Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
DVL1	1855	broad.mit.edu	37	1	1271546	1271546	+	Silent	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1271546G>A	uc001aer.3	-	15	2036	c.1989C>T	c.(1987-1989)TGC>TGT	p.C663C	DVL1_uc002quu.2_Silent_p.C405C|DVL1_uc009vka.2_Silent_p.C346C|DVL1_uc001aeu.1_3'UTR	NM_004421	NP_004412	O14640	DVL1_HUMAN	dishevelled 1	688					canonical Wnt receptor signaling pathway|dendrite morphogenesis|intracellular signal transduction|negative regulation of protein binding|negative regulation of protein kinase activity|neural tube development|neuromuscular junction development|neurotransmitter secretion|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|receptor clustering|transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, planar cell polarity pathway	cytoplasmic membrane-bounded vesicle|cytosol|plasma membrane|synapse|synaptosome	frizzled binding|identical protein binding|protein kinase binding|signal transducer activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CGAAGAACTCGCAGGGGTTCC	0.692													3	11	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16946434	16946434	+	RNA	SNP	C	T	T	rs367060		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946434C>T	uc010ocf.1	-	3		c.464G>A			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CTCAGCCTTCCGCCGGGCCAG	0.672													4	15	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17264920	17264920	+	Missense_Mutation	SNP	C	T	T	rs4463721	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17264920C>T	uc001azt.2	+	11	1385	c.1316C>T	c.(1315-1317)GCG>GTG	p.A439V	CROCC_uc009voy.1_Missense_Mutation_p.A142V|CROCC_uc009voz.1_Missense_Mutation_p.A202V|CROCC_uc001azu.2_5'Flank	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	439	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGGAGCAGGCGGCCCTGGAG	0.617													3	6	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17264939	17264939	+	Silent	SNP	T	C	C	rs4558023	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17264939T>C	uc001azt.2	+	11	1404	c.1335T>C	c.(1333-1335)GAT>GAC	p.D445D	CROCC_uc009voy.1_Silent_p.D148D|CROCC_uc009voz.1_Silent_p.D208D|CROCC_uc001azu.2_5'Flank	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	445					cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AGACAGAGGATGGAGAGGGGC	0.632													4	5	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35579021	35579021	+	Silent	SNP	A	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35579021A>G	uc001bym.2	+	11	1738	c.1590A>G	c.(1588-1590)CAA>CAG	p.Q530Q	ZMYM1_uc001byn.2_Silent_p.Q530Q|ZMYM1_uc010ohu.1_Silent_p.Q511Q|ZMYM1_uc001byo.2_Silent_p.Q170Q|ZMYM1_uc009vut.2_Silent_p.Q455Q	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	530	TTF-type.					nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAGAATACCAATTTTGTGATG	0.318													16	181	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44087698	44087698	+	3'UTR	SNP	A	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44087698A>C	uc001cjr.2	+	34					PTPRF_uc001cjs.2_3'UTR|PTPRF_uc001cju.2_3'UTR|PTPRF_uc009vwt.2_3'UTR|PTPRF_uc001cjv.2_3'UTR|PTPRF_uc001cjw.2_3'UTR	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTCCTCCGCCACCCCCGCCGT	0.652													10	41	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115454198	115454198	+	Silent	SNP	C	T	T	rs148948913	byFrequency	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115454198C>T	uc001efr.2	+	18	1733	c.1524C>T	c.(1522-1524)AAC>AAT	p.N508N	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Silent_p.N508N|SYCP1_uc009wgw.2_Silent_p.N508N	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	508	Potential.			IQLTAITTSEQYYSKEVKDLKTELENEK -> YSYCHYHKW TVLPKRGQRPKLSSKRE (in Ref. 2; BAA22586).	cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCTTGAAAACGAGAAGTATG	0.244													19	20	---	---	---	---	PASS
TXNIP	10628	broad.mit.edu	37	1	145439910	145439910	+	Silent	SNP	T	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145439910T>C	uc001enn.3	+	3	797	c.456T>C	c.(454-456)AAT>AAC	p.N152N	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_Silent_p.N97N	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	152					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGGATGTCAATACCCCTGATT	0.433													32	128	---	---	---	---	PASS
LELP1	149018	broad.mit.edu	37	1	153177307	153177307	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153177307C>T	uc001fbl.2	+	2	234	c.124C>T	c.(124-126)CGC>TGC	p.R42C		NM_001010857	NP_001010857	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	42	Cys/Pro-rich.									ovary(1)	1	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGCTGCAACGCTGTTTCGA	0.552													13	178	---	---	---	---	PASS
OR10K2	391107	broad.mit.edu	37	1	158390384	158390384	+	Silent	SNP	G	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158390384G>T	uc010pii.1	-	1	273	c.273C>A	c.(271-273)ACC>ACA	p.T91T		NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					GGAAAGAAATGGTCTTCTTCT	0.478													17	262	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276052	186276052	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276052A>C	uc001gru.3	+	7	1252	c.1201A>C	c.(1201-1203)ACC>CCC	p.T401P	PRG4_uc001grt.3_Missense_Mutation_p.T360P|PRG4_uc009wyl.2_Missense_Mutation_p.T308P|PRG4_uc009wym.2_Missense_Mutation_p.T267P|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	401	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|7.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACCCACCACCACCAAGGAGCC	0.642													6	122	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276640	186276640	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276640A>C	uc001gru.3	+	7	1840	c.1789A>C	c.(1789-1791)ACC>CCC	p.T597P	PRG4_uc001grt.3_Missense_Mutation_p.T556P|PRG4_uc009wyl.2_Missense_Mutation_p.T504P|PRG4_uc009wym.2_Missense_Mutation_p.T463P|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	597	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|32.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACCCACCACCACCAAGAAGCC	0.652													6	69	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204985573	204985573	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204985573G>A	uc001hbj.2	+	30	3957	c.3629G>A	c.(3628-3630)GGC>GAC	p.G1210D	NFASC_uc010pra.1_Missense_Mutation_p.G1144D|NFASC_uc001hbi.2_Missense_Mutation_p.G1139D|NFASC_uc010prb.1_Missense_Mutation_p.G1159D|NFASC_uc010prc.1_Missense_Mutation_p.G710D|NFASC_uc001hbl.1_Missense_Mutation_p.G286D|NFASC_uc001hbm.1_Missense_Mutation_p.G233D|NFASC_uc009xbh.1_Missense_Mutation_p.A65T|NFASC_uc001hbo.1_Missense_Mutation_p.A86T	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	1317	Cytoplasmic (Potential).				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCCTTCATCGGCCAGTACACG	0.562													4	128	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220142023	220142023	+	3'UTR	SNP	C	T	T	rs1061248	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220142023C>T	uc001hly.1	-	32						NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase						glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	AATAATTGTCCTGTGTGACTT	0.279													7	8	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179412022	179412022	+	Silent	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179412022G>A	uc010zfg.1	-	289	86750	c.86526C>T	c.