Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	transcript_name	strand	transcript_status	amino_acid_change	ucsc_cons	normal_depth	normal_vaf	tumor_depth	tumor_vaf	rna_depth	rna_vaf	polyphen	sift	condel	domain
DHDDS	79947	genome.wustl.edu	37	1	26774103	26774103	+	Missense_Mutation	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_024887.2	+1	validated	p.A165V	1.000	63	0%	119	25.2%	-	-	probably_damaging(0.998)	deleterious(0)	deleterious(0.919)	HMMPfam_Prenyltransf,superfamily_Undecaprenyl diphosphate synthase
NSUN4	387338	genome.wustl.edu	37	1	46806527	46806527	+	Missense_Mutation	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_199044.2	+1	validated	p.R10L	0.002	6	0.000	18	0.444	-	-	possibly_damaging(0.659)	tolerated(0.05)	deleterious(0.578)	NULL
SMG5	23381	genome.wustl.edu	37	1	156222849	156222849	+	Silent	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_015327.2	-1	validated	p.E841	1.000	8	0.000	10	0.700	-	-	-	-	-	NULL
OR2T33	391195	genome.wustl.edu	37	1	248436221	248436221	+	Missense_Mutation	SNP	A	A	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	A	A					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_001004695.1	-1	provisional	p.L299Q	0.000	449	0%	638	13.5%	-	-	probably_damaging(0.999)	deleterious(0)	deleterious(0.935)	superfamily_Family A G protein-coupled receptor-like
NRXN1	9378	genome.wustl.edu	37	2	51254689	51254689	+	Silent	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_001135659.1	-1	reviewed	p.A241	0.954	7	0.000	9	0.444	-	-	-	-	-	HMMSmart_EGF,superfamily_ConA_like_lec_gl
NKIRAS1	28512	genome.wustl.edu	37	3	23934682	23934682	+	Silent	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_020345.3	-1	validated	p.F161	1.000	265	0%	457	22.5%	-	-	-	-	-	superfamily_SSF52540
AMOTL2	51421	genome.wustl.edu	37	3	134079157	134079159	+	In_Frame_Del	DEL	CTG	CTG	-	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	CTG	CTG					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_016201.2	-1	reviewed	p.Q558in_frame_del	1.000:1.000:1.000	-	-	-	-	-	-	-	-	-	NULL
MMRN1	22915	genome.wustl.edu	37	4	90872815	90872815	+	Silent	SNP	A	A	C	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	A	A					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_007351.2	+1	reviewed	p.R1060	0.055	147	0%	183	27.9%	-	-	-	-	-	PatternScan_ASX_HYDROXYL,HMMSmart_SM00179,HMMPfam_EGF,HMMSmart_SM00181,superfamily_EGF/Laminin
FAT4	79633	genome.wustl.edu	37	4	126389666	126389666	+	Splice_Site	SNP	G	G	C	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_024582.4	+1	validated	e11-1	1.000	92	0%	105	31.4%	-	-	-	-	-	-
FAT1	2195	genome.wustl.edu	37	4	187630042	187630042	+	Nonsense_Mutation	SNP	C	C	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_005245.3	-1	reviewed	p.E314*	1.000	297	0%	262	64.1%	-	-	-	-	-	HMMSmart_SM00112,superfamily_Cadherin-like
DIAPH1	1729	genome.wustl.edu	37	5	140953313	140953350	+	Frame_Shift_Del	DEL	GGGGAATTCCAGCACTCCCAGGCAAAGGAGGTGGTGGT	GGGGAATTCCAGCACTCCCAGGCAAAGGAGGTGGTGGT	-	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	GGGGAATTCCAGCACTCCCAGGCAAAGGAGGTGGTGGT	GGGGAATTCCAGCACTCCCAGGCAAAGGAGGTGGTGGT					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_005219.4	-1	reviewed	p.P691fs	1.000:0.616:0.625:0.317:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.007:0.998:1.000:0.998:1.000:1.000:0.998:1.000:1.000:0.452:0.996:0.996:0.662:1.000:0.999:0.000:1.000:1.000:0.992:1.000:1.000:0.930	-	-	-	-	-	-	-	-	-	HMMPfam_Drf_FH1
