron|CDRT1_uc002gov.3_Intron|CDRT1_uc002gou.2_Intron|CDRT1_uc010cos.1_Intron			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GAGCCCATCAAGTCAGATTCTAGA	0.539													4	3	---	---	---	---	
TAOK1	57551	broad.mit.edu	37	17	27861114	27861115	+	Intron	DEL	TC	-	-	rs80075693		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27861114_27861115delTC	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			CTTTTTTTTTTCTCTCTCTCTC	0.416													37	7	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925055	47925058	+	Intron	DEL	ACAC	-	-	rs113382605		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925055_47925058delACAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						acacacacagacacacacacacac	0.191													3	4	---	---	---	---	
ITGA3	3675	broad.mit.edu	37	17	48157869	48157870	+	Intron	INS	-	GA	GA	rs2018134	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48157869_48157870insGA	uc010dbl.2	+						ITGA3_uc010dbm.2_Intron	NM_002204	NP_002195	P26006	ITA3_HUMAN	integrin alpha 3 isoform a precursor						blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity			ovary(2)|pancreas(1)	3						tgtgtgtgtgtgatttgcgtgt	0.282													4	3	---	---	---	---	
TUBD1	51174	broad.mit.edu	37	17	57963683	57963684	+	Intron	INS	-	A	A	rs113094238		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57963683_57963684insA	uc002ixw.1	-						TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Intron|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Intron|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin						cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			TGTCCAAATCCAAAAAAAAAAA	0.376													10	6	---	---	---	---	
ASXL3	80816	broad.mit.edu	37	18	31241861	31241862	+	Intron	INS	-	AA	AA	rs146967011	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31241861_31241862insAA	uc010dmg.1	+						ASXL3_uc002kxq.2_Intron	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TAATCTGTGATAAAAAAAAACT	0.302													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16823289	16823289	+	IGR	DEL	T	-	-	rs36044959		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16823289delT								TMEM38A (23475 upstream) : NWD1 (7498 downstream)																							tttcatttccttttttttttt	0.134													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35128512	35128512	+	Intron	DEL	A	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35128512delA	uc002nvo.1	-											Homo sapiens cDNA FLJ36176 fis, clone TESTI2026491.																		gcaaaatcataaaaaaaaaat	0.104													4	2	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50284995	50284997	+	Intron	DEL	CCT	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50284995_50284997delCCT	uc002ppn.2	+						AP2A1_uc010enj.1_Intron|AP2A1_uc002ppo.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CACTGCCTACCCTCCTCCTCCTC	0.606													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25900165	25900167	+	IGR	DEL	CAA	-	-			TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25900165_25900167delCAA								FAM182B (51379 upstream) : LOC100134868 (90268 downstream)																							CAGCAACCGCCAACAACTGTCCT	0.379													63	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44755913	44755914	+	IGR	INS	-	CAC	CAC	rs150119883	by1000genomes	TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44755913_44755914insCAC								CRYAA (163000 upstream) : SIK1 (78484 downstream)																							atcaccaccatcaccatcacca	0.000													5	4	---	---	---	---	
CELSR1	9620	broad.mit.edu	37	22	46877139	46877140	+	Intron	INS	-	A	A	rs112875441		TCGA-EJ-5502-01A-01D-1576-08	TCGA-EJ-5502-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46877139_46877140insA	uc003bhw.1	-							NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		gaccatgtctcaaaaaaaaaaa	0.163													3	3	---	---	---	---	