(86524-86526)AGC>AGT	p.S28842S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.S22537S|TTN_uc010zfi.1_Silent_p.S22470S|TTN_uc010zfj.1_Silent_p.S22345S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29769							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTAGGAGCGCTTGGTGGGA	0.378													17	111	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179435374	179435374	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179435374C>G	uc010zfg.1	-	275	68005	c.67781G>C	c.(67780-67782)AGC>ACC	p.S22594T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S16289T|TTN_uc010zfi.1_Missense_Mutation_p.S16222T|TTN_uc010zfj.1_Missense_Mutation_p.S16097T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23521							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAGTCGGTGCTCTTTATTTC	0.408													36	71	---	---	---	---	PASS
P4HTM	54681	broad.mit.edu	37	3	49028271	49028271	+	Silent	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49028271G>A	uc003cvg.2	+	2	709	c.360G>A	c.(358-360)GGG>GGA	p.G120G	P4HTM_uc003cvh.2_Silent_p.G120G	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	120	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	CTTAGGTGGGGCACGAGCGTA	0.662													3	26	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100373726	100373726	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100373726T>C	uc003duc.2	+	12	1695	c.1427T>C	c.(1426-1428)ATA>ACA	p.I476T	GPR128_uc011bhc.1_Missense_Mutation_p.I177T|GPR128_uc003dud.2_5'UTR	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	476	Helical; Name=2; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						AATCTGTGCATATCAATGTTG	0.318													3	57	---	---	---	---	PASS
CCDC54	84692	broad.mit.edu	37	3	107096617	107096617	+	Silent	SNP	C	T	T	rs144553244		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107096617C>T	uc003dwi.1	+	1	430	c.183C>T	c.(181-183)GAC>GAT	p.D61D		NM_032600	NP_115989	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	61											0						ATAGTTATGACGGAAAAATGA	0.363													8	89	---	---	---	---	PASS
FAM193A	8603	broad.mit.edu	37	4	2648484	2648484	+	Silent	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2648484C>T	uc010icl.2	+	5	714	c.363C>T	c.(361-363)TCC>TCT	p.S121S	FAM193A_uc010ick.2_Silent_p.S321S|FAM193A_uc003gfd.2_Silent_p.S121S|FAM193A_uc011bvm.1_Silent_p.S121S|FAM193A_uc011bvn.1_Silent_p.S121S|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	121	Potential.									ovary(3)	3						ACCAGCGTTCCGAGGAGGAGC	0.597													10	142	---	---	---	---	PASS
SFRP2	6423	broad.mit.edu	37	4	154709740	154709740	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154709740A>G	uc003inv.1	-	1	489	c.248T>C	c.(247-249)GTC>GCC	p.V83A		NM_003013	NP_003004	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2 precursor	83	FZ.				brain development|cardiac left ventricle morphogenesis|cell-cell signaling|dermatome development|hemopoietic stem cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|negative regulation of cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell adhesion mediated by integrin|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of fat cell differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of stem cell division|sclerotome development	cytoplasm|extracellular matrix|extracellular space|plasma membrane	fibronectin binding|integrin binding|PDZ domain binding|receptor agonist activity|Wnt receptor activity|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.093)	Renal(120;0.117)				CTGCTTCATGACCAGCGGGAT	0.627													20	127	---	---	---	---	PASS
ZNF622	90441	broad.mit.edu	37	5	16465318	16465318	+	Nonsense_Mutation	SNP	T	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16465318T>A	uc003jfq.2	-	1	577	c.457A>T	c.(457-459)AAG>TAG	p.K153*		NM_033414	NP_219482	Q969S3	ZN622_HUMAN	zinc finger protein 622	153						cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						CTGGCCTCCTTTGCAGGCGCT	0.642													13	113	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23526359	23526359	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23526359C>T	uc003jgo.2	+	11	1344	c.1162C>T	c.(1162-1164)CAT>TAT	p.H388Y		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	388	C2H2-type 1.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GCCAGAGATCCATCCATGTCC	0.438										HNSCC(3;0.000094)			53	92	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23526987	23526987	+	Missense_Mutation	SNP	C	G	G	rs74710141		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23526987C>G	uc003jgo.2	+	11	1972	c.1790C>G	c.(1789-1791)ACT>AGT	p.T597S		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	597	C2H2-type 4.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GTCCTCCTCACTCACCAGAGG	0.592										HNSCC(3;0.000094)			4	102	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37038824	37038824	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37038824T>A	uc003jkl.3	+	34	6591	c.6092T>A	c.(6091-6093)CTT>CAT	p.L2031H	NIPBL_uc003jkk.3_Missense_Mutation_p.L2031H	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2031					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CAACCATACCTTACCACTAAA	0.348													5	51	---	---	---	---	PASS
PPAP2A	8611	broad.mit.edu	37	5	54826060	54826060	+	Intron	SNP	T	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54826060T>G	uc003jqa.2	-						PPAP2A_uc003jpz.2_Intron|PPAP2A_uc003jqb.2_Intron|RNF138P1_uc003jqc.1_RNA	NM_003711	NP_003702	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|androgen receptor signaling pathway|germ cell migration|negative regulation of cell proliferation|phospholipid dephosphorylation|regulation of lipid metabolic process|sphingolipid metabolic process	integral to plasma membrane|membrane fraction	phosphatidate phosphatase activity|sphingosine-1-phosphate phosphatase activity			ovary(2)	2		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				ATTCACAAATTCTCCATAATC	0.373													7	87	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63256567	63256567	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63256567C>T	uc011cqt.1	-	1	980	c.980G>A	c.(979-981)CGC>CAC	p.R327H		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	327	Cytoplasmic (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	CTCGGCGTTGCGCTCATTTTT	0.622													9	82	---	---	---	---	PASS
BHMT	635	broad.mit.edu	37	5	78415119	78415119	+	Silent	SNP	A	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78415119A>T	uc003kfu.3	+	3	309	c.204A>T	c.(202-204)TCA>TCT	p.S68S	BHMT_uc011cti.1_Intron	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase	68	Hcy-binding.				protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GAGCTGGCTCAAACGTCATGC	0.448													33	41	---	---	---	---	PASS
