Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16907266	16907266	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16907266C>T	uc009vos.1	-	16	2453	c.1565G>A	c.(1564-1566)TGT>TAT	p.C522Y	NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Missense_Mutation_p.C251Y	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	522	NBPF 2.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AGCATCCTGACATTCATCATG	0.443													17	840	---	---	---	---	PASS
MST1P2	11209	broad.mit.edu	37	1	16975947	16975947	+	RNA	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16975947C>T	uc010och.1	+	11		c.1969C>T			MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						AGAGCCAGGCCTACAGCGGGT	0.577													4	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	21752738	21752738	+	RNA	SNP	A	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21752738A>C	uc001bep.1	-	3		c.238T>G								Homo sapiens cDNA FLJ25572 fis, clone JTH05111.																		ATCCACGTCAAGAGAAAAGCC	0.458													8	113	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43783609	43783609	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43783609C>T	uc001ciu.2	+	17	2867	c.2788C>T	c.(2788-2790)CGG>TGG	p.R930W	TIE1_uc010oke.1_Missense_Mutation_p.R885W|TIE1_uc009vwq.2_Missense_Mutation_p.R886W|TIE1_uc010okg.1_Missense_Mutation_p.R575W	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	930	Cytoplasmic (Potential).|Protein kinase.				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGATTTTCTGCGGAAAAGCCG	0.527													28	298	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612168	120612168	+	5'UTR	SNP	C	T	T	rs11801102	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612168C>T	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAAGCCCAGGCGCAAATGCCT	0.677			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	7	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612269	120612269	+	5'UTR	SNP	A	G	G	rs145966861	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612269A>G	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTGCAACGAAGCAGCCTCGT	0.731			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				2	7	---	---	---	---	PASS
ETV3L	440695	broad.mit.edu	37	1	157069117	157069117	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157069117G>T	uc001fqq.1	-	2	397	c.112C>A	c.(112-114)CAG>AAG	p.Q38K		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	38						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				AGCTGGATCTGCCGGGAGCCT	0.617													3	56	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158735740	158735740	+	Missense_Mutation	SNP	A	G	G	rs857826	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158735740A>G	uc010piq.1	-	1	733	c.733T>C	c.(733-735)TTC>CTC	p.F245L		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					ACCACAGTGAAGTGGGAGGCA	0.537													6	153	---	---	---	---	PASS
RGS2	5997	broad.mit.edu	37	1	192780790	192780790	+	3'UTR	SNP	A	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192780790A>C	uc001gsl.2	+	5						NM_002923	NP_002914	P41220	RGS2_HUMAN	regulator of G-protein signaling 2						cell cycle|negative regulation of cardiac muscle hypertrophy|negative regulation of G-protein coupled receptor protein signaling pathway|negative regulation of MAP kinase activity|negative regulation of phospholipase activity|positive regulation of cardiac muscle contraction|regulation of adrenergic receptor signaling pathway|regulation of translation|relaxation of cardiac muscle	cytosol|internal side of plasma membrane|mitochondrion|nucleolus	calmodulin binding|GTPase activator activity|signal transducer activity				0						AAGGACTGTGACCTGCCATAA	0.443													8	17	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200971521	200971521	+	Intron	SNP	G	A	A	rs56770229	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200971521G>A	uc001gvs.1	-						KIF21B_uc001gvr.1_Intron|KIF21B_uc009wzl.1_Intron|KIF21B_uc010ppn.1_Intron|KIF21B_uc001gvt.1_3'UTR	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						AGCAGAGCTCGCGGTTGGGGG	0.637													4	47	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200971528	200971528	+	Intron	SNP	G	T	T	rs41269929	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200971528G>T	uc001gvs.1	-						KIF21B_uc001gvr.1_Intron|KIF21B_uc009wzl.1_Intron|KIF21B_uc010ppn.1_Intron|KIF21B_uc001gvt.1_3'UTR	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						CTCGCGGTTGGGGGGGTAAGG	0.627													3	35	---	---	---	---	PASS
ZNF678	339500	broad.mit.edu	37	1	227842075	227842075	+	Nonsense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227842075C>T	uc001hqw.1	+	4	469	c.124C>T	c.(124-126)CAG>TAG	p.Q42*	ZNF678_uc009xet.1_RNA|ZNF678_uc009xeu.1_RNA	NM_178549	NP_848644	F5GXA7	F5GXA7_HUMAN	zinc finger protein 678	97					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			pancreas(1)	1		Prostate(94;0.0885)				TTTGCCAGAGCAGGATATGAA	0.333													11	134	---	---	---	---	PASS
LPIN1	23175	broad.mit.edu	37	2	11943067	11943067	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11943067C>T	uc010yjn.1	+	15	2087	c.1813C>T	c.(1813-1815)CGC>TGC	p.R605C	LPIN1_uc010yjm.1_Missense_Mutation_p.R690C|LPIN1_uc002rbt.2_Missense_Mutation_p.R605C|LPIN1_uc010yjo.1_Missense_Mutation_p.R106C	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	605					fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TGATGAGGAGCGCGCAGCTGC	0.498													19	172	---	---	---	---	PASS
CNRIP1	25927	broad.mit.edu	37	2	68520911	68520911	+	3'UTR	SNP	C	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68520911C>A	uc002sek.3	-	3					CNRIP1_uc002sej.3_Intron|CNRIP1_uc002sem.1_RNA|CNRIP1_uc002sel.3_RNA	NM_015463	NP_056278	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1								protein binding			liver(1)	1						AATGGTGTGGCATGCCTTGTT	0.433													8	26	---	---	---	---	PASS
SNRNP27	11017	broad.mit.edu	37	2	70130361	70130361	+	Nonsense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70130361C>T	uc002sfw.2	+	5	424	c.397C>T	c.(397-399)CAG>TAG	p.Q133*	SNRNP27_uc002sfv.2_RNA|SNRNP27_uc002sfx.2_Intron	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa	133					mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						AAATGTCTCTCAGAAGAGGAA	0.328													10	117	---	---	---	---	PASS
UXS1	80146	broad.mit.edu	37	2	106710354	106710354	+	3'UTR	SNP	C	G	G			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106710354C>G	uc002tdm.2	-	15					UXS1_uc002tdk.2_3'UTR|UXS1_uc002tdl.2_3'UTR|UXS1_uc002tdn.2_3'UTR|UXS1_uc002tdo.2_3'UTR	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1						cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						AAGCAAGCTTCAGAATGAAAT	0.348													2	10	---	---	---	---	PASS
UBXN4	23190	broad.mit.edu	37	2	136511817	136511817	+	Silent	SNP	A	G	G	rs1050115	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136511817A>G	uc002tur.2	+	4	614	c.303A>G	c.(301-303)GAA>GAG	p.E101E	UBXN4_uc002tus.2_5'UTR	NM_014607	NP_055422	Q92575	UBXN4_HUMAN	UBX domain containing 2	101	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding			skin(2)	2						CTGCAGATGAACTTGTTACAA	0.373													4	83	---	---	---	---	PASS
TTC30A	92104	broad.mit.edu	37	2	178483090	178483090	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178483090G>A	uc002ulo.2	-	1	605	c.340C>T	c.(340-342)CGG>TGG	p.R114W		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	114					cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			CGGAGGACCCGGCTGTGGTAG	0.642													10	71	---	---	---	---	PASS
