Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CROCCL1	84809	broad.mit.edu	37	1	16955128	16955128	+	5'Flank	SNP	A	G	G	rs1762949	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16955128A>G	uc010ocf.1	-						CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA|CROCCL1_uc001azg.1_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CAGGCTGTGGACCAGGTTGCT	0.682													3	14	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19477277	19477277	+	Silent	SNP	C	A	A	rs144206434	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19477277C>A	uc001bbi.2	-	49	7228	c.7224G>T	c.(7222-7224)TCG>TCT	p.S2408S	UBR4_uc001bbk.1_Silent_p.S62S	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	2408					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGGATCCACCGAGGCCCCAA	0.483													4	191	---	---	---	---	PASS
GALE	2582	broad.mit.edu	37	1	24124802	24124802	+	Intron	SNP	T	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24124802T>C	uc009vqo.1	-						GALE_uc001bhv.1_Intron|GALE_uc001bhw.1_Intron|GALE_uc001bhx.1_Intron|GALE_uc009vqp.1_Intron|GALE_uc001bhy.1_Intron|GALE_uc001bhz.1_5'UTR|GALE_uc001bia.2_5'Flank|GALE_uc009vqq.1_3'UTR	NM_001127621	NP_001121093	Q14376	GALE_HUMAN	UDP-galactose-4-epimerase						galactose catabolic process	cytosol	coenzyme binding|protein homodimerization activity|UDP-glucose 4-epimerase activity				0		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.79e-24)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;4.22e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		TGCACTCACCttttttttttt	0.284													2	2	---	---	---	---	PASS
COL16A1	1307	broad.mit.edu	37	1	32150183	32150183	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32150183G>A	uc001btk.1	-	31	2466	c.2101C>T	c.(2101-2103)CGG>TGG	p.R701W	COL16A1_uc001btj.1_Missense_Mutation_p.R530W|COL16A1_uc001btl.3_Missense_Mutation_p.R701W	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	701	Triple-helical region 6 (COL6) with 1 imperfection.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		AGTCCTGGCCGCCCTGTGGTG	0.637													11	81	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62739491	62739491	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62739491C>T	uc001dah.3	-	3	1662	c.1285G>A	c.(1285-1287)GAT>AAT	p.D429N	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	429										ovary(3)|skin(2)|lung(1)	6						ATGCCCTTATCACACGACTCC	0.547													6	224	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91781959	91781959	+	Nonsense_Mutation	SNP	C	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91781959C>A	uc001doa.3	-	26	2987	c.2887G>T	c.(2887-2889)GAA>TAA	p.E963*	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Nonsense_Mutation_p.E642*|HFM1_uc001dob.3_Nonsense_Mutation_p.E151*|HFM1_uc010osv.1_Nonsense_Mutation_p.E647*	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	963	SEC63.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		AATTCAAGTTCCCTTGCATCT	0.303													7	86	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144863318	144863318	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144863318C>T	uc001elw.3	-	37	6376	c.6085G>A	c.(6085-6087)GCT>ACT	p.A2029T	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.A1923T|PDE4DIP_uc001elv.3_Missense_Mutation_p.A1036T|PDE4DIP_uc001ema.2_3'UTR	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2029	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GAACACATACCTTTCAGCCCC	0.488			T	PDGFRB	MPD								5	209	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	G	G	rs146714035	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145367739A>G	uc001end.3	+	85	10595	c.10560A>G	c.(10558-10560)AAA>AAG	p.K3520K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3445											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.244													4	72	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200960075	200960075	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200960075G>T	uc001gvs.1	-	18	2974	c.2657C>A	c.(2656-2658)GCG>GAG	p.A886E	KIF21B_uc001gvr.1_Missense_Mutation_p.A886E|KIF21B_uc009wzl.1_Missense_Mutation_p.A886E|KIF21B_uc010ppn.1_Missense_Mutation_p.A886E	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	886					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						GACAGTGGGCGCAGGATGGTC	0.632													7	96	---	---	---	---	PASS
ITGB1BP1	9270	broad.mit.edu	37	2	9558813	9558813	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9558813C>T	uc002qzj.2	-	2	191	c.14G>A	c.(13-15)GGC>GAC	p.G5D	ITGB1BP1_uc002qzk.2_Missense_Mutation_p.G5D|ITGB1BP1_uc002qzl.2_RNA|ITGB1BP1_uc002qzm.2_RNA|ITGB1BP1_uc010yiy.1_Intron|ITGB1BP1_uc002qzn.1_Missense_Mutation_p.G5D	NM_004763	NP_004754	O14713	ITBP1_HUMAN	integrin cytoplasmic domain-associated protein 1	5					cell migration|cell-matrix adhesion|intracellular protein kinase cascade	cytosol|lamellipodium|membrane|ruffle	protein binding|protein binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		TCGTTTTTTGCCCTTGCGAAA	0.393													5	231	---	---	---	---	PASS
SIX2	10736	broad.mit.edu	37	2	45233549	45233549	+	Silent	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45233549C>T	uc002ruo.2	-	2	929	c.636G>A	c.(634-636)TCG>TCA	p.S212S	SIX2_uc002rup.2_Silent_p.S214S	NM_016932	NP_058628	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	212						nucleus	sequence-specific DNA binding transcription factor activity			pancreas(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCTCATCCTCCGAGCTGCCTA	0.632													39	105	---	---	---	---	PASS
GNLY	10578	broad.mit.edu	37	2	85925771	85925771	+	3'UTR	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85925771C>T	uc002sql.3	+	5					GNLY_uc010fgp.2_3'UTR|GNLY_uc010ysx.1_3'UTR	NM_006433	NP_006424	P22749	GNLY_HUMAN	granulysin isoform NKG5						cellular defense response|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0						CAACCTCTGCCGGCTCCTCGC	0.582													9	25	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220331957	220331957	+	Silent	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220331957C>T	uc010fwg.2	+	10	2943	c.2943C>T	c.(2941-2943)GCC>GCT	p.A981A		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	981	Ig-like 4.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ACGTGGGGGCCGGGGAGATGG	0.692											OREG0004000	type=REGULATORY REGION|Gene=APEG1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	57	104	---	---	---	---	PASS