ATG10	83734	broad.mit.edu	37	5	81354375	81354375	+	Nonsense_Mutation	SNP	C	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81354375C>G	uc003khs.2	+	4	599	c.170C>G	c.(169-171)TCA>TGA	p.S57*	ATG10_uc003khq.2_Nonsense_Mutation_p.S57*|ATG10_uc003khr.2_Nonsense_Mutation_p.S57*|ATG10_uc010jas.2_Intron	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like	57					autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		TCTGTGATGTCACATCTAGGA	0.373													28	227	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140711178	140711178	+	Silent	SNP	C	T	T	rs148638556		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140711178C>T	uc003lji.1	+	1	927	c.927C>T	c.(925-927)TTC>TTT	p.F309F	PCDHGA1_uc011dan.1_Silent_p.F309F	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	309	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACTAGATTTCGAAGAATACA	0.373													6	44	---	---	---	---	PASS
HIST1H2AB	8335	broad.mit.edu	37	6	26033605	26033605	+	Silent	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26033605C>T	uc003nft.1	-	1	192	c.192G>A	c.(190-192)CTG>CTA	p.L64L	HIST1H3B_uc003nfs.1_5'Flank	NM_003513	NP_003504	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	64					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CCGCCAGCTCCAGGATCTCGG	0.637													11	56	---	---	---	---	PASS
TRIM15	89870	broad.mit.edu	37	6	30140170	30140170	+	3'UTR	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30140170C>T	uc010jrx.2	+	7						NM_033229	NP_150232	Q9C019	TRI15_HUMAN	tripartite motif protein 15						mesodermal cell fate determination	intracellular	zinc ion binding				0						GGCGGCTCTCCGGGATCCAGC	0.647													12	32	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34804091	34804091	+	Silent	SNP	G	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34804091G>T	uc003oju.3	+	8	1233	c.999G>T	c.(997-999)CTG>CTT	p.L333L	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	333										ovary(3)	3						GCCTGGACCTGCACATTTGTG	0.577													31	75	---	---	---	---	PASS
SRPK1	6732	broad.mit.edu	37	6	35810383	35810383	+	Splice_Site	SNP	T	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810383T>A	uc003olj.2	-	14	1744	c.1621_splice	c.e14-1	p.A541_splice	SRPK1_uc011dtg.1_Splice_Site_p.A525_splice|SRPK1_uc003olh.2_Splice_Site_p.A434_splice|SRPK1_uc003oli.2_Splice_Site_p.A434_splice	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TTCAAAGGCCTAAAAAAAAAA	0.418													3	45	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51915071	51915071	+	Silent	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51915071C>T	uc003pah.1	-	22	2439	c.2163G>A	c.(2161-2163)ACG>ACA	p.T721T	PKHD1_uc003pai.2_Silent_p.T721T	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	721	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CTGGGCGAGCCGTTCCAGAAT	0.537											OREG0017493	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	92	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69646520	69646520	+	Nonsense_Mutation	SNP	C	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69646520C>A	uc003pev.3	+	5	1426	c.978C>A	c.(976-978)TGC>TGA	p.C326*	BAI3_uc010kak.2_Nonsense_Mutation_p.C326*	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	326	TSP type-1 1.|Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				GGACACACTGCAGCGGCCCAT	0.493													3	35	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157522425	157522425	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157522425G>A	uc003qqn.2	+	18	4795	c.4643G>A	c.(4642-4644)CGC>CAC	p.R1548H	ARID1B_uc003qqo.2_Missense_Mutation_p.R1508H|ARID1B_uc003qqp.2_Missense_Mutation_p.R1495H	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1553	Pro-rich.				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CTGGAGAACCGCATGTCTCCA	0.622													4	168	---	---	---	---	PASS
GATS	352954	broad.mit.edu	37	7	99800055	99800055	+	3'UTR	SNP	T	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99800055T>C	uc003uua.3	-	5					STAG3_uc003utx.1_Intron|STAG3_uc011kjk.1_Intron|GATS_uc003uty.3_RNA|GATS_uc003utz.3_RNA|GATS_uc010lgt.2_RNA|STAG3_uc003uub.1_Intron	NM_178831	NP_849153	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGTGATTCCCTTTTGCCTTCC	0.552													3	147	---	---	---	---	PASS
TSPAN33	340348	broad.mit.edu	37	7	128807390	128807390	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128807390G>A	uc003vop.1	+	7	968	c.739G>A	c.(739-741)GCC>ACC	p.A247T	TSPAN33_uc003voq.1_Missense_Mutation_p.A79T	NM_178562	NP_848657	Q86UF1	TSN33_HUMAN	tetraspanin 33	247	Helical; (Potential).					integral to membrane				ovary(1)	1						TCTAGGCCTGGCCATCCCCCA	0.507													4	137	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151932961	151932961	+	Nonsense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932961G>A	uc003wla.2	-	16	2929	c.2710C>T	c.(2710-2712)CGA>TGA	p.R904*	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	904					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CGGCCACCTCGCCCCGACAGT	0.502			N		medulloblastoma								6	92	---	---	---	---	PASS
INTS10	55174	broad.mit.edu	37	8	19690802	19690802	+	Silent	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19690802G>A	uc003wzj.2	+	12	1631	c.1500G>A	c.(1498-1500)GCG>GCA	p.A500A		NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	500					snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		TCCAGCTGGCGACGTGCCACT	0.607													12	44	---	---	---	---	PASS
FUT10	84750	broad.mit.edu	37	8	33246843	33246843	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33246843C>T	uc003xje.2	-	4	1206	c.850G>A	c.(850-852)GTT>ATT	p.V284I	FUT10_uc003xjc.2_Missense_Mutation_p.V291I|FUT10_uc003xjd.2_Missense_Mutation_p.V256I|FUT10_uc011lbi.1_Missense_Mutation_p.V334I|FUT10_uc003xjf.2_Missense_Mutation_p.V222I|FUT10_uc003xjg.2_Missense_Mutation_p.V256I|FUT10_uc003xjh.2_Missense_Mutation_p.V284I	NM_032664	NP_116053	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10	284	Lumenal (Potential).				embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		TCATCACAAACTGCATTCTCA	0.468													8	46	---	---	---	---	PASS
DNAJC5B	85479	broad.mit.edu	37	8	67012255	67012255	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67012255A>T	uc003xvs.1	+	6	880	c.589A>T	c.(589-591)ACA>TCA	p.T197S	DNAJC5B_uc003xvt.1_RNA	NM_033105	NP_149096	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	197					protein folding	membrane	heat shock protein binding|unfolded protein binding				0		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			AAGTTATTGCACAGACTCTTG	0.448													4	24	---	---	---	---	PASS
FAM83H	286077	broad.mit.edu	37	8	144811144	144811144	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144811144T>C	uc003yzk.2	-	4	799	c.730A>G	c.(730-732)AGC>GGC	p.S244G	FAM83H_uc010mfk.1_5'Flank	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	244					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CACCTGTAGCTCCCACTCATC	0.662													8	108	---	---	---	---	PASS
TEX10	54881	broad.mit.edu	37	9	103092097	103092097	+	Intron	SNP	G	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103092097G>T	uc004bas.2	-						TEX10_uc011lvf.1_Intron|TEX10_uc011lvg.1_Intron|TEX10_uc011lvh.1_3'UTR	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1							integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TTTATGGCTTGAATACAATTA	0.388													8	14	---	---	---	---	PASS