NDUFS1	4719	broad.mit.edu	37	2	207008763	207008763	+	Silent	SNP	C	A	A	rs1127566	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207008763C>A	uc002vbe.2	-	10	1093	c.966G>T	c.(964-966)GCG>GCT	p.A322A	NDUFS1_uc010ziq.1_Silent_p.A336A|NDUFS1_uc010zir.1_Silent_p.A286A|NDUFS1_uc010zis.1_Silent_p.A265A|NDUFS1_uc010zit.1_Silent_p.A211A|NDUFS1_uc010ziu.1_Silent_p.A206A	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,	322					apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	CGCGAGAGAGCGCATCCTCCC	0.388													4	108	---	---	---	---	PASS
SLC4A3	6508	broad.mit.edu	37	2	220502444	220502444	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220502444G>A	uc002vmp.3	+	17	2946	c.2677G>A	c.(2677-2679)GCA>ACA	p.A893T	SLC4A3_uc002vmo.3_Missense_Mutation_p.A920T|SLC4A3_uc010fwm.2_Missense_Mutation_p.A443T|SLC4A3_uc010fwn.1_Missense_Mutation_p.A402T	NM_005070	NP_005061	P48751	B3A3_HUMAN	solute carrier family 4, anion exchanger, member	893	Helical; (Potential).|Membrane (anion exchange).				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCCAATACGGCACTGCTCTC	0.657													3	56	---	---	---	---	PASS
EPHA4	2043	broad.mit.edu	37	2	222290829	222290829	+	Silent	SNP	C	T	T	rs35860178	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222290829C>T	uc002vmq.2	-	17	2922	c.2880G>A	c.(2878-2880)ACG>ACA	p.T960T	EPHA4_uc002vmr.2_3'UTR|EPHA4_uc010zlm.1_Silent_p.T901T|EPHA4_uc010zln.1_Silent_p.T960T	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor	960	Cytoplasmic (Potential).|SAM.					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TATTCTGGTGCGTGATGGCTG	0.488													5	126	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38768300	38768300	+	Missense_Mutation	SNP	T	C	C	rs57326399	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38768300T>C	uc003ciq.2	-	16	2884	c.2884A>G	c.(2884-2886)ATT>GTT	p.I962V		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	962					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	TTGGCAGCAATGTGGTTCTCA	0.602													5	104	---	---	---	---	PASS
ABCF3	55324	broad.mit.edu	37	3	183908945	183908945	+	Missense_Mutation	SNP	A	C	C	rs140615216		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183908945A>C	uc003fmz.2	+	16	1604	c.1471A>C	c.(1471-1473)ATT>CTT	p.I491L	ABCF3_uc003fna.2_Missense_Mutation_p.I485L|ABCF3_uc003fnb.2_Missense_Mutation_p.I172L	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	491							ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTCGCCGCCAATTCTGCAGCT	0.557													8	119	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505863	195505863	+	Silent	SNP	G	T	T	rs113561118		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505863G>T	uc011bto.1	-	3	12664	c.12204C>A	c.(12202-12204)ACC>ACA	p.T4068T	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	959	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.607													2	5	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141543453	141543453	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141543453G>T	uc010ioj.2	-	21	3969	c.3697C>A	c.(3697-3699)CCC>ACC	p.P1233T		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1233						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				ATGCACACGGGCTTGTCAAAG	0.592													9	53	---	---	---	---	PASS
RXFP1	59350	broad.mit.edu	37	4	159567948	159567948	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159567948G>A	uc003ipz.2	+	16	1433	c.1351G>A	c.(1351-1353)GAC>AAC	p.D451N	RXFP1_uc011cja.1_Missense_Mutation_p.D346N|RXFP1_uc010iqo.2_Missense_Mutation_p.D403N|RXFP1_uc011cjb.1_Missense_Mutation_p.D349N|RXFP1_uc010iqk.2_Missense_Mutation_p.D319N|RXFP1_uc011cjc.1_Missense_Mutation_p.D370N|RXFP1_uc011cjd.1_Missense_Mutation_p.D370N|RXFP1_uc010iql.2_Missense_Mutation_p.D295N|RXFP1_uc011cje.1_Missense_Mutation_p.D478N|RXFP1_uc010iqm.2_Missense_Mutation_p.D418N|RXFP1_uc011cjf.1_Missense_Mutation_p.D320N|RXFP1_uc010iqn.2_Missense_Mutation_p.D396N	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	451	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		TCTAGGTGCCGACTGCTTAAT	0.348													9	85	---	---	---	---	PASS
FRG1	2483	broad.mit.edu	37	4	190883030	190883030	+	Missense_Mutation	SNP	G	T	T	rs112946446		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190883030G>T	uc003izs.2	+	8	874	c.683G>T	c.(682-684)AGT>ATT	p.S228I		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	228					rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AAAGAAGACAGTAAAATTCTT	0.318													6	172	---	---	---	---	PASS
CEP72	55722	broad.mit.edu	37	5	648008	648008	+	Silent	SNP	G	A	A	rs142569661		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:648008G>A	uc003jbf.2	+	11	1827	c.1755G>A	c.(1753-1755)ACG>ACA	p.T585T		NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa	585	Potential.				G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			AGGAGCTCACGCAGATGCTGC	0.602													5	39	---	---	---	---	PASS
MSH3	4437	broad.mit.edu	37	5	79952234	79952234	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79952234C>A	uc003kgz.2	+	2	495	c.242C>A	c.(241-243)ACA>AAA	p.T81K	DHFR_uc011ctl.1_5'Flank|DHFR_uc011ctm.1_5'Flank|DHFR_uc010jap.1_5'Flank|DHFR_uc003kgx.1_5'Flank|DHFR_uc003kgy.1_5'Flank	NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3	81	Interaction with EXO1.				maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ATATAGGCTACAGAAATTGAC	0.388								MMR					10	140	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140741738	140741738	+	Missense_Mutation	SNP	G	C	C	rs62378417	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140741738G>C	uc003ljs.1	+	1	2036	c.2036G>C	c.(2035-2037)CGG>CCG	p.R679P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.R679P|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	679	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGACCGCCGGGAGCCCTCT	0.597													4	78	---	---	---	---	PASS
C5orf45	51149	broad.mit.edu	37	5	179264731	179264731	+	Missense_Mutation	SNP	T	C	C	rs10277	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179264731T>C	uc003mla.2	-	7	736	c.692A>G	c.(691-693)CAA>CGA	p.Q231R	SQSTM1_uc011dgr.1_3'UTR|SQSTM1_uc011dgs.1_3'UTR|SQSTM1_uc003mkw.3_3'UTR|SQSTM1_uc003mkx.2_3'UTR|C5orf45_uc003mky.2_Intron|C5orf45_uc011dgt.1_Intron|C5orf45_uc011dgu.1_Intron|C5orf45_uc003mlc.2_Missense_Mutation_p.Q176R|C5orf45_uc003mlb.2_Missense_Mutation_p.Q97R	NM_016175	NP_057259	Q6NTE8	CE045_HUMAN	hypothetical protein LOC51149 isoform 1	231											0						CAGGACAAATTGCGCCCATTT	0.567													4	90	---	---	---	---	PASS
BTNL8	79908	broad.mit.edu	37	5	180374534	180374534	+	Silent	SNP	G	A	A	rs3733756	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180374534G>A	uc003mmp.2	+	4	930	c.696G>A	c.(694-696)TCG>TCA	p.S232S	BTNL8_uc003mmq.2_Silent_p.S232S|BTNL8_uc011dhg.1_Silent_p.S107S|BTNL8_uc010jll.2_Silent_p.S232S|BTNL8_uc010jlm.2_Silent_p.S116S|BTNL8_uc011dhh.1_Silent_p.S48S	NM_001040462	NP_001035552	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8 isoform 2 precursor	232	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|skin(1)	2	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCCTATATCGTGGCACCTGG	0.398													9	318	---	---	---	---	PASS
