Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MFN2	9927	broad.mit.edu	37	1	12058937	12058937	+	Splice_Site	SNP	T	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12058937T>A	uc001atn.3	+	7	1161	c.708_splice	c.e7+2	p.T236_splice	MFN2_uc009vni.2_Splice_Site_p.T236_splice	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2						blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		ATGCAGACGGTAACTCCTCCT	0.577													14	120	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16974277	16974277	+	RNA	SNP	A	C	C	rs151151026	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974277A>C	uc009vow.2	+	5		c.1087A>C			MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_Splice_Site|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_Splice_Site|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_Splice_Site|MST1P2_uc001azm.3_Splice_Site					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						GGTCCATCTAAGGGTCCGAGG	0.657													10	42	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37324731	37324731	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37324731C>T	uc001caz.2	-	7	1217	c.1082G>A	c.(1081-1083)CGC>CAC	p.R361H	GRIK3_uc001cba.1_Missense_Mutation_p.R361H	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	361	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	GTTCATGAAGCGGCCGCCAAA	0.557													20	88	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507397	74507397	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507397C>A	uc001dfy.3	-	7	1410	c.1218G>T	c.(1216-1218)GAG>GAT	p.E406D	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	406										ovary(2)	2						GTGCAAAAAACTCTTTCATAC	0.343													15	74	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111854851	111854851	+	Missense_Mutation	SNP	C	A	A	rs149356213	byFrequency	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111854851C>A	uc001eas.2	+	4	198	c.95C>A	c.(94-96)GCC>GAC	p.A32D	CHIA_uc001ear.2_Intron|CHIA_uc001eaq.2_Intron|CHIA_uc009wgc.2_Intron|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_Intron|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	32					apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		ACCAACTGGGCCCAGTACCGG	0.582													5	97	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	145074882	145074882	+	3'UTR	SNP	G	T	T	rs3845334		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145074882G>T	uc001emk.2	-	2					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q5VU43	MYOME_HUMAN	SubName: Full=Phosphodiesterase 4D interacting protein;						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TAAAAAGCCTGCAGCACAATC	0.303			T	PDGFRB	MPD								3	15	---	---	---	---	PASS
SV2A	9900	broad.mit.edu	37	1	149885276	149885276	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149885276G>A	uc001etg.2	-	2	608	c.117C>T	c.(115-117)GAC>GAT	p.D39D	SV2A_uc001eth.2_Silent_p.D39D	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2	39	Cytoplasmic (Potential).|Interaction with SYT1 (By similarity).				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GGGAATATTCGTCCTGGACTC	0.542													19	94	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153907306	153907306	+	Silent	SNP	T	C	C	rs12567786	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153907306T>C	uc001fdd.1	-	18	3104	c.2703A>G	c.(2701-2703)CAA>CAG	p.Q901Q	uc001fdc.1_RNA	NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	901	Gln-rich.									ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			gctgctgctgttgctgctgct	0.473													4	101	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161022538	161022538	+	Silent	SNP	T	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161022538T>C	uc001fxl.2	-	7	1060	c.714A>G	c.(712-714)TCA>TCG	p.S238S	ARHGAP30_uc001fxk.2_Silent_p.S238S|ARHGAP30_uc001fxm.2_Silent_p.S84S|ARHGAP30_uc009wtx.2_5'UTR|ARHGAP30_uc001fxn.1_Silent_p.S84S	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	238					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CGGGGCTGCCTGATGCCCGGG	0.607													3	63	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175086262	175086262	+	Silent	SNP	G	A	A	rs138969989	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175086262G>A	uc001gkl.1	+	10	2420	c.2307G>A	c.(2305-2307)CCG>CCA	p.P769P		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	769	Fibronectin type-III 6.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCCTGAGGCCGGGTGTGGAGT	0.617													19	101	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196952162	196952162	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196952162G>A	uc001gts.3	+	2	334	c.206G>A	c.(205-207)CGC>CAC	p.R69H		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	69	Sushi 1.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						TTTTGGACTCGCATAACATGC	0.393													10	57	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21234018	21234018	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21234018C>A	uc002red.2	-	26	5850	c.5722G>T	c.(5722-5724)GAT>TAT	p.D1908Y		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1908					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GTATGTGCATCGATGGTCATG	0.463													7	124	---	---	---	---	PASS
HAAO	23498	broad.mit.edu	37	2	43015711	43015711	+	Silent	SNP	G	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43015711G>T	uc002rst.3	-	2	192	c.117C>A	c.(115-117)GGC>GGA	p.G39G	HAAO_uc010ynw.1_Silent_p.G39G	NM_012205	NP_036337	P46952	3HAO_HUMAN	3-hydroxyanthranilate 3,4-dioxygenase	39	Domain A (catalytic) (By similarity).				neuron homeostasis|pyridine nucleotide biosynthetic process|quinolinate biosynthetic process|response to cadmium ion|response to zinc ion|tryptophan catabolic process	cytosol|soluble fraction	3-hydroxyanthranilate 3,4-dioxygenase activity|electron carrier activity|ferrous iron binding			ovary(1)	1						TGGTGTTGGGGCCTCCGATGA	0.572													6	66	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	51255226	51255226	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51255226G>A	uc010fbq.2	-	2	1663	c.186C>T	c.(184-186)AGC>AGT	p.S62S	NRXN1_uc002rxe.3_Silent_p.S62S|NRXN1_uc002rxd.1_Silent_p.S62S	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GGCCGCGGGCGCTGCGAGTCT	0.662													4	10	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167142945	167142945	+	Silent	SNP	C	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167142945C>T	uc010fpl.2	-	11	1844	c.1503G>A	c.(1501-1503)TCG>TCA	p.S501S	uc002udp.2_Intron|SCN9A_uc002udr.1_Silent_p.S372S|SCN9A_uc002uds.1_Silent_p.S372S|SCN9A_uc002udt.1_Silent_p.S372S	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	501				S -> P (in Ref. 3; AAT85835).		voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	ATTCTGATTTCGACAATTTCT	0.428													7	194	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167262810	167262810	+	Silent	SNP	A	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167262810A>T	uc002udu.1	-	25	4456	c.4329T>A	c.(4327-4329)ATT>ATA	p.I1443I		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1443					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TACTGTTGAAAATTGCATCAA	0.383													32	132	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196825327	196825327	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196825327G>A	uc002utj.3	-	18	2649	c.2548C>T	c.(2548-2550)CGC>TGC	p.R850C		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	850	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TGCCTGGGGCGCAAACCAGGA	0.453													4	116	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33602330	33602330	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33602330G>C	uc003cfu.2	-	27	3254	c.2900C>G	c.(2899-2901)GCA>GGA	p.A967G	CLASP2_uc003cfs.2_Missense_Mutation_p.A174G|CLASP2_uc003cft.2_RNA|CLASP2_uc010hgb.2_RNA|CLASP2_uc011axt.1_Missense_Mutation_p.A567G	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2	976										ovary(3)|central_nervous_system(1)	4						CTGAACTTTTGCCTGAACAGA	0.338													31	177	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89391103	89391103	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89391103C>A	uc003dqy.2	+	5	1394	c.1169C>A	c.(1168-1170)ACC>AAC	p.T390N	EPHA3_uc003dqx.1_Missense_Mutation_p.T390N|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	390	Extracellular (Potential).|Fibronectin type-III 1.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TTTGGACTCACCAACACCACG	0.478										TSP Lung(6;0.00050)			4	71	---	---	---	---	PASS
