Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
LPHN2	23266	broad.mit.edu	37	1	82409004	82409004	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82409004A>G	uc001dit.3	+	6	930	c.749A>G	c.(748-750)TAC>TGC	p.Y250C	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.Y250C|LPHN2_uc001div.2_Missense_Mutation_p.Y250C|LPHN2_uc009wcd.2_Missense_Mutation_p.Y250C	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	250	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TATGCCAACTACCATGATACC	0.403													30	130	---	---	---	---	PASS
NEK7	140609	broad.mit.edu	37	1	198233329	198233329	+	Silent	SNP	A	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198233329A>G	uc001gun.3	+	5	663	c.336A>G	c.(334-336)GAA>GAG	p.E112E		NM_133494	NP_598001	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	112	Protein kinase.					cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4						TAGTTTTGGAACTAGCAGATG	0.299													25	201	---	---	---	---	PASS
AGT	183	broad.mit.edu	37	1	230838910	230838910	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230838910C>A	uc001hty.3	-	5	1943	c.1435G>T	c.(1435-1437)GCC>TCC	p.A479S	AGT_uc009xfe.2_3'UTR|AGT_uc009xff.2_Missense_Mutation_p.A451S	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	479					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	AGCGGGTTGGCCACGCGGCCC	0.607													7	92	---	---	---	---	PASS
ALLC	55821	broad.mit.edu	37	2	3743215	3743215	+	Intron	SNP	G	C	C			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3743215G>C	uc010ewt.2	+						ALLC_uc002qyf.2_5'UTR	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a								allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		cCTACCAAGAGATGACACTGG	0.234										HNSCC(21;0.051)			4	23	---	---	---	---	PASS
FAHD2B	151313	broad.mit.edu	37	2	97749338	97749338	+	3'UTR	SNP	C	A	A	rs114539294	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97749338C>A	uc002sxm.2	-	8						NM_199336	NP_955368	Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing								hydrolase activity|metal ion binding				0						TGACCCGACGCATTTATTGAA	0.542													3	12	---	---	---	---	PASS
MCM6	4175	broad.mit.edu	37	2	136610460	136610460	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136610460C>T	uc002tuw.2	-	12	1728	c.1652G>A	c.(1651-1653)CGC>CAC	p.R551H		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	551	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	ATCTACTATGCGCCTGGCAAT	0.368													23	112	---	---	---	---	PASS
ATXN7	6314	broad.mit.edu	37	3	63898514	63898514	+	Silent	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63898514G>A	uc003dlw.3	+	3	793	c.240G>A	c.(238-240)GAG>GAA	p.E80E	ATXN7_uc003dlv.2_Silent_p.E80E|ATXN7_uc010hnv.2_Silent_p.E80E|ATXN7_uc010hnu.1_RNA	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	80					cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		CGGTCGGGGAGCGCAGGCCTC	0.433													6	29	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64554181	64554181	+	Nonsense_Mutation	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64554181G>A	uc003dmg.2	-	29	4419	c.4387C>T	c.(4387-4389)CAA>TAA	p.Q1463*	ADAMTS9_uc011bfo.1_Nonsense_Mutation_p.Q1435*|ADAMTS9_uc003dmh.1_Nonsense_Mutation_p.Q1292*|ADAMTS9_uc011bfp.1_Nonsense_Mutation_p.Q374*|uc003dmi.1_Intron	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1463	TSP type-1 11.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		ACATTTCGTTGTTTATGCCCT	0.428													32	153	---	---	---	---	PASS
LOC220729	220729	broad.mit.edu	37	3	197349110	197349110	+	Intron	SNP	T	C	C			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197349110T>C	uc011bug.1	-						LOC220729_uc003fxw.2_RNA|LOC220729_uc003fxy.2_RNA|LOC220729_uc010iao.1_Intron					Homo sapiens cDNA FLJ60865 complete cds, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC 1.3.5.1).												0						GGCATCCTGGTCCCCCAGCCA	0.587													4	15	---	---	---	---	PASS
NCAPG	64151	broad.mit.edu	37	4	17845238	17845238	+	3'UTR	SNP	G	C	C	rs7688403	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17845238G>C	uc003gpp.2	+	21					NCAPG_uc011bxj.1_3'UTR|LCORL_uc003gpq.2_3'UTR|LCORL_uc011bxk.1_3'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		CAGAAAAAGTGTGCATCAGTC	0.284													4	7	---	---	---	---	PASS
NCAPG	64151	broad.mit.edu	37	4	17845241	17845241	+	3'UTR	SNP	C	T	T	rs77416591	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17845241C>T	uc003gpp.2	+	21					NCAPG_uc011bxj.1_3'UTR|LCORL_uc003gpq.2_3'UTR|LCORL_uc011bxk.1_3'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		AAAAAGTGTGCATCAGTCAGT	0.274													4	7	---	---	---	---	PASS
C6orf218	221718	broad.mit.edu	37	6	10430010	10430010	+	RNA	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10430010G>A	uc003myz.2	-	3		c.1026C>T				NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)				GTAGAGGCTAGAACTGGAATT	0.368											OREG0017184	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	18	---	---	---	---	PASS
BTN2A3	54718	broad.mit.edu	37	6	26428149	26428149	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26428149A>G	uc011dkl.1	+	4	787	c.757A>G	c.(757-759)ATG>GTG	p.M253V	BTN2A3_uc011dkm.1_RNA					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0						GCCTGTTATCATGATTATTCT	0.428													67	236	---	---	---	---	PASS