HLA-F	3134	broad.mit.edu	37	6	29694720	29694720	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29694720G>A	uc003nno.3	+	7	1221	c.1097G>A	c.(1096-1098)GGG>GAG	p.G366E	HLA-F_uc011dlx.1_Missense_Mutation_p.G366E|HLA-F_uc011dly.1_RNA|LOC285830_uc003nnp.2_RNA|LOC285830_uc011dlz.1_RNA	NM_001098479	NP_001091949	P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	Error:Variant_position_missing_in_P30511_after_alignment					antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity				0						TTTCTCCTGGGGGTGCTCTTC	0.498													11	132	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36931162	36931162	+	Silent	SNP	A	G	G	rs2296934	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36931162A>G	uc003ona.2	+	5	1372	c.1044A>G	c.(1042-1044)GAA>GAG	p.E348E	PI16_uc003omz.1_Intron|PI16_uc003onb.2_Intron|PI16_uc011dts.1_Silent_p.E119E	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	348	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0						GGGCAAGGGAACTCCTACCCC	0.562													3	41	---	---	---	---	PASS
FGD2	221472	broad.mit.edu	37	6	36976637	36976637	+	Missense_Mutation	SNP	G	C	C	rs831510	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36976637G>C	uc010jwp.1	+	2	267	c.96G>C	c.(94-96)CAG>CAC	p.Q32H	FGD2_uc003onf.2_Missense_Mutation_p.Q32H|FGD2_uc011dtu.1_Missense_Mutation_p.Q32H|FGD2_uc003ong.2_5'UTR|FGD2_uc011dtv.1_5'UTR	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	32					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						CCAGAGGCCAGAGGCTAGAGG	0.637													4	83	---	---	---	---	PASS
C6orf204	387119	broad.mit.edu	37	6	118790443	118790443	+	Silent	SNP	T	G	G			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118790443T>G	uc003pxz.1	-	12	2634	c.2046A>C	c.(2044-2046)ACA>ACC	p.T682T		NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a	682	Potential.					centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		ATAAAGAGCATGTCTCATCTG	0.413													10	123	---	---	---	---	PASS
PEG10	23089	broad.mit.edu	37	7	94293246	94293246	+	Silent	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94293246C>T	uc011kie.1	+	2	823	c.606C>T	c.(604-606)ACC>ACT	p.T202T		NM_001040152	NP_001035242	Q86TG7	PEG10_HUMAN	paternally expressed 10 isoform RF1	126	Necessary for interaction with ALK1.				apoptosis|cell differentiation|negative regulation of transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GCATGATGACCGGCCGTGCTG	0.532													7	99	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100686777	100686777	+	Missense_Mutation	SNP	C	T	T	rs138142210	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100686777C>T	uc003uxp.1	+	3	12133	c.12080C>T	c.(12079-12081)ACG>ATG	p.T4027M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4027	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TCTGCATCAACGCTTTCTGCA	0.537													6	149	---	---	---	---	PASS
ADAM28	10863	broad.mit.edu	37	8	24199261	24199261	+	Silent	SNP	C	T	T	rs149263503	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24199261C>T	uc003xdy.2	+	16	1904	c.1821C>T	c.(1819-1821)GGC>GGT	p.G607G	ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_Silent_p.G294G	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	607	Extracellular (Potential).|Cys-rich.				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CTAAGTGTGGCGATAACAAGG	0.408													5	89	---	---	---	---	PASS
WDYHV1	55093	broad.mit.edu	37	8	124440174	124440174	+	Missense_Mutation	SNP	A	G	G	rs6999234	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124440174A>G	uc003yqn.1	+	2	219	c.94A>G	c.(94-96)ATT>GTT	p.I32V	WDYHV1_uc011lij.1_Translation_Start_Site|WDYHV1_uc003yqo.1_5'Flank	NM_018024	NP_060494	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	32					protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2						TGAAGAAAATATTTGGAAGCT	0.294													6	224	---	---	---	---	PASS
OC90	729330	broad.mit.edu	37	8	133053386	133053386	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133053386C>T	uc003ytg.2	-	4	314	c.314G>A	c.(313-315)CGC>CAC	p.R105H	OC90_uc011lix.1_Missense_Mutation_p.R121H	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	121	Phospholipase A2-like 1.				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			ATAGCACCTGCGGTGCTGGAA	0.557													5	94	---	---	---	---	PASS
GSDMD	79792	broad.mit.edu	37	8	144643931	144643931	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144643931C>A	uc010mfe.2	+	10	1459	c.756C>A	c.(754-756)AGC>AGA	p.S252R	GSDMD_uc003yyf.2_Missense_Mutation_p.S300R|GSDMD_uc003yyg.2_Missense_Mutation_p.S252R|GSDMD_uc003yyh.2_Missense_Mutation_p.S183R	NM_024736	NP_079012	P57764	GSDMD_HUMAN	gasdermin D	252											0						GTTCCACGAGCGAAGGCGCCT	0.672													3	15	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	43861081	43861081	+	RNA	SNP	T	G	G	rs62536501		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43861081T>G	uc004acz.1	+	11		c.1905T>G								Homo sapiens cDNA FLJ30083 fis, clone BGGI12001097, weakly similar to Homo sapiens contactin associated protein (Caspr) mRNA.																		GGGCACCCGCTCTCGGCTGTG	0.746													2	7	---	---	---	---	PASS
LHX3	8022	broad.mit.edu	37	9	139091593	139091593	+	Missense_Mutation	SNP	C	A	A	rs142521088		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139091593C>A	uc004cha.2	-	3	482	c.385G>T	c.(385-387)GAC>TAC	p.D129Y	LHX3_uc004cgz.2_Missense_Mutation_p.D134Y	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a	129	LIM zinc-binding 2.				inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		TAGAACTCGTCGCCCGTGGCC	0.672													9	38	---	---	---	---	PASS
AGAP6	414189	broad.mit.edu	37	10	51748381	51748381	+	5'UTR	SNP	T	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51748381T>C	uc001jix.3	+	1						NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						AGACCATCTCTGCAAGTGCAG	0.706													3	4	---	---	---	---	PASS
KRTAP5-4	387267	broad.mit.edu	37	11	1642884	1642884	+	Missense_Mutation	SNP	A	C	C	rs6578597	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1642884A>C	uc009ycy.1	-	4	665	c.578T>G	c.(577-579)TTC>TGC	p.F193C		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	207	9 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCTGAAGAGAAGCAGCAGGG	0.632													7	170	---	---	---	---	PASS
WIT1	51352	broad.mit.edu	37	11	32460593	32460593	+	RNA	SNP	T	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32460593T>C	uc010rec.1	+	2		c.1311T>C			WIT1_uc010red.1_RNA|WIT1_uc010ree.1_Intron	NR_023920				full-length cDNA clone CS0DC024YP12 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).												0	Breast(20;0.247)					ACCCCGGCGCTGTCCACTGCA	0.617													3	54	---	---	---	---	PASS
ALKBH3	221120	broad.mit.edu	37	11	43940602	43940602	+	Missense_Mutation	SNP	C	G	G	rs2434470	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43940602C>G	uc001mxs.2	+	9	1127	c.684C>G	c.(682-684)GAC>GAG	p.D228E	ALKBH3_uc009ykp.2_RNA|ALKBH3_uc001mxt.2_RNA|ALKBH3_uc009ykq.2_Missense_Mutation_p.D81E|uc001mxu.1_Intron	NM_139178	NP_631917	Q96Q83	ALKB3_HUMAN	AlkB homolog 3	228	Fe2OG dioxygenase.				DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation	mitochondrion|nucleoplasm	damaged DNA binding|DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0					Vitamin C(DB00126)	AGAATGGAGACTACACATATG	0.413								Direct_reversal_of_damage					8	174	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76885779	76885779	+	Intron	SNP	G	A	A	rs2276283	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76885779G>A	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_5'UTR	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						TGGCCCTGATGCCCTTGGCTG	0.632													3	6	---	---	---	---	PASS