DCBLD2	131566	broad.mit.edu	37	3	98519475	98519475	+	Silent	SNP	A	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98519475A>C	uc003dtd.2	-	15	2169	c.1806T>G	c.(1804-1806)GTT>GTG	p.V602V	DCBLD2_uc003dte.2_Silent_p.V616V	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	602	Cytoplasmic (Potential).				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3						TCAGGTGATTAACTTCGCTGC	0.507													3	153	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118621295	118621295	+	3'UTR	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118621295C>T	uc003ebw.2	-	7					IGSF11_uc011biv.1_3'UTR|IGSF11_uc003ebx.2_3'UTR|IGSF11_uc003eby.2_3'UTR|IGSF11_uc003ebz.2_3'UTR|IGSF11_uc010hqs.2_3'UTR	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						TCCCAGCACTCCCCACCCCAC	0.453													4	42	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	123988019	123988019	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123988019C>A	uc003ehg.2	+	5	1007	c.880C>A	c.(880-882)CAC>AAC	p.H294N	KALRN_uc010hrv.1_Missense_Mutation_p.H294N|KALRN_uc003ehf.1_Missense_Mutation_p.H294N|KALRN_uc011bjy.1_Missense_Mutation_p.H294N	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	294	Spectrin 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						CACCCGGCAGCACCTGCACCA	0.607													5	37	---	---	---	---	PASS
PFN2	5217	broad.mit.edu	37	3	149686232	149686232	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149686232C>A	uc003ext.1	-	2	336	c.238G>T	c.(238-240)GTC>TTC	p.V80F	PFN2_uc003exs.1_Missense_Mutation_p.V31F|PFN2_uc003exu.1_Missense_Mutation_p.V80F|PFN2_uc011bnu.1_Missense_Mutation_p.V80F	NM_053024	NP_444252	P35080	PROF2_HUMAN	profilin 2 isoform a	80					actin cytoskeleton organization|regulation of actin polymerization or depolymerization	actin cytoskeleton|cytoplasm	actin binding|phosphatidylinositol-4,5-bisphosphate binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TCACCATCGACGTATAGACTA	0.473													70	190	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													5	1	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195515449	195515449	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515449A>T	uc011bto.1	-	2	3462	c.3002T>A	c.(3001-3003)GTA>GAA	p.V1001E	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGC	0.587													3	9	---	---	---	---	PASS
BMP2K	55589	broad.mit.edu	37	4	79786791	79786791	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79786791C>T	uc003hlk.2	+	10	1314	c.1148C>T	c.(1147-1149)ACT>ATT	p.T383I	BMP2K_uc010ijl.1_RNA|BMP2K_uc003hlj.2_Missense_Mutation_p.T383I	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	383						nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						ACTACTGCCACTCCCAGTGTG	0.443													15	69	---	---	---	---	PASS
HPGDS	27306	broad.mit.edu	37	4	95220625	95220625	+	3'UTR	SNP	G	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95220625G>C	uc003hte.1	-	6						NM_014485	NP_055300	O60760	HPGDS_HUMAN	prostaglandin D2 synthase, hematopoietic						locomotory behavior|prostaglandin biosynthetic process|signal transduction	cytoplasm|nucleus	calcium ion binding|glutathione transferase activity|magnesium ion binding|prostaglandin-D synthase activity|protein homodimerization activity			ovary(1)	1					Glutathione(DB00143)	AGGCAACATGGATCAGCTAGA	0.498													4	79	---	---	---	---	PASS
SKIV2L2	23517	broad.mit.edu	37	5	54642959	54642959	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54642959A>C	uc003jpy.3	+	11	1493	c.1227A>C	c.(1225-1227)TTA>TTC	p.L409F	SKIV2L2_uc011cqi.1_Missense_Mutation_p.L308F	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2	409	Helicase C-terminal.				maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TGACCAAATTAGATTTCAACA	0.269													27	68	---	---	---	---	PASS
ZNF366	167465	broad.mit.edu	37	5	71739880	71739880	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71739880C>A	uc003kce.1	-	5	2124	c.1938G>T	c.(1936-1938)GAG>GAT	p.E646D		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	646					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TGGACAGATCCTCGGGTGTGC	0.632													5	284	---	---	---	---	PASS
PCDHA13	56136	broad.mit.edu	37	5	140261920	140261920	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140261920G>T	uc003lif.2	+	1	67	c.67G>T	c.(67-69)GCC>TCC	p.A23S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.A23S|PCDHA13_uc003lid.2_Missense_Mutation_p.A23S	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	23					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATCCTCGCAGCCTGGGAGAC	0.602													5	246	---	---	---	---	PASS
LY6G6D	58530	broad.mit.edu	37	6	31683271	31683271	+	Intron	SNP	C	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31683271C>G	uc003nwf.1	+						BAT5_uc011dnz.1_5'Flank|LY6G6F_uc003nwb.1_Intron|LY6G6E_uc011dob.1_5'Flank|LY6G6E_uc003nwc.2_5'Flank|LY6G6E_uc003nwd.2_5'Flank|LY6G6E_uc003nwe.2_5'Flank|LY6G6D_uc003nwg.1_5'UTR	NM_021246	NP_067069	O95868	LY66D_HUMAN	lymphocyte antigen 6 complex G6D precursor							anchored to membrane|filopodium|plasma membrane				lung(1)	1						CCTCTTTTCTCCTGCCAGGAA	0.642													12	91	---	---	---	---	PASS
HLA-DOB	3112	broad.mit.edu	37	6	32782068	32782068	+	Intron	SNP	C	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32782068C>A	uc003oca.2	-						TAP2_uc011dqf.1_Intron|HLA-DOB_uc011dqg.1_3'UTR	NM_002120	NP_002111	P13765	DOB_HUMAN	major histocompatibility complex, class II, DO						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						CTGAGTCAGGCCCAGAGAGTA	0.473													6	49	---	---	---	---	PASS
RWDD2A	112611	broad.mit.edu	37	6	83905528	83905528	+	Missense_Mutation	SNP	A	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83905528A>T	uc003pjx.3	+	3	687	c.416A>T	c.(415-417)AAG>ATG	p.K139M	PGM3_uc003pjv.2_5'Flank|PGM3_uc003pjw.2_5'Flank|PGM3_uc011dyz.1_5'Flank|RWDD2A_uc011dza.1_Missense_Mutation_p.K64M	NM_033411	NP_219479	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A	139											0		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		CTGAACAGAAAGCTTGTATAT	0.433													42	69	---	---	---	---	PASS
SLC16A10	117247	broad.mit.edu	37	6	111498553	111498553	+	Silent	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111498553C>T	uc003pus.2	+	3	802	c.627C>T	c.(625-627)GGC>GGT	p.G209G	SLC16A10_uc003pur.3_Silent_p.G209G|SLC16A10_uc003put.2_5'UTR	NM_018593	NP_061063	Q8TF71	MOT10_HUMAN	solute carrier family 16, member 10	209	Helical; (Potential).				aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)		TCACTGCTGGCAGCAGTGTCT	0.498													28	78	---	---	---	---	PASS