OR2B2	81697	broad.mit.edu	37	6	27879450	27879450	+	Silent	SNP	T	G	G	rs147063988	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27879450T>G	uc011dkw.1	-	1	648	c.648A>C	c.(646-648)ATA>ATC	p.I216I		NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AAGCATACGATATAAGGATGA	0.443													6	169	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33138676	33138676	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33138676C>T	uc003ocx.1	-	46	3613	c.3385G>A	c.(3385-3387)GGA>AGA	p.G1129R	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.G1043R|COL11A2_uc003ocz.1_Missense_Mutation_p.G1022R	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1129	Triple-helical region.			EPGARGP -> GAGGLGT (in Ref. 6; AAA52034).	cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						CCCCGAGCTCCGGGCTCCCCA	0.577													8	141	---	---	---	---	PASS
RPS18	6222	broad.mit.edu	37	6	33243782	33243782	+	Missense_Mutation	SNP	A	G	G	rs144855906	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33243782A>G	uc003odp.1	+	4	275	c.230A>G	c.(229-231)TAC>TGC	p.Y77C	RPS18_uc010jum.1_RNA|RPS18_uc003odq.1_RNA|B3GALT4_uc003odr.2_5'Flank	NM_022551	NP_072045	P62269	RS18_HUMAN	ribosomal protein S18	77					endocrine pancreas development|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	rRNA binding|structural constituent of ribosome				0						CCACGCCAGTACAAGATCCCA	0.517													4	74	---	---	---	---	PASS
IGF2BP3	10643	broad.mit.edu	37	7	23353160	23353160	+	Missense_Mutation	SNP	A	G	G	rs79900450	byFrequency	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23353160A>G	uc003swg.2	-	13	1774	c.1508T>C	c.(1507-1509)ATT>ACT	p.I503T	IGF2BP3_uc003swf.2_Missense_Mutation_p.I122T	NM_006547	NP_006538	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding	503	KH 4.				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2						TCCTTTTCCAATAACTCTGCC	0.408													5	203	---	---	---	---	PASS
C9orf125	84302	broad.mit.edu	37	9	104239189	104239189	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104239189G>T	uc004bbm.2	-	2	508	c.186C>A	c.(184-186)AGC>AGA	p.S62R	uc004bbl.1_5'Flank	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	62						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)				GGAACTCTTGGCTCATTTGGT	0.547													30	91	---	---	---	---	PASS
FBXO18	84893	broad.mit.edu	37	10	5979235	5979235	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5979235G>A	uc001iis.2	+	21	3219	c.3124G>A	c.(3124-3126)GTC>ATC	p.V1042I	FBXO18_uc001iir.2_Missense_Mutation_p.V985I|FBXO18_uc009xig.2_Missense_Mutation_p.V968I|FBXO18_uc001iit.2_Missense_Mutation_p.V1093I	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2	1042					DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						GCTCTTCCTCGTCTTCTGAGG	0.657													3	22	---	---	---	---	PASS
TRDMT1	1787	broad.mit.edu	37	10	17204221	17204221	+	Silent	SNP	A	C	C			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17204221A>C	uc001iop.2	-	4	315	c.267T>G	c.(265-267)GGT>GGG	p.G89G	TRDMT1_uc001ioq.2_Intron|TRDMT1_uc001ior.2_Intron|TRDMT1_uc001ios.2_Silent_p.G18G|TRDMT1_uc009xjt.2_Silent_p.G30G|TRDMT1_uc010qcc.1_Silent_p.G18G|TRDMT1_uc010qcd.1_Intron|TRDMT1_uc009xjs.1_Intron|TRDMT1_uc009xju.1_Intron	NM_004412	NP_004403	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1 isoform	89					tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1						CAGTCATATCACCCTGCCGGC	0.313													14	150	---	---	---	---	PASS
CCDC7	221016	broad.mit.edu	37	10	32856778	32856778	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32856778G>A	uc001iwj.2	+	16	1948	c.1378G>A	c.(1378-1380)GGT>AGT	p.G460S	CCDC7_uc001iwk.2_Missense_Mutation_p.G460S|CCDC7_uc009xlv.2_RNA|C10orf68_uc001iwl.1_5'UTR|C10orf68_uc001iwm.1_5'UTR|C10orf68_uc001iwn.3_5'UTR	NM_145023	NP_659460	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	460											0		Breast(68;0.000207)|Prostate(175;0.0107)				TTCAGATTCAGGTGGACAAAG	0.328													9	89	---	---	---	---	PASS
CCDC7	221016	broad.mit.edu	37	10	32856779	32856779	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32856779G>T	uc001iwj.2	+	16	1949	c.1379G>T	c.(1378-1380)GGT>GTT	p.G460V	CCDC7_uc001iwk.2_Missense_Mutation_p.G460V|CCDC7_uc009xlv.2_RNA|C10orf68_uc001iwl.1_5'UTR|C10orf68_uc001iwm.1_5'UTR|C10orf68_uc001iwn.3_5'UTR	NM_145023	NP_659460	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	460											0		Breast(68;0.000207)|Prostate(175;0.0107)				TCAGATTCAGGTGGACAAAGG	0.328													9	89	---	---	---	---	PASS
ADRA2A	150	broad.mit.edu	37	10	112838922	112838922	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112838922G>T	uc001kzo.2	+	1	2133	c.1168G>T	c.(1168-1170)GTG>TTG	p.V390L		NM_000681	NP_000672	P08913	ADA2A_HUMAN	alpha-2A-adrenergic receptor	375	Helical; Name=6; (By similarity).				actin cytoskeleton organization|activation of MAPK activity by adrenergic receptor signaling pathway|activation of phospholipase C activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cellular component movement|cellular response to hormone stimulus|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|glucose homeostasis|inhibition of adenylate cyclase activity by adrenergic receptor signaling pathway|intestinal absorption|negative regulation of adrenergic receptor signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cAMP biosynthetic process|negative regulation of epinephrine secretion|negative regulation of insulin secretion involved in cellular response to glucose stimulus|negative regulation of lipid catabolic process|negative regulation of norepinephrine secretion|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cytokine production|positive regulation of membrane protein ectodomain proteolysis|positive regulation of potassium ion transport|positive regulation of wound healing|Rho protein signal transduction	basolateral plasma membrane|cytoplasm|integral to plasma