SORCS2	57537	broad.mit.edu	37	4	7728622	7728622	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7728622G>A	uc003gkb.3	+	21	2861	c.2861G>A	c.(2860-2862)CGT>CAT	p.R954H	SORCS2_uc011bwi.1_Missense_Mutation_p.R782H	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor	954	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						AGGGTCCTCCGTGTGCTGGGT	0.617													4	47	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115750976	115750976	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115750976T>A	uc003ibu.2	-	13	3148	c.2469A>T	c.(2467-2469)AAA>AAT	p.K823N	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	823	Lumenal (Potential).|PAPS (By similarity).|Heparan sulfate N-sulfotransferase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		ATTTTCGGCCTTTGCTTTTTC	0.333													10	50	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	166935656	166935656	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166935656G>A	uc003irh.1	+	8	1633	c.986G>A	c.(985-987)CGA>CAA	p.R329Q	TLL1_uc011cjn.1_Missense_Mutation_p.R329Q|TLL1_uc011cjo.1_Missense_Mutation_p.R153Q	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	329	Metalloprotease (By similarity).				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ATTGGTCAGCGAACCCGTCTA	0.458													11	247	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175897858	175897858	+	Silent	SNP	C	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175897858C>T	uc003iuc.2	+	5	1852	c.1182C>T	c.(1180-1182)ATC>ATT	p.I394I	ADAM29_uc003iud.2_Silent_p.I394I|ADAM29_uc010irr.2_Silent_p.I394I|ADAM29_uc011cki.1_Silent_p.I394I	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	394	Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CAAAGGACATCTTTAATGTGA	0.393													28	129	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140574045	140574045	+	Silent	SNP	C	G	G	rs619668	byFrequency	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140574045C>G	uc003lix.2	+	1	2094	c.1920C>G	c.(1918-1920)CTC>CTG	p.L640L		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	640	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCACAGGCTCGTGGTGCTTG	0.682													3	47	---	---	---	---	PASS
PPP2R2B	5521	broad.mit.edu	37	5	146017843	146017843	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146017843G>A	uc003loe.2	-	6	1286	c.761C>T	c.(760-762)GCA>GTA	p.A254V	PPP2R2B_uc010jgm.2_Missense_Mutation_p.A243V|PPP2R2B_uc003log.3_Missense_Mutation_p.A254V|PPP2R2B_uc003lof.3_Missense_Mutation_p.A254V|PPP2R2B_uc003loi.3_Missense_Mutation_p.A257V|PPP2R2B_uc003loh.3_Missense_Mutation_p.A254V|PPP2R2B_uc003loj.3_Missense_Mutation_p.A234V|PPP2R2B_uc003lok.3_Missense_Mutation_p.A243V|PPP2R2B_uc011dbu.1_Missense_Mutation_p.A260V|PPP2R2B_uc011dbv.1_Missense_Mutation_p.A312V	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein	254	WD 4.				apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGGGCAGATGCCCGCATGTC	0.597													8	68	---	---	---	---	PASS
TMEM200A	114801	broad.mit.edu	37	6	130762197	130762197	+	Silent	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130762197C>A	uc003qca.2	+	3	1501	c.630C>A	c.(628-630)ATC>ATA	p.I210I	TMEM200A_uc010kfh.2_Silent_p.I210I|TMEM200A_uc010kfi.2_Silent_p.I210I|TMEM200A_uc003qcb.2_Silent_p.I210I	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	210	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		CAAATACGATCGCCTCTTTCT	0.468													3	38	---	---	---	---	PASS
MOXD1	26002	broad.mit.edu	37	6	132641814	132641814	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132641814A>G	uc003qdf.2	-	9	1418	c.1319T>C	c.(1318-1320)ATT>ACT	p.I440T	MOXD1_uc003qde.2_Missense_Mutation_p.I372T	NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	440	Lumenal (Potential).				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		ACACTCAGTAATTAGGTTATC	0.308													6	24	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168297653	168297653	+	Splice_Site	SNP	G	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168297653G>T	uc003qwd.2	+	10	1456	c.1314_splice	c.e10+1	p.Q438_splice	MLLT4_uc003qwb.1_Splice_Site_p.Q423_splice|MLLT4_uc003qwc.1_Splice_Site_p.Q439_splice|MLLT4_uc003qwf.2_Splice_Site_p.Q124_splice	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CTCTATCCAGGTACGTAGTCT	0.433			T	MLL	AL								5	22	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567282	5567282	+	3'UTR	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567282C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		caaaacaaaacaaaaaaaaca	0.378													10	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38370456	38370456	+	5'UTR	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38370456C>A	uc010kxj.1	-	1					uc010kxk.1_Intron					SubName: Full=Putative uncharacterized protein ENSP00000374866;																		AGTAAGGGACCAGACGAAGAG	0.527													3	59	---	---	---	---	PASS
STAG3L2	442582	broad.mit.edu	37	7	74298939	74298939	+	RNA	SNP	G	C	C	rs142156061	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74298939G>C	uc011kfj.1	-	6		c.728C>G						P0CL84	ST3L2_HUMAN	Homo sapiens cDNA FLJ76564 complete cds.							nucleus	binding				0						TTTCCCCCACGCCATGCCACC	0.537													2	17	---	---	---	---	PASS
GALNTL5	168391	broad.mit.edu	37	7	151664546	151664546	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151664546G>A	uc003wkp.2	+	2	438	c.215G>A	c.(214-216)AGG>AAG	p.R72K	GALNTL5_uc003wkq.2_5'UTR|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_5'UTR	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	72	Lumenal (Potential).					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		ATAGTCAAAAGGACTGATGAA	0.373													4	41	---	---	---	---	PASS
GALNTL5	168391	broad.mit.edu	37	7	151664547	151664547	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151664547G>C	uc003wkp.2	+	2	439	c.216G>C	c.(214-216)AGG>AGC	p.R72S	GALNTL5_uc003wkq.2_5'UTR|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_5'UTR	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	72	Lumenal (Potential).					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TAGTCAAAAGGACTGATGAAG	0.373													4	39	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151932961	151932961	+	Nonsense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932961G>A	uc003wla.2	-	16	2929	c.2710C>T	c.(2710-2712)CGA>TGA	p.R904*	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	904					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CGGCCACCTCGCCCCGACAGT	0.502			N		medulloblastoma								7	77	---	---	---	---	PASS