TNFAIP3	7128	broad.mit.edu	37	6	138197133	138197133	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138197133A>G	uc003qhr.2	+	5	701	c.635A>G	c.(634-636)GAC>GGC	p.D212G	TNFAIP3_uc003qhs.2_Missense_Mutation_p.D212G	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	212	TRAF-binding.|OTU.				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(22)		haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CTTTGAACAGACAAAATGCTA	0.438			D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								20	78	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163983069	163983069	+	Missense_Mutation	SNP	A	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163983069A>G	uc003qui.2	+	5	1153	c.602A>G	c.(601-603)AAT>AGT	p.N201S	QKI_uc003que.2_Missense_Mutation_p.N201S|QKI_uc003quf.2_Missense_Mutation_p.N201S|QKI_uc003qug.2_Missense_Mutation_p.N201S|QKI_uc003quh.2_Missense_Mutation_p.N201S|QKI_uc003quj.2_Missense_Mutation_p.N201S	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	201					mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		GCGATTCTGAATGGCACCTAC	0.448													20	41	---	---	---	---	PASS
HEATR2	54919	broad.mit.edu	37	7	796543	796543	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:796543G>C	uc010krz.1	+	6	1402	c.1382G>C	c.(1381-1383)CGG>CCG	p.R461P	HEATR2_uc003siz.2_Missense_Mutation_p.R329P	NM_017802	NP_060272	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	461							protein binding			skin(1)	1		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		TCCGCCATGCGGGGTTGCCCC	0.622													11	84	---	---	---	---	PASS
EVX1	2128	broad.mit.edu	37	7	27283058	27283058	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27283058G>A	uc003szd.1	+	1	895	c.409G>A	c.(409-411)GAG>AAG	p.E137K	EVX1_uc011jzn.1_Intron|EVX1_uc010kuy.1_Intron	NM_001989	NP_001980	P49640	EVX1_HUMAN	even-skipped homeobox 1	137						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						CGGGAACGCCGAGTACCAGCA	0.657													4	41	---	---	---	---	PASS
TARP	445347	broad.mit.edu	37	7	38305254	38305254	+	Silent	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38305254G>A	uc003tge.1	-	5	830	c.453C>T	c.(451-453)TCC>TCT	p.S151S	uc003tfz.1_Intron|TARP_uc003tgb.2_5'UTR|TARP_uc003tgc.1_5'UTR|TARP_uc003tgd.1_5'UTR|TARP_uc010kxi.1_RNA|TARP_uc003tgf.1_RNA|TARP_uc003tgj.1_RNA|TARP_uc003tgh.1_RNA|TARP_uc003tgi.1_RNA|TARP_uc003tgg.1_RNA			A2JGV3	A2JGV3_HUMAN	Homo sapiens TCRgamma alternate reading frame protein (TCRg) mRNA, complete cds.	Error:Variant_position_missing_in_A2JGV3_after_alignment											0						TGGGCTTGGGGGAAACATCTG	0.378													81	196	---	---	---	---	PASS
TNFRSF10C	8794	broad.mit.edu	37	8	22974405	22974405	+	Missense_Mutation	SNP	C	A	A	rs61736406	byFrequency	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22974405C>A	uc003xcy.2	+	5	842	c.641C>A	c.(640-642)ACC>AAC	p.T214N	TNFRSF10C_uc011kzr.1_RNA	NM_003841	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily,	214	TAPE 4.				apoptosis	anchored to membrane|integral to plasma membrane	TRAIL binding|transmembrane receptor activity				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.612													4	93	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55533728	55533728	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55533728G>A	uc003xsd.1	+	2	350	c.202G>A	c.(202-204)GAT>AAT	p.D68N	RP1_uc011ldy.1_Missense_Mutation_p.D68N	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	68	Doublecortin 1.				axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGCTCTGCTGGATAACTTGTC	0.597													4	133	---	---	---	---	PASS
WASH5P	375690	broad.mit.edu	37	9	14889	14889	+	Missense_Mutation	SNP	A	G	G	rs145923895	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14889A>G	uc010mgm.1	-	11	1459	c.1316T>C	c.(1315-1317)GTC>GCC	p.V439A	WASH5P_uc003zfr.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						TGACACGCGGACAAAGGCTCC	0.632													2	14	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33384977	33384977	+	3'UTR	SNP	T	G	G	rs13434	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33384977T>G	uc003zst.2	-	8					SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_3'UTR	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TATTGGGGAATGGATGGGATC	0.557													5	264	---	---	---	---	PASS
HSD17B7P2	158160	broad.mit.edu	37	10	38654432	38654432	+	Missense_Mutation	SNP	A	G	G	rs2257765		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38654432A>G	uc010qex.1	+	5	599	c.524A>G	c.(523-525)AAT>AGT	p.N175S	HSD17B7P2_uc001izq.2_RNA|HSD17B7P2_uc001izo.1_RNA|HSD17B7P2_uc001izp.1_Missense_Mutation_p.N173S					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0						TCATCTCGCAATGCAAGGAAA	0.453													6	55	---	---	---	---	PASS
ZNF485	220992	broad.mit.edu	37	10	44104060	44104060	+	Splice_Site	SNP	A	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44104060A>T	uc010qfc.1	+	3	219	c.25_splice	c.e3-2	p.G9_splice	ZNF485_uc010qfd.1_Intron	NM_145312	NP_660355	Q8NCK3	ZN485_HUMAN	zinc finger protein 485						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTGGTTTTGCAGGGACCGCTG	0.562													6	15	---	---	---	---	PASS
LOC642826	642826	broad.mit.edu	37	10	47207813	47207813	+	RNA	SNP	T	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47207813T>C	uc001jei.2	-	12		c.1586A>G			uc009xnf.2_Missense_Mutation_p.H132R					Homo sapiens cDNA, FLJ99065.												0						TTTACTTACATGGTTTGTACA	0.294													3	18	---	---	---	---	PASS
AGAP6	414189	broad.mit.edu	37	10	51749089	51749089	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51749089C>G	uc001jix.3	+	2	643	c.245C>G	c.(244-246)GCC>GGC	p.A82G		NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	82					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						AACCTTTCTGCCAATCCAGAG	0.343													7	69	---	---	---	---	PASS
AGAP6	414189	broad.mit.edu	37	10	51749117	51749117	+	Silent	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51749117G>A	uc001jix.3	+	2	671	c.273G>A	c.(271-273)CAG>CAA	p.Q91Q		NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	91					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						CAATATTCCAGAGGAACTCTC	0.358													5	66	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													6	45	---	---	---	---	PASS