membrane|receptor complex	alpha-1B adrenergic receptor binding|alpha-2C adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|heterotrimeric G-protein binding|norepinephrine binding|protein heterodimerization activity|protein homodimerization activity|protein kinase binding|thioesterase binding				0		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amphetamine(DB00182)|Apraclonidine(DB00964)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Clonidine(DB00575)|Debrisoquin(DB04840)|Dexmedetomidine(DB00633)|Dipivefrin(DB00449)|Epinastine(DB00751)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Guanfacine(DB01018)|Lofexidine(DB04948)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Norepinephrine(DB00368)|Oxymetazoline(DB00935)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Tizanidine(DB00697)|Trazodone(DB00656)|Yohimbine(DB01392)	CTTCACGTTCGTGCTGGCCGT	0.697													20	51	---	---	---	---	PASS
API5	8539	broad.mit.edu	37	11	43345105	43345105	+	Silent	SNP	A	C	C			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43345105A>C	uc010rfh.1	+	6	842	c.669A>C	c.(667-669)CTA>CTC	p.L223L	API5_uc010rfg.1_Silent_p.L212L|API5_uc001mxf.2_Silent_p.L223L|API5_uc010rfi.1_Silent_p.L169L|API5_uc001mxg.2_Silent_p.L97L	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5 isoform a	223					anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						AGGCCGACCTAGAACAGACCT	0.463													34	158	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70319095	70319095	+	Missense_Mutation	SNP	T	C	C			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70319095T>C	uc001oqc.2	-	22	5507	c.5429A>G	c.(5428-5430)AAT>AGT	p.N1810S	SHANK2_uc010rqn.1_Missense_Mutation_p.N1222S|SHANK2_uc001opz.2_Missense_Mutation_p.N1215S|uc009ysn.1_5'UTR|SHANK2_uc001opy.2_Missense_Mutation_p.N146S	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1431	SAM.				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			ATCGATCTCATTGTCCATGAA	0.478													55	245	---	---	---	---	PASS
CARD16	114769	broad.mit.edu	37	11	104915235	104915235	+	Missense_Mutation	SNP	T	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104915235T>G	uc001pip.1	-	2	185	c.158A>C	c.(157-159)AAG>ACG	p.K53T	CASP1_uc010rve.1_Intron|CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CARD16_uc001pio.1_Missense_Mutation_p.K53T	NM_001017534	NP_001017534	Q5EG05	CAR16_HUMAN	caspase-1 dominant-negative inhibitor pseudo-ICE	53	CARD.				regulation of apoptosis	intracellular	cysteine-type endopeptidase inhibitor activity			skin(1)	1						AGCTCGGGTCTTATCCATAAC	0.428													96	447	---	---	---	---	PASS
YARS2	51067	broad.mit.edu	37	12	32908717	32908717	+	Missense_Mutation	SNP	G	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32908717G>T	uc001rli.2	-	1	158	c.92C>A	c.(91-93)GCC>GAC	p.A31D		NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	31					tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	GCCCGAGTGGGCCTTACGCAG	0.602											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	74	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43777766	43777766	+	Silent	SNP	A	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43777766A>G	uc010skx.1	-	30	4467	c.4467T>C	c.(4465-4467)TGT>TGC	p.C1489C		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1489	TSP type-1 12.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTCCAGAGCCACAGGTCACAG	0.413													4	56	---	---	---	---	PASS
KRT78	196374	broad.mit.edu	37	12	53238473	53238473	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53238473G>A	uc001sbc.1	-	5	855	c.791C>T	c.(790-792)ACG>ATG	p.T264M		NM_173352	NP_775487	Q8N1N4	K2C78_HUMAN	keratin 5b	264	Linker 12.|Rod.					keratin filament	protein binding|structural molecule activity			ovary(2)	2						CACCACAGACGTGTCGCTGGC	0.622													15	77	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120150460	120150460	+	Silent	SNP	G	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120150460G>T	uc001txi.1	-	35	4547	c.4494C>A	c.(4492-4494)CCC>CCA	p.P1498P	CIT_uc001txh.1_Silent_p.P1017P|CIT_uc001txj.1_Silent_p.P1540P	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1498	PH.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CATCCCCGTCGGGAAGGCACA	0.443													4	113	---	---	---	---	PASS
RPLP0	6175	broad.mit.edu	37	12	120635152	120635152	+	Silent	SNP	C	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120635152C>T	uc001txp.2	-	7	1002	c.765G>A	c.(763-765)ACG>ACA	p.T255T	GCN1L1_uc001txo.2_5'Flank|RPLP0_uc001txq.2_Silent_p.T255T|RPLP0_uc001txr.2_Silent_p.T193T	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	255					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGTGTAATCCGTCTCCACAG	0.507													17	79	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19415783	19415783	+	RNA	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19415783G>A	uc010tcj.1	-	1		c.30327C>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						AGCAGCAGAAGATGTACTATG	0.299													3	81	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39357242	39357242	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39357242G>A	uc001uwv.2	+	5	5986	c.5677G>A	c.(5677-5679)GTT>ATT	p.V1893I	FREM2_uc001uww.2_5'UTR	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	1893	Extracellular (Potential).|Calx-beta 2.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CAAATACTCCGTTGAAGAAGA	0.438													58	205	---	---	---	---	PASS