POU2F3	25833	broad.mit.edu	37	11	120187971	120187971	+	Missense_Mutation	SNP	G	A	A	rs2282537	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120187971G>A	uc001pxc.2	+	12	1271	c.1169G>A	c.(1168-1170)AGG>AAG	p.R390K	POU2F3_uc010rzk.1_Missense_Mutation_p.R344K|POU2F3_uc010rzl.1_Missense_Mutation_p.R320K|POU2F3_uc001pxe.1_Missense_Mutation_p.R175K|POU2F3_uc001pxf.1_RNA	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor	390	Ser-rich.				negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)		AACAACAGCAGGCCTTCATCT	0.522													5	111	---	---	---	---	PASS
NTM	50863	broad.mit.edu	37	11	132081914	132081914	+	Splice_Site	SNP	A	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132081914A>C	uc001qgp.2	+	3	1065	c.401_splice	c.e3-2	p.V134_splice	NTM_uc001qgm.2_Splice_Site_p.V134_splice|NTM_uc010sch.1_Splice_Site_p.V125_splice|NTM_uc010sci.1_Splice_Site_p.V134_splice|NTM_uc010scj.1_Splice_Site_p.V93_splice|NTM_uc001qgo.2_Splice_Site_p.V134_splice|NTM_uc001qgq.2_Splice_Site_p.V134_splice|NTM_uc001qgr.2_Splice_Site	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						TTGTTTCCACAGTATCTCCCA	0.383													4	35	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6686950	6686950	+	Splice_Site	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6686950C>T	uc001qpo.2	-	37	5525	c.5361_splice	c.e37+1	p.K1787_splice	CHD4_uc001qpn.2_Splice_Site_p.K1780_splice|CHD4_uc001qpp.2_Splice_Site_p.K1812_splice|uc001qpq.1_5'Flank	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						CAACCGCTCACCTTAAACCTT	0.463													4	84	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6696651	6696651	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6696651G>A	uc001qpo.2	-	25	3942	c.3778C>T	c.(3778-3780)CGT>TGT	p.R1260C	CHD4_uc001qpn.2_Missense_Mutation_p.R1253C|CHD4_uc001qpp.2_Missense_Mutation_p.R1257C	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1260					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TCCTGGTTACGGTCTAGCAGC	0.458													22	150	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546314	11546314	+	Missense_Mutation	SNP	T	C	C	rs34305575	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546314T>C	uc010shk.1	-	3	733	c.698A>G	c.(697-699)CAA>CGA	p.Q233R		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TCGGGCACTTTGGGACTTGTT	0.602													13	464	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19511256	19511256	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19511256A>G	uc001reb.2	+	21	2821	c.2735A>G	c.(2734-2736)CAT>CGT	p.H912R	PLEKHA5_uc010sie.1_Missense_Mutation_p.H1073R|PLEKHA5_uc001rea.2_Missense_Mutation_p.H970R|PLEKHA5_uc009zin.2_Missense_Mutation_p.H670R|PLEKHA5_uc010sif.1_Missense_Mutation_p.H901R|PLEKHA5_uc010sig.1_Missense_Mutation_p.H894R|PLEKHA5_uc010sih.1_Missense_Mutation_p.H867R|PLEKHA5_uc001rec.1_Missense_Mutation_p.H721R|PLEKHA5_uc009zio.2_Missense_Mutation_p.H178R	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	912							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATAAGAAGACATCAACAAGCG	0.433													4	36	---	---	---	---	PASS
PFKM	5213	broad.mit.edu	37	12	48533667	48533667	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48533667T>C	uc001rrc.2	+	13	1333	c.1163T>C	c.(1162-1164)CTA>CCA	p.L388P	PFKM_uc001rra.1_Missense_Mutation_p.L73P|PFKM_uc001rrb.1_Missense_Mutation_p.L459P|PFKM_uc001rrd.2_Missense_Mutation_p.L73P|PFKM_uc001rre.1_Missense_Mutation_p.L388P|PFKM_uc001rrg.1_Missense_Mutation_p.L357P	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle	388					fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						TACAAGCTTCTAGCTCATGTC	0.512													4	37	---	---	---	---	PASS
KRT86	3892	broad.mit.edu	37	12	52695668	52695668	+	Intron	SNP	C	A	A	rs56016927	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52695668C>A	uc010snq.1	+						KRT86_uc009zmg.2_Intron|KRT81_uc001sac.2_Intron|KRT86_uc001sad.2_5'UTR	NM_002284	NP_002275	O43790	KRT86_HUMAN	keratin 86						cytoskeleton organization	keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.189)		ACGTCTCCATCCTCAGAACCT	0.592													6	79	---	---	---	---	PASS
KRT83	3889	broad.mit.edu	37	12	52709845	52709845	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52709845G>T	uc001saf.2	-	7	1157	c.1094C>A	c.(1093-1095)GCC>GAC	p.A365D		NM_002282	NP_002273	P78385	KRT83_HUMAN	keratin 83	365	Rod.|Coil 2.				epidermis development	keratin filament	structural molecule activity			skin(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		ATCACTGAGGGCCGCCTCACC	0.597													6	47	---	---	---	---	PASS
LRIG3	121227	broad.mit.edu	37	12	59282122	59282122	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59282122C>G	uc001sqr.2	-	7	1182	c.936G>C	c.(934-936)AAG>AAC	p.K312N	LRIG3_uc009zqh.2_Missense_Mutation_p.K252N|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	312	LRR 11.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			GCTCACTGAGCTTCTGGCAGA	0.493													8	77	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72036214	72036214	+	Splice_Site	SNP	A	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72036214A>C	uc001swo.2	-	6	1986	c.1627_splice	c.e6+1	p.A543_splice		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						TTTGGCTCATACCTGGAGAAC	0.343													7	68	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101488062	101488062	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101488062C>T	uc010svm.1	+	18	2302	c.1730C>T	c.(1729-1731)ACG>ATG	p.T577M	ANO4_uc001thw.2_Missense_Mutation_p.T542M|ANO4_uc001thx.2_Missense_Mutation_p.T577M|ANO4_uc001thy.2_Missense_Mutation_p.T97M	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	577	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CTGCTTCTGACGAATTTAGGT	0.328										HNSCC(74;0.22)			5	55	---	---	---	---	PASS
ANAPC5	51433	broad.mit.edu	37	12	121746472	121746472	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121746472G>T	uc001uag.2	-	17	2201	c.2079C>A	c.(2077-2079)AAC>AAA	p.N693K	ANAPC5_uc010szu.1_Missense_Mutation_p.N359K|ANAPC5_uc001uae.2_Missense_Mutation_p.N257K|ANAPC5_uc010szv.1_Missense_Mutation_p.N295K|ANAPC5_uc001uaf.2_RNA|ANAPC5_uc001uah.2_Missense_Mutation_p.N581K	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a	693	TPR 4.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTTCATTGAGGTTCTCGATGG	0.453													7	103	---	---	---	---	PASS
COG3	83548	broad.mit.edu	37	13	46066301	46066301	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46066301G>T	uc001vak.2	+	11	1204	c.1103G>T	c.(1102-1104)AGT>ATT	p.S368I	COG3_uc001vai.2_Missense_Mutation_p.S368I|COG3_uc001vaj.1_Missense_Mutation_p.S368I|COG3_uc010tfv.1_Missense_Mutation_p.S205I|COG3_uc010aci.2_Missense_Mutation_p.S144I	NM_031431	NP_113619	Q96JB2	COG3_HUMAN	component of golgi transport complex 3	368					ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		CAGGTTCGTAGTGGCTGTGCC	0.383													3	34	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21866026	21866026	+	Silent	SNP	T	C	C	rs61752837	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21866026T>C	uc001was.1	-	27	4264	c.4170A>G	c.(4168-4170)GCA>GCG	p.A1390A	CHD8_uc001war.1_Silent_p.A1286A|SNORD8_uc001wau.1_5'Flank	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1669					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GATGTTCTGCTGCAATTGCTT	0.403													3	33	---	---	---	---	PASS