ZNF214	7761	broad.mit.edu	37	11	7021497	7021497	+	Missense_Mutation	SNP	G	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7021497G>C	uc001mfa.2	-	3	1720	c.1417C>G	c.(1417-1419)CCT>GCT	p.P473A	ZNF214_uc010ray.1_Missense_Mutation_p.P473A|ZNF214_uc009yfh.1_Missense_Mutation_p.P473A	NM_013249	NP_037381	Q9UL59	ZN214_HUMAN	zinc finger protein 214	473	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		CCACATTCAGGACAAGTATAG	0.438													12	52	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26620449	26620449	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26620449G>T	uc001mqt.3	+	16	1720	c.1575G>T	c.(1573-1575)GAG>GAT	p.E525D	ANO3_uc010rdr.1_Missense_Mutation_p.E509D|ANO3_uc010rds.1_Missense_Mutation_p.E364D|ANO3_uc010rdt.1_Missense_Mutation_p.E379D	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	525	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ACAAGATGGAGATTGTAAATC	0.383													9	31	---	---	---	---	PASS
TMEM216	51259	broad.mit.edu	37	11	61161357	61161357	+	Silent	SNP	T	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61161357T>G	uc010rlj.1	+	3	410	c.117T>G	c.(115-117)GGT>GGG	p.G39G	TMEM216_uc001nrn.1_5'UTR	NM_016499	NP_057583	Q9P0N5	TM216_HUMAN	transmembrane protein 216	39						integral to membrane					0						TATTGGCAGGTGTCCTGCTAC	0.438													9	39	---	---	---	---	PASS
B3GAT3	26229	broad.mit.edu	37	11	62384117	62384117	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62384117G>A	uc001ntw.2	-	4	799	c.770C>T	c.(769-771)GCC>GTC	p.A257V	B3GAT3_uc009ynz.2_Missense_Mutation_p.A250V|B3GAT3_uc001ntx.2_RNA|B3GAT3_uc010rlz.1_Missense_Mutation_p.A257V	NM_012200	NP_036332	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	257	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|manganese ion binding				0						CAGGGCCACGGCAAATCCAGC	0.612													3	52	---	---	---	---	PASS
HRASLS2	54979	broad.mit.edu	37	11	63326111	63326111	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63326111G>A	uc001nxg.1	-	3	199	c.140C>T	c.(139-141)GCG>GTG	p.A47V		NM_017878	NP_060348	Q9NWW9	HRSL2_HUMAN	HRAS-like suppressor 2	47					lipid catabolic process	cytoplasm	acyltransferase activity|hydrolase activity				0						GACACTGGCCGCACCAGCTCC	0.582													4	148	---	---	---	---	PASS
PLBD2	196463	broad.mit.edu	37	12	113822716	113822716	+	Silent	SNP	C	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113822716C>G	uc001tve.2	+	8	1214	c.1179C>G	c.(1177-1179)CCC>CCG	p.P393P	PLBD2_uc001tvf.2_Intron	NM_173542	NP_775813	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2 isoform 1	393					lipid catabolic process	lysosomal lumen	hydrolase activity				0						GGCCCAGCCCCGGGAGCCGGG	0.667													3	39	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124399457	124399457	+	Missense_Mutation	SNP	A	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124399457A>C	uc001uft.3	+	61	10304	c.10279A>C	c.(10279-10281)ACC>CCC	p.T3427P		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3427	AAA 5 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CATCCTCACCACCCGGGCCAG	0.552													5	10	---	---	---	---	PASS
KHNYN	23351	broad.mit.edu	37	14	24901309	24901309	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24901309G>T	uc001wph.3	+	3	1044	c.842G>T	c.(841-843)TGG>TTG	p.W281L	KHNYN_uc010tpc.1_Missense_Mutation_p.W322L|KHNYN_uc010alw.2_Missense_Mutation_p.W281L|CBLN3_uc001wpg.3_5'Flank	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351	281										ovary(2)|liver(1)	3						GAAGAGGCGTGGGAGAGAGAA	0.622											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	34	---	---	---	---	PASS
SIX1	6495	broad.mit.edu	37	14	61115639	61115639	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61115639G>A	uc001xfb.3	-	1	517	c.269C>T	c.(268-270)GCG>GTG	p.A90V		NM_005982	NP_005973	Q15475	SIX1_HUMAN	SIX homeobox 1	90					branching involved in ureteric bud morphogenesis|embryonic cranial skeleton morphogenesis|epithelial cell differentiation|inner ear morphogenesis|mesonephric tubule formation|metanephric mesenchyme development|myoblast migration|negative regulation of neuron apoptosis|organ induction|pattern specification process|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|protein localization to nucleus|regulation of branch elongation involved in ureteric bud branching|regulation of neuron differentiation|skeletal muscle tissue development|thymus development|thyroid gland development	nucleolus|transcription factor complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		CACGTAATGCGCCTTCAGCCA	0.627													6	189	---	---	---	---	PASS
TSHR	7253	broad.mit.edu	37	14	81422160	81422160	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81422160C>T	uc001xvd.1	+	1	292	c.136C>T	c.(136-138)CGC>TGC	p.R46C	C14orf145_uc001xva.1_Intron|TSHR_uc001xvb.1_Missense_Mutation_p.R46C|TSHR_uc001xvc.2_Missense_Mutation_p.R46C|TSHR_uc010tvs.1_Missense_Mutation_p.R46C	NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	46	Extracellular (Potential).				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GGATATTCAACGCATCCCCAG	0.607			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						31	92	---	---	---	---	PASS
KIAA0284	283638	broad.mit.edu	37	14	105349541	105349541	+	Silent	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105349541G>A	uc010axb.2	+	8	971	c.747G>A	c.(745-747)ACG>ACA	p.T249T	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Silent_p.T179T|KIAA0284_uc001yps.2_Silent_p.T155T	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	249						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		AGATGCCCACGAAGGATGCAG	0.667													6	36	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106471515	106471515	+	RNA	SNP	C	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106471515C>A	uc010tyt.1	-	1891		c.36594G>T								Parts of antibodies, mostly variable regions.												0						TTCACCTCAGCCCCAGACTGC	0.582													5	66	---	---	---	---	PASS