TM9SF2	9375	broad.mit.edu	37	13	100206634	100206634	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100206634C>T	uc001voj.1	+	14	1698	c.1565C>T	c.(1564-1566)CCT>CTT	p.P522L	TM9SF2_uc010afz.1_Missense_Mutation_p.P357L	NM_004800	NP_004791	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2 precursor	522	Cytoplasmic (Potential).				transport	endosome membrane|integral to plasma membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					AAGCCCTTGCCTGGTATTATC	0.418													43	154	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109779876	109779876	+	Silent	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109779876G>A	uc001vqt.1	+	31	4089	c.3963G>A	c.(3961-3963)GCG>GCA	p.A1321A	MYO16_uc010agk.1_Silent_p.A1343A|MYO16_uc010tjh.1_Silent_p.A833A	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1321					cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GCCTCTCCGCGGCCAGGGAAG	0.687													3	23	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28459325	28459325	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28459325C>T	uc001zbj.2	-	41	6558	c.6452G>A	c.(6451-6453)CGC>CAC	p.R2151H		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2151					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTGCAGCGTGCGCAGCAGTGC	0.637													5	123	---	---	---	---	PASS
TEKT1	83659	broad.mit.edu	37	17	6716186	6716186	+	Missense_Mutation	SNP	C	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6716186C>G	uc002gdt.2	-	6	926	c.816G>C	c.(814-816)AAG>AAC	p.K272N	TEKT1_uc010vth.1_Missense_Mutation_p.K126N	NM_053285	NP_444515	Q969V4	TEKT1_HUMAN	tektin 1	272	Potential.				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|skin(1)	2		Myeloproliferative disorder(207;0.0255)				CCCTGGCATCCTTTGTATCCT	0.527													32	158	---	---	---	---	PASS
ZPBP2	124626	broad.mit.edu	37	17	38033277	38033277	+	3'UTR	SNP	A	C	C	rs57151617	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38033277A>C	uc002hte.2	+	8					ZPBP2_uc002htf.2_3'UTR	NM_199321	NP_955353	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2 isoform 2						binding of sperm to zona pellucida	extracellular region				ovary(1)	1	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			TTGAAGTTTTAATGGATTATT	0.284													5	2	---	---	---	---	PASS
LRRC37A2	474170	broad.mit.edu	37	17	44630768	44630768	+	Missense_Mutation	SNP	A	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630768A>G	uc002ikn.1	+	11	4815	c.4812A>G	c.(4810-4812)ATA>ATG	p.I1604M	ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Missense_Mutation_p.I565M|ARL17A_uc002iks.2_3'UTR	NM_001006607	NP_001006608	A6NM11	L37A2_HUMAN	c114 SLIT-like testicular protein precursor	1604	Cytoplasmic (Potential).					integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TAAAACAGATATGTTGTCACC	0.284													5	231	---	---	---	---	PASS
GSK3A	2931	broad.mit.edu	37	19	42736723	42736723	+	Missense_Mutation	SNP	C	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42736723C>A	uc002otb.1	-	9	1329	c.1210G>T	c.(1210-1212)GAT>TAT	p.D404Y	GSK3A_uc002ota.1_Missense_Mutation_p.D322Y|GSK3A_uc002otc.2_RNA	NM_019884	NP_063937	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	404					insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of insulin receptor signaling pathway|negative regulation of transferase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process	beta-catenin destruction complex|cytosol	ATP binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|tau-protein kinase activity			ovary(2)|lung(2)	4		Prostate(69;0.00682)				CGCAGTTCATCAAAGAAGCTG	0.602													3	72	---	---	---	---	PASS
DYRK1A	1859	broad.mit.edu	37	21	38858790	38858790	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38858790G>A	uc002ywk.2	+	5	613	c.538G>A	c.(538-540)GTG>ATG	p.V180M	DYRK1A_uc002ywh.1_Missense_Mutation_p.V142M|DYRK1A_uc002ywi.2_Missense_Mutation_p.V180M|DYRK1A_uc002ywj.2_Missense_Mutation_p.V171M|DYRK1A_uc002ywl.2_Missense_Mutation_p.V180M|DYRK1A_uc002ywm.2_Missense_Mutation_p.V180M|DYRK1A_uc011aei.1_5'Flank	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	180	Protein kinase.				nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4						ATATGATCGTGTGGAGCAAGA	0.308													36	167	---	---	---	---	PASS
KRTAP10-6	386674	broad.mit.edu	37	21	46011324	46011324	+	Missense_Mutation	SNP	T	C	C	rs145117382	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46011324T>C	uc002zfm.2	-	1	1063	c.1042A>G	c.(1042-1044)ATG>GTG	p.M348V	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	348						keratin filament					0						CGGGAGCACATGGGGCGGCAG	0.682													4	55	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22664606	22664606	+	RNA	SNP	A	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22664606A>G	uc011aim.1	+	31		c.2121A>G			LOC96610_uc011aiq.1_RNA					Parts of antibodies, mostly variable regions.												0						GTCTTCATGCAAACTTGGTAT	0.398													3	33	---	---	---	---	PASS
CYP2D7P1	1564	broad.mit.edu	37	22	42537889	42537889	+	Missense_Mutation	SNP	T	C	C	rs2982056		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42537889T>C	uc003bci.2	-	5	943	c.562A>G	c.(562-564)AAG>GAG	p.K188E	CYP2D7P1_uc003bcg.2_5'Flank|CYP2D7P1_uc003bch.2_5'UTR|CYP2D7P1_uc010gyv.2_5'UTR|CYP2D7P1_uc010gyw.2_RNA|CYP2D7P1_uc010gyx.1_Missense_Mutation_p.K188E	NR_002570				SubName: Full=Cytochrome P450 2D6;          EC=1.14.14.1;												0						TTCTCCTTCTTTGCCAGGAAG	0.612													2	8	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37027785	37027785	+	Silent	SNP	C	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37027785C>T	uc004ddl.1	+	1	1316	c.1302C>T	c.(1300-1302)CGC>CGT	p.R434R		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	434										ovary(3)	3						CCAAGACTCGCGGATCTCATC	0.617													28	33	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70349258	70349258	+	Missense_Mutation	SNP	C	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70349258C>T	uc004dyy.2	+	26	3869	c.3670C>T	c.(3670-3672)CTC>TTC	p.L1224F	MED12_uc011mpq.1_Missense_Mutation_p.L1224F|MED12_uc004dyz.2_Missense_Mutation_p.L1224F|MED12_uc004dza.2_Missense_Mutation_p.L1071F|MED12_uc010nla.2_5'Flank	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1224					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GTTTGCTGTTCTCAAGGCTGT	0.562											OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	34	---	---	---	---	PASS