FAM66D	100132923	broad.mit.edu	37	8	12282443	12282443	+	Intron	SNP	G	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12282443G>T	uc011kxp.1	+						uc003wvm.1_Intron|uc011kxs.1_5'Flank|uc003wvp.1_RNA					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						GAACCTGCAAGAGTCTCAGCA	0.502													3	27	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25166414	25166414	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25166414G>A	uc003xeg.2	+	12	1302	c.1165G>A	c.(1165-1167)GCA>ACA	p.A389T	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.A103T|DOCK5_uc003xei.2_5'Flank	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	389						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AGTGATTGCAGCAAAGGAAGT	0.522													3	41	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62492216	62492216	+	Intron	SNP	A	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62492216A>G	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_Missense_Mutation_p.I421V	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	GTCCTCTGACATCCTGCCCAA	0.622													3	42	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77690474	77690474	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77690474C>T	uc003yav.2	+	4	3433	c.3046C>T	c.(3046-3048)CCC>TCC	p.P1016S	ZFHX4_uc003yau.1_Missense_Mutation_p.P1042S|ZFHX4_uc003yaw.1_Missense_Mutation_p.P1016S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1016						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGCAGTGAATCCCGAATCCTG	0.483										HNSCC(33;0.089)			25	99	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790187	78790187	+	Intron	SNP	G	C	C	rs10118321		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790187G>C	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.W681S|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ggaatggaatggaatcgaatc	0.119													4	6	---	---	---	---	PASS
KIAA1984	84960	broad.mit.edu	37	9	139701517	139701517	+	Silent	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139701517C>A	uc004cjf.2	+	13	1533	c.1485C>A	c.(1483-1485)ATC>ATA	p.I495I	C9orf86_uc004cjm.2_5'Flank|C9orf86_uc004cjh.2_5'Flank|C9orf86_uc004cjj.1_5'Flank|C9orf86_uc004cjk.1_5'Flank|C9orf86_uc004cji.1_5'Flank|C9orf86_uc010nbr.1_5'Flank|LOC100131193_uc004cjg.1_RNA	NM_001039374	NP_001034463	Q5T5S1	K1984_HUMAN	hypothetical protein LOC84960	495										ovary(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		AGGATATGATCGGTACAGGCC	0.642													3	43	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26575384	26575384	+	Silent	SNP	C	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26575384C>T	uc001isp.2	+	13	1850	c.1347C>T	c.(1345-1347)CAC>CAT	p.H449H	GAD2_uc001isq.2_Silent_p.H449H	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	449					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	GCGGACGCCACGTTGATGTTT	0.443													9	61	---	---	---	---	PASS
TALDO1	6888	broad.mit.edu	37	11	764817	764817	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:764817G>T	uc001lqz.2	+	8	1036	c.986G>T	c.(985-987)CGA>CTA	p.R329L	TALDO1_uc001lra.2_3'UTR	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	329					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		TTCTAGGAACGAATGTTCAAT	0.562													3	98	---	---	---	---	PASS
LTBP3	4054	broad.mit.edu	37	11	65315007	65315007	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65315007G>A	uc001oej.2	-	14	2279	c.2010C>T	c.(2008-2010)TGC>TGT	p.C670C	LTBP3_uc001oef.2_5'Flank|LTBP3_uc001oeg.2_5'Flank|LTBP3_uc001oeh.2_Silent_p.C100C|LTBP3_uc010roi.1_Silent_p.C553C|LTBP3_uc001oei.2_Silent_p.C670C|LTBP3_uc010roj.1_Silent_p.C371C|LTBP3_uc010rok.1_Silent_p.C581C	NM_001130144	NP_001123616	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding	670	EGF-like 5; calcium-binding (Potential).|Cys-rich.					extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3						CGCCGTCGCCGCACAGGTGGG	0.657													5	118	---	---	---	---	PASS
SLC37A4	2542	broad.mit.edu	37	11	118900037	118900037	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118900037A>C	uc010rys.1	-	3	800	c.43T>G	c.(43-45)TCA>GCA	p.S15A	SLC37A4_uc009zam.2_RNA|SLC37A4_uc009zan.2_RNA|SLC37A4_uc010ryr.1_Missense_Mutation_p.S15A|SLC37A4_uc010ryt.1_Intron|SLC37A4_uc001pus.2_Missense_Mutation_p.S15A	NM_001164277	NP_001157749	O43826	G6PT1_HUMAN	solute carrier family 37 (glucose-6-phosphate	15					glucose homeostasis|glucose metabolic process	endoplasmic reticulum membrane|integral to endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphate transmembrane transporter activity|glucose-6-phosphate transmembrane transporter activity			large_intestine(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		AACATGGCTGAGAAGATCACA	0.517									Glycogen_Storage_Disease_type_Ib				4	24	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105571030	105571030	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105571030G>A	uc001tlf.1	-	18	1863	c.1645C>T	c.(1645-1647)CCA>TCA	p.P549S	APPL2_uc010swt.1_Missense_Mutation_p.P506S|APPL2_uc001tlg.1_Missense_Mutation_p.P303S|APPL2_uc010swu.1_Missense_Mutation_p.P555S|APPL2_uc009zuq.2_Missense_Mutation_p.P506S	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	549	PID.				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						TGAGTCTGTGGATCTATCAAC	0.328													7	52	---	---	---	---	PASS
LOC647288	647288	broad.mit.edu	37	13	75814354	75814354	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75814354C>G	uc010ths.1	-	1	164	c.123G>C	c.(121-123)TGG>TGC	p.W41C		NR_027466				Homo sapiens mRNA; cDNA DKFZp434F0327 (from clone DKFZp434F0327).												0						CCACCAGTTCCCATGGAAAAC	0.488													3	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	36841080	36841080	+	Silent	SNP	C	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36841080C>A	uc001wtp.2	+	1	711	c.462C>A	c.(460-462)ACC>ACA	p.T154T		NM_199286	NP_954980			stella																		ATCAAGACACCAAGCCACTTC	0.378													9	95	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28386775	28386775	+	Nonsense_Mutation	SNP	G	A	A	rs149707599	byFrequency	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28386775G>A	uc001zbj.2	-	78	11924	c.11818C>T	c.(11818-11820)CGA>TGA	p.R3940*		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3940	WD 5.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCATCTGGTCGCCTACAATAC	0.478													29	119	---	---	---	---	PASS
ARHGAP11B	89839	broad.mit.edu	37	15	30938316	30938316	+	Splice_Site	SNP	G	A	A	rs112615235	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30938316G>A	uc010azv.1	+	11		c.1127_splice	c.e11-1		ARHGAP11B_uc001zeu.2_Splice_Site			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TTCCTTGGCAGTGGATAAGTT	0.393													5	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	62538191	62538191	+	RNA	SNP	C	T	T	rs62004227	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62538191C>T	uc002ain.1	-	5		c.1026G>A			uc002ajj.1_3'UTR|uc002ajl.2_5'Flank|uc002ajm.2_5'Flank|uc002ajn.2_5'Flank|uc002ajo.2_5'Flank|uc002ajq.2_5'Flank|uc002ajr.1_5'Flank|uc010uhp.1_5'Flank|uc002ajt.2_5'Flank|uc002ajw.2_5'Flank|uc010uhq.1_5'Flank|uc002ajx.2_5'Flank|uc002ajy.2_5'Flank					Homo sapiens cDNA FLJ38723 fis, clone KIDNE2010137, weakly similar to GOLGIN-95.																		GTAGCTGCTGCTCCACCTCGG	0.602													3	2	---	---	---	---	PASS