OR13C5	138799	broad.mit.edu	37	9	107361114	107361114	+	Missense_Mutation	SNP	C	T	T	rs76558719		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107361114C>T	uc011lvp.1	-	1	581	c.581G>A	c.(580-582)GGC>GAC	p.G194D		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						GAACTCATTGCCTGAGATGTC	0.383													5	177	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123171436	123171436	+	Nonsense_Mutation	SNP	C	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123171436C>A	uc004bkf.2	-	30	4754	c.4573G>T	c.(4573-4575)GAG>TAG	p.E1525*	CDK5RAP2_uc010mvi.2_Nonsense_Mutation_p.E534*|CDK5RAP2_uc004bke.2_Nonsense_Mutation_p.E810*|CDK5RAP2_uc004bkg.2_Nonsense_Mutation_p.E1525*|CDK5RAP2_uc011lxw.1_Nonsense_Mutation_p.E790*|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_Nonsense_Mutation_p.E790*|CDK5RAP2_uc011lya.1_Nonsense_Mutation_p.E790*|CDK5RAP2_uc004bkh.1_Nonsense_Mutation_p.E1295*|CDK5RAP2_uc004bki.2_Nonsense_Mutation_p.E1292*	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1525					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						CAGCGGACCTCCTGGATCAGC	0.612													5	70	---	---	---	---	PASS
SLC25A25	114789	broad.mit.edu	37	9	130854176	130854176	+	Silent	SNP	A	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130854176A>G	uc004btd.2	+	1	49	c.27A>G	c.(25-27)CTA>CTG	p.L9L	SLC25A25_uc004btb.2_Intron|SLC25A25_uc004btc.2_Silent_p.L9L	NM_001006642	NP_001006643	Q6KCM7	SCMC2_HUMAN	solute carrier family 25, member 25 isoform c	Error:Variant_position_missing_in_Q6KCM7_after_alignment					transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding				0						GGCATTTCCTAGCTAGCTTTT	0.577													95	161	---	---	---	---	PASS
FIBCD1	84929	broad.mit.edu	37	9	133780631	133780631	+	Silent	SNP	G	A	A	rs142382814		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133780631G>A	uc004bzz.2	-	6	1361	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	FIBCD1_uc011mcc.1_Silent_p.S372S	NM_032843	NP_116232	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	372	Fibrinogen C-terminal.|Extracellular (Potential).				signal transduction	extracellular space|integral to membrane	chitin binding|metal ion binding|receptor binding				0	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		CTGCAGTGCCGGAATAGTCAG	0.647													8	19	---	---	---	---	PASS
FRG2B	441581	broad.mit.edu	37	10	135439015	135439015	+	Missense_Mutation	SNP	T	C	C	rs75470891	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135439015T>C	uc010qvg.1	-	4	478	c.425A>G	c.(424-426)GAT>GGT	p.D142G		NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	142						nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		ATGGTGGGCATCACAGGTCTC	0.517													7	199	---	---	---	---	PASS
KRTAP5-5	439915	broad.mit.edu	37	11	1651453	1651453	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651453G>C	uc001lty.2	+	1	421	c.383G>C	c.(382-384)GGC>GCC	p.G128A		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	128	8 X 4 AA repeats of C-C-X-P.					keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCCAAGGGGGGCTGTGGCTCC	0.682													3	28	---	---	---	---	PASS
CYB5R2	51700	broad.mit.edu	37	11	7690490	7690490	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7690490C>T	uc001mfm.2	-	5	572	c.334G>A	c.(334-336)GGG>AGG	p.G112R	CYB5R2_uc001mfn.2_RNA|CYB5R2_uc009yfk.2_Missense_Mutation_p.G112R|CYB5R2_uc009yfl.1_Missense_Mutation_p.G112R	NM_016229	NP_057313	Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase b5R.2	112	FAD-binding FR-type.|FAD (By similarity).				sterol biosynthetic process	membrane|soluble fraction	cytochrome-b5 reductase activity				0				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATGGTCTCCCCGATTTTCATG	0.483													15	115	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	55999741	55999741	+	Silent	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55999741C>T	uc010rjc.1	-	1	921	c.921G>A	c.(919-921)TCG>TCA	p.S307S		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	307	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					TGTCATGGTCCGAAGCATAGC	0.408													6	143	---	---	---	---	PASS
PLAC1L	219990	broad.mit.edu	37	11	59812207	59812207	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59812207C>A	uc001nol.2	+	3	492	c.307C>A	c.(307-309)CAT>AAT	p.H103N		NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor	103						extracellular region				ovary(2)|skin(1)	3						GAATATAGATCATGACCCTCA	0.408													4	94	---	---	---	---	PASS
EFEMP2	30008	broad.mit.edu	37	11	65637423	65637423	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65637423G>C	uc001ofy.3	-	7	826	c.632C>G	c.(631-633)GCC>GGC	p.A211G	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.A211G	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	211	EGF-like 4; calcium-binding (Potential).				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)		CTCGCATGGGGCCCCCATGTC	0.607													9	127	---	---	---	---	PASS
INTS4	92105	broad.mit.edu	37	11	77612471	77612471	+	Nonsense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77612471G>A	uc001oys.2	-	18	2252	c.2224C>T	c.(2224-2226)CGA>TGA	p.R742*	C11orf67_uc001oyp.2_Intron|INTS4_uc001oyt.2_RNA	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4	742					snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TCTTACCCTCGTGTAGTTCGT	0.378													6	247	---	---	---	---	PASS
OR4D5	219875	broad.mit.edu	37	11	123811134	123811134	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123811134G>A	uc001pzk.1	+	1	811	c.811G>A	c.(811-813)GTC>ATC	p.V271I		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	271	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GGACAAGGCCGTCTCTGTGCT	0.493													36	140	---	---	---	---	PASS
NTM	50863	broad.mit.edu	37	11	132180059	132180059	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132180059G>T	uc001qgp.2	+	5	1379	c.715G>T	c.(715-717)GGG>TGG	p.G239W	NTM_uc001qgm.2_Missense_Mutation_p.G239W|NTM_uc010sch.1_Missense_Mutation_p.G230W|NTM_uc010sci.1_Missense_Mutation_p.G239W|NTM_uc010scj.1_Missense_Mutation_p.G198W|NTM_uc001qgo.2_Missense_Mutation_p.G239W|NTM_uc001qgq.2_Missense_Mutation_p.G239W|NTM_uc001qgr.2_5'UTR	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1	239	Ig-like C2-type 3.				cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						GGGACAAAAGGGGACACTGCA	0.498													18	169	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32134717	32134717	+	Silent	SNP	A	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32134717A>G	uc001rks.2	+	4	1242	c.828A>G	c.(826-828)AGA>AGG	p.R276R		NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	276										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			CTGACAAAAGACCTCCTCCTC	0.418													5	94	---	---	---	---	PASS