ZCCHC12	170261	broad.mit.edu	37	X	117959282	117959282	+	Missense_Mutation	SNP	G	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117959282G>A	uc004equ.2	+	4	548	c.75G>A	c.(73-75)ATG>ATA	p.M25I		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	25					regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1						CCCATTCCATGCTGAGGTCCC	0.433													25	46	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39833649	39833649	+	Intron	DEL	A	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39833649delA	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tctcaaaaggaaaaaaaaaaa	0.129													2	4	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43010889	43010889	+	Intron	DEL	A	-	-	rs141597374		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43010889delA	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						TGCCTATGGTAAAAAAAAAAT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	68708081	68708082	+	IGR	DEL	GT	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68708081_68708082delGT								WLS (9828 upstream) : RPE65 (186425 downstream)																							TAGCGTTTTAgtgtgtgtgtgt	0.243													4	2	---	---	---	---	
RPF1	80135	broad.mit.edu	37	1	84962250	84962252	+	Intron	DEL	AAA	-	-	rs72198353		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84962250_84962252delAAA	uc001djv.3	+							NM_025065	NP_079341	Q9H9Y2	RPF1_HUMAN	RNA processing factor 1						rRNA processing|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|rRNA binding				0						cccttgaactaaaaaaaaaaaaa	0.099													4	2	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114301137	114301137	+	Intron	DEL	T	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114301137delT	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc010own.1_Intron|PHTF1_uc001edp.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGTACATCTTTTTTTTTTT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214058323	214058324	+	Intron	INS	-	CACG	CACG			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214058323_214058324insCACG	uc001hkf.1	-											Homo sapiens cDNA FLJ34932 fis, clone NT2RP7005631.																		acacatgcacacacacacacac	0.342													4	2	---	---	---	---	
R3HDM1	23518	broad.mit.edu	37	2	136399544	136399544	+	Intron	DEL	T	-	-	rs11303510		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136399544delT	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		TCAGAAAGCATTTTTTTCCCC	0.284													4	2	---	---	---	---	
ARL8B	55207	broad.mit.edu	37	3	5213916	5213917	+	Intron	INS	-	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5213916_5213917insT	uc003bqg.2	+						ARL8B_uc011asx.1_Intron|ARL8B_uc011asy.1_Intron	NM_018184	NP_060654	Q9NVJ2	ARL8B_HUMAN	ADP-ribosylation factor-like 10C						cell cycle|cell division|chromosome segregation|small GTPase mediated signal transduction	late endosome membrane|lysosomal membrane|midbody|spindle midzone	alpha-tubulin binding|beta-tubulin binding|GDP binding|GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.0717)|Epithelial(13;0.0777)		TGTGTAAGTGGTTTTTTTTTGT	0.371													402	8	---	---	---	---	
SLC4A7	9497	broad.mit.edu	37	3	27445065	27445067	+	Intron	DEL	TAG	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27445065_27445067delTAG	uc003cdv.2	-						SLC4A7_uc011awu.1_Intron|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011aww.1_Intron|SLC4A7_uc011awx.1_Intron|SLC4A7_uc011awy.1_Intron|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Intron|SLC4A7_uc010hfl.2_Intron|SLC4A7_uc003cdw.2_Intron	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate							apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						ACTAGCTTATTAGTAGatttatt	0.232													4	2	---	---	---	---	
RBM6	10180	broad.mit.edu	37	3	50098186	50098187	+	Intron	INS	-	A	A	rs35467618		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50098186_50098187insA	uc003cyc.2	+						RBM6_uc010hlc.1_Intron|RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		gactccgtctcaaaaaaaaaaa	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	80006953	80006953	+	IGR	DEL	T	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80006953delT								ROBO1 (189894 upstream) : None (None downstream)																							TTCTCCCAGGTTCGTCACAAC	0.438													4	2	---	---	---	---	
LOC100302640	100302640	broad.mit.edu	37	3	106824708	106824709	+	Intron	DEL	TC	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106824708_106824709delTC	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0						TGtttttatatctttttttttt	0.198													4	2	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160958626	160958628	+	Intron	DEL	TTT	-	-	rs141601797		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160958626_160958628delTTT	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			tcagccAGGATTTTTTTTTTTTT	0.133													4	3	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184552423	184552423	+	Intron	DEL	T	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184552423delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc003fpc.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATGTTTTTCTTTTTTTTTTT	0.343													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196281024	196281024	+	IGR	DEL	T	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281024delT								C3orf43 (38787 upstream) : WDR53 (37 downstream)																							AACCAGGAGCTTTTTTTTTTA	0.254													70	9	---	---	---	---	