CA12	771	broad.mit.edu	37	15	63632619	63632619	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63632619G>A	uc002amc.2	-	7	771	c.615C>T	c.(613-615)TTC>TTT	p.F205F	CA12_uc002amd.2_Silent_p.F205F|CA12_uc002ame.2_Silent_p.F145F	NM_001218	NP_001209	O43570	CAH12_HUMAN	carbonic anhydrase XII isoform 1 precursor	205	Extracellular (Potential).				one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding			ovary(1)	1					Acetazolamide(DB00819)	CTTCAATGTTGAATCCCGGGA	0.562													5	58	---	---	---	---	PASS
LRRC49	54839	broad.mit.edu	37	15	71329574	71329574	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71329574A>G	uc002asw.2	+	15	2007	c.1760A>G	c.(1759-1761)AAC>AGC	p.N587S	LRRC49_uc002asu.2_Missense_Mutation_p.N577S|LRRC49_uc002asx.2_Missense_Mutation_p.N543S|LRRC49_uc010ukf.1_Missense_Mutation_p.N592S|LRRC49_uc002asy.2_Missense_Mutation_p.N293S|LRRC49_uc002asz.2_Missense_Mutation_p.N559S	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	587						cytoplasm|microtubule				ovary(1)	1						GGTATTATCAACGAAGAAAAT	0.318													4	114	---	---	---	---	PASS
IRX5	10265	broad.mit.edu	37	16	54966502	54966502	+	Silent	SNP	A	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54966502A>G	uc002ehv.2	+	2	342	c.342A>G	c.(340-342)CCA>CCG	p.P114P	IRX5_uc010cca.1_Silent_p.P166P|IRX5_uc002ehw.2_Silent_p.P48P	NM_005853	NP_005844	P78411	IRX5_HUMAN	iroquois homeobox protein 5	114	Homeobox; TALE-type.				response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|vitamin D binding				0						ACGGGGACCCAGCGTACCGGA	0.657													17	81	---	---	---	---	PASS
PDXDC2	283970	broad.mit.edu	37	16	70010511	70010511	+	3'UTR	SNP	A	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70010511A>G	uc010vlq.1	-	6					CLEC18C_uc002exy.2_Intron|PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA					SubName: Full=Putative uncharacterized protein;												0						GTTATCAGTTATAGAATGTTG	0.498													8	46	---	---	---	---	PASS
MAP1LC3B	81631	broad.mit.edu	37	16	87436734	87436734	+	3'UTR	SNP	G	T	T	rs115646842	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87436734G>T	uc002fjx.2	+	4					MAP1LC3B_uc010chs.2_RNA	NM_022818	NP_073729	Q9GZQ8	MLP3B_HUMAN	microtubule-associated proteins 1A/1B light						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0249)		TTCTAGAATTGTTTAAACCCT	0.413													3	44	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7690227	7690227	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7690227A>T	uc002giu.1	+	41	6493	c.6479A>T	c.(6478-6480)GAC>GTC	p.D2160V		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2160	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GAGAAACCCGACGAGAAGTGG	0.567													11	45	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10355525	10355525	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10355525G>A	uc002gmn.2	-	27	3582	c.3471C>T	c.(3469-3471)GCC>GCT	p.A1157A	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1157	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TGGCCCCACCGGCTTCTTCCA	0.607													34	125	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42333173	42333173	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42333173G>A	uc002igf.3	-	14	1817	c.1668C>T	c.(1666-1668)AAC>AAT	p.N556N		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	556	Extracellular (Potential).|Membrane (anion exchange).				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCATCAACACGTTGTAGTTAT	0.532													25	131	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45234300	45234300	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234300G>T	uc002ild.3	-	7	948	c.821C>A	c.(820-822)GCT>GAT	p.A274D	CDC27_uc002ile.3_Missense_Mutation_p.A274D|CDC27_uc002ilf.3_Missense_Mutation_p.A274D|CDC27_uc010wkp.1_Missense_Mutation_p.A213D|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	274					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGGACTAAGAGCTGCTGGTCC	0.363													3	39	---	---	---	---	PASS
HOXB3	3213	broad.mit.edu	37	17	46628435	46628435	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46628435G>T	uc002inn.2	-	2	957	c.557C>A	c.(556-558)GCG>GAG	p.A186E	HOXB3_uc010wlm.1_Missense_Mutation_p.A113E|HOXB3_uc010dbf.2_Missense_Mutation_p.A186E|HOXB3_uc010dbg.2_Missense_Mutation_p.A186E|HOXB3_uc002ino.2_Missense_Mutation_p.A186E|HOXB3_uc010wlk.1_Missense_Mutation_p.A54E|HOXB3_uc010wll.1_Missense_Mutation_p.A113E	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3	186					angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTTGGACGCCGCCGACCCCGG	0.453													9	56	---	---	---	---	PASS
CSH2	1443	broad.mit.edu	37	17	61949662	61949662	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61949662G>C	uc002jch.2	-	5	593	c.478C>G	c.(478-480)CGG>GGG	p.R160G	CSH2_uc002jcg.2_Missense_Mutation_p.R65G|CSH2_uc002jci.2_3'UTR|GH2_uc002jcj.2_Silent_p.A158A|CSH2_uc002jck.2_Missense_Mutation_p.R160G	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1	160					female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						TGCCCAGTCCGGCGGCTGCCG	0.547													28	124	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61949663	61949663	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61949663G>A	uc002jcj.2	-	5	535	c.473C>T	c.(472-474)GCC>GTC	p.A158V	CSH2_uc002jcg.2_Silent_p.R64R|CSH2_uc002jch.2_Silent_p.R159R|CSH2_uc002jci.2_3'UTR|CSH2_uc002jck.2_Silent_p.R159R	NM_022557	NP_072051	P01242	SOM2_HUMAN	growth hormone 2 isoform 2	Error:Variant_position_missing_in_P01242_after_alignment						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						GCCCAGTCCGGCGGCTGCCGT	0.547													27	119	---	---	---	---	PASS
DSG2	1829	broad.mit.edu	37	18	29099853	29099853	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29099853G>A	uc002kwu.3	+	3	357	c.169G>A	c.(169-171)GCT>ACT	p.A57T		NM_001943	NP_001934	Q14126	DSG2_HUMAN	desmoglein 2 preproprotein	57	Extracellular (Potential).|Cadherin 1.				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			CGCCCCCGTGGCTCTTCGGGA	0.453													15	70	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7810724	7810724	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7810724A>T	uc002mht.2	-	4	495	c.428T>A	c.(427-429)CTG>CAG	p.L143Q	CD209_uc010xju.1_Intron|CD209_uc010dvp.2_Missense_Mutation_p.L119Q|CD209_uc002mhr.2_Missense_Mutation_p.L119Q|CD209_uc002mhs.2_Missense_Mutation_p.L119Q|CD209_uc002mhu.2_Missense_Mutation_p.L143Q|CD209_uc010dvq.2_Missense_Mutation_p.L143Q|CD209_uc002mhq.2_Missense_Mutation_p.L143Q|CD209_uc002mhv.2_Missense_Mutation_p.L119Q|CD209_uc002mhx.2_Missense_Mutation_p.L99Q|CD209_uc002mhw.2_Missense_Mutation_p.L99Q|CD209_uc010dvr.2_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	143	Extracellular (Probable).|7 X approximate tandem repeats.|3.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						GATCTCCTGCAGCTTAGATTT	0.552													4	197	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	15881921	15881921	+	RNA	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15881921G>A	uc002nbo.2	-	6		c.977C>T			uc010xor.1_Silent_p.H152H					Homo sapiens cDNA FLJ60024 complete cds, highly similar to Cytochrome P450 4F12 (EC 1.14.14.1).																		CTGTGAAGTCGTGCACCAGGC	0.522													10	49	---	---	---	---	PASS