SLC24A6	80024	broad.mit.edu	37	12	113748108	113748108	+	Silent	SNP	G	T	T	rs138371135		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113748108G>T	uc001tvc.2	-	12	1398	c.1188C>A	c.(1186-1188)ATC>ATA	p.I396I	SLC24A6_uc001tuz.2_Silent_p.I101I|SLC24A6_uc001tva.2_RNA|SLC24A6_uc001tvb.2_Silent_p.I134I	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor	396	Helical; Name=8; (Potential).				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						CTGTGCCTGCGATCACCACCA	0.587													50	56	---	---	---	---	PASS
ATP6V0A2	23545	broad.mit.edu	37	12	124229429	124229429	+	Silent	SNP	T	C	C	rs7135542	byFrequency	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124229429T>C	uc001ufr.2	+	13	1763	c.1515T>C	c.(1513-1515)AAT>AAC	p.N505N		NM_012463	NP_036595	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	505	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		TTTGTTACAGTGACAGCGTCG	0.517													3	96	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19414267	19414267	+	RNA	SNP	T	C	C	rs74350188		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19414267T>C	uc010tcj.1	-	1		c.31843A>G				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						TAACATTTGTTTTTTCTTCAT	0.279													3	40	---	---	---	---	PASS
ZIC2	7546	broad.mit.edu	37	13	100635173	100635173	+	Silent	SNP	A	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100635173A>G	uc001von.2	+	1	855	c.855A>G	c.(853-855)ACA>ACG	p.T285T		NM_007129	NP_009060	O95409	ZIC2_HUMAN	zinc finger protein of the cerebellum 2	285	C2H2-type 1; atypical.				brain development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|visual perception	cytoplasm|nucleus	chromatin DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGCTGGTGACACACGTCTCGG	0.582													53	71	---	---	---	---	PASS
SLC10A2	6555	broad.mit.edu	37	13	103710721	103710721	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103710721G>T	uc001vpy.3	-	2	986	c.389C>A	c.(388-390)ACC>AAC	p.T130N		NM_000452	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid	130	Helical; (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GGAGCATGTGGTCATGCTGAC	0.428													5	51	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33290883	33290883	+	Silent	SNP	G	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33290883G>T	uc001wrq.2	+	13	4034	c.3864G>T	c.(3862-3864)GTG>GTT	p.V1288V		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1288					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TTTACCAGGTGTACAGCCTCC	0.453													3	42	---	---	---	---	PASS
COQ6	51004	broad.mit.edu	37	14	74426130	74426130	+	Silent	SNP	T	C	C	rs113814754		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74426130T>C	uc001xph.2	+	8	876	c.796T>C	c.(796-798)TTG>CTG	p.L266L	ENTPD5_uc001xpi.2_3'UTR|COQ6_uc001xpe.2_Silent_p.L191L|COQ6_uc001xpf.2_Silent_p.L191L|COQ6_uc010tuk.1_Silent_p.L241L|COQ6_uc010tun.1_Missense_Mutation_p.L274P|COQ6_uc001xpg.2_Silent_p.L266L	NM_182476	NP_872282	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 homolog isoform a	266					ubiquinone biosynthetic process	mitochondrion	flavin adenine dinucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.00337)		CTCAGACACCTTGAGTTCCTT	0.448													52	78	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3640329	3640329	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3640329G>A	uc002cvp.2	-	12	3937	c.3310C>T	c.(3310-3312)CGG>TGG	p.R1104W		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	1104	Interaction with PLK1 and TERF2-TERF2IP.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						AGCACGGACCGACGCTCTTTG	0.532								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				5	137	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48258247	48258247	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48258247C>G	uc002eff.1	-	4	839	c.489G>C	c.(487-489)TTG>TTC	p.L163F	ABCC11_uc002efg.1_Missense_Mutation_p.L163F|ABCC11_uc002efh.1_Missense_Mutation_p.L163F|ABCC11_uc010vgl.1_Missense_Mutation_p.L163F	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	163	Cytoplasmic (Potential).|ABC transmembrane type-1 1.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				CATCGAAAATCAACCTTGTTC	0.507									Cerumen_Type				8	25	---	---	---	---	PASS
ACCN1	40	broad.mit.edu	37	17	32483118	32483118	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32483118T>G	uc002hhu.2	-	1	708	c.434A>C	c.(433-435)CAC>CCC	p.H145P		NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	145	Extracellular (By similarity).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GGGTTTGTAGTGCTTGAAGTT	0.592													16	132	---	---	---	---	PASS
RDM1	201299	broad.mit.edu	37	17	34249537	34249537	+	Intron	SNP	T	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34249537T>G	uc002hkh.2	-						RDM1_uc010cty.2_Intron|RDM1_uc010ctz.2_Intron|RDM1_uc010cua.2_Intron|RDM1_uc002hkg.3_Intron|RDM1_uc010cub.2_Intron|RDM1_uc010cud.2_Intron|RDM1_uc010cuf.2_Intron|RDM1_uc010cue.2_Intron|RDM1_uc010cug.2_Intron|RDM1_uc010cuc.2_Intron|RDM1_uc010wco.1_3'UTR|RDM1_uc010wcp.1_Nonstop_Mutation_p.*214Y|RDM1_uc002hki.2_Nonstop_Mutation_p.*237Y	NM_145654	NP_663629	Q8NG50	RDM1_HUMAN	RAD52 motif 1 isoform 1						DNA recombination|DNA repair	Cajal body|cytoplasm|nucleolus|PML body	DNA binding|nucleotide binding|RNA binding			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GTTTATTTGCTTACTGAAACT	0.254								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					15	94	---	---	---	---	PASS
KRT15	3866	broad.mit.edu	37	17	39673185	39673185	+	Missense_Mutation	SNP	C	T	T	rs138271368		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39673185C>T	uc002hwy.2	-	3	804	c.613G>A	c.(613-615)GTT>ATT	p.V205I	KRT15_uc002hwz.2_Missense_Mutation_p.V107I|KRT15_uc002hxa.2_Missense_Mutation_p.V40I|KRT15_uc002hxb.1_Missense_Mutation_p.V40I	NM_002275	NP_002266	P19012	K1C15_HUMAN	keratin 15	205	Rod.|Coil 1B.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000286)				TCAGCCTCAACGCCCTGGCGC	0.612													35	60	---	---	---	---	PASS
LRRC37A	9884	broad.mit.edu	37	17	44408598	44408598	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44408598A>C	uc002ikg.2	+	9	3958	c.3955A>C	c.(3955-3957)ACC>CCC	p.T1319P	ARL17A_uc002iki.3_Intron|ARL17A_uc002ikh.3_Intron|ARL17B_uc002ikf.2_Intron|LRRC37A_uc002ikj.2_Missense_Mutation_p.T280P|LRRC37A_uc010daw.1_Missense_Mutation_p.T249P	NM_014834	NP_055649	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A precursor	1319	Extracellular (Potential).					integral to membrane					0		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		CCACAGAACAACCAAAGTCAA	0.428													8	9	---	---	---	---	PASS
CBX8	57332	broad.mit.edu	37	17	77768836	77768836	+	Silent	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77768836C>T	uc002jxd.1	-	5	861	c.768G>A	c.(766-768)TCG>TCA	p.S256S		NM_020649	NP_065700	Q9HC52	CBX8_HUMAN	chromobox homolog 8	256					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear chromatin|PcG protein complex	methylated histone residue binding				0			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCACCAGGTCCGAGTCCTGTC	0.627													7	11	---	---	---	---	PASS