IGDCC4	57722	broad.mit.edu	37	15	65687537	65687537	+	Missense_Mutation	SNP	G	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65687537G>A	uc002aou.1	-	8	1681	c.1471C>T	c.(1471-1473)CGG>TGG	p.R491W	IGDCC4_uc002aot.1_Missense_Mutation_p.R79W	NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member	491	Extracellular (Potential).|Fibronectin type-III 1.					integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3						TCCAGGTCCCGAACCTGTAGT	0.572													18	39	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86064727	86064727	+	Missense_Mutation	SNP	G	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86064727G>T	uc002blv.1	+	3	272	c.102G>T	c.(100-102)TTG>TTT	p.L34F	AKAP13_uc002bls.2_Missense_Mutation_p.L34F|AKAP13_uc002blt.1_Missense_Mutation_p.L34F|AKAP13_uc002blu.1_Missense_Mutation_p.L34F	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	34					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						TGTTTTACTTGGTATTTTTGG	0.423													4	128	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	15023266	15023266	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15023266C>G	uc010uzk.1	+	6	1111	c.835C>G	c.(835-837)CTG>GTG	p.L279V	NPIP_uc002dcx.3_RNA					SubName: Full=cDNA FLJ57488, highly similar to Polycystin-1;																		CGAGGAGCCCCTGACGCTGGC	0.701													3	27	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15198590	15198590	+	Intron	SNP	C	T	T	rs113675370		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15198590C>T	uc002ddc.2	+						uc010uzr.1_Missense_Mutation_p.R100H|uc010uzs.1_RNA|uc002ddh.2_3'UTR|uc010bve.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGAAGAATGACGATGCTCCGC	0.488													5	58	---	---	---	---	PASS
FOXL1	2300	broad.mit.edu	37	16	86612373	86612373	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86612373C>T	uc002fjr.2	+	1	259	c.44C>T	c.(43-45)TCG>TTG	p.S15L		NM_005250	NP_005241	Q12952	FOXL1_HUMAN	forkhead box L1	15					brain development|camera-type eye development|cartilage development|embryo development|forelimb morphogenesis|heart development|organ morphogenesis|pattern specification process|proteoglycan biosynthetic process|regulation of sequence-specific DNA binding transcription factor activity|regulation of Wnt receptor signaling pathway|visceral mesoderm-endoderm interaction involved in midgut development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1						CTGGCCGCCTCGCCCATGCTG	0.726													18	73	---	---	---	---	PASS
GLP2R	9340	broad.mit.edu	37	17	9739734	9739734	+	Missense_Mutation	SNP	T	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9739734T>A	uc002gmd.1	+	3	324	c.324T>A	c.(322-324)CAT>CAA	p.H108Q	GLP2R_uc010cog.1_RNA	NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	108	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	GTTGGCCTCATTCTTCTCCTG	0.428													15	140	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10356642	10356642	+	Missense_Mutation	SNP	T	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10356642T>G	uc002gmn.2	-	24	3049	c.2938A>C	c.(2938-2940)AAA>CAA	p.K980Q	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	980	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GTGAGGTTTTTCACCTTTAGA	0.438													38	90	---	---	---	---	PASS
TOP2A	7153	broad.mit.edu	37	17	38555127	38555127	+	Silent	SNP	G	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38555127G>T	uc002huq.2	-	26	3477	c.3351C>A	c.(3349-3351)TCC>TCA	p.S1117S		NM_001067	NP_001058	P11388	TOP2A_HUMAN	DNA topoisomerase II, alpha isozyme	1117					apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	AATCTGTTACGGAGTCACTCT	0.353													8	57	---	---	---	---	PASS
CCDC57	284001	broad.mit.edu	37	17	80129645	80129645	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80129645T>C	uc002kdz.1	-	13	2169	c.1814A>G	c.(1813-1815)GAT>GGT	p.D605G	CCDC57_uc002kdx.1_Missense_Mutation_p.D605G|CCDC57_uc010dik.1_Missense_Mutation_p.D113G	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	605	Potential.									ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CTTTAAAGGATCCAACACATC	0.468													5	92	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	G	G	rs2447437	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753768C>G	uc002lmt.2	+	2	1777	c.1777C>G	c.(1777-1779)CTC>GTC	p.L593V	SALL3_uc010dra.2_Missense_Mutation_p.L200V	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	593					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													6	4	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9064360	9064360	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9064360C>T	uc002mkp.2	-	3	23290	c.23086G>A	c.(23086-23088)GTG>ATG	p.V7696M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7698	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTGAGGTCACGGCAGGTAAA	0.582													16	56	---	---	---	---	PASS
ZNF799	90576	broad.mit.edu	37	19	12501649	12501649	+	Silent	SNP	T	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12501649T>A	uc010dyt.2	-	4	1713	c.1563A>T	c.(1561-1563)GTA>GTT	p.V521V	ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN	zinc finger protein 799	521	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						TTCTTTCATGTACTTTTAAGT	0.388													5	76	---	---	---	---	PASS
RPSAP58	388524	broad.mit.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24010294C>G	uc002nrn.2	+	4	754	c.331C>G	c.(331-333)CAG>GAG	p.Q111E		NM_002295	NP_002286			ribosomal protein SA												0						CTTCACTAACCAGATCCAGGC	0.567													3	59	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44891126	44891126	+	Silent	SNP	T	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44891126T>A	uc002ozd.3	-	4	1368	c.1281A>T	c.(1279-1281)CCA>CCT	p.P427P	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Silent_p.P434P	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	427					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						CACACCTATATGGTTTCTCCC	0.483													3	54	---	---	---	---	PASS
CCDC8	83987	broad.mit.edu	37	19	46915974	46915974	+	Missense_Mutation	SNP	T	C	C			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46915974T>C	uc002pep.2	-	1	946	c.94A>G	c.(94-96)ACC>GCC	p.T32A		NM_032040	NP_114429	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	32						plasma membrane				ovary(3)	3				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		gcttccttggtggcgggctta	0.010													3	78	---	---	---	---	PASS
ZNF419	79744	broad.mit.edu	37	19	57999247	57999247	+	5'UTR	SNP	T	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57999247T>G	uc002qov.2	+	1					ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_5'UTR|ZNF419_uc010etz.1_5'UTR|ZNF419_uc010eua.1_5'UTR|ZNF419_uc002qow.2_5'UTR|ZNF419_uc010eub.1_5'UTR|ZNF419_uc010euc.1_5'UTR	NM_024691	NP_078967	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		TGAGGCTCGGTGGCGGCGCCC	0.706													4	19	---	---	---	---	PASS