EGF	1950	broad.mit.edu	37	4	110925371	110925372	+	Intron	INS	-	AC	AC	rs35428416		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110925371_110925372insAC	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	TGGGcatacatacacacacaca	0.193													4	3	---	---	---	---	
ARHGAP10	79658	broad.mit.edu	37	4	148831168	148831168	+	Intron	DEL	T	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148831168delT	uc003ilf.2	+						ARHGAP10_uc003ilg.2_Intron	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		ttttcttttctttttttttga	0.209													4	2	---	---	---	---	
RXFP1	59350	broad.mit.edu	37	4	159494170	159494171	+	Intron	INS	-	T	T	rs149207993	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159494170_159494171insT	uc003ipz.2	+						RXFP1_uc010iqj.1_Intron|RXFP1_uc011cja.1_Intron|RXFP1_uc010iqo.2_Intron|RXFP1_uc011cjb.1_Intron|RXFP1_uc010iqk.2_Intron|RXFP1_uc011cjc.1_Intron|RXFP1_uc011cjd.1_Intron|RXFP1_uc010iql.2_Intron|RXFP1_uc011cje.1_Intron|RXFP1_uc010iqm.2_Intron|RXFP1_uc011cjf.1_Intron|RXFP1_uc010iqn.2_Intron	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		tcttgtttttgtttttttttga	0.109													4	3	---	---	---	---	
PALLD	23022	broad.mit.edu	37	4	169728429	169728430	+	Intron	DEL	CA	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169728429_169728430delCA	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		cacacacacgcacacacacaca	0.332									Pancreatic_Cancer_Familial_Clustering_of				3	3	---	---	---	---	
MLN	4295	broad.mit.edu	37	6	33768593	33768594	+	Intron	INS	-	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33768593_33768594insT	uc003off.1	-						MLN_uc003ofg.1_Intron|MLN_uc011drn.1_Intron	NM_002418	NP_002409	P12872	MOTI_HUMAN	motilin isoform 1 preproprotein						cell-cell signaling|G-protein coupled receptor protein signaling pathway	extracellular region|soluble fraction	hormone activity				0						TATTTATTGGCTTGTTAATTTA	0.500													17	7	---	---	---	---	
SRPK1	6732	broad.mit.edu	37	6	35810501	35810501	+	Intron	DEL	T	-	-	rs71652741		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810501delT	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TTATAGATCATTTAAAAAAAA	0.308													5	6	---	---	---	---	
PDE10A	10846	broad.mit.edu	37	6	165842337	165842338	+	Intron	INS	-	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165842337_165842338insA	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	TCTGCTTTGGCAAAAAAAAAAA	0.282													6	3	---	---	---	---	
FAM185A	222234	broad.mit.edu	37	7	102396081	102396084	+	Intron	DEL	CTGA	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102396081_102396084delCTGA	uc011klf.1	+						FAM185A_uc011klg.1_Intron|FAM185A_uc011klh.1_Intron	NM_001145268	NP_001138740	Q8N0U4	F185A_HUMAN	hypothetical protein LOC222234 isoform 1												0						TCCCATTGAGCTGACTGTTTTCCT	0.500													4	2	---	---	---	---	
ASZ1	136991	broad.mit.edu	37	7	117020837	117020838	+	Intron	INS	-	AAAAAC	AAAAAC	rs147516910	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117020837_117020838insAAAAAC	uc003vjb.2	-						ASZ1_uc011kno.1_Intron|ASZ1_uc011knp.1_Intron	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GACAATCTGAAAAAAACAAAAA	0.282													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143816457	143816457	+	IGR	DEL	T	-	-	rs67586979		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143816457delT								OR2A2 (8827 upstream) : OR2A14 (9749 downstream)																							ATCCCATTTCTTTTTTTTTTt	0.244													4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139701401	139701402	+	Intron	INS	-	G	G	rs149093007	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139701401_139701402insG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCTGCTCTCCCGGGGGGGGGGC	0.545										HNSCC(7;0.00092)			5	3	---	---	---	---	
C9orf150	286343	broad.mit.edu	37	9	12775861	12775862	+	In_Frame_Ins	INS	-	GGCGGCGGC	GGCGGCGGC	rs139315731	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12775861_12775862insGGCGGCGGC	uc003zkw.2	+	1	850_851	c.147_148insGGCGGCGGC	c.(145-150)insGGCGGCGGC	p.55_56insGGG		NM_203403	NP_981948	Q8IV03	CI150_HUMAN	hypothetical protein LOC286343	58_59	Gly-rich.										0				GBM - Glioblastoma multiforme(1;1.64e-13)		gcggtggtggtggcggcggcgg	0.505													4	3	---	---	---	---	
KIAA1462	57608	broad.mit.edu	37	10	30362610	30362611	+	Intron	INS	-	CTTC	CTTC	rs145825538	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362610_30362611insCTTC	uc001iuz.2	-									Q9P266	K1462_HUMAN	RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4						ttccttccttgcttccttcctt	0.144													2	4	---	---	---	---	
ABCC2	1244	broad.mit.edu	37	10	101571087	101571087	+	Intron	DEL	A	-	-	rs112044854		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101571087delA	uc001kqf.2	+							NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	accatgactcaaaaaaaaaaa	0.214													4	2	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47765831	47765831	+	Intron	DEL	T	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47765831delT	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						CAGAAAGCACttttttttttt	0.124													4	3	---	---	---	---	