TBXA2R	6915	broad.mit.edu	37	19	3600542	3600542	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3600542C>T	uc002lyg.1	-	2	305	c.91G>A	c.(91-93)GCC>ACC	p.A31T	TBXA2R_uc002lye.1_Missense_Mutation_p.A31T	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	31	Helical; Name=1; (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	AAGGAGGCGGCGAACCAGGGC	0.697													9	23	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22574357	22574357	+	Missense_Mutation	SNP	C	G	G	rs149823740	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22574357C>G	uc002nqt.2	-	4	1802	c.1680G>C	c.(1678-1680)AAG>AAC	p.K560N		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	560					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				ATTTGGAAATCTTTGCAATGT	0.323													3	14	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41533038	41533038	+	Intron	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41533038C>T	uc002opo.2	-						uc002ops.1_RNA	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CGAAGGTGGCCTGCTCGCCTC	0.667													4	37	---	---	---	---	PASS
ZNF576	79177	broad.mit.edu	37	19	44103050	44103050	+	Silent	SNP	T	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44103050T>C	uc002owy.2	+	3	362	c.153T>C	c.(151-153)CGT>CGC	p.R51R	IRGQ_uc010eiv.2_5'Flank|ZNF576_uc002owz.2_Silent_p.R51R|SRRM5_uc002oxb.2_Intron	NM_024327	NP_077303	Q9H609	ZN576_HUMAN	zinc finger protein 576	51	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0199)				TCCAGGAGCGTCACATGAAGC	0.647													4	143	---	---	---	---	PASS
CENPB	1059	broad.mit.edu	37	20	3765219	3765219	+	3'UTR	SNP	A	G	G			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3765219A>G	uc002wjk.2	-	1					CDC25B_uc010zqk.1_5'Flank|CDC25B_uc010zql.1_5'Flank|CDC25B_uc010zqm.1_5'Flank	NM_001810	NP_001801	P07199	CENPB_HUMAN	centromere protein B						regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|satellite DNA binding				0						AAGCATTACTAAAGGATCTGG	0.622													16	18	---	---	---	---	PASS
KCNB1	3745	broad.mit.edu	37	20	47991220	47991220	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47991220G>A	uc002xur.1	-	2	1041	c.877C>T	c.(877-879)CGC>TGC	p.R293C	KCNB1_uc002xus.1_Missense_Mutation_p.R293C	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	293					energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACCACGCGGCGGACATTCTGG	0.542													3	89	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23029718	23029718	+	RNA	SNP	A	T	T	rs144226184	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23029718A>T	uc011aim.1	+	128		c.8357A>T								Parts of antibodies, mostly variable regions.												0						TATTACTGTCAATCAGCAGAC	0.527													5	67	---	---	---	---	PASS
LOC644165	644165	broad.mit.edu	37	22	25045855	25045855	+	Silent	SNP	G	A	A	rs738818	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25045855G>A	uc011ajv.1	+	6	936	c.579G>A	c.(577-579)AGG>AGA	p.R193R	POM121L10P_uc003aaz.3_Intron|POM121L10P_uc003abc.2_Intron	NR_024494				Homo sapiens cDNA FLJ57042 complete cds, moderately similar to Breakpoint cluster region protein (EC 2.7.11.1).												0						GGTCAATAAGGTGTCCCTGCA	0.632													4	14	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	C	C	rs142470496	byFrequency	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091840T>C	uc003adu.1	-	11	1189	c.1117A>G	c.(1117-1119)AAG>GAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				3	55	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	A	A	rs146546850	byFrequency	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				3	54	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3227796	3227796	+	Silent	SNP	G	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3227796G>A	uc004crg.3	-	7	8605	c.8448C>T	c.(8446-8448)CTC>CTT	p.L2816L		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2816	Ig-like C2-type 12.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AGTCACTGCCGAGAATGTTTT	0.468													20	3	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40572273	40572273	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40572273C>T	uc004dex.3	-	6	814	c.674G>A	c.(673-675)CGT>CAT	p.R225H	MED14_uc010nhe.1_Missense_Mutation_p.R109H	NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	225	Interaction with STAT2.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						TCCTTCAACACGAAACTTCAC	0.403													11	3	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70461110	70461110	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70461110G>C	uc004dzh.1	-	24	3974	c.3887C>G	c.(3886-3888)CCT>CGT	p.P1296R	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.P1296R|ZMYM3_uc004dzj.1_Missense_Mutation_p.P1284R	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	1296					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					GAACTTGACAGGGCAGCGGAG	0.512													5	23	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70461111	70461111	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70461111G>T	uc004dzh.1	-	24	3973	c.3886C>A	c.(3886-3888)CCT>ACT	p.P1296T	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.P1296T|ZMYM3_uc004dzj.1_Missense_Mutation_p.P1284T	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	1296					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					AACTTGACAGGGCAGCGGAGG	0.507													5	23	---	---	---	---	PASS
GABRE	2564	broad.mit.edu	37	X	151138818	151138818	+	Missense_Mutation	SNP	T	C	C	rs61730039	byFrequency	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151138818T>C	uc004ffi.2	-	2	167	c.113A>G	c.(112-114)TAT>TGT	p.Y38C	GABRE_uc011myd.1_RNA|GABRE_uc011mye.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	38	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGGGGCCATAGACAACATC	0.512													81	15	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1633003	1633004	+	Intron	INS	-	CG	CG			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1633003_1633004insCG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|MMP23A_uc001ahi.1_Intron|MMP23A_uc009vko.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						GGGCAGGCAGCGGGGGGGGGCT	0.733													4	2	---	---	---	---	
UTS2	10911	broad.mit.edu	37	1	7907620	7907621	+	Intron	INS	-	TAAT	TAAT	rs143440682	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7907620_7907621insTAAT	uc001aoq.2	-							NM_006786	NP_006777	O95399	UTS2_HUMAN	urotensin 2 isoform b preproprotein						muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		GAAGAAAAGAATAATTATAAAT	0.297													6	6	---	---	---	---	
TNFRSF9	3604	broad.mit.edu	37	1	7980708	7980709	+	3'UTR	INS	-	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7980708_7980709insA	uc001aot.2	-	8						NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,						induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		gagaccctgtcaaaaaaaaaaa	0.183													4	3	---	---	---	---	
RBP7	116362	broad.mit.edu	37	1	10068112	10068112	+	Intron	DEL	A	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10068112delA	uc001aqq.2	+						RBP7_uc009vms.2_Intron	NM_052960	NP_443192	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular							cytoplasm	retinal binding|retinol binding|transporter activity				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	actccatctcaaaaaaaaaaa	0.189													6	4	---	---	---	---	