JUND	3727	broad.mit.edu	37	19	18391297	18391297	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18391297T>C	uc002nip.2	-	1	1136	c.998A>G	c.(997-999)AAC>AGC	p.N333S	hsa-mir-3188|MI0014232_5'Flank	NM_005354	NP_005345	P17535	JUND_HUMAN	jun D proto-oncogene	333					regulation of transcription from RNA polymerase II promoter	chromatin|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0						GCAGCCGCTGTTGACGTGGCT	0.706													5	9	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940806	22940806	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940806G>A	uc010xrh.1	-	5	1632	c.1632C>T	c.(1630-1632)ACC>ACT	p.T544T		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGGGTTGAGGACT	0.378													3	41	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941279	22941279	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941279C>G	uc010xrh.1	-	5	1159	c.1159G>C	c.(1159-1161)GAG>CAG	p.E387Q		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAGGGTTTCTCTCCAGTATGA	0.353													3	37	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891202	44891202	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891202C>G	uc002ozd.3	-	4	1292	c.1205G>C	c.(1204-1206)TGC>TCC	p.C402S	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Missense_Mutation_p.C409S	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	402	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						ACACTCACTGCATTTGTAGGG	0.478													3	48	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891217	44891217	+	Missense_Mutation	SNP	T	C	C	rs144198432	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891217T>C	uc002ozd.3	-	4	1277	c.1190A>G	c.(1189-1191)GAG>GGG	p.E397G	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Missense_Mutation_p.E404G	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	397					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						GTAGGGCTTCTCTCCAGTGTG	0.483													3	52	---	---	---	---	PASS
SIGLEC9	27180	broad.mit.edu	37	19	51630484	51630484	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51630484G>C	uc002pvu.2	+	4	1013	c.946G>C	c.(946-948)GCT>CCT	p.A316P	SIGLEC9_uc010yct.1_Missense_Mutation_p.A316P	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	316	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GAGGGATGCAGCTGAATTCAC	0.632													8	45	---	---	---	---	PASS
ZNF749	388567	broad.mit.edu	37	19	57956721	57956721	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57956721A>C	uc002qoq.2	+	3	2459	c.2205A>C	c.(2203-2205)AAA>AAC	p.K735N	ZNF547_uc002qpm.3_Intron	NM_001023561	NP_001018855	O43361	ZN749_HUMAN	zinc finger protein 749	735					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		ACTTCAACAAATGTAATACTG	0.398													18	89	---	---	---	---	PASS
ZNF587	84914	broad.mit.edu	37	19	58353011	58353011	+	Intron	SNP	A	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58353011A>G	uc002qqb.2	+						uc002qqh.1_Silent_p.K273K|ZNF587_uc010yhh.1_Intron|ZNF587_uc002qqi.1_Intron|uc010yhj.1_Silent_p.K323K|ZNF587_uc002qqj.1_Intron	NM_032828	NP_116217	Q96SQ5	ZN587_HUMAN	zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		ACGCTGGAAAAGGGCCTTATG	0.418													2	6	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	A	A	rs145250945		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385748G>A	uc002qqo.2	-	3	1282	c.1010C>T	c.(1009-1011)GCT>GTT	p.A337V	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337	C2H2-type 5.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ACTGAAGCTAGCATATTTGCT	0.353													2	1	---	---	---	---	PASS
PROCR	10544	broad.mit.edu	37	20	33764648	33764648	+	3'UTR	SNP	T	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33764648T>C	uc002xbt.2	+	4					EDEM2_uc010zuv.1_Intron|PROCR_uc010zuw.1_3'UTR	NM_006404	NP_006395	Q9UNN8	EPCR_HUMAN	endothelial protein C receptor precursor						antigen processing and presentation|blood coagulation|immune response	integral to plasma membrane|MHC class I protein complex	receptor activity				0			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	AGGGGCTGGATTGATGGAGGC	0.537													5	19	---	---	---	---	PASS
RBPJL	11317	broad.mit.edu	37	20	43945650	43945650	+	3'UTR	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43945650G>A	uc002xns.2	+	12					RBPJL_uc002xnt.2_3'UTR	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L						signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				GCCCGCGCCAGGCGCGGGGAC	0.657													8	69	---	---	---	---	PASS
TUBB1	81027	broad.mit.edu	37	20	57598857	57598857	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57598857G>C	uc002yak.2	+	4	644	c.375G>C	c.(373-375)GAG>GAC	p.E125D		NM_030773	NP_110400	Q9H4B7	TBB1_HUMAN	beta tubulin 1, class VI	125					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity			ovary(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)		Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	ACGAGAGTGAGAGCTGTGACT	0.602													19	108	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11058248	11058248	+	Silent	SNP	G	A	A	rs8130203	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11058248G>A	uc002yit.1	-	3	400	c.192C>T	c.(190-192)ATC>ATT	p.I64I	BAGE_uc002yiw.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCAGCACAAGGATAATGATAC	0.433													5	86	---	---	---	---	PASS
PACSIN2	11252	broad.mit.edu	37	22	43267420	43267420	+	Silent	SNP	G	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43267420G>A	uc010gzg.2	-	11	1626	c.1404C>T	c.(1402-1404)CGC>CGT	p.R468R	PACSIN2_uc003bdg.3_Silent_p.R468R|PACSIN2_uc003bde.3_Silent_p.R468R|PACSIN2_uc003bdf.3_Silent_p.R427R	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in	468	SH3.				actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)				CGTTGTCCAAGCGTCCCTTGC	0.622													10	45	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32536160	32536160	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32536160C>T	uc004dda.1	-	18	2501	c.2257G>A	c.(2257-2259)GAA>AAA	p.E753K	DMD_uc004dcz.2_Missense_Mutation_p.E630K|DMD_uc004dcy.1_Missense_Mutation_p.E749K|DMD_uc004ddb.1_Missense_Mutation_p.E745K|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.E745K	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	753	Spectrin 4.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AAGTTGCCTTCCTTCCGAAAG	0.383													12	18	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11080808	11080808	+	Intron	DEL	A	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11080808delA	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		attaaaatacaaaaaaaaaaa	0.000													4	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17299014	17299014	+	3'UTR	DEL	A	-	-	rs6661019	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17299014delA	uc001azt.2	+	37					CROCC_uc001azu.2_3'UTR|CROCC_uc001azv.2_3'UTR	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGCCCCCCCACCCAGAGCCC	0.672													6	3	---	---	---	---	
FUCA1	2517	broad.mit.edu	37	1	24175455	24175456	+	Intron	INS	-	T	T			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24175455_24175456insT	uc001bie.2	-							NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor						fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		TGCTGTTTTAAttttttttttt	0.183													4	2	---	---	---	---	
MAN1C1	57134	broad.mit.edu	37	1	26107407	26107407	+	Intron	DEL	C	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26107407delC	uc001bkm.2	+						MAN1C1_uc009vry.1_Intron|MAN1C1_uc001bkn.2_5'UTR	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CTGACCTGGGCCCTCTGCTTG	0.612													95	11	---	---	---	---	