CST9L	128821	broad.mit.edu	37	20	23546639	23546639	+	Missense_Mutation	SNP	T	G	G	rs2295564	byFrequency	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23546639T>G	uc002wtk.3	-	2	625	c.326A>C	c.(325-327)CAT>CCT	p.H109P		NM_080610	NP_542177	Q9H4G1	CST9L_HUMAN	cystatin 9-like precursor	109						extracellular region	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TTCTTGGAAATGGCAGTTGTC	0.502													4	97	---	---	---	---	PASS
TPX2	22974	broad.mit.edu	37	20	30363692	30363692	+	Nonsense_Mutation	SNP	G	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30363692G>T	uc002wwp.1	+	8	1329	c.631G>T	c.(631-633)GAG>TAG	p.E211*	TPX2_uc010gdv.1_Nonsense_Mutation_p.E211*	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog	211					activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			AAAAAGTACTGAGGAGCAAGA	0.418													24	54	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36974956	36974956	+	Silent	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36974956C>T	uc002xic.1	+	1	72	c.37C>T	c.(37-39)CTG>TTG	p.L13L		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	13					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				GTCCATACTGCTGGCATTGCT	0.617													11	117	---	---	---	---	PASS
ADA	100	broad.mit.edu	37	20	43257807	43257807	+	Missense_Mutation	SNP	C	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43257807C>A	uc002xmj.2	-	3	227	c.99G>T	c.(97-99)AGG>AGT	p.R33S	ADA_uc010ggt.2_RNA	NM_000022	NP_000013	P00813	ADA_HUMAN	adenosine deaminase	33					adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	CGATCCCTCTCCTCCTGGAAA	0.602									Adenosine_Deaminase_Deficiency				14	66	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46295036	46295036	+	Silent	SNP	G	A	A	rs142442971	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46295036G>A	uc002xto.2	-	12	2103	c.1773C>T	c.(1771-1773)TAC>TAT	p.Y591Y	SULF2_uc002xtr.2_Silent_p.Y591Y|SULF2_uc002xtq.2_Silent_p.Y591Y|SULF2_uc010zyd.1_5'Flank	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	591					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						TGGCGGCTGAGTAGTCGGGAA	0.612													4	106	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11098863	11098863	+	5'UTR	SNP	A	G	G	rs75318310	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11098863A>G	uc002yit.1	-	1					BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccagcctccaactcccccttc	0.000													3	13	---	---	---	---	PASS
CYP2D7P1	1564	broad.mit.edu	37	22	42538870	42538870	+	Missense_Mutation	SNP	A	C	C	rs2982057	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42538870A>C	uc003bci.2	-	3	475	c.94T>G	c.(94-96)TCG>GCG	p.S32A	CYP2D7P1_uc003bcg.2_5'Flank|CYP2D7P1_uc003bch.2_5'Flank|CYP2D7P1_uc010gyv.2_Intron|CYP2D7P1_uc010gyw.2_RNA|CYP2D7P1_uc010gyx.1_Missense_Mutation_p.S32A	NR_002570				SubName: Full=Cytochrome P450 2D6;          EC=1.14.14.1;												0						CCATAGCGCGACAGGAACACC	0.687													3	32	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	4966872	4966872	+	Missense_Mutation	SNP	C	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:4966872C>T	uc004fqo.2	+	2	1987	c.1253C>T	c.(1252-1254)ACG>ATG	p.T418M	PCDH11Y_uc010nwg.1_Missense_Mutation_p.T407M|PCDH11Y_uc004fql.1_Missense_Mutation_p.T407M|PCDH11Y_uc004fqm.1_Missense_Mutation_p.T407M|PCDH11Y_uc004fqn.1_Missense_Mutation_p.T418M|PCDH11Y_uc004fqp.1_Missense_Mutation_p.T189M	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	418	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						ATAACTGTGACGGATAAGGAT	0.413													18	25	---	---	---	---	PASS
RPA2	6118	broad.mit.edu	37	1	28223996	28223996	+	Intron	DEL	G	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28223996delG	uc001bpe.1	-						RPA2_uc001bpd.1_Intron|RPA2_uc010ofp.1_Intron	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		AAAAAAAAAAGAAAAGTTATT	0.303								Direct_reversal_of_damage|NER					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	89570005	89570018	+	IGR	DEL	TGTGAATCATCATC	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89570005_89570018delTGTGAATCATCATC								GBP1 (38962 upstream) : GBP2 (1825 downstream)																							ATCACTGTCTTGTGAATCATCATCTGCTCCATCT	0.364													74	16	---	---	---	---	
FAM63A	55793	broad.mit.edu	37	1	150974465	150974465	+	Intron	DEL	T	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150974465delT	uc001ewf.2	-						FAM63A_uc001ewc.2_Intron|FAM63A_uc010pcm.1_Intron|FAM63A_uc001ewd.2_Intron|FAM63A_uc001ewe.2_Intron|FAM63A_uc010pcn.1_Intron|FAM63A_uc001ewg.2_Intron	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1								protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GATCTTCCTCTTTTTTTTTTT	0.393													6	4	---	---	---	---	
RC3H1	149041	broad.mit.edu	37	1	173941766	173941767	+	Splice_Site	INS	-	TA	TA			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173941766_173941767insTA	uc001gju.3	-	7	1190	c.1103_splice	c.e7-1	p.D368_splice	RC3H1_uc010pms.1_Splice_Site_p.D368_splice|RC3H1_uc001gjv.2_Splice_Site_p.D368_splice|RC3H1_uc010pmt.1_Splice_Site_p.D368_splice	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin						cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GGAGGAGCATCTATACAACCAA	0.361													69	11	---	---	---	---	
MSH2	4436	broad.mit.edu	37	2	47709796	47709797	+	Intron	INS	-	A	A			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47709796_47709797insA	uc002rvy.1	+						MSH2_uc010yoh.1_Intron|MSH2_uc002rvz.2_Intron|MSH2_uc010fbg.2_Intron	NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	p.?(2)		large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			atatgaaaaataaaaaaaaaaT	0.178			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	2	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77563311	77563322	+	Intron	DEL	AAGGAAAGAAGG	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77563311_77563322delAAGGAAAGAAGG	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		ggaaggaagaaaggaaagaaggaaggaaagaa	0.000													4	2	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107049257	107049257	+	Intron	DEL	G	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107049257delG	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						aaaaaaaaaaGACCAAAATGT	0.234													7	5	---	---	---	---	