KDM4A	9682	broad.mit.edu	37	1	44169065	44169066	+	Intron	INS	-	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44169065_44169066insT	uc001cjx.2	+						uc001cjy.2_Intron|ST3GAL3_uc009vwu.1_5'Flank|KDM4A_uc010oki.1_Intron	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						TTATAGCTGGATTTTTTTTTTT	0.431													3	3	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114281008	114281008	+	Intron	DEL	A	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114281008delA	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc010own.1_Intron|PHTF1_uc001edp.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGTTCAGTTAAAAAAAAAAA	0.323													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144823602	144823605	+	Intron	DEL	TGTC	-	-	rs67650428		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144823602_144823605delTGTC	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						tgtgtgtctgtgtctgtgtgtgtg	0.324													4	2	---	---	---	---	
RANBP2	5903	broad.mit.edu	37	2	109375209	109375210	+	Intron	INS	-	GTGTATATAA	GTGTATATAA			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109375209_109375210insGTGTATATAA	uc002tem.3	+							NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						TATGTGATCACGTGTATATAAA	0.342													4	2	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20597097	20597098	+	Intron	INS	-	ATC	ATC	rs142662998	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20597097_20597098insATC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						GGATGTTCACTATCAAGGAGAT	0.431													6	4	---	---	---	---	
LIAS	11019	broad.mit.edu	37	4	39468962	39468962	+	Intron	DEL	T	-	-	rs78228460		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39468962delT	uc003guf.2	+						LIAS_uc003gug.2_Intron|LIAS_uc003guh.2_Intron	NM_006859	NP_006850	O43766	LIAS_HUMAN	lipoic acid synthetase isoform 1 precursor						inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding				0					Lipoic Acid(DB00166)	AACGGTCTGCTTTTTTTTTTT	0.284													5	4	---	---	---	---	
LOC550112	550112	broad.mit.edu	37	4	68632418	68632419	+	Intron	INS	-	ACACACACAT	ACACACACAT	rs141790878	by1000genomes	TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68632418_68632419insACACACACAT	uc003hdl.3	+											Homo sapiens chromosome 4 cDNA.												0						cacacacacacaTATATATAct	0.149													8	12	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70900409	70900410	+	Intron	INS	-	T	T	rs35873168		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70900409_70900410insT	uc003kbs.3	+						MCCC2_uc010iyv.1_Intron|MCCC2_uc003kbt.3_Intron|MCCC2_uc003kbu.1_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	AAAATCTAAtcttttttttttt	0.153													4	4	---	---	---	---	
SNX14	57231	broad.mit.edu	37	6	86251851	86251852	+	Intron	INS	-	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86251851_86251852insA	uc003pkr.2	-						SNX14_uc003pkp.2_Intron|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		CCAGTTTTGGGAAAAAAAAAAA	0.272													4	3	---	---	---	---	
RPS2P32	256355	broad.mit.edu	37	7	23531029	23531030	+	3'UTR	INS	-	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23531029_23531030insA	uc011jza.1	+	1						NR_026676				Homo sapiens ribosomal protein S2 pseudogene, mRNA (cDNA clone IMAGE:4671259).												0						CTATTACTGTCAAAAAAAAAAA	0.381													4	2	---	---	---	---	
MLXIPL	51085	broad.mit.edu	37	7	73008883	73008884	+	Intron	INS	-	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73008883_73008884insT	uc003tyn.1	-						MLXIPL_uc003tyj.1_Intron|MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CCTACttcttcttttttttttt	0.262													8	4	---	---	---	---	
GTF2I	2969	broad.mit.edu	37	7	74129040	74129040	+	Intron	DEL	T	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74129040delT	uc003uau.2	+						GTF2I_uc003uat.2_Intron|GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|uc003uaz.2_Intron	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						CTTGTCAGTCttttttttttt	0.294													6	3	---	---	---	---	
ANKIB1	54467	broad.mit.edu	37	7	92000724	92000724	+	Intron	DEL	T	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92000724delT	uc003ulw.2	+						ANKIB1_uc010lew.1_5'Flank	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1								protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GTGTGGAGGGTTTTTTTTTCC	0.363													4	2	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	11990647	11990648	+	Intron	INS	-	GTTTGTT	GTTTGTT			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11990647_11990648insGTTTGTT	uc011kxo.1	+						FAM66D_uc011kxp.1_Intron	NR_027425				Homo sapiens cDNA FLJ56781 complete cds.												0						ATTCTTGGCAAGTTTGTTGCCT	0.485													61	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	30689950	30689951	+	IGR	INS	-	T	T			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30689950_30689951insT								None (None upstream) : None (None downstream)																							TCCTACAGAGATTCATATGAGA	0.455													219	20	---	---	---	---	
RASEF	158158	broad.mit.edu	37	9	85619330	85619331	+	Intron	INS	-	TTTATTCTATTA	TTTATTCTATTA			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85619330_85619331insTTTATTCTATTA	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						TATTCTATTATTTTAATCCACC	0.302													4	2	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94485769	94485772	+	3'UTR	DEL	CTCT	-	-	rs142966395		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94485769_94485772delCTCT	uc004arj.1	-	9					ROR2_uc004ari.1_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						GGCAGGGCAGCTCTCTGTGTCAGA	0.608													7	10	---	---	---	---	
C9orf44	158314	broad.mit.edu	37	9	94904432	94904432	+	Intron	DEL	G	-	-	rs34310564		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94904432delG	uc004arp.1	+							NR_027341				Homo sapiens cDNA FLJ13600 fis, clone PLACE1009947.												0						GGCCTTCTTTGGGGGGGGGGT	0.612													3	4	---	---	---	---	
PTF1A	256297	broad.mit.edu	37	10	23482992	23482994	+	3'UTR	DEL	GAT	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482992_23482994delGAT	uc001irp.2	+	2						NM_178161	NP_835455	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2						TGATGAAATAGATGATTTCtttt	0.246													3	3	---	---	---	---	
ANKRD26	22852	broad.mit.edu	37	10	27324807	27324807	+	Intron	DEL	A	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27324807delA	uc001ith.2	-						ANKRD26_uc001itg.2_Intron|ANKRD26_uc009xku.1_Intron	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26							centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TATCCAATTGAAAAAAAAAAA	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1361104	1361105	+	IGR	DEL	AG	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1361104_1361105delAG								TOLLIP (30265 upstream) : BRSK2 (50024 downstream)																							aaagaaagaaagagagagagag	0.000													4	2	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94653675	94653675	+	Intron	DEL	C	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94653675delC	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_5'Flank	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						cttgtctctacaaaaaaaaaa	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28913367	28913367	+	Intron	DEL	T	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28913367delT	uc010azc.2	+						uc010uao.1_Intron					Homo sapiens I.M.A.G.E. clone 321824, mRNA sequence.																		TGAGTTCTCCTTTTTTTTTTT	0.308													4	2	---	---	---	---	