RAB3B	5865	broad.mit.edu	37	1	52446102	52446102	+	Intron	DEL	A	-	-	rs80211476		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52446102delA	uc001cth.2	-							NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						tgtctctaccaaaaaaaaaaa	0.219													4	4	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202163833	202163834	+	Intron	INS	-	G	G	rs2361432		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202163833_202163834insG	uc001gxu.2	+							NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						TTCGTGGGGGCGGGGGGGGCGG	0.619													3	3	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236645415	236645415	+	Intron	DEL	A	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236645415delA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			actccatctcaaaaaaaaaaa	0.129													9	4	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10822020	10822020	+	Intron	DEL	A	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10822020delA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		tattaggGTTAAAAAAAAAAA	0.179													4	2	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	24103433	24103433	+	Intron	DEL	A	-	-	rs75314008		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24103433delA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc010exx.1_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					actctgtctcaaaaaaaaaaa	0.179													4	3	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37276994	37276994	+	Intron	DEL	A	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37276994delA	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GCCCTACATTaaaaaaaaaaa	0.264													12	6	---	---	---	---	
HK2	3099	broad.mit.edu	37	2	75094526	75094527	+	Intron	INS	-	A	A	rs151230031		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75094526_75094527insA	uc002snd.2	+							NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2						apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						agtgagggattaaaaaAAAAAC	0.129													4	2	---	---	---	---	
GALNT13	114805	broad.mit.edu	37	2	155099377	155099377	+	Frame_Shift_Del	DEL	A	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155099377delA	uc002tyr.3	+	6	1212	c.645delA	c.(643-645)TTAfs	p.L215fs	GALNT13_uc002tyt.3_Frame_Shift_Del_p.L215fs|GALNT13_uc010foc.1_Frame_Shift_Del_p.L34fs|GALNT13_uc010fod.2_5'Flank	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	215	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						AATGCACGTTAGGATGGCTGG	0.473													51	8	---	---	---	---	
EEF1B2	1933	broad.mit.edu	37	2	207026490	207026491	+	Intron	INS	-	T	T	rs142413994	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207026490_207026491insT	uc002vbf.1	+						NDUFS1_uc010ziq.1_5'Flank|NDUFS1_uc002vbe.2_5'Flank|NDUFS1_uc010zir.1_5'Flank|NDUFS1_uc010zis.1_5'Flank|NDUFS1_uc010zit.1_5'Flank|NDUFS1_uc010ziu.1_5'Flank|EEF1B2_uc002vbg.1_Intron|EEF1B2_uc002vbh.1_Intron|SNORD51_uc002vbi.1_5'Flank|SNORA41_uc002vbj.2_5'Flank	NM_001037663	NP_001032752	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta							cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						gagactccgtcccaaaaaaaaa	0.069													3	5	---	---	---	---	
MLPH	79083	broad.mit.edu	37	2	238419911	238419912	+	Intron	DEL	TT	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238419911_238419912delTT	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		TTCTGGCTGCtttttttttttt	0.104													4	2	---	---	---	---	
VGLL4	9686	broad.mit.edu	37	3	11685143	11685144	+	Intron	INS	-	A	A	rs34152653		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11685143_11685144insA	uc003bwf.2	-						VGLL4_uc010hdx.1_5'UTR|VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482	Q14135	VGLL4_HUMAN	vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ATGCAAAAGTTAAAAAAAAAAA	0.406													3	3	---	---	---	---	
KAT2B	8850	broad.mit.edu	37	3	20141236	20141237	+	Intron	DEL	TG	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20141236_20141237delTG	uc003cbq.2	+							NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CTTTAAAGGCTGTGTGTGTGTG	0.218													4	2	---	---	---	---	
CSPG5	10675	broad.mit.edu	37	3	47604271	47604271	+	Intron	DEL	G	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47604271delG	uc003crp.3	-						CSPG5_uc003crm.2_RNA|CSPG5_uc003crn.2_Intron|CSPG5_uc003cro.3_Intron|CSPG5_uc011bbb.1_Intron	NM_006574	NP_006565	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan						cell differentiation|intracellular transport|nervous system development|regulation of growth	endoplasmic reticulum membrane|Golgi-associated vesicle membrane|integral to plasma membrane|membrane fraction	growth factor activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GGAAAAAGTTGGGGGGGGGGA	0.453													76	7	---	---	---	---	
PTPRG	5793	broad.mit.edu	37	3	62204385	62204385	+	Intron	DEL	C	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62204385delC	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc011bfi.1_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CTGCGGATTGCCCCTCCTGTC	0.527													13	6	---	---	---	---	
DPPA4	55211	broad.mit.edu	37	3	109056179	109056179	+	Intron	DEL	A	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109056179delA	uc003dxq.3	-						DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Intron	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4							nucleus	protein binding			upper_aerodigestive_tract(1)	1						CTCTTAAAATAAAAAAAAAAA	0.378													8	4	---	---	---	---	
HPS3	84343	broad.mit.edu	37	3	148859319	148859319	+	Intron	DEL	T	-	-	rs10718838		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148859319delT	uc003ewu.1	+						HPS3_uc003ewt.1_Intron|HPS3_uc011bnq.1_Intron	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein							cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			tttttttttgttttttttttt	0.224									Hermansky-Pudlak_syndrome				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168269865	168269865	+	IGR	DEL	A	-	-	rs139746804		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168269865delA								MIR551B (128 upstream) : C3orf50 (257719 downstream)																							CAATGGGATTAAAAAAAAAAA	0.279													4	4	---	---	---	---	
TMPRSS11D	9407	broad.mit.edu	37	4	68719842	68719845	+	Frame_Shift_Del	DEL	ACTG	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68719842_68719845delACTG	uc003hdq.2	-	3	255_258	c.190_193delCAGT	c.(190-195)CAGTTAfs	p.Q64fs	LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_5'UTR	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	64_65	SEA.|Extracellular (Potential).				proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GGTGAATTTAACTGACTATTATAT	0.304													119	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	69242012	69242012	+	IGR	DEL	C	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69242012delC								YTHDC1 (26188 upstream) : UGT2B15 (270304 downstream)																							TACAACCTGTCCCGACTCCAG	0.542													43	7	---	---	---	---	
SLC35B2	347734	broad.mit.edu	37	6	44224750	44224751	+	Intron	DEL	CT	-	-	rs72454787		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44224750_44224751delCT	uc003oxd.2	-						SLC35B2_uc011dvt.1_Intron|SLC35B2_uc011dvu.1_Intron	NM_178148	NP_835361	Q8TB61	S35B2_HUMAN	solute carrier family 35, member B2						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GACAAAGAGCctctctctctct	0.663													6	3	---	---	---	---	
SYTL3	94120	broad.mit.edu	37	6	159146359	159146360	+	Intron	DEL	GT	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159146359_159146360delGT	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		gtgtgtgtgcgtgtgtgtgtgt	0.386													6	3	---	---	---	---	