ATM	472	broad.mit.edu	37	11	108206869	108206869	+	Intron	DEL	A	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108206869delA	uc001pkb.1	+						ATM_uc009yxr.1_Intron|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		acaaaaagttaaaaaaaaaaa	0.000			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			4	4	---	---	---	---	
BUD13	84811	broad.mit.edu	37	11	116629300	116629301	+	Intron	DEL	TT	-	-	rs35862860		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116629300_116629301delTT	uc001ppn.2	-						BUD13_uc001ppo.2_Intron	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1											large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		GGCAttttcctttttttttttt	0.213													4	2	---	---	---	---	
COL2A1	1280	broad.mit.edu	37	12	48380331	48380332	+	Intron	INS	-	G	G	rs144941834	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48380331_48380332insG	uc001rqu.2	-						COL2A1_uc009zkw.2_Intron|COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor						axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTTTCAGGGCTGGGGGGGGGCT	0.550													4	3	---	---	---	---	
OR8S1	341568	broad.mit.edu	37	12	48920466	48920467	+	Intron	INS	-	A	A	rs34181851		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48920466_48920467insA	uc010slu.1	+							NM_001005203	NP_001005203	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						accctgtctccaaaaaaaaaaa	0.010													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	66739604	66739605	+	IGR	INS	-	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66739604_66739605insA								HELB (7612 upstream) : GRIP1 (1619 downstream)																							ggtctgtcatgaAAAAAAAAAT	0.129													4	2	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	71003062	71003063	+	Frame_Shift_Ins	INS	-	G	G			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71003062_71003063insG	uc001swb.3	-	2	141_142	c.111_112insC	c.(109-114)TCCAGCfs	p.S37fs	PTPRB_uc010sto.1_Frame_Shift_Ins_p.S37fs|PTPRB_uc010stp.1_Frame_Shift_Ins_p.S37fs|PTPRB_uc001swc.3_Frame_Shift_Ins_p.S255fs|PTPRB_uc001swa.3_Frame_Shift_Ins_p.S255fs|PTPRB_uc001swd.3_Frame_Shift_Ins_p.S254fs|PTPRB_uc009zrr.1_Frame_Shift_Ins_p.S134fs|PTPRB_uc001swe.2_Frame_Shift_Ins_p.S255fs	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	37_38	Fibronectin type-III 1.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACAGAATGGCTGGAGGCCTTGG	0.535													150	7	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	47928765	47928768	+	Intron	DEL	TTCC	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47928765_47928768delTTCC	uc001wwj.3	-						MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						ccttccttctttccttccttcctt	0.137													4	2	---	---	---	---	
GNPNAT1	64841	broad.mit.edu	37	14	53245162	53245163	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53245162_53245163delAG	uc001xab.2	-	6	676_677	c.421_422delCT	c.(421-423)CTTfs	p.L141fs		NM_198066	NP_932332	Q96EK6	GNA1_HUMAN	glucosamine-phosphate N-acetyltransferase 1	141	N-acetyltransferase.				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol|endosome membrane|Golgi membrane	glucosamine 6-phosphate N-acetyltransferase activity				0	Breast(41;0.176)					TAGCAAAGTAAGGGTTGATAAT	0.292													130	24	---	---	---	---	
DLGAP5	9787	broad.mit.edu	37	14	55617394	55617397	+	Intron	DEL	GAGT	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55617394_55617397delGAGT	uc001xbs.2	-						DLGAP5_uc001xbt.2_Intron	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a						cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						GAAAAATGAAGAGTGAGTAAGCAA	0.240													5	10	---	---	---	---	
WARS	7453	broad.mit.edu	37	14	100833386	100833386	+	Intron	DEL	A	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100833386delA	uc001yhf.1	-						WARS_uc001yhg.1_Intron|WARS_uc001yhh.1_Intron|WARS_uc001yhi.1_Intron|WARS_uc001yhj.1_Intron|WARS_uc001yhk.1_Intron|WARS_uc001yhl.1_Intron|WARS_uc010twz.1_Intron	NM_173701	NP_776049	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase isoform a						angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity			breast(1)	1		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	AAATAAGAttaaaaaaaaaaa	0.055													4	2	---	---	---	---	
WDR25	79446	broad.mit.edu	37	14	100947441	100947445	+	Intron	DEL	AAAAA	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100947441_100947445delAAAAA	uc010avx.2	+						WDR25_uc001yhm.2_Intron|WDR25_uc001yhn.2_Intron|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Intron	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25												0		Melanoma(154;0.212)				AAAAAAGTGCaaaaaaaaaaaaaaa	0.380													4	3	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	63955042	63955042	+	Intron	DEL	A	-	-	rs67648242		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63955042delA	uc002amp.2	-							NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						GTAACCTCATAACTTTAAATC	0.388													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84858138	84858139	+	IGR	INS	-	T	T	rs71453232		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84858138_84858139insT								ADAMTSL3 (149547 upstream) : LOC388152 (9461 downstream)																							TGGGGAGCTGGTGCAGAGGCCT	0.599													4	5	---	---	---	---	
MCTP2	55784	broad.mit.edu	37	15	94927494	94927494	+	Intron	DEL	T	-	-	rs3217405		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94927494delT	uc002btj.2	+						MCTP2_uc002bti.2_Intron|MCTP2_uc010boj.2_Intron|MCTP2_uc010bok.2_Intron|MCTP2_uc002btk.3_Intron|MCTP2_uc002btl.2_Intron	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TATCCTTTCATTTTTATAGAG	0.328													3	5	---	---	---	---	