LRRC16A	55604	genome.wustl.edu	37	6	25606322	25606322	+	Missense_Mutation	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_017640.5	+1	validated	p.R1178H	1.000	68	0%	103	41.7%	-	-	probably_damaging(0.999)	deleterious(0)	deleterious(0.935)	NULL
ZNF292	23036	genome.wustl.edu	37	6	87968075	87968075	+	Silent	SNP	A	A	G	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	A	A					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_015021.1	+1	validated	p.L1576	0.990	78	0%	196	36.7%	-	-	-	-	-	NULL
EPHA7	2045	genome.wustl.edu	37	6	94066535	94066535	+	Missense_Mutation	SNP	G	G	C	rs145928664	by1000genomes	TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_004440.3	-1	reviewed	p.H408Q	0.908	82	0%	140	15%	-	-	probably_damaging(0.964)	deleterious(0)	deleterious(0.851)	HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III
TSPYL1	7259	genome.wustl.edu	37	6	116600417	116600417	+	Missense_Mutation	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_003309.3	-1	reviewed	p.E193K	0.616	66	0%	76	17.1%	-	-	benign(0.352)	tolerated(0.23)	neutral(0.153)	NULL
SLC22A2	6582	genome.wustl.edu	37	6	160664701	160664701	+	Silent	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_003058.2	-1	reviewed	p.I394	1.000	99	0%	197	17.8%	-	-	-	-	-	PatternScan_SUGAR_TRANSPORT_1,superfamily_MFS general substrate transporter
GPR31	2853	genome.wustl.edu	37	6	167570471	167570471	+	Silent	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_005299.2	-1	validated	p.C283	1.000	100	0%	98	29.6%	-	-	-	-	-	superfamily_SSF81321
DNAH11	8701	genome.wustl.edu	37	7	21641117	21641117	+	Missense_Mutation	SNP	C	C	G	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_003777.3	+1	reviewed	p.L1177V	1.000	231	0%	348	25%	-	-	benign(0.01)	tolerated(0.59)	neutral(0.005)	NULL
TAX1BP1	8887	genome.wustl.edu	37	7	27805500	27805500	+	Missense_Mutation	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_006024.5	+1	validated	p.V105I	1.000	108	0%	155	45.8%	-	-	probably_damaging(0.993)	deleterious(0)	deleterious(0.895)	HMMPfam_CALCOCO1
VKORC1L1	154807	genome.wustl.edu	37	7	65419354	65419356	+	In_Frame_Del	DEL	TTA	TTA	-	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	TTA	TTA					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	ENST00000434382	+1	known	p.I167in_frame_del	0.999:0.999:0.932	-	-	-	-	-	-	-	-	-	NULL
ASB10	136371	genome.wustl.edu	37	7	150884266	150884267	+	Frame_Shift_Ins	INS	-	-	AG	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	-	-					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_001142459.1	-1	reviewed	p.P30fs	0.000:0.003	-	-	-	-	-	-	-	-	-	NULL
DLC1	10395	genome.wustl.edu	37	8	12943378	12943378	+	Missense_Mutation	SNP	T	T	G	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	T	T					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_182643.2	-1	reviewed	p.K1510T	1.000	124	0%	175	25.1%	-	-	benign(0.001)	deleterious(0.01)	neutral(0.406)	HMMPfam_START,HMMSmart_SM00234,superfamily_Bet v1-like
ATP6V0D2	245972	genome.wustl.edu	37	8	87162505	87162505	+	Silent	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_152565.1	+1	validated	p.A268	0.003	255	0%	491	58.9%	-	-	-	-	-	HMMPfam_vATP-synt_AC39,superfamily_ATPase_V0/A0_c/d
NFX1	4799	genome.wustl.edu	37	9	33354178	33354178	+	Missense_Mutation	SNP	C	C	G	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_002504.3	+1	reviewed	p.Q942E	0.998	102	0%	124	21%	-	-	benign(0.005)	tolerated(0.33)	neutral(0.024)	NULL