ZNF12	7559	broad.mit.edu	37	7	6732518	6732519	+	Intron	DEL	AC	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6732518_6732519delAC	uc003sqt.1	-						ZNF12_uc011jxa.1_Intron|ZNF12_uc003sqs.1_Intron	NM_016265	NP_057349	P17014	ZNF12_HUMAN	zinc finger protein 12 isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		acacacacaaacacacacacac	0.302													4	2	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38462154	38462155	+	Intron	INS	-	TATC	TATC			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38462154_38462155insTATC	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron|AMPH_uc003tgw.1_Intron|AMPH_uc010kxl.1_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						GTCTGCCTACGtatctatctat	0.163													22	7	---	---	---	---	
PDAP1	11333	broad.mit.edu	37	7	98994127	98994127	+	3'UTR	DEL	C	-	-	rs113663373		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98994127delC	uc003uqe.2	-	6						NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1						cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	CTCCCCCAGTCCCCCCCCCCA	0.542													4	3	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100230357	100230357	+	Intron	DEL	G	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100230357delG	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					aaaaaaaaaagaacctttttt	0.000													5	4	---	---	---	---	
CHCHD3	54927	broad.mit.edu	37	7	132719269	132719271	+	Intron	DEL	TTT	-	-	rs77416363		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132719269_132719271delTTT	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron|CHCHD3_uc011kpn.1_Intron	NM_017812	NP_060282	Q9NX63	CHCH3_HUMAN	coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0						GGATCCAGTCttttttttttttt	0.345													4	3	---	---	---	---	
ARHGEF10	9639	broad.mit.edu	37	8	1806393	1806393	+	Intron	DEL	A	-	-	rs11331147		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1806393delA	uc003wpr.2	+						ARHGEF10_uc003wpq.1_Intron|ARHGEF10_uc003wps.2_Intron|ARHGEF10_uc003wpt.2_5'Flank|ARHGEF10_uc010lrd.1_5'Flank|ARHGEF10_uc003wpu.2_5'Flank	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10						centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		tccccaggtgagtccccaggt	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81213784	81213784	+	IGR	DEL	A	-	-	rs7842505		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81213784delA								TPD52 (129948 upstream) : ZBTB10 (184070 downstream)																							CTCACCCCCCACCACcacaca	0.428													3	4	---	---	---	---	
EFR3A	23167	broad.mit.edu	37	8	132966045	132966046	+	Intron	INS	-	T	T	rs112472883		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132966045_132966046insT	uc003yte.2	+							NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CATTTTCTTCCTTTTTTTTTTT	0.322													6	4	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4850482	4850483	+	Intron	INS	-	T	T	rs140826399	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4850482_4850483insT	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron|RCL1_uc010mhl.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		CTTATGGAGGcttttttttttc	0.406													9	6	---	---	---	---	
PRSS3	5646	broad.mit.edu	37	9	33795418	33795423	+	Intron	DEL	GCCGAG	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33795418_33795423delGCCGAG	uc003ztj.3	+						uc003ztk.1_Intron|PRSS3_uc003zti.3_Intron|PRSS3_uc003ztl.3_5'Flank	NM_007343	NP_031369	P35030	TRY3_HUMAN	mesotrypsin isoform 1 preproprotein						digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)			GCCAAACGTAGCCGAGCTGATGCAAG	0.529													6	3	---	---	---	---	
KIAA0368	23392	broad.mit.edu	37	9	114170786	114170786	+	Intron	DEL	A	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114170786delA	uc004bfe.1	-							NM_001080398	NP_001073867			KIAA0368 protein												0						AACTGCACCTAAAAAAAAAAA	0.348													4	2	---	---	---	---	
IL2RA	3559	broad.mit.edu	37	10	6059068	6059068	+	Intron	DEL	G	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6059068delG	uc001iiz.1	-						IL2RA_uc009xih.1_Intron	NM_000417	NP_000408	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha chain precursor						cell proliferation	integral to membrane	interleukin-2 receptor activity			ovary(1)|skin(1)	2					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	ACAGCCCTTTGGACTGCCTTC	0.433													4	2	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88819234	88819234	+	Intron	DEL	A	-	-	rs35013042		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88819234delA	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TCTATTTAGGAAAAAAAAAAA	0.328													4	3	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097228	135097228	+	Intron	DEL	G	-	-	rs67681147		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097228delG	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		tgcctctcccgcactccctgc	0.055													6	4	---	---	---	---	
NCAPD2	9918	broad.mit.edu	37	12	6630750	6630751	+	Intron	INS	-	G	G	rs146599711	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6630750_6630751insG	uc001qoo.2	+						NCAPD2_uc009zen.1_Intron|NCAPD2_uc010sfd.1_Intron	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						actgctcaggagctgaagtgag	0.000													2	8	---	---	---	---	
ADAMTS20	80070	broad.mit.edu	37	12	43945219	43945220	+	Intron	DEL	CA	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43945219_43945220delCA	uc010skx.1	-							NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with							proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GATGCGCACGCACACACACACA	0.554													4	2	---	---	---	---	
KRT1	3848	broad.mit.edu	37	12	53069236	53069256	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	-	-	rs66529359		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53069236_53069256delTAGCTGCTACCTCCGGAGCCA	uc001sau.1	-	9	1715_1735	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)TATGGCTCCGGAGGTAGCAGCTAC>TAC	p.552_559YGSGGSSY>Y	KRT1_uc001sav.1_Splice_Site_p.G556_splice	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	552_559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						tccggagccgtagctgctacctccggagccatagctgccac	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80632597	80632598	+	IGR	DEL	TG	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80632597_80632598delTG								PPP1R12A (303362 upstream) : PTPRQ (205528 downstream)																							TACACCTATTtgtgtgtgtgtg	0.302													3	3	---	---	---	---	
TEP1	7011	broad.mit.edu	37	14	20871341	20871343	+	Intron	DEL	TAC	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20871341_20871343delTAC	uc001vxe.2	-						TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Intron	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		aaaaaaaaaaTACAATACCAAGG	0.217													11	5	---	---	---	---	
RABGGTA	5875	broad.mit.edu	37	14	24739363	24739364	+	Intron	INS	-	G	G	rs145834132	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24739363_24739364insG	uc001wof.2	-						RABGGTA_uc001woe.2_5'Flank|RABGGTA_uc001wog.2_Intron|RABGGTA_uc001woh.2_Intron|RABGGTA_uc001woi.2_Intron	NM_004581	NP_004572	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase alpha						visual perception		Rab geranylgeranyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(265;0.0184)		CCAGAAGGGAAGGGGGGGGTCA	0.589													10	10	---	---	---	---	