RIPK3	11035	broad.mit.edu	37	14	24808388	24808388	+	Silent	SNP	A	G	G	rs3181247	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24808388A>G	uc001wpb.2	-	3	514	c.304T>C	c.(304-306)TTG>CTG	p.L102L	RIPK3_uc001wpa.2_5'Flank|RIPK3_uc010alq.2_RNA|RIPK3_uc010toi.1_5'UTR|RIPK3_uc010toj.1_Silent_p.L102L	NM_006871	NP_006862	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	102	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals	cytoplasm	ATP binding|protein binding|transcription coactivator activity			central_nervous_system(2)|ovary(1)|lung(1)	4				GBM - Glioblastoma multiforme(265;0.0181)		AGCCCCGACAAGGAGCCGTTC	0.572													4	61	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64612845	64612845	+	Silent	SNP	C	T	T	rs11629287	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64612845C>T	uc001xgm.2	+	84	15773	c.15543C>T	c.(15541-15543)ATC>ATT	p.I5181I	SYNE2_uc001xgl.2_Silent_p.I5181I|SYNE2_uc010apy.2_Silent_p.I1566I|SYNE2_uc001xgn.2_Silent_p.I143I|SYNE2_uc001xgo.2_RNA	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5181	Spectrin 3.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAATACAGATCTTGAACAACT	0.353													3	46	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64612858	64612858	+	Missense_Mutation	SNP	C	A	A	rs10151658	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64612858C>A	uc001xgm.2	+	84	15786	c.15556C>A	c.(15556-15558)CTG>ATG	p.L5186M	SYNE2_uc001xgl.2_Missense_Mutation_p.L5186M|SYNE2_uc010apy.2_Missense_Mutation_p.L1571M|SYNE2_uc001xgn.2_Missense_Mutation_p.L148M|SYNE2_uc001xgo.2_RNA	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5186	Spectrin 3.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAACAACTGGCTGGAAGCACA	0.383													3	59	---	---	---	---	PASS
TTLL5	23093	broad.mit.edu	37	14	76224211	76224211	+	Intron	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76224211C>T	uc001xrx.2	+						TTLL5_uc010ask.1_Intron|TTLL5_uc001xrz.2_Nonsense_Mutation_p.R92*|TTLL5_uc001xry.1_Intron	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		AGGAAGAACACGGTAATTGAC	0.383													3	53	---	---	---	---	PASS
XRCC3	7517	broad.mit.edu	37	14	104165753	104165753	+	Missense_Mutation	SNP	G	A	A	rs861539	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104165753G>A	uc001yny.3	-	8	1102	c.722C>T	c.(721-723)ACG>ATG	p.T241M	KLC1_uc010tyf.1_Intron|KLC1_uc001yno.2_Intron|KLC1_uc001yns.2_Intron|XRCC3_uc001ynx.3_Missense_Mutation_p.T241M|XRCC3_uc001ynz.3_Missense_Mutation_p.T241M|XRCC3_uc001yoa.3_Missense_Mutation_p.T241M	NM_005432	NP_005423	O43542	XRCC3_HUMAN	X-ray repair cross complementing protein 3	241					DNA recombination|DNA repair	mitochondrion|nucleus|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)		CTCACGCAGCGTGGCCCCCAG	0.637								Direct_reversal_of_damage|Homologous_recombination					3	31	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105411700	105411700	+	Missense_Mutation	SNP	A	G	G	rs4264326	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105411700A>G	uc010axc.1	-	7	10208	c.10088T>C	c.(10087-10089)GTG>GCG	p.V3363A	AHNAK2_uc001ypx.2_Missense_Mutation_p.V3263A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3363						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTCCAGGTCCACAGAAGGGAG	0.662													8	200	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106091329	106091329	+	RNA	SNP	G	C	C	rs8015545	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106091329G>C	uc010tyt.1	-	3647		c.62179C>G			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron					Parts of antibodies, mostly variable regions.												0						TCCTGGTGCAGGACGGTGAGG	0.572													8	275	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106092152	106092152	+	RNA	SNP	G	A	A	rs10137020	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106092152G>A	uc010tyt.1	-	3645		c.61866C>T			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron					Parts of antibodies, mostly variable regions.												0						TGTGATCTACGTTGCAGGTGT	0.607													5	146	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106110137	106110137	+	RNA	SNP	C	T	T	rs8009156	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106110137C>T	uc010tyt.1	-	3642		c.61114G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_RNA					Parts of antibodies, mostly variable regions.												0						TGCACCTCCACGCCGTCCACG	0.612													6	175	---	---	---	---	PASS
PLA2G4F	255189	broad.mit.edu	37	15	42446634	42446634	+	Silent	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42446634C>T	uc001zoz.2	-	3	270	c.207G>A	c.(205-207)GTG>GTA	p.V69V	PLA2G4F_uc010bcr.2_5'UTR|PLA2G4F_uc001zpa.2_5'UTR|PLA2G4F_uc010bcs.2_5'UTR	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	69	C2.				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GCCACAGTTGCACATAGCAGT	0.597													5	32	---	---	---	---	PASS
PLA2G15	23659	broad.mit.edu	37	16	68293320	68293320	+	Silent	SNP	T	C	C	rs3743739	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68293320T>C	uc002evr.2	+	6	1082	c.999T>C	c.(997-999)GGT>GGC	p.G333G	PLA2G15_uc010vld.1_3'UTR|PLA2G15_uc010vle.1_Silent_p.G239G|PLA2G15_uc010vlf.1_Silent_p.G133G|PLA2G15_uc002evs.2_Silent_p.G154G	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase A2)	333					fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1						GCCTCTATGGTACTGGCGTCC	0.562													4	88	---	---	---	---	PASS
GSG2	83903	broad.mit.edu	37	17	3628362	3628362	+	Missense_Mutation	SNP	T	C	C	rs3809806	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3628362T>C	uc002fwp.2	+	1	1166	c.1133T>C	c.(1132-1134)GTC>GCC	p.V378A	ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	NM_031965	NP_114171	Q8TF76	HASP_HUMAN	haspin	378					cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity				0						TTACAGAATGTCTGCTTTTGG	0.483													5	84	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44111613	44111613	+	Silent	SNP	A	G	G	rs17574604		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44111613A>G	uc002ikb.2	-	10	2665	c.2580T>C	c.(2578-2580)TTT>TTC	p.F860F	KIAA1267_uc002ikc.2_Silent_p.F860F|KIAA1267_uc002ikd.2_Silent_p.F860F|KIAA1267_uc010dav.2_Silent_p.F859F|KIAA1267_uc010wkb.1_Silent_p.F191F|KIAA1267_uc010wkc.1_Silent_p.F128F	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	860						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				TGTTAATATCAAATGAGCTCT	0.398													3	50	---	---	---	---	PASS
GOSR2	9570	broad.mit.edu	37	17	45017859	45017859	+	3'UTR	SNP	A	G	G	rs758392	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45017859A>G	uc002ila.2	+	6					GOSR2_uc010wkh.1_Intron|GOSR2_uc002ikz.2_Intron	NM_004287	NP_004278	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2 isoform A						cellular membrane fusion|ER to Golgi vesicle-mediated transport|protein transport	Golgi membrane|integral to membrane	transporter activity			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(9;0.102)			CTAGCGCAGGACTTTTGGTAA	0.527													4	64	---	---	---	---	PASS
USH1G	124590	broad.mit.edu	37	17	72915904	72915904	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72915904G>A	uc002jme.1	-	2	1210	c.1027C>T	c.(1027-1029)CGG>TGG	p.R343W	USH1G_uc010wro.1_Missense_Mutation_p.R240W	NM_173477	NP_775748	Q495M9	USH1G_HUMAN	Usher syndrome 1G protein	343					equilibrioception|photoreceptor cell maintenance|sensory perception of sound	actin cytoskeleton				skin(2)	2	all_lung(278;0.172)|Lung NSC(278;0.207)					AGCCGACCCCGCGGCGCTCCC	0.687													4	84	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76459153	76459153	+	5'UTR	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76459153C>T	uc010dhp.1	-	2					DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GAGGCCTTGACTTCCCACTAC	0.512													3	27	---	---	---	---	PASS