LRRC18	474354	genome.wustl.edu	37	10	50122110	50122110	+	Missense_Mutation	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_001006939.3	-1	validated	p.R31C	0.993	75	0%	80	61.3%	-	-	probably_damaging(1)	deleterious(0)	deleterious(0.945)	superfamily_Outer arm dynein light chain 1
PCDH15	65217	genome.wustl.edu	37	10	55698707	55698707	+	Missense_Mutation	SNP	C	C	G	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_001142763.1	-1	reviewed	p.G1086R	1.000	132	0%	180	30.6%	-	-	benign(0.097)	tolerated(0.35)	neutral(0.028)	HMMPfam_Cadherin,HMMSmart_SM00112,superfamily_Cadherin-like
VCL	7414	genome.wustl.edu	37	10	75874037	75874037	+	Silent	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_014000.2	+1	reviewed	p.L1015	1.000	62	0%	90	18.9%	-	-	-	-	-	HMMPfam_Vinculin,superfamily_alpha-catenin/vinculin
SORCS3	22986	genome.wustl.edu	37	10	107005371	107005371	+	Missense_Mutation	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_014978.1	+1	reviewed	p.Q980H	1.000	124	0%	188	22.9%	-	-	probably_damaging(0.999)	deleterious(0)	deleterious(0.935)	superfamily_PKD
ZRANB1	54764	genome.wustl.edu	37	10	126660556	126660556	+	Missense_Mutation	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_017580.2	+1	validated	p.C342F	1.000	276	0%	900	44.6%	-	-	probably_damaging(0.986)	tolerated(0.2)	deleterious(0.483)	NULL
FOLH1	2346	genome.wustl.edu	37	11	49170247	49170247	+	Missense_Mutation	SNP	C	C	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_004476.1	-1	reviewed	p.M669I	1.000	93	0%	175	39.4%	-	-	probably_damaging(0.999)	tolerated(0.08)	deleterious(0.790)	HMMPfam_TFR_dimer,superfamily_Transferrin receptor ectodomain C-terminal domain
ATP5B	506	genome.wustl.edu	37	12	57038732	57038732	+	Silent	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_001686.3	-1	reviewed	p.S106	1.000	84	0%	103	25.2%	-	-	-	-	-	HMMPfam_ATP-synt_ab_N,superfamily_N-terminal domain of alpha and beta subunits of F1 ATP synthase
ERO1L	30001	genome.wustl.edu	37	14	53133139	53133139	+	Missense_Mutation	SNP	C	C	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_014584.1	-1	provisional	p.D195Y	0.995	71	0%	79	31.6%	-	-	probably_damaging(0.98)	deleterious(0)	deleterious(0.869)	HMMPfam_ERO1,superfamily_ERO1
OCA2	4948	genome.wustl.edu	37	15	28326871	28326871	+	Silent	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_000275.2	-1	reviewed	p.S50	0.004	13	0%	13	46.2%	-	-	-	-	-	NULL
SEMA7A	8482	genome.wustl.edu	37	15	74707190	74707190	+	Missense_Mutation	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_003612.3	-1	reviewed	p.R362W	0.653	14	0%	19	57.9%	-	-	probably_damaging(1)	deleterious(0)	deleterious(0.945)	HMMPfam_Sema,HMMSmart_Sema,superfamily_Sema
OR4F15	390649	genome.wustl.edu	37	15	102359095	102359095	+	Missense_Mutation	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_001001674.1	+1	provisional	p.A236S	1.000	534	0%	986	38.4%	-	-	probably_damaging(0.978)	deleterious(0)	deleterious(0.865)	HMMPfam_7tm_1,superfamily_Family A G protein-coupled receptor-like
PHLPP2	23035	genome.wustl.edu	37	16	71683148	71683148	+	Missense_Mutation	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_015020.2	-1	validated	p.R1206Q	1.000	69	0%	73	61.6%	-	-	benign(0.022)	tolerated(0.16)	neutral(0.060)	NULL