C14orf37	145407	broad.mit.edu	37	14	58699122	58699122	+	Intron	DEL	C	-	-	rs5808963		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58699122delC	uc010tro.1	-						ACTR10_uc001xdf.2_Intron|ACTR10_uc001xdg.2_Intron|ACTR10_uc001xdh.2_Intron|ACTR10_uc010trp.1_Intron|ACTR10_uc010apc.2_Intron	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor							integral to membrane	binding				0						CTGACtttttctttttttttt	0.144													6	3	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53997013	53997014	+	Intron	INS	-	AA	AA	rs35150329		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53997013_53997014insAA	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		acaggGAGTTTAAAAAAAAAAA	0.124													4	2	---	---	---	---	
CCDC33	80125	broad.mit.edu	37	15	74536301	74536301	+	Intron	DEL	C	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74536301delC	uc002axo.2	+							NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)|skin(2)	5						aaaaaaaaaaCACTCAGCCCT	0.308													102	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85795448	85795448	+	IGR	DEL	T	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85795448delT								PDE8A (113078 upstream) : AKAP13 (128423 downstream)																							CCAGAGCTGGTTGAGGCAAGT	0.607													3	3	---	---	---	---	
RSL1D1	26156	broad.mit.edu	37	16	11940251	11940252	+	Intron	INS	-	A	A			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11940251_11940252insA	uc002dbp.1	-						RSL1D1_uc010buv.1_Intron|RSL1D1_uc010uyw.1_Intron|RSL1D1_uc010buw.2_Intron	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1						regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						gactccatctcaaaaaaaaaaa	0.094													9	6	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74372915	74372915	+	Intron	DEL	T	-	-	rs67181940		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74372915delT	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						ACGTAGtttgttttttttttt	0.204													8	4	---	---	---	---	
HOXB2	3212	broad.mit.edu	37	17	46622348	46622349	+	5'UTR	INS	-	C	C	rs138169880	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46622348_46622349insC	uc002inm.2	-	1						NM_002145	NP_002136	P14652	HXB2_HUMAN	homeobox B2						blood circulation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCCCTCCTGCACCCCCCCCGAT	0.495													6	3	---	---	---	---	
VEZF1	7716	broad.mit.edu	37	17	56060635	56060635	+	Frame_Shift_Del	DEL	T	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56060635delT	uc002ivf.1	-	2	296	c.153delA	c.(151-153)AAAfs	p.K51fs	VEZF1_uc010dcn.1_5'UTR	NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	51					cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						CACCCTGAGGTTTCTGAGTTA	0.473													212	7	---	---	---	---	
RPL38	6169	broad.mit.edu	37	17	72205160	72205169	+	Intron	DEL	AAGTTGGAGG	-	-	rs147131226	by1000genomes	TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72205160_72205169delAAGTTGGAGG	uc002jjz.2	+						RPL38_uc002jka.2_Intron	NM_000999	NP_000990	P63173	RL38_HUMAN	ribosomal protein L38						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						TAAAAGTCCCAAGTTGGAGGAACGGGTAAT	0.352													27	9	---	---	---	---	
CCDC102B	79839	broad.mit.edu	37	18	66503898	66503900	+	Intron	DEL	AAA	-	-	rs140287589		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66503898_66503900delAAA	uc002lkk.2	+						CCDC102B_uc002lki.2_Intron|CCDC102B_uc002lkj.1_Intron	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B											ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				ATCAATTTTCAAAAAAAAAAAAA	0.167													4	3	---	---	---	---	
ZNF333	84449	broad.mit.edu	37	19	14829233	14829251	+	Frame_Shift_Del	DEL	CCTATGCATGTAACAAATG	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14829233_14829251delCCTATGCATGTAACAAATG	uc002mzn.2	+	12	1228_1246	c.1094_1112delCCTATGCATGTAACAAATG	c.(1093-1113)TCCTATGCATGTAACAAATGTfs	p.S365fs	ZNF333_uc002mzk.3_Frame_Shift_Del_p.S256fs	NM_032433	NP_115809	Q96JL9	ZN333_HUMAN	zinc finger protein 333	365_371	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GGGGATAAATCCTATGCATGTAACAAATGTGAAAAATCC	0.438													67	8	---	---	---	---	
HNRNPL	3191	broad.mit.edu	37	19	39330958	39330959	+	Frame_Shift_Ins	INS	-	G	G			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39330958_39330959insG	uc010xul.1	-	8	1021_1022	c.1010_1011insC	c.(1009-1011)CCAfs	p.P337fs	HNRNPL_uc010ege.1_5'UTR|HNRNPL_uc002ojj.1_5'UTR|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_5'UTR|HNRNPL_uc002ojl.2_5'UTR|HNRNPL_uc010xum.1_Frame_Shift_Ins_p.P204fs|HNRNPL_uc002ojp.1_5'UTR|HNRNPL_uc010xun.1_Frame_Shift_Ins_p.H45fs	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	337	Pro-rich.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CGTAGTGAGGTGGGGGGGGCCC	0.668													30	8	---	---	---	---	
RBM39	9584	broad.mit.edu	37	20	34328950	34328952	+	Intron	DEL	TTC	-	-	rs8183604		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34328950_34328952delTTC	uc002xeb.2	-						RBM39_uc002xea.2_Intron|RBM39_uc010gfn.2_Intron|RBM39_uc010zvm.1_Intron|RBM39_uc002xeg.2_Intron|RBM39_uc002xec.2_Intron|RBM39_uc002xed.2_Intron|RBM39_uc002xee.2_Intron|RBM39_uc002xef.2_Intron|RBM39_uc010zvn.1_Intron	NM_184234	NP_909122	Q14498	RBM39_HUMAN	RNA binding motif protein 39 isoform a						mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	centrosome|nuclear speck	nucleotide binding|protein binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					GTAAACAtttttctttttttttt	0.177													4	2	---	---	---	---	
CHRNA4	1137	broad.mit.edu	37	20	61991234	61991235	+	Intron	INS	-	GC	GC			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61991234_61991235insGC	uc002yes.2	-						CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_Intron|CHRNA4_uc010gke.1_5'Flank|CHRNA4_uc002yev.1_Intron|CHRNA4_uc010gkf.1_Intron	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit						B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)	tgtgtgtgtgtgtgccgggcgt	0.490													4	2	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074046	62074048	+	Intron	DEL	CAC	-	-			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074046_62074048delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccatcaccatcaccaccatcacc	0.000													6	4	---	---	---	---	
GAGE2A	729447	broad.mit.edu	37	X	49208295	49208296	+	Intron	INS	-	TAT	TAT			TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49208295_49208296insTAT	uc004dnr.3	+						GAGE12J_uc004dnl.3_Intron|GAGE13_uc004dnn.3_Intron|GAGE8_uc011mne.1_Intron|GAGE8_uc011mnf.1_Intron|GAGE8_uc011mng.1_Intron|GAGE8_uc004dnq.3_Intron|GAGE2A_uc004dnv.3_In_Frame_Ins_p.9_10insY|GAGE10_uc010nis.2_Intron|GAGE12J_uc004dnk.3_Intron|GAGE2D_uc004dnp.3_Intron|GAGE2C_uc004dno.3_Intron|GAGE8_uc011mnh.1_Intron|GAGE2C_uc004dnu.3_In_Frame_Ins_p.9_10insY|GAGE2D_uc010njc.2_In_Frame_Ins_p.9_10insY|GAGE2D_uc004dnt.3_In_Frame_Ins_p.9_10insY|GAGE8_uc011mni.1_In_Frame_Ins_p.9_10insY	NM_001127212	NP_001120684	Q6NT46	GAG2A_HUMAN	G antigen 2A												0	Ovarian(276;0.236)					GAAGATCGACCTATCGGCCTAG	0.465													18	7	---	---	---	---	
XPNPEP2	7512	broad.mit.edu	37	X	128885512	128885519	+	Intron	DEL	AAGAAAGA	-	-	rs67526221		TCGA-G9-6348-01A-11D-1786-08	TCGA-G9-6348-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128885512_128885519delAAGAAAGA	uc004eut.1	+							NM_003399	NP_003390	O43895	XPP2_HUMAN	X-prolyl aminopeptidase 2, membrane-bound						cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0						gaaagaaaggaagaaagaaagaaagaaa	0.000													6	4	---	---	---	---	