NPTX1	4884	broad.mit.edu	37	17	78444658	78444658	+	Silent	SNP	T	G	G	rs12943620	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78444658T>G	uc002jyp.1	-	5	1412	c.1254A>C	c.(1252-1254)GGA>GGC	p.G418G		NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor	418	Pentaxin.				central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			TGGTGGCCCCTCCGTAGATCT	0.662													4	71	---	---	---	---	PASS
CYP4F22	126410	broad.mit.edu	37	19	15648715	15648715	+	Silent	SNP	G	A	A	rs11666601	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15648715G>A	uc002nbh.3	+	7	749	c.582G>A	c.(580-582)GCG>GCA	p.A194A		NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,	194						endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						AGGGCTCAGCGGTCTCCCTTG	0.517													4	102	---	---	---	---	PASS
FBXO17	115290	broad.mit.edu	37	19	39433299	39433299	+	Silent	SNP	A	G	G	rs8113389	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39433299A>G	uc002okg.1	-	6	958	c.786T>C	c.(784-786)TAT>TAC	p.Y262Y	SARS2_uc010xuq.1_Intron|FBXO17_uc002okf.1_Silent_p.Y271Y	NM_024907	NP_079183	Q96EF6	FBX17_HUMAN	F-box protein FBG4 isoform 2	262	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding				0	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CAAGGGCGCCATAGTGCCCCA	0.567													4	111	---	---	---	---	PASS
IL28B	282617	broad.mit.edu	37	19	39735644	39735644	+	5'Flank	SNP	C	G	G	rs28416813	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39735644C>G	uc010xut.1	-						IL28B_uc010xuu.1_5'UTR	NM_172139	NP_742151	Q8IZI9	IL28B_HUMAN	interleukin 28B						response to virus	extracellular space	cytokine activity				0	all_cancers(60;2.81e-07)|all_lung(34;7.81e-08)|Lung NSC(34;9.29e-08)|all_epithelial(25;3.9e-07)|Ovarian(47;0.0315)		Epithelial(26;1.55e-27)|all cancers(26;1.41e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			TGAGGGAATGCAGAGGCTGCC	0.587													3	56	---	---	---	---	PASS
PSG8	440533	broad.mit.edu	37	19	43257330	43257330	+	3'UTR	SNP	T	G	G			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43257330T>G	uc002ouh.2	-	6					PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_3'UTR|PSG8_uc010ein.2_3'UTR|PSG8_uc002ouj.3_3'UTR|PSG8_uc002ouk.3_3'UTR|PSG8_uc002oul.3_3'UTR|PSG8_uc002oum.3_3'UTR|PSG1_uc002oun.2_RNA	NM_001130167	NP_001123639	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform							extracellular region					0		Prostate(69;0.00899)				agtttgagcatctgttgttat	0.000													2	7	---	---	---	---	PASS
LILRA4	23547	broad.mit.edu	37	19	54849889	54849889	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54849889C>T	uc002qfj.2	-	3	190	c.133G>A	c.(133-135)GTG>ATG	p.V45M	LILRA4_uc002qfi.2_Translation_Start_Site	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	45	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CAGATGGTCACGGGGTTATGC	0.537											OREG0003656	type=REGULATORY REGION|Gene=LILRA4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	7	98	---	---	---	---	PASS
ZNF134	7693	broad.mit.edu	37	19	58132430	58132430	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58132430C>T	uc002qpn.2	+	3	1042	c.943C>T	c.(943-945)CCT>TCT	p.P315S	ZNF134_uc002qpo.2_Missense_Mutation_p.P142S|ZNF211_uc010yhb.1_5'UTR	NM_003435	NP_003426	P52741	ZN134_HUMAN	zinc finger protein 134	315						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		TGGAGAAAATCCTTATGATTG	0.418													4	104	---	---	---	---	PASS
SLC23A2	9962	broad.mit.edu	37	20	4854682	4854682	+	Silent	SNP	A	G	G	rs1110277	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4854682A>G	uc002wlg.1	-	11	1377	c.1002T>C	c.(1000-1002)GAT>GAC	p.D334D	SLC23A2_uc010zqr.1_Silent_p.D219D|SLC23A2_uc002wlh.1_Silent_p.D334D|SLC23A2_uc002wli.2_Silent_p.D333D	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	334					L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						GAGGGAAGACATCTGTCACCG	0.562													4	93	---	---	---	---	PASS
FERMT1	55612	broad.mit.edu	37	20	6064731	6064731	+	Silent	SNP	C	T	T	rs2232079	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6064731C>T	uc002wmr.2	-	13	2463	c.1674G>A	c.(1672-1674)GCG>GCA	p.A558A	FERMT1_uc002wmq.2_Silent_p.A111A|FERMT1_uc010gbt.2_Silent_p.A301A	NM_017671	NP_060141	Q9BQL6	FERM1_HUMAN	kindlin-1	558	FERM.				cell adhesion|establishment of epithelial cell polarity|keratinocyte migration|keratinocyte proliferation	cytosol|focal adhesion|ruffle membrane	binding			ovary(1)|pancreas(1)|skin(1)	3						GTGACTGCCACGCCTGGATGA	0.527													3	38	---	---	---	---	PASS
BCAS1	8537	broad.mit.edu	37	20	52561469	52561469	+	Missense_Mutation	SNP	A	G	G	rs1055246	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52561469A>G	uc002xws.2	-	12	2085	c.1747T>C	c.(1747-1749)TCC>CCC	p.S583P	BCAS1_uc010zza.1_Missense_Mutation_p.S249P|BCAS1_uc010zzb.1_Missense_Mutation_p.S509P|BCAS1_uc010gim.2_Missense_Mutation_p.S439P|BCAS1_uc002xwt.2_Missense_Mutation_p.S569P|BCAS1_uc010gil.1_Missense_Mutation_p.S505P	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	583						cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			GTTTACTTGGATTTGCCAACT	0.488													7	210	---	---	---	---	PASS
GART	2618	broad.mit.edu	37	21	34903824	34903824	+	Nonsense_Mutation	SNP	C	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34903824C>A	uc002yrx.2	-	6	703	c.568G>T	c.(568-570)GAA>TAA	p.E190*	GART_uc002yrz.2_Nonsense_Mutation_p.E190*|GART_uc010gmd.2_5'UTR|GART_uc002yry.2_Nonsense_Mutation_p.E190*|GART_uc002ysa.2_Nonsense_Mutation_p.E190*	NM_000819	NP_000810	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase,	190	ATP (By similarity).|ATP-grasp.				'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding			ovary(1)	1					Pemetrexed(DB00642)	AGAAGTTCTTCAATGACAATT	0.353													16	168	---	---	---	---	PASS
GNAZ	2781	broad.mit.edu	37	22	23438191	23438191	+	Silent	SNP	C	T	T	rs1805058	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23438191C>T	uc002zwu.1	+	2	846	c.309C>T	c.(307-309)GAC>GAT	p.D103D	RTDR1_uc002zwt.2_Intron	NM_002073	NP_002064	P19086	GNAZ_HUMAN	guanine nucleotide binding protein, alpha z	103						endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity			kidney(1)|skin(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		GCGCCTACGACGCTGTGCAGC	0.667													7	172	---	---	---	---	PASS
C22orf31	25770	broad.mit.edu	37	22	29456733	29456733	+	Silent	SNP	T	C	C	rs6005977	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29456733T>C	uc003aej.1	-	2	229	c.102A>G	c.(100-102)TCA>TCG	p.S34S		NM_015370	NP_056185	O95567	CV031_HUMAN	hypothetical protein LOC25770	34											0						TGAGAGCCGGTGAGTCCACAT	0.502													5	155	---	---	---	---	PASS
CENPM	79019	broad.mit.edu	37	22	42341934	42341934	+	Silent	SNP	A	G	G	rs35542507	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42341934A>G	uc003bbn.2	-	3	281	c.213T>C	c.(211-213)AAT>AAC	p.N71N	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|CENPM_uc003bbm.2_Silent_p.N37N|CENPM_uc003bbo.2_Silent_p.N71N|CENPM_uc003bbp.1_Silent_p.N71N	NM_024053	NP_076958	Q9NSP4	CENPM_HUMAN	centromere protein M isoform a	71					mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleus					0						TGCTGTGAAGATTAACCACAA	0.537													3	57	---	---	---	---	PASS