ELAC2	60528	broad.mit.edu	37	17	12908601	12908606	+	Intron	DEL	GTAACT	-	-	rs10532461		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12908601_12908606delGTAACT	uc002gnz.3	-						ELAC2_uc002gnv.3_5'Flank|ELAC2_uc002gnw.3_5'Flank|ELAC2_uc002gnx.3_Intron|ELAC2_uc010vvo.1_Intron|ELAC2_uc010vvp.1_Intron|ELAC2_uc010vvq.1_Intron|ELAC2_uc010vvr.1_Intron	NM_018127	NP_060597	Q9BQ52	RNZ2_HUMAN	elaC homolog 2 isoform 1						tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0						ACCTAAACAGGTAACTGTCAGGTTGA	0.466									Hereditary_Prostate_Cancer				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518737	21518737	+	IGR	DEL	A	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518737delA								C17orf51 (41006 upstream) : FAM27L (306633 downstream)																							TATTGGTAGCAAAACAGCCAT	0.259													6	4	---	---	---	---	
C17orf53	78995	broad.mit.edu	37	17	42229795	42229796	+	Intron	INS	-	A	A			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42229795_42229796insA	uc002ifi.1	+						C17orf53_uc010czq.1_Intron|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_Intron	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AAAGCAATCAGaaaaaaaaaaa	0.337													4	2	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3134953	3134954	+	Intron	INS	-	TT	TT			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3134953_3134954insTT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TTATTTTACGAttttttttttt	0.168													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15198397	15198397	+	IGR	DEL	A	-	-	rs34382864		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15198397delA								ANKRD30B (345660 upstream) : LOC644669 (115158 downstream)																							AGCTGAAGACAAAAAAAAAAA	0.463													9	4	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	8969553	8969554	+	Intron	INS	-	TT	TT	rs36058947		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8969553_8969554insTT	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						tttttcttttcttttttttttt	0.178													3	4	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9006152	9006153	+	Intron	INS	-	AA	AA			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006152_9006153insAA	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GATGGACTCTGGAATCTCTCAG	0.505													4	5	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14732268	14732269	+	Intron	INS	-	A	A	rs75726167		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14732268_14732269insA	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						ctctgtctcagaaaaaaaaaaa	0.059													4	2	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14746869	14746870	+	Intron	INS	-	T	T			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14746869_14746870insT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						tccttccttccttcctttcctt	0.000													4	2	---	---	---	---	
LOC729991-MEF2B	4207	broad.mit.edu	37	19	19288517	19288517	+	Intron	DEL	G	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19288517delG	uc010xqo.1	-						LOC729991-MEF2B_uc010xqp.1_Intron|LOC729991-MEF2B_uc002nlo.2_Intron|LOC729991-MEF2B_uc002nlp.2_Intron|LOC729991_uc002nlq.2_Intron	NM_005919	NP_005910	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B isoform b						muscle organ development	transcription factor complex	histone deacetylase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						gaaaagaaaagaaaagaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49715876	49715877	+	IGR	INS	-	CCTC	CCTC	rs143181876	by1000genomes	TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49715876_49715877insCCTC								TRPM4 (785 upstream) : SLC6A16 (77017 downstream)																							cttccttccttcctccctccct	0.035													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53703995	53703996	+	IGR	DEL	TT	-	-	rs113703393		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53703995_53703996delTT								ZNF665 (7376 upstream) : ZNF677 (34642 downstream)																							TGTTTCCCCCtttttttttttt	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2056532	2056532	+	IGR	DEL	A	-	-			TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2056532delA								PDYN (81829 upstream) : STK35 (25996 downstream)																							TCTCAAACGGAAAAAAAAAAA	0.209													6	4	---	---	---	---	
DGCR5	26220	broad.mit.edu	37	22	18976301	18976324	+	Intron	DEL	TATTTATTTATTTATTTATTTATT	-	-	rs111433751		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18976301_18976324delTATTTATTTATTTATTTATTTATT	uc002zom.1	+						DGCR5_uc002zon.1_Intron	NR_002733				Homo sapiens mRNA for KIAA1647 protein, partial cds.												0						TGGCTGGACAtatttatttatttatttatttatttatttattta	0.219													4	5	---	---	---	---	
ASCC2	84164	broad.mit.edu	37	22	30203916	30203917	+	Intron	INS	-	A	A	rs78855417		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30203916_30203917insA	uc003agr.2	-						ASCC2_uc003ags.2_Intron|ASCC2_uc003agt.2_Intron|ASCC2_uc011akr.1_Intron	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			acaacaacaacaaaaaaaaaaa	0.149													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13601466	13601467	+	IGR	INS	-	T	T	rs112972965		TCGA-EJ-5510-01A-01D-1576-08	TCGA-EJ-5510-10A-01D-1577-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13601466_13601467insT								None (None upstream) : None (None downstream)																							AGAGCAGGCTCTTGCCCACATC	0.490													5	3	---	---	---	---	