FOXD4L1	200350	broad.mit.edu	37	2	114256793	114256794	+	5'UTR	INS	-	C	C	rs137911975	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114256793_114256794insC	uc002tjw.3	+	1						NM_012184	NP_036316	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1						axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						GGCCAGGTGATCGGCCGCCACA	0.629													132	7	---	---	---	---	
USP37	57695	broad.mit.edu	37	2	219352899	219352901	+	Intron	DEL	AAA	-	-	rs11345257		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219352899_219352901delAAA	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		accctgtctcaaaaaaaaaaaaa	0.089													4	2	---	---	---	---	
OBSL1	23363	broad.mit.edu	37	2	220430311	220430316	+	Intron	DEL	CAACTG	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220430311_220430316delCAACTG	uc010fwk.2	-						OBSL1_uc010zli.1_5'Flank|OBSL1_uc010fwl.1_Intron|OBSL1_uc002vmi.2_Intron|OBSL1_uc002vmj.2_Intron	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1						cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		TCAGAGGGAACAACTGCTGTTGTTGG	0.456											OREG0003987	type=REGULATORY REGION|Gene=BC061909|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	11	5	---	---	---	---	
ZNF621	285268	broad.mit.edu	37	3	40571112	40571115	+	Intron	DEL	TTTG	-	-	rs72322611		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40571112_40571115delTTTG	uc003ckm.2	+						ZNF621_uc003ckn.2_Intron|ZNF621_uc003cko.2_Intron|ZNF621_uc011aze.1_Intron	NM_001098414	NP_001091884	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		gtttgtttgttttgtttgtttgtt	0.176													5	4	---	---	---	---	
IL17RB	55540	broad.mit.edu	37	3	53883546	53883547	+	Intron	INS	-	A	A	rs149695132	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53883546_53883547insA	uc003dha.2	+							NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor						defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		ctacaaaaaacatttttttaat	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	20620790	20620790	+	IGR	DEL	A	-	-	rs75247881		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20620790delA								SLIT2 (2 upstream) : PACRGL (77115 downstream)																							CTGCATTTGGAAAAAAAAAAA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	174555577	174555579	+	IGR	DEL	TTT	-	-	rs34026730		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174555577_174555579delTTT								MORF4 (17783 upstream) : FBXO8 (602233 downstream)																							CTCTTATTCCttttttttttttt	0.261													4	2	---	---	---	---	
REV3L	5980	broad.mit.edu	37	6	111714245	111714246	+	Intron	INS	-	T	T	rs3218608		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111714245_111714246insT	uc003puy.3	-						REV3L_uc003pux.3_Intron|REV3L_uc003puz.3_Intron	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta						DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TAGAAGGTAAAttttttttttt	0.144								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					9	4	---	---	---	---	
HOXA5	3202	broad.mit.edu	37	7	27185066	27185075	+	5'Flank	DEL	GTTTTGTTTT	-	-	rs70994631		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27185066_27185075delGTTTTGTTTT	uc003syn.1	-						uc003syp.1_5'Flank	NM_019102	NP_061975	P20719	HXA5_HUMAN	homeobox A5						negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTGTGTGAGgttttgttttgttttgtttt	0.467													3	4	---	---	---	---	
MLXIPL	51085	broad.mit.edu	37	7	73038473	73038473	+	Intron	DEL	C	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73038473delC	uc003tyn.1	-						MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTGCCCCGGACCCCCCCCCCA	0.716													4	2	---	---	---	---	
TECPR1	25851	broad.mit.edu	37	7	97862098	97862098	+	Intron	DEL	A	-	-	rs139511001		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97862098delA	uc003upg.2	-						TECPR1_uc003uph.1_Intron	NM_015395	NP_056210	Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1							integral to membrane	protein binding			pancreas(1)	1						tgattgctggaaaaaaaaaAA	0.289													5	3	---	---	---	---	
ERCC6	2074	broad.mit.edu	37	10	50736488	50736492	+	Frame_Shift_Del	DEL	ATCTA	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50736488_50736492delATCTA	uc001jhs.3	-	4	777_781	c.623_627delTAGAT	c.(622-627)CTAGATfs	p.L208fs	PGBD3_uc009xoe.2_Frame_Shift_Del_p.L208fs|PGBD3_uc001jhu.2_Frame_Shift_Del_p.L208fs	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	208_209					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						GACTGGCGTGATCTAGTTCAATTTT	0.459								Direct_reversal_of_damage|NER					56	16	---	---	---	---	
TET1	80312	broad.mit.edu	37	10	70392610	70392610	+	Intron	DEL	G	-	-	rs2066343	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70392610delG	uc001jok.3	+							NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						aaaaaaaaaagaaagaaaaca	0.239													6	3	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101763831	101763831	+	Intron	DEL	A	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101763831delA	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						gtgtctacataaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110073302	110073304	+	IGR	DEL	CAT	-	-	rs146683052	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110073302_110073304delCAT								MVK (38232 upstream) : C12orf34 (78886 downstream)																							ccaccaccaccatcaccaccacc	0.000													4	2	---	---	---	---	
CDKN3	1033	broad.mit.edu	37	14	54886586	54886586	+	Intron	DEL	C	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54886586delC	uc001xap.2	+						CDKN3_uc001xar.2_Intron|CDKN3_uc001xaq.2_Intron|CDKN3_uc001xas.1_Intron|CDKN3_uc010aoj.1_Intron	NM_005192	NP_005183	Q16667	CDKN3_HUMAN	cyclin-dependent kinase inhibitor 3 isoform 1						cell cycle arrest|G1/S transition of mitotic cell cycle|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity	perinuclear region of cytoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0						TGCTTCCTTACCCAAAAAGAT	0.328													5	6	---	---	---	---	
UBE2Q2P1	388165	broad.mit.edu	37	15	85115422	85115423	+	5'Flank	INS	-	T	T			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85115422_85115423insT	uc002bkn.1	-						uc002bko.1_5'UTR	NR_003661				Homo sapiens cDNA FLJ43276 fis, clone KIDNE2011532, moderately similar to Homo sapiens melanoma-associated chondroitin sulfate proteoglycan 4.												0						ACATAATGCTCttttttttttt	0.391													7	4	---	---	---	---	