MAGEB4	4115	broad.mit.edu	37	X	30261002	30261002	+	Silent	SNP	A	G	G	rs2071311	byFrequency	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30261002A>G	uc004dcb.2	+	1	834	c.750A>G	c.(748-750)GTA>GTG	p.V250V	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	250	MAGE.									ovary(1)	1						AAGATCTGGTACAGGAAAAAT	0.483													3	35	---	---	---	---	PASS
LOC200030	200030	broad.mit.edu	37	1	148006620	148006631	+	Intron	DEL	AGAGAGAGAGAG	-	-	rs141222110	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148006620_148006631delAGAGAGAGAGAG	uc001eqf.2	-						LOC200030_uc010ozz.1_5'Flank|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc001eqq.2_Intron|NBPF14_uc010pad.1_Intron|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						acacacacacagagagagagagagagagagag	0.340													4	2	---	---	---	---	
PRUNE	58497	broad.mit.edu	37	1	150996971	150996972	+	Intron	INS	-	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150996971_150996972insA	uc001ewh.1	+						PRUNE_uc001ewi.1_Intron|PRUNE_uc010pco.1_Intron|PRUNE_uc001ewj.1_Intron|PRUNE_uc001ewk.1_5'Flank	NM_021222	NP_067045	Q86TP1	PRUNE_HUMAN	prune							cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			aactccgtctcaaaaaaaaaaa	0.208													9	4	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45645816	45645816	+	Intron	DEL	A	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45645816delA	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AAGGGAGTTTaaaaaaaaaaa	0.199													4	2	---	---	---	---	
CASP10	843	broad.mit.edu	37	2	202060401	202060401	+	Intron	DEL	T	-	-	rs41363644		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202060401delT	uc002uxl.1	+						CASP10_uc002uxi.1_Intron|CASP10_uc010zhn.1_Intron|CASP10_uc002uxj.1_Intron|CASP10_uc002uxk.1_Intron|CASP10_uc010fta.1_Intron|CASP10_uc002uxm.1_Intron|CASP10_uc010ftb.1_Intron	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein						apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						TGCTTCAGTAttttttttttc	0.214													6	3	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32769472	32769483	+	Intron	DEL	TTTATTTATTTA	-	-	rs71695725		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32769472_32769483delTTTATTTATTTA	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						CATTTCTCTTtttatttatttatttatttatt	0.151													5	3	---	---	---	---	
HTR3E	285242	broad.mit.edu	37	3	183821908	183821908	+	Intron	DEL	T	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183821908delT	uc010hxq.2	+						HTR3E_uc003fml.3_Intron|HTR3E_uc003fmm.2_Intron|HTR3E_uc010hxr.2_Intron|HTR3E_uc003fmn.2_Intron	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E							integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			ATTTCATAACTTTTTTTTTTA	0.333													6	3	---	---	---	---	
CCRN4L	25819	broad.mit.edu	37	4	139964068	139964069	+	Intron	INS	-	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139964068_139964069insA	uc003ihl.2	+						CCRN4L_uc003ihk.1_Intron	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like						rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					aactccatctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
KIAA1712	80817	broad.mit.edu	37	4	175238739	175238739	+	3'UTR	DEL	T	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175238739delT	uc003itr.2	+	12					KIAA1712_uc010iro.2_Intron|KIAA1712_uc003its.2_RNA	NM_001040157	NP_001035247	Q9C0F1	CEP44_HUMAN	HBV PreS1-transactivated protein 3 isoform a							centrosome|midbody|spindle pole					0		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)		CTTGTGTCACTTTTTTTTTTT	0.299													4	2	---	---	---	---	
TRIO	7204	broad.mit.edu	37	5	14401279	14401280	+	Intron	DEL	TG	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14401279_14401280delTG	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					TGTTGTTGTTTGTGTGTGTGTG	0.342													4	2	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16762252	16762253	+	Intron	INS	-	T	T	rs76973167		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16762252_16762253insT	uc003jft.3	-						MYO10_uc010itx.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						aaaaaaaaaaaaTACAATGCCT	0.332													10	6	---	---	---	---	
PHIP	55023	broad.mit.edu	37	6	79725154	79725154	+	Intron	DEL	A	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79725154delA	uc003pir.2	-						PHIP_uc011dyp.1_Intron	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		AAAAAACAGCAAATATCTACT	0.328													4	2	---	---	---	---	
EPHB4	2050	broad.mit.edu	37	7	100410929	100410931	+	Intron	DEL	TTT	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100410929_100410931delTTT	uc003uwn.1	-						EPHB4_uc003uwm.1_Intron|EPHB4_uc010lhj.1_Intron	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor						cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					GTCTCCGTGGttttttttttttt	0.291													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100552898	100552898	+	RNA	DEL	G	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100552898delG	uc003uxk.1	+	2		c.2043delG			uc003uxl.1_Frame_Shift_Del_p.G415fs					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		TGACAATGGTGGCACCTGGGA	0.567													157	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																							TTCTTCTCTTCTCTTCTTGTTT	0.277													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383711	42383712	+	IGR	INS	-	C	C			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383711_42383712insC								None (None upstream) : LOC441666 (443603 downstream)																							tcaaatggaatcaaaataacca	0.000													4	2	---	---	---	---	
CYP26C1	340665	broad.mit.edu	37	10	94826082	94826088	+	Intron	DEL	CCTGCCG	-	-	rs61863115	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94826082_94826088delCCTGCCG	uc010qns.1	+						CYP26C1_uc009xud.2_Intron	NM_183374	NP_899230	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C,						anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			central_nervous_system(1)	1		Colorectal(252;0.122)				cctcctgcctcctgccgcctgccgcct	0.546													3	3	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78224970	78224975	+	5'Flank	DEL	AGAGAC	-	-	rs72186592	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224970_78224975delAGAGAC	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						agagagagagagagacagagagagag	0.204										HNSCC(70;0.22)			5	3	---	---	---	---	
USP30	84749	broad.mit.edu	37	12	109490426	109490427	+	5'UTR	INS	-	CGGCGG	CGGCGG	rs140371213	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109490426_109490427insCGGCGG	uc010sxi.1	+	1					USP30_uc001tnu.3_Intron	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						ATCCCTCGGTCcggcggcggcg	0.589													3	5	---	---	---	---	
THSD1	55901	broad.mit.edu	37	13	52952999	52952999	+	Intron	DEL	T	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52952999delT	uc001vgo.2	-						THSD1_uc001vgp.2_Intron|THSD1_uc010tgz.1_Intron|THSD1_uc010aea.2_Intron	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1							extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		ttttcttttcttttttttttt	0.129													4	3	---	---	---	---	
IQGAP1	8826	broad.mit.edu	37	15	91018049	91018049	+	Intron	DEL	T	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91018049delT	uc002bpl.1	+							NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CCATAAGAGCttttttttttt	0.274													9	4	---	---	---	---	