TP53	7157	genome.wustl.edu	37	17	7576855	7576855	+	Nonsense_Mutation	SNP	G	G	A	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_000546.4	-1	reviewed	p.Q331*	0.999	98	0%	127	65.4%	-	-	-	-	-	HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain
CACNG4	27092	genome.wustl.edu	37	17	65027083	65027101	+	Frame_Shift_Del	DEL	ACGTCAGCATGCTGAACCG	ACGTCAGCATGCTGAACCG	-	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	ACGTCAGCATGCTGAACCG	ACGTCAGCATGCTGAACCG					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_014405.2	+1	reviewed	p.V317fs	0.618:0.221:0.705:0.990:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.996:1.000:1.000:1.000:1.000:1.000	-	-	-	-	-	-	-	-	-	NULL
POTEC	388468	genome.wustl.edu	37	18	14511815	14511815	+	Missense_Mutation	SNP	A	A	C	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	A	A					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	ENST00000444806	-1	known	p.L570R	0.105	105	0%	254	29.1%	-	-	-	-	-	NULL
SETBP1	26040	genome.wustl.edu	37	18	42643074	42643074	+	Missense_Mutation	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_015559.2	+1	validated	p.R1401L	1.000	42	0%	64	25%	-	-	probably_damaging(0.999)	deleterious(0)	deleterious(0.935)	NULL
CDH7	1005	genome.wustl.edu	37	18	63477090	63477090	+	Nonsense_Mutation	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_004361.2	+1	reviewed	p.R121*	0.995	218	0%	237	58.2%	-	-	-	-	-	HMMPfam_Cadherin,HMMSmart_SM00112,superfamily_Cadherin-like
ATP9B	374868	genome.wustl.edu	37	18	76936816	76936816	+	Missense_Mutation	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_198531.3	+1	validated	p.S261L	1.000	151	0%	144	17.4%	-	-	possibly_damaging(0.892)	deleterious(0.02)	deleterious(0.734)	HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A
PPP2R1A	5518	genome.wustl.edu	37	19	52716323	52716323	+	Missense_Mutation	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_014225.5	+1	reviewed	p.S256F	1.000	38	0%	23	52.2%	-	-	probably_damaging(1)	deleterious(0)	deleterious(0.945)	HMMPfam_HEAT,superfamily_ARM repeat
RASSF2	9770	genome.wustl.edu	37	20	4768385	4768385	+	Frame_Shift_Del	DEL	T	T	-	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	T	T					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_014737.2	-1	reviewed	p.K236fs	1.000	-	-	-	-	-	-	-	-	-	HMMPfam_RA,HMMSmart_RA
ZC3H7B	23264	genome.wustl.edu	37	22	41726076	41726085	+	Frame_Shift_Del	DEL	TGCGAGTTCG	TGCGAGTTCG	-	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	TGCGAGTTCG	TGCGAGTTCG					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_017590.4	+1	reviewed	p.L165fs	1.000:0.998:1.000:0.996:0.981:0.978:0.862:0.565:1.000:1.000	-	-	-	-	-	-	-	-	-	NULL
IL3RA	3563	genome.wustl.edu	37	X	1467396	1467396	+	Missense_Mutation	SNP	G	G	C	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_002183.2	+1	reviewed	p.A86P	0.029	211	0%	219	21%	-	-	benign(0.138)	tolerated(0.09)	neutral(0.308)	NULL
ZNF449	203523	genome.wustl.edu	37	X	134483146	134483146	+	Nonsense_Mutation	SNP	G	G	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	G	G					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_152695.5	+1	reviewed	p.E156*	0.007	141	0%	141	68.1%	-	-	-	-	-	NULL
UBL4A	8266	genome.wustl.edu	37	X	153714208	153714208	+	Missense_Mutation	SNP	C	C	T	novel		TCGA-BK-A0CC-01A-21W-A027-09	TCGA-BK-A0CC-10A-01W-A027-09	C	C					Unknown	Unknown	Somatic	Phase_IV	Capture		1	dbGAP	Illumina GAIIx	NM_014235.3	-1	provisional	p.D89N	0.063	12	0%	10	50%	-	-	benign(0.005)	tolerated(0.48)	neutral(0.011)	NULL