LRRC28	123355	broad.mit.edu	37	15	99926171	99926176	+	Intron	DEL	AGAAAG	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99926171_99926176delAGAAAG	uc002bva.1	+						LRRC28_uc002bvb.1_Intron|LRRC28_uc010urt.1_Intron|LRRC28_uc002bvc.1_Intron|LRRC28_uc010uru.1_Intron|LRRC28_uc002bvd.1_Intron	NM_144598	NP_653199	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28												0	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			AGTTTCCAGCAGAAAGAATCAGAGAC	0.388													294	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	14394686	14394686	+	IGR	DEL	A	-	-	rs72190678		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14394686delA								MKL2 (34057 upstream) : MIR193B (3138 downstream)																							tgtctcaaacaaaaaaaaaaa	0.244													3	3	---	---	---	---	
RPGRIP1L	23322	broad.mit.edu	37	16	53705553	53705553	+	Intron	DEL	A	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53705553delA	uc002ehp.2	-						RPGRIP1L_uc002eho.3_Intron|RPGRIP1L_uc010vgy.1_Intron|RPGRIP1L_uc010cbx.2_Intron|RPGRIP1L_uc010vgz.1_Intron|RPGRIP1L_uc002ehq.1_Intron	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a						negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				ACTTGGGGGTAAAAAAAAACA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18304008	18304008	+	5'Flank	DEL	G	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18304008delG	uc010vxw.1	-						uc002gto.2_5'Flank					DQ589132																		CTGGACGCCTGGGGTGGCCAC	0.592													4	2	---	---	---	---	
SLC47A1	55244	broad.mit.edu	37	17	19452762	19452774	+	Intron	DEL	GGGATTACAGGCT	-	-	rs111619103		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19452762_19452774delGGGATTACAGGCT	uc002gvy.1	+						SLC47A1_uc010vyy.1_Intron|SLC47A1_uc002gvx.2_Intron|SLC47A1_uc010vyz.1_Intron|SLC47A1_uc010cqp.1_Intron|SLC47A1_uc010cqq.1_Intron	NM_018242	NP_060712	Q96FL8	S47A1_HUMAN	solute carrier family 47, member 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)					tgcttgcctcgggattacaggctgggattacag	0.122													2	4	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													6	3	---	---	---	---	
POLRMT	5442	broad.mit.edu	37	19	623080	623081	+	Intron	INS	-	T	T	rs142978491	by1000genomes	TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:623080_623081insT	uc002lpf.1	-							NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase						transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGAGACCTCATGGCCCTCAAG	0.688													5	3	---	---	---	---	
FDX1L	112812	broad.mit.edu	37	19	10425995	10425996	+	Intron	INS	-	T	T	rs2358583		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10425995_10425996insT	uc002mny.1	-						FDX1L_uc002mnx.1_Intron	NM_001031734	NP_001026904	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like precursor						electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			TAATTTGTGGGTTTTTTTTTTT	0.460													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37239224	37239224	+	Frame_Shift_Del	DEL	A	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37239224delA	uc010efc.2	-	5	2877	c.2712delT	c.(2710-2712)TTTfs	p.F904fs	uc010xtm.1_Frame_Shift_Del_p.F872fs					Homo sapiens zinc finger protein 850 pseudogene, mRNA (cDNA clone IMAGE:6082150).																		AACGACGTCTAAAGGCCTTGC	0.418													4	2	---	---	---	---	
KLK2	3817	broad.mit.edu	37	19	51379825	51379826	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51379825_51379826delAA	uc002ptv.2	+	3	345_346	c.304_305delAA	c.(304-306)AATfs	p.N102fs	KLK2_uc010eog.2_5'UTR|KLK2_uc010yck.1_Frame_Shift_Del_p.N102fs|KLK2_uc002ptu.2_Frame_Shift_Del_p.N102fs|KLK2_uc002ptt.2_RNA|KLK2_uc010ycl.1_Frame_Shift_Del_p.N85fs|KLK2_uc010ycm.1_5'UTR|KLK2_uc010eoh.2_5'UTR	NM_005551	NP_005542	P20151	KLK2_HUMAN	kallikrein 2, prostatic isoform 1	102	Peptidase S1.				proteolysis		serine-type endopeptidase activity			ovary(1)|skin(1)	2		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		CCCGCTCTACAATATGAGCCTT	0.554			T	ETV4	prostate								34	15	---	---	---	---	
SIGLEC10	89790	broad.mit.edu	37	19	51919445	51919446	+	Intron	INS	-	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51919445_51919446insG	uc002pwo.2	-						SIGLEC10_uc002pwp.2_Intron|SIGLEC10_uc002pwq.2_Intron|SIGLEC10_uc002pwr.2_Intron|SIGLEC10_uc010ycy.1_Intron|SIGLEC10_uc010ycz.1_Intron|SIGLEC10_uc010eow.2_Frame_Shift_Ins_p.F56fs|SIGLEC10_uc002pws.1_Intron	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor						cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		aaaaaaaaaaaagagagaaagg	0.401													53	8	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26710061	26710062	+	Intron	INS	-	AGAG	AGAG	rs55746736		TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26710061_26710062insAGAG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						cacacacacacagagagagaga	0.000													6	3	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	32007282	32007282	+	Frame_Shift_Del	DEL	G	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32007282delG	uc003ale.2	+	23	2801	c.2408delG	c.(2407-2409)AGGfs	p.R803fs	SFI1_uc003alf.2_Frame_Shift_Del_p.R772fs|SFI1_uc003alg.2_Frame_Shift_Del_p.R721fs|SFI1_uc011alp.1_Frame_Shift_Del_p.R709fs|SFI1_uc011alq.1_Frame_Shift_Del_p.R748fs|SFI1_uc003alh.2_RNA|SFI1_uc010gwi.2_RNA|SFI1_uc003ali.2_5'Flank	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	803					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						CAGTGTGTCAGGAAGAGGGTG	0.622													26	10	---	---	---	---	
IL2RB	3560	broad.mit.edu	37	22	37532507	37532507	+	Intron	DEL	C	-	-			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37532507delC	uc003aqv.1	-							NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor						interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CATCACAGAACCCCCCCCCAA	0.493													3	3	---	---	---	---	
ASB9	140462	broad.mit.edu	37	X	15267128	15267129	+	Intron	INS	-	G	G			TCGA-G9-6494-01A-11D-1786-08	TCGA-G9-6494-10A-01D-1786-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15267128_15267129insG	uc004cwl.2	-						ASB9_uc004cwk.2_Intron|ASB9_uc004cwm.2_Intron|ASB9_uc010ner.2_Intron|ASB9_uc004cwn.2_Intron	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform						intracellular signal transduction						0	Hepatocellular(33;0.183)					TTCAAAGCCCCGAGCCCCAAAA	0.465													5	4	---	---	---	---	