RSL1D1	26156	broad.mit.edu	37	16	11940251	11940252	+	Intron	INS	-	A	A			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11940251_11940252insA	uc002dbp.1	-						RSL1D1_uc010buv.1_Intron|RSL1D1_uc010uyw.1_Intron|RSL1D1_uc010buw.2_Intron	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1						regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						gactccatctcaaaaaaaaaaa	0.094													6	4	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85701839	85701840	+	Frame_Shift_Ins	INS	-	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701839_85701840insT	uc002fix.2	+	14	3298_3299	c.3224_3225insT	c.(3223-3225)CCTfs	p.P1075fs	KIAA0182_uc002fiw.2_Frame_Shift_Ins_p.P971fs|KIAA0182_uc002fiy.2_Frame_Shift_Ins_p.P1002fs|KIAA0182_uc002fiz.2_Frame_Shift_Ins_p.P217fs|KIAA0182_uc010cho.2_Frame_Shift_Ins_p.P255fs	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1	1075							protein binding			large_intestine(3)|ovary(1)|skin(1)	5						AGCCGCGCCCCTCCACCCCAGC	0.569													123	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16748911	16748913	+	IGR	DEL	GCT	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16748911_16748913delGCT								LOC162632 (41092 upstream) : TNFRSF13B (83936 downstream)																							CGCCCTCAAAGCTGCTGCTGCCA	0.650													4	3	---	---	---	---	
CACNB1	782	broad.mit.edu	37	17	37347528	37347529	+	Intron	INS	-	ACTTATTAT	ACTTATTAT	rs138131266	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37347528_37347529insACTTATTAT	uc002hrm.1	-						CACNB1_uc002hrl.1_Intron|CACNB1_uc002hrn.2_Intron|CACNB1_uc002hro.2_Intron|CACNB1_uc002hrp.1_Intron|CACNB1_uc010web.1_Intron	NM_000723	NP_000714	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1						axon guidance	voltage-gated calcium channel complex				large_intestine(1)|ovary(1)	2					Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Verapamil(DB00661)	taataacacgcacttattatac	0.000													5	3	---	---	---	---	
TBC1D3P2	440452	broad.mit.edu	37	17	60347260	60347260	+	Intron	DEL	T	-	-	rs71934275		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60347260delT	uc002izq.2	-						TBC1D3P2_uc010woz.1_Intron|uc010wpa.1_5'Flank					SubName: Full=Putative uncharacterized protein TBC1D3E;												0						CTCTGAATGATTTTTTTTTTT	0.448													2	4	---	---	---	---	
NOL11	25926	broad.mit.edu	37	17	65720449	65720449	+	Intron	DEL	T	-	-	rs34287872		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65720449delT	uc002jgd.1	+						NOL11_uc010wql.1_Intron|NOL11_uc010deu.1_Intron	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11							nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATGCCTTCACttttttttttt	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74591634	74591634	+	IGR	DEL	A	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74591634delA								ST6GALNAC2 (9489 upstream) : ST6GALNAC1 (29213 downstream)																							actctgtctcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544325	80544325	+	Intron	DEL	C	-	-	rs111739683		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544325delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			caaaggtgggccgggggggga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	214519	214520	+	IGR	INS	-	TTG	TTG	rs142588910		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:214519_214520insTTG								USP14 (780 upstream) : THOC1 (2 downstream)																							CTGTACAACAATTGTTATAAAA	0.351													9	7	---	---	---	---	
LMAN1	3998	broad.mit.edu	37	18	57026573	57026574	+	5'Flank	INS	-	C	C	rs140141851	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57026573_57026574insC	uc002lhz.2	-						LMAN1_uc010xek.1_5'Flank	NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor						blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	AGCCCGGGGGACCCCCAAGGGC	0.752													6	5	---	---	---	---	
LIG1	3978	broad.mit.edu	37	19	48636047	48636048	+	Intron	INS	-	AAAAAAAAAAA	AAAAAAAAAAA			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48636047_48636048insAAAAAAAAAAA	uc002pia.1	-						LIG1_uc010xze.1_Intron|LIG1_uc002phz.1_Intron|LIG1_uc002pib.1_Intron|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Intron	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	gactctgtctcaaaaaaaaaaa	0.218								NER					6	4	---	---	---	---	
KIR2DL4	3805	broad.mit.edu	37	19	55317289	55317290	+	Intron	DEL	GA	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55317289_55317290delGA	uc010yfm.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Intron|KIR2DL4_uc002qhg.2_Intron|KIR2DL4_uc002qhi.2_Intron|KIR2DL4_uc002qhh.2_Intron|KIR2DL4_uc002qhj.2_Intron|KIR2DL4_uc002qhf.2_Intron|KIR2DL4_uc010esd.2_Intron|KIR2DL4_uc010ese.2_5'Flank	NM_002255	NP_002246	Q99706	KI2L4_HUMAN	killer cell immunoglobulin-like receptor, two						cellular defense response|regulation of immune response	integral to plasma membrane	protein binding|transmembrane receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0192)		GGTGGAGGGTGAGAGAGAGAGA	0.376													8	4	---	---	---	---	
SULF2	55959	broad.mit.edu	37	20	46294778	46294779	+	Intron	INS	-	T	T			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46294778_46294779insT	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010zyd.1_5'Flank	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						GTGGGAAGCCCTTGCCGAGGTC	0.599													73	7	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60308764	60308765	+	Intron	INS	-	GAAA	GAAA			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60308764_60308765insGAAA	uc002ybn.1	+						CDH4_uc002ybo.1_Intron|CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			aaagaaagaatgaaagaaagaa	0.292													6	4	---	---	---	---	
PI4KA	5297	broad.mit.edu	37	22	21097228	21097228	+	Intron	DEL	T	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21097228delT	uc002zsz.3	-							NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TGATCACAGCTTTTTTTTTTT	0.393													4	2	---	---	---	---	
NF2	4771	broad.mit.edu	37	22	30073959	30073960	+	Intron	INS	-	TGAGGGA	TGAGGGA	rs150466339	by1000genomes	TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30073959_30073960insTGAGGGA	uc003age.3	+						NF2_uc003afy.3_Intron|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Intron|NF2_uc003agb.3_Intron|NF2_uc003agc.3_Intron|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Intron|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Intron|NF2_uc010gvp.2_Intron|NF2_uc011akq.1_Intron	NM_000268	NP_000259	P35240	MERL_HUMAN	neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728						GGTTAGAGATTTGAGGGATGAT	0.361			D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				5	4	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36744885	36744886	+	Intron	INS	-	G	G	rs113389460		TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36744885_36744886insG	uc003apg.2	-						MYH9_uc003api.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						TGGGAAGACCCGCCCCCCCCCC	0.619			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				4	2	---	---	---	---	
HDAC6	10013	broad.mit.edu	37	X	48674165	48674166	+	Intron	DEL	CT	-	-			TCGA-G9-6356-01A-11D-1786-08	TCGA-G9-6356-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48674165_48674166delCT	uc011mmi.1	+						HDAC6_uc004dks.1_Intron|HDAC6_uc010nig.1_Intron|HDAC6_uc004dkt.1_Intron|HDAC6_uc011mmk.1_Intron|HDAC6_uc004dkv.1_Intron|HDAC6_uc004dkw.1_Intron	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6						aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	GGGTCAGGCCCTCTCTCTCTCC	0.594													6	3	---	---	---	---	