CATSPER2	117155	broad.mit.edu	37	15	43950645	43950645	+	Intron	DEL	A	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43950645delA	uc001zsl.1	-									Q96P56	CTSR2_HUMAN	Homo sapiens putative ion channel protein CATSPER2 variant 1 mRNA, complete cds.						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		actccatctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
FBN1	2200	broad.mit.edu	37	15	48709620	48709621	+	Intron	INS	-	TCCC	TCCC			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48709620_48709621insTCCC	uc001zwx.1	-						FBN1_uc010beo.1_Intron	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor						heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ccttccttccttcccccctccc	0.064													6	3	---	---	---	---	
TMC3	342125	broad.mit.edu	37	15	81637358	81637359	+	Intron	DEL	GA	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81637358_81637359delGA	uc002bgo.1	-						TMC3_uc010blr.1_Intron|TMC3_uc002bgp.2_Intron	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2						ATTTCCTGGGgagagagagaga	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102292874	102292876	+	Intron	DEL	CTC	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102292874_102292876delCTC	uc010usj.1	+						uc002bxo.2_5'Flank|uc002bxp.3_5'Flank|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		AGTTCATCTTCTCAGAGCTGCTG	0.581													3	4	---	---	---	---	
SEC14L5	9717	broad.mit.edu	37	16	5037500	5037501	+	Intron	INS	-	A	A	rs59154516		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5037500_5037501insA	uc002cye.2	+							NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5							integral to membrane|intracellular	transporter activity				0						GGTCGCGCTGGGGGGGGGGGTC	0.634													4	2	---	---	---	---	
ATF7IP2	80063	broad.mit.edu	37	16	10532277	10532277	+	Intron	DEL	T	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10532277delT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						aatttttgggttttttttttt	0.000													4	2	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15508388	15508389	+	Intron	INS	-	A	A			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15508388_15508389insA	uc002gor.1	-						CDRT1_uc002gov.3_Intron|CDRT1_uc002gou.2_Intron			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TTTTCCTTGCCAAAAAAAAAAT	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44337386	44337386	+	IGR	DEL	T	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44337386delT								KIAA1267 (34669 upstream) : ARL17B (26477 downstream)																							CTCCAGGGCCTTTTTGGCCAT	0.657													4	2	---	---	---	---	
HOXB3	3213	broad.mit.edu	37	17	46629933	46629933	+	5'UTR	DEL	A	-	-	rs71366892		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46629933delA	uc002inn.2	-	1					HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbf.2_5'UTR|HOXB3_uc010dbg.2_Intron|HOXB3_uc002ino.2_5'UTR|HOXB3_uc010wlk.1_Intron|HOXB3_uc010wll.1_Intron	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GACACGCCGGAcccccccccc	0.512													9	4	---	---	---	---	
C17orf70	80233	broad.mit.edu	37	17	79518970	79518970	+	Frame_Shift_Del	DEL	G	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79518970delG	uc002kaq.2	-	2	329	c.274delC	c.(274-276)CACfs	p.H92fs	C17orf70_uc010wuq.1_5'Flank|C17orf70_uc002kap.2_5'UTR	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	92					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CTGCCCGGGTGGTCCAGCGAC	0.736													4	2	---	---	---	---	
C19orf59	199675	broad.mit.edu	37	19	7744076	7744078	+	3'UTR	DEL	CCC	-	-	rs112807024		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7744076_7744078delCCC	uc002mhh.1	+	7					TRAPPC5_uc002mhi.1_5'Flank|TRAPPC5_uc002mhj.1_5'Flank|TRAPPC5_uc002mhk.1_5'Flank	NM_174918	NP_777578	Q8IX19	MCEM1_HUMAN	mast cell-expressed membrane protein 1							integral to membrane				skin(1)	1						CGGGAAATGACCCCCCCCCCCCA	0.517											OREG0025208	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	6	---	---	---	---	
ELAVL3	1995	broad.mit.edu	37	19	11565285	11565286	+	3'UTR	DEL	TC	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11565285_11565286delTC	uc002mry.1	-	7					ELAVL3_uc002mrx.1_3'UTR	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1						cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3						tctctctctttctctctctctc	0.574													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53833023	53833024	+	IGR	INS	-	T	T	rs112929393		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53833023_53833024insT								BIRC8 (38148 upstream) : ZNF845 (3978 downstream)																							TCAGAAAAttcttttttttttt	0.203													5	3	---	---	---	---	
SNX5	27131	broad.mit.edu	37	20	17923540	17923540	+	Intron	DEL	A	-	-	rs74179145		TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17923540delA	uc002wqc.2	-						SNX5_uc002wqb.2_Intron|SNX5_uc002wqd.2_Intron|SNX5_uc002wqe.2_Intron	NM_014426	NP_055241	Q9Y5X3	SNX5_HUMAN	sorting nexin 5						cell communication|pinocytosis|protein transport	cytoplasmic vesicle membrane|early endosome membrane|extrinsic to endosome membrane|extrinsic to internal side of plasma membrane|macropinocytic cup|phagocytic cup|ruffle	phosphatidylinositol binding			large_intestine(1)	1						catctctattaaaaaaaaaaa	0.144													4	2	---	---	---	---	
FAM65C	140876	broad.mit.edu	37	20	49286399	49286399	+	Intron	DEL	A	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49286399delA	uc010zyt.1	-						FAM65C_uc010zyu.1_Intron	NM_080829	NP_543019	Q96MK2	FA65C_HUMAN	hypothetical protein LOC140876											ovary(2)	2						GGGGGCTCTGAAAAAAAAAAA	0.284													3	5	---	---	---	---	
ZNF512B	57473	broad.mit.edu	37	20	62594683	62594683	+	Intron	DEL	C	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62594683delC	uc002yhl.1	-							NM_020713	NP_065764	Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ACTGCCGCGGCCCCCCACTGA	0.726													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	92643879	92643879	+	IGR	DEL	T	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92643879delT								PCDH11X (765653 upstream) : NAP1L3 (282050 downstream)																							CAtttttttcttttttttttt	0.313													6	3	---	---	---	---	
ARHGAP36	158763	broad.mit.edu	37	X	130219333	130219333	+	Intron	DEL	A	-	-			TCGA-G9-6362-01A-11D-1786-08	TCGA-G9-6362-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130219333delA	uc004evz.2	+						ARHGAP36_uc004ewa.2_Intron|ARHGAP36_uc004ewb.2_Intron|ARHGAP36_uc004ewc.2_Intron	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						CTCTCAGGTCAAAAAAAAAAA	0.393													5	4	---	---	---	---	
